WO2013056684A2 - Thiazole derivative as dhodh inhibitor and use thereof - Google Patents

Abstract

The present invention relates to a thiazole derivative, as represented in formula I, as a DHODH inhibitor and a use thereof. The compound of the present invention can be used for treating or preventing DHODH-mediated diseases, including, but not limited to, rheumatoid arthritis and autoimmune diseases such as anti-tumor, anti-organ transplant rejection, and anti-psoriasis.

Description

 Thiazole derivative as DHODH inhibitor and its application

 The invention belongs to the fields of medicinal chemistry and pharmacotherapy, and in particular to thiazole derivatives as DH0DH inhibitors and their use. Background technique

 The inhibitor of dihydroorotate dehydrogenase (DH0DH) mainly acts on immune system-related cells to produce related biological effects, and reduces the activity and quantity of immune-activated T-lymphocytes and B-lymphocytes by inhibiting the pyrimidine de novo synthesis pathway. And its cell cycle is blocked in the G1/S phase.

 Dihydroorotate dehydrogenase (DH0DH) inhibitor is a target for anti-rheumatic arthritis, anti-tumor, anti-organ transplant rejection, anti-psoriatic drugs and other autoimmune diseases. DH0DH inhibitors are also used. Antibiotics inhibit H. pylori and antifungal agents. The role of these inhibitors is to inhibit pyrimidine biosynthesis rate control steps. In this step, dihydroorotate is oxidized to orotate, which is a precursor of guanosine monophosphate and pyrimidine synthesis, which is a key component of DNA and RNA. Therefore, the dihydroorotate dehydrogenase (DH0DH) inhibitor mainly acts on the immune system-related cells to produce related biological effects, and reduces the activity of immune-activated T-lymphocytes and B-lymphocytes by inhibiting the pyrimidine de novo synthesis pathway. Quantity, and block its cell cycle in the G1/S phase to achieve control, and even cure the disease.

 Rheumatoid arthritis (RA), which is significantly associated with DH0DH, is an autoimmune disease and is a chronic systemic inflammatory disease that is prone to recurrent episodes. The cause of the disease is not fully understood, and there is no specific treatment to date. Because rheumatoid arthritis patients often have symptoms such as fatigue, fever, joint swelling and pain, joint dysfunction and even disability, it is also called "immortal cancer", which seriously affects the normal life of patients and even their families. At present, the treatment of rheumatoid arthritis mainly depends on the treatment of inflammation and sequelae, such as controlling inflammation of joints and other tissues, maintaining joint function and preventing degeneration and surgical repair of damaged joints.

DH0DH inhibitors can effectively reduce the activity and quantity of immune-activated T-lymphocytes and B-lymphocytes, and can be successfully developed as therapeutic drugs for autoimmune diseases such as rheumatoid arthritis. Currently, immunosuppressive drugs targeting DH0DH have been marketed, including leflunomide and terif lunomide (A771726), and brequinar has also entered phase II clinical trials. However, all of the above drugs have side effects such as diarrhea, rash, high blood pressure and disorders of the liver enzyme system. Bucura combined with cyclosporine A or cisplatin may cause mucositis and thrombocytopenia. Therefore, it is necessary to find new DH0DH inhibitors with higher efficiency, safety and good drug-forming properties. Important academic

)

Summary of the invention

According to the principle that the DH0DH inhibitor binds to the ubiquinone binding pocket located at the N-terminus of the DH0DH enzyme, the inhibitor will have a polar head and a hydrophobic tail, which allows them to be efficiently incorporated into the ubiquinone binding pocket. . Accordingly, the inventors have used a combination of computational drug design, medicinal chemistry, and molecular biology methods and techniques in the preliminary work to find a series of thiazole derivatives that meet the above structural requirements, and the structural skeleton is completely different from the high activity reported in the literature. DH0DH inhibitor (levipide, teriflamine, bupina). Some of these compounds have significant immunosuppressive activity at the cellular and animal levels, and at the same time have low toxicity, good safety and good prospects for drug discovery. By introducing a series of lead compounds, the inventors designed a composition having the following structural formula:

 In the formula,

R ^{1 is} selected from H, dC ₆ alkyl, C ₂ -C ₆ alkenyl or alkynyl, optionally substituted aryl, nitro, amino, NR ⁴ R ⁵ , halogen;

R ^{2 is} selected from the group consisting of H, dC ₆ alkyl, halogen-substituted dC ₆ alkyl, dC ₆ unsaturated alkyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, aminocarbonyl, dC ₆ alkoxy Carbonyl, hydroxy, dC ₆ alkoxy, optionally substituted aryl, optionally substituted heteroaryl, amino, ₈ -cycloalkyl, NHR ⁶ ;

R ^{3 is} selected from H, dC ₆ alkyl, -C(0)NHR ⁷ , dC ₆ alkoxycarbonyl, halogen substituted alkyl, C ₂ -C ₆ alkenyl or alkynyl, optionally substituted phenyl , dC ₄ alkylcarbonyl, optionally substituted benzoyl, optionally substituted pyridylcarbonyl, dC ₃ alkylcarboxy, amide, amino, d-do alkyl substituted amino, carboxy dC ₃ alkyl, halogen ;

R ⁴ and R ⁵ are each independently selected from the group consisting of H, dC ₆ alkyl, optionally substituted aryl, optionally substituted heterocyclic group, optionally substituted arylcarbonyl, optionally substituted heterocyclic carbonyl, and a substituted aryloxyalkylcarbonyl group;

R ^{6 is} selected from dC ₆ alkyl, optionally substituted phenyl, C ₃ -C ₈ cycloalkylcarbonyl, benzoyl, or attached thereto

N consists of a 6-membered ring, such as a piperidine ring, or a 6-membered oxygen or nitrogen heterocycle such as a piperidine ring and a morpholine ring;

R ^{7 is} selected from the group consisting of an optionally substituted aryl group and an optionally substituted heterocyclic group. In a preferred embodiment, the compound is selected from the group consisting of the compounds of formula II:

 Ar is selected from the group consisting of an optionally substituted aryl group, an optionally substituted heterocyclic group, an optionally substituted arylcarbonyl group, an optionally substituted heterocyclic carbonyl group, and an optionally substituted aryloxyalkylcarbonyl group;

R ^{2 is} selected from dC ₆ alkyl, halogen-substituted dC ₆ alkyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, aminocarbonyl, dC ₆ alkoxycarbonyl, hydroxy, dC ₆ alkoxy , optionally substituted aryl or heteroaryl, amino, C ₃ -C ₈ cycloalkyl, NHR ⁶ ;

R ^{3 is} selected from the group consisting of CC ₆ alkyl, dC ₆ alkoxycarbonyl, optionally substituted phenyl, dC ₄ alkylcarbonyl, optionally substituted benzoyl, dC ₃ alkylcarboxy, amide, carboxy dC ₃ alkane And optionally substituted phenylcarbamoyl; R ^{6 is} selected from dC ₆ alkyl, optionally substituted phenyl, C ₃ -C ₈ cycloalkylcarbonyl, benzoyl, or attached thereto

N constitutes a 6-membered ring, such as a piperidine ring, or a 6-membered oxygen or nitrogen heterocycle such as a piperidine ring and a morpholine ring.

In a preferred embodiment, the substituent on Ar includes d-doalkyl, C ₃ -C ₈ cycloalkyl, dC ₄ alkoxy, optionally substituted phenyl, optionally substituted phenoxy, benzyloxy The base, CF ₃ , and halogen, the number of substituents is 1, 2, 3, 4 or 5. Ar may be a benzo fused (hetero) ring compound, and the hetero atom includes N, 0, S, Se, such as an anthracenyl group, a carbazolyl group, an indanyl group, a tetrahydronaphthyl group or the like.

In a more preferred embodiment, R ^{2 is} selected from the group consisting of dC ₆ alkyl, CF ₃ , phenyl, acetyl, benzoyl, carboxy, carbamoyl, dC ₆ alkoxycarbonyl, amino. More preferably methyl, CF _3, phenyl.

In a more preferred embodiment, R ^{3 is} selected from the group consisting of dC ₆ alkyl, phenyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, dC ₆ alkoxycarbonyl, amide, optionally substituted aniline Formyl; preferably dC ₃ alkylcarbonyl, dC ₆ alkoxycarbonyl.

 In a preferred embodiment, the compound

Wherein R ^{2 is} selected from the group consisting of dC ₆ alkyl, halogen-substituted dC ₆ alkyl, optionally substituted phenyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, carbamoyl, dC ₆ alkane Oxycarbonyl, hydroxy, dC ₆ alkoxy, optionally substituted aryl or heteroaryl, amino, ₈ -cycloalkyl, optionally substituted amino;

R ^{3 is} selected from the group consisting of CC ₆ alkyl, optionally substituted phenyl, dC ₃ alkylcarbonyl, dC ₃ alkoxycarbonyl, optionally substituted benzoyl, carboxy, amide, optionally substituted benzoyl;

R ^{8 is} selected from C ₅ or more alkyl or cycloalkyl, optionally substituted phenyl, 5 or 6 membered aromatic heterocyclic group, or any a substituted phenoxyalkyl group.

In certain embodiments of Formulas I, Π, and III, R ² is dC ₄ alkyl such as methyl, and R ³ is optionally substituted benzoyl. In other embodiments, R ² is an optionally substituted phenyl group and R ³ is a dC ₄ alkoxycarbonyl group. In other embodiments, R ² is dC ₄ alkyl such as methyl, and R ^{3 is} selected from the group consisting of dC ₄ alkylcarbonyl, dC ₄ alkoxycarbonyl, and optionally substituted benzoyl. In other embodiments, R ² is an amino group, ! ^ is ^-^ alkoxycarbonyl.

 As used herein, "alkyl" generally refers to saturated branched and straight-chain alkyl groups having a carbon chain length of from 1 to 10 carbon atoms, preferably from 1 to 6 carbon atoms, more preferably from one to four or from one to three. An alkyl group of carbon atoms. "Cycloalkyl" means a cyclic alkyl group which usually has 3 to 8 ring carbon atoms. Exemplary cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, cyclohexyl and the like.

 As used herein, "alkenyl" means a radical having 1 to 10 carbon atoms in a straight or branched chain, wherein at least one of the two carbon atoms in the chain contains a double bond. Preferred alkenyl groups are alkenyl groups having from 2 to 4 carbon atoms. Typical alkenyl groups include ethenyl, 1-propenyl, 2-methyl-1-propenyl, 1-butenyl and 2-butenyl.

 As used herein, "alkynyl" means a straight or branched chain containing from 2 to 10 carbon atoms, wherein at least one of the two carbon atoms in the chain contains a hydrazone bond. Preferred alkynyl groups are alkynyl groups having 2 to 4 carbon atoms. Typical alkynyl groups include ethynyl, 1-propynyl, 1-methyl-2-propynyl, 2-propynyl, 1-butynyl and 2-butynyl.

As used herein, "aryl" refers to a monocyclic, bicyclic or tricyclic aromatic radical containing from 6 to 14 carbon atoms, including phenyl, naphthyl, phenanthryl, anthracenyl, fluorenyl, fluoro, tetrahydronaphthalene. Base, indanyl group, and the like. The aryl group may be optionally substituted by 1 to 5 (for example, 1, 2, 3, 4 or 5) substituents selected from the group consisting of halogen, dC ₄ aldehyde group, linear or branched alkyl group of dC ₆ , Cyano, nitro, amino, hydroxy, hydroxymethyl, halogen-substituted alkyl (eg trifluoromethyl), halogen-substituted alkoxy (eg trifluoromethoxy), carboxyl, dC ₄ alkoxy An acyl group, a decyl group, a d-do thioalkyl group and an acyl group of dC ₄ , a morpholinyl group, an optionally substituted aryl group (for example, an optionally substituted phenyl group), an optionally substituted aryloxy group (for example, an optionally substituted benzene) Oxy) and optionally substituted benzyloxy. For example, an aryl group may be substituted with from 1 to 3 groups selected from the group consisting of fluorine, chlorine, bromine, dC ₄ alkyl, trifluoromethyl, morpholinyl, methoxy, phenyl, methoxy substituted Phenyl, phenoxy, benzyloxy, benzyloxy substituted by halogen, ethoxy, nitro and the like.

The term "heterocyclyl" as used herein, refers to a single or fused ring structure, which may be aromatic or non-aromatic in nature, and which preferably contains from 3 to 20 ring atoms, more preferably from 5 to 14 Ring atoms, wherein at least one and preferably up to 4 are heteroatoms selected from the group consisting of 0, S and N. Herein, examples of the heterocyclic group include furyl, thienyl, pyrrolyl, pyrrolidinyl, imidazolyl, triazolyl, thiazolyl, tetrazolyl, oxazolyl, isoxazolyl, pyrazolyl, pyridine , pyrimidinyl, pyridyl, fluorenyl, tridecyl, quinolyl, isoquinolyl, quinoxalinyl, benzothiazolyl, benzoxazolyl, benzothienyl, benzofuran Base, morpholinyl, oxazolyl, dibenzothiophene and 1,2-methylenedioxyphenyl. Herein, a heterocyclic group may be optionally substituted with one to three substituents described herein. The term "heteroatom" as used herein includes 0, S and N. When the hetero atom is N, the N atom may be further substituted with a group such as hydrogen or a d-do alkyl group.

 The term "heteroaryl" or "aromatic heterocyclic" as used herein, refers to those heterocyclic groups which have aromatic character as described above, including but not limited to furyl, thienyl, pyrrolyl, pyridyl, oxazolyl. , pyridinyl, fluorenyl, pyrimidinyl and the like.

 The term "halogen" as used herein includes fluoro, chloro, bromo and iodo.

The term "optionally substituted" as used herein, unless otherwise indicated, means that the group modified thereby may be optionally substituted with from 1 to 5 (usually 1, 2 or 3) substituents selected from the group consisting of: DC ₄ alkyl, carboxy, halogen, dC ₄ alkoxy, cyano, nitro, amino, hydroxy, aldehyde, dC ₆ acyl, hydroxymethyl, halogen substituted dC ₄ alkyl (eg trifluoromethyl) , halogen-substituted dC ₄ alkoxy (e.g., trifluoromethoxy), fluorenyl, and dC ₄ acyl.

 Herein, the amide group itself or as part of another group refers to a "mercapto-CO-NH-" group. Exemplary amide groups include, but are not limited to, formamide groups, acetamido groups, and the like.

 Herein, the acyl group itself or as part of another group may have 1 to 6 carbon atoms, preferably 1 to 3 carbon atoms. Exemplary acyl groups include, but are not limited to, formyl, acetyl, and the like.

 The present invention is preferably a compound shown in the following Table 1, and those compounds having an inhibition ratio of 50% or more are particularly preferable. In certain embodiments, the compounds of the invention do not include compounds 66-76 and 78.

 The compounds of the invention can be prepared by the following scheme:

Compound 19-26, 28-30, 33, 35-43, 45 Scheme 3

Compounds 47-48, 50-52, 55-59, 61-62

HL-251-133, 135, 137, 139, 143

TM: HL-251-191, 193 In the above preparation scheme, R' R ^{1 is} as defined above, wherein R is a substituent on the corresponding group, for example, a substituent on an aryl group, or R may correspond In R ₄ or (see the scheme for preparing HL-251-191, 193); the above R ₂ 0CHN corresponds to R ² , and _C(0) R ³ ' corresponds to R ³ . Those skilled in the art can prepare the compounds of the present invention by using various starting compounds conventionally obtained in the art as raw materials according to actual preparation needs.

 A second aspect of the invention comprises a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I, II and/or III of the invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or a carrier Shape agent.

 Examples of pharmaceutically acceptable salts of the compounds of the invention include, but are not limited to, inorganic and organic acid salts such as hydrochloride, hydrobromide, sulfate, citrate, lactate, tartrate, maleate , fumarate, mandelate and oxalate; and inorganic and formed with bases such as sodium hydroxy, tris(hydroxymethyl)aminomethane (TRIS, tromethamine) and N-methylglucamine Organic base salt.

 While the needs of each individual are varied, one skilled in the art can determine the optimal dosage of each active ingredient in the pharmaceutical compositions of the present invention. In general, the compound of the present invention or a pharmaceutically acceptable salt thereof is orally administered to a mammal daily, in an amount of from about 0.0025 to 50 mg / kg body weight. Preferably, it is about 0.01 to 10 mg per kilogram of oral administration. For example, a unit oral dose may include from about 0.01 to 50 mg, preferably from about 0.1 to 10 mg of the compound of the present invention. The unit dose may be administered one or more times per day in one or more tablets, each tablet containing from about 0.1 to 50 mg, conveniently from about 0.25 to 10 mg of the compound of the present invention or a solvate thereof.

The pharmaceutical composition of the present invention can be formulated into a form suitable for various administration routes, including but not limited to being formulated for parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, oral, intrathecal, cranial A form of administration, intranasal or topical, for the treatment of tumors and other diseases. The amount administered is an amount effective to ameliorate or eliminate one or more conditions. For the treatment of a particular disease, an effective amount is an amount sufficient to ameliorate or in some way alleviate the symptoms associated with the disease. Such doses can be administered as a single dose or can be administered according to an effective therapeutic regimen. The amount administered may cure the disease, but administration is usually to improve the symptoms of the disease. Repeated administration is generally required to achieve the desired improvement in symptoms. The dosage of the drug will be determined by the age of the patient, the health and weight, the type of concurrent treatment, the frequency of treatment, and the desired therapeutic benefit.

 The pharmaceutical preparation of the present invention can be administered to any mammal as long as they can obtain the therapeutic effect of the compound of the present invention. The most important of these mammals is humans.

 The compound of the present invention or a pharmaceutical composition thereof can be used for the treatment or prevention of various diseases mediated by DHODH, including cancer, organ transplant rejection, and autoimmune diseases such as rheumatoid arthritis, psoriasis and the like. Such cancers include, but are not limited to, breast cancer, prostate cancer, head and neck squamous cell carcinoma, and multiple myeloma.

 The pharmaceutical preparations of the invention can be made in a known manner. For example, it is manufactured by conventional mixing, granulating, tableting, dissolving, or freeze drying processes. When the oral preparation is made, the mixture can be selectively ground by combining the solid adjuvant with the active compound. If necessary or necessary, after adding appropriate amounts of auxiliaries, the granule mixture is processed to obtain a tablet or lozenge core.

 Suitable excipients are, in particular, fillers, such as sugars such as lactose or sucrose, mannitol or sorbitol; cellulose preparations or calcium phosphates, such as tricalcium phosphate or calcium hydrogen phosphate; and binders, such as starch pastes, including corn starch. , wheat starch, rice starch, potato starch, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, or polyvinylpyrrolidone. If necessary, add disintegrants such as the starch mentioned above, as well as carboxymethyl starch, crosslinked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate. Adjuvants, especially flow regulators and Lubricants, for example, silica, talc, stearates, such as calcium magnesium stearate, stearic acid or polyethylene glycol. If desired, the tablet core can be provided with a suitable coating that resists gastric juice. For this purpose, a concentrated sugar solution can be applied. This solution may contain gum arabic, talc, polyvinylpyrrolidone, polyethylene glycol and/or titanium dioxide, a lacquer solution and a suitable organic solvent or solvent mixture. For the preparation of a gastric juice resistant coating, a suitable cellulose solution such as cellulose acetate phthalic acid or hydroxypropyl methylcellulose phthalic acid can be used. A dye or pigment may be added to the coating of the tablet or tablet core. For example, a combination for identifying or for characterizing the dose of an active ingredient.

 Accordingly, a third aspect of the invention provides a method of treating a DHODH mediated disease, the method comprising administering to a subject in need thereof a compound or pharmaceutical composition of the invention.

 Methods of administration include, but are not limited to, various methods of administration well known in the art, which can be determined based on the actual circumstances of the patient. These methods include, but are not limited to, parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, buccal, intrathecal, intracranial, nasal or topical routes of administration.

The invention also encompasses the use of a compound of the invention in the manufacture of a medicament for the treatment or prevention of a DHDH mediated disease. The invention also encompasses the use of a compound of the invention in the manufacture of a medicament for inhibiting DHODH activity. detailed description The invention will be further illustrated in the following examples. These examples are for illustrative purposes only, and are not intended to limit the invention in any way. Synthetic part

 Example 1: Synthesis of Compound 1-18:

 Ethyl chloroacetate (9.52 g, 57.84 mmol) was dissolved in 100 mL of ethanol, and thioacetamide (4.8 g, 63.9 mmol) was added under stirring. The mixture was heated to reflux temperature and stirred for 2 h. The reaction solution was dehydrated under reduced pressure to give an orange-yellow solid 9.80 g, yield 91.1%, which was directly used for the next reaction.

Weigh LiOH.H ₂ 0 (1.25 g, 29.7 mmol) in 50 mL of water, add the ester (2.5 g, 13.5 mmol) synthesized in one step with stirring, and warm to 90 °C. The solution was gradually dissolved. After 1 h, the reaction was stopped. The pH of the reaction mixture was adjusted to neutral neutral acidity with dilute hydrochloric acid. A large amount of solid was precipitated and filtered. The filter cake was washed with water and dried to give a pale yellow solid (2.05 g, yield 9.66 %).

 Compound 1-18

 Weigh thiazolecarboxylic acid (1.1 eq) and HATU (1.2 eq) dissolved in 7 mL DMF, stir well, add 8 drops of DIPEA, stir for 5 min, then add aromatic amine compound (leq), stir at room temperature Overnight, TLC tracks the response.

 Post-treatment method 1: Add saturated ammonium chloride solution to the reaction solution, the solution gradually becomes turbid and a large amount of solid appears. Add saturated ammonium chloride solution until no more solids appear. Filter the reaction solution. The filter cake is first saturated with chlorination. The ammonium salt aqueous solution was washed with a saturated aqueous solution of sodium hydrogencarbonate, and the filter cake was dried to obtain the title compound, which was extracted with ethyl acetate/saturated ammonium chloride, and the obtained organic phase was dried over anhydrous sodium sulfate and then evaporated. The solid obtained was purified by silica gel column chromatography (PE: EA = 5:1).

 Target compound spectrum data

N-(4-chlorophenyl)-2,4-dimethylthiazole-5-carboxamide (Compound 1)

^J H NMR (400MHz, DMSO) δ (ppm ) : 10.24 (s, IH) , 7.70 (d, J = 8.8 Hz , 2H), 7.40 (d, J = 8.8 Hz , 2H), 2.66 (s, 3H) , 2.54 (s, 3H). HRMS (ESI) calcd for C12H11CI 2OS (M+H) 267.0359, found 267.0355.

N-[ 4-dimethyl-thiazole-5-carboxamide (Compound 2)

¹ H NMR (400MHz, CDC1 ₃ ) δ ( ppm ) : 7.69 (d, J = 8.4 Hz , 2H) , 7.62 (d, J = 8.8 Hz , 2H), 7.51 (s, IH), 2.73 (s, 3H ), 2.72 (s, 3H). HRMS (ESI) calcd for : C13H13FN2OS (M+H) 265.0811 , found 265.0805.

N-(methylthiazole-5-carboxamide (compound 3)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 7.46 (dd, J 1 = 2.0 Hz , J ₂ = 11.2 Hz , IH), 7.41 (s, IH), 7.15 (t, J = 8.0 Hz , IH ), 7.10 (dd, J 1 = 2.0 Hz , J ₂ = 8.4 Hz , IH) , 2.72 (s, 6H) , 2.26 (d, J = 1.6 Hz , 3H). HRMS (ESI) calcd for : C ₁₃ H ₁₃ FN ₂ OS (M+H) 265.0811 , found 265.0805.

_N- (4-bromothiazole-5-carboxamide (Compound 4)

O NMR (400MHz, CDC1 ₃ ) δ ( ppm ) : 7.80 (d, J = 9.2 Hz , IH) , 7.37-7.35 (m, 2H), 7.21 (s, IH), 2.73 (s, 3H), 2.71 ( s, 3H), 2.28 (s, 3H). HRMS (ESI) calcd for: C ₁₃ H ₁₃ BrN ₂ OS (M+H) 325.0010, found 325.0009.

N-(4-bromo-3-(trifluoromethyl)phenyl)-2,4-dimethylthiazole-5-carboxamide (Compound 7)

^J H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 8.76 (d, J = 4.4 Hz , 1H) , 8.47 (d, J = 8.4 Hz , 1H) , 7.50-7.47 (m, 1H) , 2.82 (s , 3H), 2.80 (s, 3H).

HRMS (ESI) calcd for: C ₁₃ H ₁₀ BrF ₃ N ₂ OS (MH) 376.9571 , found 376.9572.

N-(3,5 thiazole-5-carboxamide (Compound 8)

¹ H NMR (400MHz, CDC1 ₃ ) δ ( ppm ) : 8.77 (dd, J 1 = 1.2 Hz , J ₂ = 4.4 Hz , 1H) , 8.48 (dd, Ji = 1.2 Hz , J ₂ = 8 Hz , 1H) , 7.51-7.48 (m, 1H), 2.83 (s, 3H), 2.81 (s, 3H). HRMS (ESI) calcd for: C ₁₂ H ₁₀ Ci ₂ N ₂ OS (MH) 298.9813, found 298.9806.

2,4-Dimethyl-N-(4-morpholinylphenyl)thiazole-5-carboxamide (Compound 9)

O NMR (400MHz, DMSO) δ ( ppm ) : 9.86 (s, 1H) , 7.50 (d, J = 8.4 Hz , 2H) , 6.92 (d, J = 8.8 Hz , 2H) , 3.73 (t, J = 4.4 Hz , 4H) , 3.06 (t, J = 4.4 Hz , 4H), 2.65 (s, 3H), 2.52 (s, 3H). HRMS(ESI) calcd for : C ₁₆ H ₁₉ N ₃ 0 ₂ S (M+H) 318.1276, found 318.1276ο

2,4- 5-carboxamide (compound 11)

H NMR (400MHz, CDC1 ₃ ) δ ( ppm ) : 7.57 (d, J= 7.6 Hz , 2H) , 7.43 1H), 7.39 (t, J = 7.6 Hz, 2H), 7.18 (t, J = 7.2 Hz, 1H), 2.75 (s, 3H), 2.74 (s, 3H). HRMS (ESI) calcd for: C ₁₂ H ₁₂ N ₂ OS (M+H) 233.0749, found 233.0745.

N-oxazol-5-carboxamide (compound 13)

1HNMR (400MHz, CDC1 ₃ ) δ (ppm ) : 8.81 (s, 1H) , 7.55 (d, J=8.8Hz , 2H), 7.52 (s, 1H), 7.36 (d, J= 8.8 Hz , 2H), 2.83 (s, 3H). HRMS (ESI) calcd for: C11H9CI 2OS (M+H) 253.0202, found 253.0206.

4 -5-carboxamide (compound 17)

1H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 8.77 (s, 1H) , 7.63 (s, 1H) , 7.58

(d, J = 7.6 Hz, 2H), 7.38 (t, J = 8.0 Hz, 2H), 7.19 (t, J = 8.4 Hz, 1H), 2.80 (s, 3H). HRMS (ESI) calcdfor: CuHujNsOSiM-H) 217.0436, found 217.0435. The following compounds 5, 6, 10, 12, 14, 15, 16 and 18 were prepared in a similar manner as described above.

 N-(9-ylthiazole-5-carboxamide (Compound 5)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 8.36 (s, 1H) , 8.10 (d, J=7.6Hz, 1H) , 7.57-7.55 (m, 2H) , 7.52-7.49 (m, 1H) , 7.44-7.39 (m, 2H) , 7.25 (t, J = 12 Hz , 1H) , 4.41-4.36 (m, 2H) , 2.78 (s, 3H) , 2.74 (s, 3H) , 1.45 (t, J= 7.2Hz, 3H). HRMS (ESI) calcd for: C ₂₀ H ₁₉ N ₃ OS (M+H) 350.1327, found 350.1332.

N-(indol-2-yl)-2,4-dimethylthiazole-5-carboxamide (compound 6)

¹ H NMR (400MHz, DMSO) δ (ppm ): 8.52 (s, 2H), 8.48 (s, 1H), 8.08-8.04 (m, 3H) , 7.70 (dd, J corp. 1.6 Hz, J ₂ = 9.2 Hz , 1H), 7.50-7.47 (m, 2H), 2.68 (s, 3H), 2.59 (s, 3H). HRMS(ESI) calcd for: C ₂₀ H ₁₆ N ₂ OS (MH) 331.0905, found 331

2,4-carbamide (Compound 10)

O NMR (400MHz, DMSO) δ (ppm) : 10.28 (s, 1H) , 8.33 (d, J = 2.4 Hz , 1H) , 7.90-7.84 (m, 3H) , 7.72 (dd,

, J ₂ = 10.0 Hz , 1H) , 7.49-7.42 (m, 2H), 2.68 (s, 3H), 2.59 (s, 3H). HRMS (ESI) calcd for: C ₁₆ H ₁₄ N ₂ OS (M+H) 283.0905, found 283.0900.

N-(diphenylthiazole-5-carboxamide (Compound 12)

HRMS(ESI) calcd for: C ₁₈ H ₁₄ N ₂ OS ₂ (M+H) 339.0626, found

N-(9-ethylthiazole-5-carboxamide (Compound 14)

O NMR (400MHz, DMSO) δ (ppm) : 10.25 (s, 1H) , 9.14 (s, 1H) , 8.45 (s, 1H) , 8.10 (d, J = 8.0 Hz , 1H) , 7.68-7.66 (m , 1H), 7.61 (s, 1H), 7.61-7.59 (m, 1H), 7.46 (t, J = 7.6 Hz, 1H), 7.19 (t, J = 7.6 Hz, 1H), 4.47-4.42 (m, 2H), 2.66 (s, 3H), 1.31 (t, J = 7.2 Hz, 3H). HRMS(ESI) calcd for: C ₁₉ H ₁₇ N ₃ OS (M+H) 336.1171 , found 336.1176

^J H NMR (400MHz, DMSO) δ (ppm ) : 9.17 (s, 1H) , 8.53 (d, J = 4.4 Hz , 2H) , 8.50 (s, 1H) , 8.09-8.05 (m, 3H) , 7.72 ( Dd, J corpse 2.0 Hz, J ₂ = 10.0 Hz, 1H), 7.51-7.46 (m, 2H), 2.68 (s, 3H). HRMS (ESI) calcd for: C ₁₉ H ₁₄ N ₂ OS (MH) 317.0749, found 317.0750.

4-formamide (compound 16)

1H NMR (400MHz, DMSO) δ (ppm) : 10.43 (s, 1H) , 9.15 (s, 1H) , 8.35 (s, 1H) , 7.91-7.85 (m, 3H) , 7.73 (d, J = 8.8 Hz , 1H), 7.52-7.42 (m, 2H), 2.66 (s, 3H). HRMS (ESI) calcd for: C ₁₅ H ₁₂ N ₂ OS (MH) 267.0592, found 267.0590. -2-methylthiazole-5-carboxamide (compound 18)

HRMS (ESI) calcd for: C ₁₇ H ₁₂ N ₂ OS ₂ (M+H) 325.0469, found 325.0468. Example 2: Synthesis of Compound 19-46:

Synthesis of thiourea

 The aromatic amine (8 mmol, 1 eq) was dissolved in 24 mL of acetone, and the weighed triethylenediamine (24 mmol, 3 eq) was added under stirring. Then 20 mL of carbon disulfide was added dropwise, and a large amount of solid appeared. After stirring for 24 h, the reaction mixture was filtered, and the filter cake was washed with petroleum ether. After drying, the filter cake was dissolved in 50 mL of chloroform, and BTC (2.7 mmol, 0.33 eq) was dissolved in 30 mL of chloroform, and added dropwise over 1 h. The reaction solution was stirred at room temperature overnight. After the reaction was completed, the reaction mixture was filtered under suction, and the filter cake was washed with dichloromethane, and the obtained filtrate was directly dried on silica gel and dried (PE eluted).

 Dissolve NCS in a small amount of dichloromethane, add a large excess of ammonia water, stir at 0 °C for 3 h, filter the reaction solution, wash the filter cake with water, and dry the filter cake to obtain thiourea, which is directly used for the next reaction.

Head

Compound 19-26, 28-30, 33, 35-43, 45 β-cyclodextrin (590 mg, 0.52 mmol) was dissolved in 10 mL H ₂ 0 and the solution was warmed to 50 ° C to β-ring. The dextrin was completely dissolved to form a colorless and transparent solution. The corresponding ethyl acetoacetate was diluted with 0.5 mL of acetone and added dropwise to the β-cyclodextrin aqueous solution. After stirring, NBS (138.9 mg, 0.780 mmol) was weighed. The mixed solution was added, and after stirring for 1 h, aromatic thiourea (0.52 mmol) was added, and the reaction was followed by TLC. The reaction was completed, and the mixture was extracted with ethyl acetate/saturated brine. After the sodium was dried, the solvent was evaporated under reduced pressure, and the obtained crude product was further purified by silica gel column chromatography (PE: EA = 10:1).

 Target compound spectrum data

Ethyl 2-anilino-4-phenyl-5-thiazolecarboxylate (Compound 19)

1H NMR (400MHz, CDC1 ₃ ) δ (ppm): 7.74-7.72 (m, 2H), 7.38 (d, J = 3.6 Hz, 3H), 7.38 (t, J = 8.0 Hz, 2H), 7.14 (d, J = 6.8 Hz, 3H), 4.23 (q, J = 7.2 Hz, 2H), 1.26 (t, J = 6.8 Hz, 3H). HRMS (ESI) calcd for: C ₁₈ H ₁₆ N ₂ 0 ₂ S (M+H) 325.1011, found 325.1009. 2-(3,4-acid ethyl ester (Compound 20)

^J HNMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.74-7.72 (m, 2H), 7.40-7.39 (m, 3H), 7.12 (d, J=8.4Hz, 1H) , 7.02 (dd, Ji=2.4 Hz , J ₂ =8.0Hz , 1H) , 6.97 (d, J = 2.0 Hz , 1H), 4.23 (q, J = 7.2 Hz , 2H), 2.27 (s, 6H), 1.26 (t, J=6.8Hz , 3H). HRMS(ESI) calcd for: C ₂₀ H ₂₀ N ₂ O ₂ S (M+H) 353.1324, found 353.1324c

2-(3-chloro-4-acid ethyl ester (Compound 21)

¹ H NMR (400 MHz, DMSO) δ (ppm): 7.82 (d, J = 2.0 Hz, 1H), 7.74-7.72 (m, 2H), 7.45-7.42 (m, 4H), 7.32 (d, J = 8.4 Hz , 1H), 4.16 (q, J=7.2Hz, 2H), 2.28 (s, 3H), 1.18 (t, J=7.2Hz, 3H). HRMS (ESI) calcd for: Ci ₉ H ₁₇ Cl ₂ 0 ₂ S (M+H) 373.0778, found 373.0778.

2-(4-acid ethyl ester (compound 22)

ONMR (400MHz, DMSO) δ (ppm): 10.59 (s, 1H), 7.73-7.70 (m, 2H), 7.52 (d, J = 9.2 Hz, 2H), 7.42 (t, J = 3.2Hz, 3H) , 6.96 (dd, J i = 2.0 Hz , J ₂ = 6.8 Hz , 2H) , 4.13 (q, J = 7.2 Hz , 2H) , 3.74 (s, 3H) , 1.16 (t, J = 7.2 Hz , 3H) . HRMS (ESI) calcd for: C ₁₉ H ₁₈ N ₂ 0 ₃ S (M+H) 355.1116, found 355.1115.

2-(3-tri-thiazolecarboxylic acid ethyl ester (Compound 23)

^J HNMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.69-7.67 (m, 2H), 7.53 (d, J= 8.8 Hz, 1H), 7.47 (d, J=2.8Hz, 1H), 7.33-7.29 ( m, 3H), 7.10 (dd, J 2.8 Hz, J ₂ = 8.6 Hz, 1H), 4.26 (q, J = 7.2 Hz, 2H), 1.28 (t, J = 7.2 Hz, 3H).

HRMS (ESI) calcd for: C ₁₉ H ₁₄ BrF ₃ N ₂ 0 ₂ S (M+H) 470.9990, found 470.9986.

2-(3 oxazolate ethyl ester (Compound 24)

¹ H NMR (400 MHz, CDC1 ₃ ) δ (ppm): 7.70-7.67 (m, 2H), 7.35 (dd, J corp. 2.0 Hz, J 2 = 5.4 Hz, 3H), 7.26 (d, J = 8.8 Hz, 1H ), 7.14 (d, J = 2.4 Hz, 1H), 6.88 (dd, Ji=2.8Hz, J ₂ = 8.6 Hz, 1H), 4.24 (q, J=7.2Hz, 2H), 1.27 (t, J = 12

Hz, 3H).

2-(4-chloroethyl ester (Compound 25)

¹ H NMR (400 MHz, CDC1 ₃ ) δ (ppm): 10.59 (s, 1H), 7.67 (d, J = 6.4 Hz, 2H), 7.36-7.28 (m, 3H), 7.13 (d, J = 8.4 Hz, 2H), 6.85 (d, J = 8.8 Hz, 2H), 4.23 (q, J = 7.2 Hz, 2H), 1.25 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₁₈ H ₁₅ C1 ₂ 0 ₂ S (M+H) 359.0621, found 359.0615.

2-(2-methylazolecarboxylic acid ethyl ester (Compound 26)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 7.52-7.50 (m, 2H) , 7.36 (dd, J corp. 2.4 Hz, J 2 = 8.4 Hz, 1H), 7.29 (d, J=2.0Hz, 1H ), 7.27-7.23 (m, 2H), 7.15 (t, J=3.6Hz, 2H), 4.17 (q, J = 7.2 Hz , 2H) , 2.08 (s, 3H) , 1.21 (t, J = 7.2 Hz) , 3H). HRMS (ESI) calcd for: C ₁₉ H ₁₇ BrN ₂ 0 ₂ S (M+H) 417.0272, found 417.0271.

Ethyl 2-(3-trifluoromethyl-4-chloro)-anilino-4-phenyl-5-thiazolecarboxylate (Compound 28)

^J HNMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.70-7.67 (m, 2H), 7.50 (d, J=2.8Hz, 1H) , 7.38-7.32 (m, 4H) , 7.22 (dd, J 1= 2.8 Hz, J ₂ = 8.8 Hz, 1H), 4.26 (q, J = 7.2 Hz, 2H), 1.27 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₁₉ H ₁₄ C1F ₃ N ₂ 0 ₂ S (M+H) 427.0495, found 427.0493.

2-(4-trifluoroethyl ester (Compound 29)

_{^{! HNMR (400MHz, CDC1 3)}} δ (ppm): 7.78-7.75 (m, 2H), 7.59 (d, J = 8.4Hz, 2H), 7.43-7.41 (m, 3H), 7.34 (d, J = 8.4 Hz , 2H) , 4.27 (q, J = 7.2 Hz , 2H) , 1.29 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₁₉ H ₁₅ F ₃ N ₂ 0 ₂ S (M+H) 393.0885, found 393.0884.

Ethyl 2-((3-,-biphenyl)-4-yl)amino)-4-phenyl-5-thiazolecarboxylate (Compound 30)

NMR NMR (400MHz, CDC1 ₃ ) δ ( ppm ) : 7.98 (t, J = 8.4 Hz , 1H) , 7.81-7.79 (m, 2H) , 7.61-7.59 (m, 2H) , 7.50-7.40 (m, 8H ), 4.21 (q, J = 7.2 Hz, 2H), 1.30 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₄ H ₁₉ FN ₂ 0 ₂ S (M+H) 419.1230, found 419.1232.

2-(3,5-oxazolecarboxylic acid ethyl ester (Compound 33)

1HNMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.74-7.72 (m, 2H), 7.39-7.37 (m, 3H), 7.06 (d, J = 1.6 Hz , 1H) , 7.00 (d, J = 1.6 Hz , 2H), 4.24 (q, J = 7.2 Hz, 2H), 1.29 (t, J = 7.2 Hz, 3H). 2-(4-tert-carboxylate (Compound 35)

^J HNMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.75-7.73 (m, 2H), 7.40-7.38 (m, 5H), 7.19 (d, J = 8.4 Hz , 2H) , 4.24 (q, J = 1.2 Hz, 2H), 1.36 (s, 9H), 1.27 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₂ H ₂₄ N ₂ 0 ₂ S (M+H) 381.1637, found 381.1635.

_2- (3-Fluoro-4-ethyl ester (Compound 36)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.72-7.70 (m, 2H), 7.38-7.37 (m, 3H), 7.08 (t, J=7.6Hz, 1H) , 6.84-6.78 (m, 2H ), 4.23 (q, J = 1.2 Hz, 2H), 2.25 (s, 3H), 1.26 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₁₉ H ₁₇ FN ₂ 0 ₂ S (M+H) 357.1073, found 357.1068.

Ethyl 2-([U,-biphenyl]-4-yl-amino)-4-phenyl-5-thiazolecarboxylate (Compound 37)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 8.11-8.09 (m, 1H) , 7.75 (dd, J corp. 2.4 Hz, J ₂ = 6.6 Hz, 2H), 7.64-7.61 (m, 4H), 7.48 -7.44 (m, 5H), 7.38 (d, J = 8.0 Hz, 2H), 4.26 (q, J = 7.2 Hz, 2H), 1.29 (t, J = 12 Hz, 3H). HRMS (ESI) calcd for: C24H20N2O2S (M+H) 401.1324, found 401.1318.

Ethyl 2-((3,-methoxy-[U,-biphenyl]-4-yl)amino)-4-phenyl-5-thiazolecarboxylate (Compound 38)

ONMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.76-7.74 (m, 2H), 7.51 (d, J=8.4Hz, 2H) , 7.41-7.37 (m, 4H) , 7.17 (d, J=8.4Hz , 3H), 7.12 (d, J=2.0Hz, 1H), 6.93 (dd, J i = 2.4 Hz , J ₂ = 8.0 Hz , 1H) , 4.25 (q, J = 12 Hz , 2H) , (m, 2H) , 3.91 (s, 3H), 1.28(t,J= 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₅ H ₂₂ N ₂ 0 ₃ S (M+H) 431.1429, found 431.1432. ,-Methoxy-[U,-biphenyl]-4-yl)amino)-4-phenyl-5-thiazolecarboxylic acid ethyl ester (Compound 39)

NMR NMR (400MHz, CDC1 ₃ ) δ ( ppm ) : 8.00 (t, J = 8.4 Hz , 1H) , 7.82-7.79 (m, 2H) , 7.48-7.38 (m, 6H) , 7.18 (d, J = 7.6 Hz , 1H) , 7.12 (s, 1H) , 6.94 (dd, J i = 2.4 Hz , J 2 = 8.4 Hz , 1H) , 4.28 (q, J = 7.2 Hz , 2H) , 3.90 (s, 3H) ,

1.30 (t, J = 7.2 Hz, 3H). HRMS(ESI) calcd for : C ₂₅ H ₂₁ FN ₂ 0 ₃ S (M+H) 449.1335, found

449.1331. ,-methoxy-[U,-biphenyl]-4-yl)amino)-4-phenyl-5-thiazolecarboxylic acid ethyl ester (Compound 40)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.74-7.73 (m, 2H), 7.39-7.38 (m, 3H), 7.19 (d, J = 8.0 Hz , 1H) , 7.07-6.99 (m, 2H), 4.19 (q, J = 7.2 Hz, 2H), 2.91 (t, J = 7.6 Hz, 4H), 2.14-2.07 (m, 2H), 1.26 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₅ H ₂₀ F ₂ N ₂ O ₃ S (M+H) 467.1241 , found 467.1235.

Ethyl ₂ -((3-chloro-4-phenoxyphenyl)amino)-4-phenyl-5-thiazolecarboxylate (Compound 41)

H NMR (400MHz, CDC1 ₃ ): δ 7.72 (s, 2Η), 7.40-7.31 (m, 6H), 7.15 (t, J = 7.2 Hz, 1H), 7.07-7.05 (m, 1H), 6.99 (d , J = 7.6 Hz, 2H), 6.93 (d, J = 8.8 Hz, 1H), 4.27-4.22 (m, 2H), 1.27 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 168.09, 161.52, 158.51, 157.03, 149.29, 135.91, 133.93, 129.81, 129.66, 129.19, 127.70, 126.70, 123.41, 123.07, 121.57, 120.40, 117.68 110.70, 60.96, 14.19. HRMS (ESI) calcd for: C ₂₄ H ₁₉ C1 ₂ 0 ₃ S [m+H]+ 451.0883, found 451.0882. Ethyl 5-thiazolecarboxylic acid ethyl ester (Compound 42)

NMR NMR (400MHz, CDC1 ₃ ): δ 7.70 (d, J = 3.2 Hz, 2H), 7.50 (d, J = 7.6 Hz, 2H), 7.44 (t, J = 8.8 Hz, 2H), 7.39-7.36 ( m, 4H), 7.30 (d, J= 2.4 Hz, 1H), 7.09 (dd, J corp. 2.4 Hz, J ₂ = 8.8 Hz, 1H), 6.93 (d, J= 8.8 Hz, 1H), 5.20 (s , 2H), 4.25-4.20 (m, 2H), 1.26 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 169.48, 161.58, 158.70, 151.90, 136.39, 133.97, 133.30 , 129.52, 129.03, 128.68, 128.15, 127.59, 127.12, 124.33, 124.00, 121.36, 114.76, 110.10, 77.35, 60.82, 14.19. HRMS (ESI) calcd for: C ₂₅ H ₂₁ C1N ₂ 0 ₃ S [m+H] + 465.1040, found 465.1032. ) Amino) Ethyl 4-phenyl-5-thiazolecarboxylate (Compound 43)

H NMR (400MHz, CDC1 ₃ ): S 7.63-7.61 (m, 2H), 7.37-7.32 (m, 2H), 7.30-7.26 (m, 3H), 7.10 (t, J = 8.0 Hz, 1H), 7.01 (d, J = 2.4 Hz, 1H), 6.96 (d, J = 8.8 Hz, 1H), 6.90 (dd, J corp. 2.4 Hz, J ₂ = 8.8 Hz, 1H), 5.25 (s, 2H), 4.21 ( q, J = 7.2 Hz, 2H), 1.24 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDCI3): δ 169.36, 163.32, 161.62, 160.81, 158.77, 151.79, 136.72, 136.68, 133.91 , 133.82, 131.07, 130.97, 129.53, 129.10, 127.63, 125.70, 125.67, 124.61, 124.14, 121.98, 121.81 121.20, 115.65, 114.51, 114.28, 109.99, 62.96, 62.92, 60.86, 14.22. HRMS (ESI) calcd for: C25HI9C12FN2O3S [m+H] ⁺ 517.0556, found 517.0562.

H NMR (400 MHz, CDC1 ₃ ): δ 8.54 (s, 1H), 7.69 (dd, J = 3.2 Hz, J ₂ = 4.4 Hz, 2H), 7.37-7.35 (m, 3H), 7.14 (d, J = 9.2 Hz, 2H), 6.88 (d, J= 8.8 Hz, 2H), 4.20 (q, J= 7.2 Hz, 2H) 3.85 (s, 3H), 1.24 (t, J= 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 170.58, 161.75, 159.06, 157.30, 134.33, 132.62, 129.64, 128.87, 127.54, 123.84, 114.71, 109.40, 60.65, 55.51, 14.21. HRMS (ESI) calcd for: C ₁₉ H ₁₈ N ₂ 0 ₃ S [m+H] ⁺ 355.1116, found 355.1115. The following compounds 27, 31-32, 34, 44 and 46 were obtained by the methods described above.

2-蒽Amino-4-phenyl-5-thiazolecarboxylic acid ethyl ester (Compound 27)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 8.43 (s, 2H) , 8.03 (d, J = 8.8 Hz , 3H) , 7.99 (d, J = 2.0 Hz , IH) , 7.83-7.81 (m , 2H), 7.54-7.46 (m, 5H), 7.27 (d, J = 2.0 Hz, IH), 4.30 (q, J = 7.2 Hz, 2H), 1.31 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₆ H ₂₀ N ₂ O ₂ S (M+H) 425.1324, found 425.1324. Ethyl 2-(benzo[d][l,3]dioxolan-5-yl-amino)-4-phenyl-5-thiazolecarboxylate (Compound 31)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ): 7.68-7.66 (m, 2H), 7.37-7.34 (m, 3H), 6.75 (d, J = 8.0 Hz , IH), 6.65-6.68 (m, 2H), 6.01 (s, 2H), 4.20 (q, J = 7.2 Hz, 2H), 1.24 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C19H16N2O4S (M+H) 369.0909, found 369.0902. Ethyl 4-phenyl-5-thiazolecarboxylate (Compound 32)

O NMR (400MHz, DMSO) δ (ppm) : 10.71 (s, IH) , 8.36 (d, J = 1.2 Hz , IH), 8.12 (d, J = 7.6 Hz , IH), 7.79-7.76 (m, 2H ), 7.67-7.61 (m, 3H), 7.49-7.44 (m, 4H), 7.21 (t, J = 7.2 Hz, IH), 4.48-4.43 (m, 2H), 4.13 (q, J = 7.2 Hz, 2H), 1.33 (t, J = 7.2 Hz, 3H), 1.12 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₆ H ₂₃ N ₃ 0 ₂ S (M+H) 442.1589, found 442.1582.

Ethyl 2-((5,6,7,8-tetrahydronaphthalen-2-yl)amino)-4-phenyl-5-thiazolecarboxylate (Compound 34)

^J H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 7.76-7.73 (m, 2H) , 7.42-7.41 (m, 3H), 7.72 (d, J= 8.4 Hz , 1H) , 7.02 (dd, J corpse 2.4 Hz , J ₂ = 7.4 Hz , 1H) , 6.94 (d, J = 2.0 Hz , 1H) , 4.24 (q, J = 12 Hz , 2H) , 2.78 (s, 4H) , 1.85-1.81 (m, 4H ), 1.26 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for: C ₂₂ H ₂₂ N ₂ 0 ₂ S (M+H) 379.1480, found 379.1481.

2-((2,3-Bis 5-thiazolecarboxylic acid ethyl ester (Compound 44)

¹ H NMR (400MHz, CDC1 ₃ ) δ (ppm ) : 7.74-7.73 (m, 2H) , 7.39-7.38 (m, 3H), 7.19 (d, J = 8.0 Hz , 1H) , 7.07-6.99 (m, 2H), 4.22 (q, J = 7.2 Hz, 2H), 2.91 (t, J = 7.6 Hz, 4H), 2.14-2.07 (m, 2H), 1.26 (t, J = 7.2 Hz, 3H).

HRMS (ESI) calcd for: C ₂₁ H ₂₀ N ₂ O ₂ S (M+H) 365.1324, found 365.1326. Compound 46

 NMR NMR (400MHz, DMSO-t3⁄4): δ 10.90 (s, 1H), 8.23 (s, 1H), 7.92-7.63 (m, 6H), 7.52-7.34 (m, 5H), 4.27 (q, J= 7.2 Hz, 2H), 1.30 (t, J = 7.2 Hz, 3H). ESI [M+H]+ found 375.3. Example 3: Synthesis of Compounds 47-63, 64, 65, 77, 89-92

Compounds 47-48, 50-52, 55-59, 61-62, 89_92 can be synthesized according to the following scheme.

 Compound 47-48, 50-52, 55-59, 61-62 Synthetic method: 1 mmol of substituted phenylthiourea and 1 mmol of 2-chloroacetylacetone (2-chloroacetoacetate) dissolved in 20 mL Methanol, refluxed overnight, lysed in methanol, neutralized with a small diluted aqueous solution of potassium carbonate, washed with saturated brine, ethyl acetate, and then evaporated Target compound spectrum data

 2-(3,4-methylanilino)-4-methyl-5-acetylthiazole (Compound 47)

1H NMR (400MHz, DMSO) S (ppm): 7.32 (d, J = 8.0 Hz, 1H), 7.28 (s, 1H), 7.11 (d, J = 8.4 Hz, 1H), 2.53 (s, 3H), 2.41(s, 3H), 2.21(s, 3H), 2.18(s, 3H). HRMS (ESI) calcd for C ₁₄ H ₁₆ N ₂ OS (M+H+) 261.1062, found 261.1065.

2-(4-methyl-3-chloroanilino)-4-methyl-5-acetylthiazole (Compound 48)

1H NMR (400MHz, DMSO) 5 (ppm): 7.79 (d, J = 2.0 Hz, 1H), 7.48-7.38 (m, 1H), 7.30 (d, J = 8.0 Hz, 1H), 2.55 (s, 3H) ), 2.42(s, 3H), 2.27(s, 3H). HRMS (ESI) calcd for C ₁₃ H ₁₃ C1 ₂ 0S (M+H+) 281.0515, found 281.0515.

2-(4-Bromo-3-trifluoromethylanilino)-4-methyl-5-acetylthiazole (Compound 50)

NMR (400 MHz, DMSO) 5 (ppm): 8.25 (s, 1H), 7.82 (s, 3H), 2.57 (s, 3H), 2.45 (s, 3H). HRMS (ESI) calcd for C ₁₃ H ₁₀ BrF ₃ N ₂ OS (M+H ⁺ ) 378.9728, found 378.9724. -acetylthiazole (compound 51)

1H NMR (400 MHz, DMSO) 5 (ppm): 7.61 (d, J = 8.8 Hz, 2H), 7.53 (d, J = 8.8 Hz, 2H), 2.56 (s, 3H), 2.44 (s, 3H). HRMS (ESI) calcd for C ₁₂ H „BrN ₂ OS(M+H+) 310.9854, found 310.9854. Acetylthiazole (Compound 52)

1H NMR (400MHz, DMSO) 5 (ppm): 7.60 (d, J = 8.0 Hz, 2H), 7.37 (t, J = 8.0 Hz, 2H), 7.05 (d, J = 7.2 Hz, 1H), 2.56 ( s, 3H), 2.43(s, 3H). HRMS (ESI) calcd for Ci ₂ Hi ₂ N ₂ OS (M+H ⁺ ) 233.0749, found 233.0746. 5-acetylthiazole (compound 55)

1H NMR (400MHz, DMSO) 5 (ppm): 7.40 (d, J = 8.4 Hz, 2H), 7.91 (d, J = 8.8 Hz, 2H), 4.02-3.97 (m, 2H), 2.50 (s, 3H) ), 2.36(s, 3H), 1.32(t, J = 6.8 Hz, 3H). HRMS (ESI) calcd for C ₁₄ H ₁₆ N ₂ 0 ₂ S (M+H ⁺ ) 277.1011, found 277.1009. -5-acetylthiazole (Compound 56)

H NMR (400 MHz, DMSO) 5 (ppm): 7.49 (d, J = 8.4 Hz, 2H), 7.38 (d, J 2.54 (s, 3H), 2.42 (s, 3H), 1.28 (s, 9H). HRMS (ESI) calcd for C ₁₆ H ₂₀ N ₂ OS (M+H X) 289.1375 found 289.1374. -4-methyl-5-acetylthiazole (compound 57)

'H NMR (400 MHz, DMSO) S (ppm): 11.13 (s, 1H), 8.26 (d, J = 2.4 Hz, 1H), 7.91 (dd, Ji 2.4 Hz, J ₂ = 8.8 Hz, 1H), 7.69 (d, J = 8.8 Hz, 1H), 2.58 (s, 3H), 2.46 (s, 3H). -5-ethyl formate thiazole (compound 58)

H NMR (400MHz, DMSO) 5 (ppm): 7.45 (d, J = 9.2 Hz, 2H), 6.92 (d, J = 8.8 Hz, 4.21-4.16 (m, 2H), 4.02-3.97 (m, 2H) , 2.46(s, 3H), 1.32(t, J = 6.8 Hz, 3H), 1.25(t, J = 7.2 3H). HRMS(ESI) calcd for C ₁₅ H ₁₈ N ₂ 0 ₃ S(M+H+) 307.1116, found 307.1114. -5-Ethyl thiazole (Compound 59)

^{! H NMR (400MHz, DMSO)} 5 (ppm): 7.33 (dd, Ji = 2.0 Hz, J 2 = 8.0 Hz, 1H), 7.28 (s, 1H), 7.11 (d, J = 8.0 Hz, 1H), 4.23-4.17(m, 2H), 2.22(s, 3H), 2.18(s, 3H), 1.26(t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for C ₁₅ H ₁₈ N ₂ 0 ₂ S (M+H+) 291.1167, found 291.1169. Base-5-ethyl formate thiazole (compound 61)

1H NMR (400MHz, DMSO) 5 (ppm): 7.82 (d, J = 2.0 Hz, 2H), 7.42-7.39 (m, 2H), 7.3 l (d, J 8.4 Hz, 1H), 4.24-4.19 (m , 2H), 2.53 (s, 3H), 2.28 (s, 3H), 1.27 (t, J = 7.2 Hz, 3H). HRMS (ESI) Calcd for C ₁₄ H ₁₅ C1 ₂ 0 ₂ S(M+H 十) 311.0621, found 311.0620 ₀ ethyl formate thiazole (compound 62)

NMR NMR (400MHz, DMSO) 5 (ppm): 7.61 (d, J = 8.8 Hz, 2H), 7.52 (d, J = 8.8 Hz, 2H), 4.24-4.19 (m, 2H), 2.53 (s, 3H) ), 1.27(t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for C ₁₃ H ₁₃ BrN ₂ 0 ₂ S (M+H ⁺ ) 340.9959, found 340.9951. Compound 64

H NMR (400MHz, DMSO-t3⁄4): δ 10.79 (s, 1H), 7.80 (d, J = 2.0 Hz, 1H), 7.75 (dd, J; = 2.4 Hz, J ₂ = 8.4 Hz, 1H), 7.30 (d, J = 8.0 Hz, 1H), 2.55 (s, 3H), 2.42 (s, 3H), 2.27 (s, 3H). ¹³ C NMR (100 MHz, DMSO-t3⁄4): δ 189.70, 165.12, 156.91 , 139.58, 133.81, 131.93, 129.60, 123.15 118.37, 117.12, 56.51, 30.17, 19.33, 19.00, 18.94. HRMS (ESI) calcd for: C ₁₃ H ₁₃ C1 ₂ 0S

 [M+H]+ 281.0515, found 281.0515.

H NMR (400MHz, DMSO-t3⁄4): δ 7.41 (d, J = 8.4 Hz, 2H), 6.92 (d, J = 8.8 Hz, 2H), 4.00 (q, J = 6.8 Hz, 2H), 2.50 (s , 3H), 2.36 (s, 3H), 1.32 (t, J = 6.8 Hz, 3H). ¹³ C NMR (100 MHz, DMSO-t3⁄4): δ 188.95, 166.63, 157.61, 154.96, 134.21, 120.95, 115.35, 63.65, 56.49, 30.09, 18.96, 15.15. HRMS (ESI) calcd for: C ₁₃ H ₁₃ C1 ₂ 0S [M+H]+ 277.1011, found 277.1009. Compound 77

NMR NMR (400MHz, DMSO-t3⁄4): δ 10.87 (s, 1H), 7.61 (d, J = 8.8 Hz, 2H), 7.53 (d, J = 8.8 Hz, 2H), 2.56 (s, 3H), 2.44 (s, 3H). ¹³ C NMR (100 MHz, DMSO-t3⁄4): 189.26, 164.55, 156.38, 139.30, 131.78, 122.76, 119.81, 113.93, 56.01, 29.68, 18.41. HRMS (ESI) calcd for:

C ₁₂ H„BrN ₂ OS [M+H]+ 310.9854, found 310.9854.

HL-251-91 (Compound 89)

2-( (2,3-dihydro-1Η-茚-5-yl)ammonia

NMR NMR (400MHz, CDC1 ₃ ): δ 7.25 (d, J= 8.0 Hz, 1H), 7.21 (s, 1H), 7.09 (dd, J corp. 2.0 Hz, J ₂ = 8.0 Hz, 1H), 4.29 (q , J = 7.2 Hz, 2H), 2.97-2.91 (m, 4H), 2.57 (s, 3H), 2.17-2.10 (m, 2H), 1.35 (t, J = 6.8 Hz, 3H). ¹³ C NMR ( 100 MHz, CDC1 ₃ ): δ 169.47, 162.67, 158.77, 146.06, 141.57, 137.66, 125.23, 119.50, 117.59, 60.47, 33.01, 32.42, 25.59, 17.41, 14.45. HRMS (ESI) calcd for: C ₁₆ H ₁₈ N ₂ 0 ₂ S [M+H] ⁺ 303.1167, found 303.1163.

H NMR (400MHz, DMSO-t3⁄4): δ 10.73 (s, 1H), 7.60 (dd, J corp. 1.6 Hz, J ₂ = 12.2 Hz, 1H), 7.24 (t, J = 8.4 Hz, 1H), 7.19 ( Dd, J= 2.0 Hz, J ₂ = 8.4 Hz, 1H), 4.21 (q, J= 7.2 Hz, 2H), 2.53 (s, 3H), 2.18 (q, J= 1.2 Hz, 3H), 1.27 (t , J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ) : δ 167.80, 162.71, 162.49, 160.27, 158.48, 138.54, 138.43, 132.20, 132.14, 121.37, 121.20, 115.87, 115.83, 110.09, 107.73 , 107.48, 60.68, 17.36, 14.41, 14.12, 14.09. HRMS (ESI) calcd for:

C14H15FN2O2S [M+H] ⁺ 295.0917, found 295.0916.

HL-251-97 (Compound 91)

NMR NMR (400MHz, CDC1 ₃ ): S 7.20-7.13 (m, 1H), 7.07 (d, J = 2.0 Hz, 2H), 4.27 (q, J = 7.2 Hz, 2H), 2.55 (s, 3H), 2.30 (s, 3H), 2.26 (s, 3H), 1.32 (t, J= 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDCI3): S 169.59, 162.67, 158.71, 138.14, 137.23, 133.86, 130.69, 122.80, 118.80, 60.47 19.91, 19.26, 17.42, 14.44. HRMS (ESI) calcd for: C ₁₅ H ₁₈ N ₂ 0 ₂ S [ M+H]+ 291.1167, found

291.1164.

H NMR (400MHz, CDC1 ₃ ): S 7.42 (t, J = 8.0 Hz, 1H), 7.27 (s, 3H), 7.17 (d, J = 7.6 Hz, 1H), 6.99 (dd, J corp. 2.0 Hz, J ₂ = 8.0 Hz, 1H), 4.28 (q, J = 7.2 Hz, 2H), 3.91 (s, 3H), 2.59 (s, 3H), 1.33 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 170.60, 162.34, 160.17, 159.45, 157.94, 156.95, 141.95, 139.59, 130.20, 119.32, 115.70, 114.10, 112.66, 111.08, 111.02, 110.84, 60.64, 55.41, 16.85, 14.383. HRMS (ESI) calcd for: C ₂₀ H ₁₈ F ₂ N ₂ O ₃ S [M+H]+ 405.1084, found 405.1083 c Compounds 49, 53, 54, 60, 63, 64 were prepared in a similar manner to the above. 65 and 77.

 Thiazole (compound 49)

H NMR (400MHz, DMSO) 5 (ppm): 8.25 (d, J = 2.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.86 (d, J = 8.8 Hz, 2H), 7.61 ( Dd, Ji = 2.4 Hz, J ₂ = 8.8 Hz, 1H), 7.51-7.47 (m, 1H), 7.43-7.39 (m, 1H), 2.62 (s, 3H), 2.46 (s, 3H). HRMS (ESI) calcd for C ₁₆ H ₁₄ N ₂ OS (M+H+) 283.0905, found 283.0903. Azole (compound 53)

NMR (400MHz, DMSO) 5 (ppm): 8.51-8.47 (m, 3H), 8.10-8.04 (m, 3H), 7.57-7.45 (m, 3H), 2.65 (s, 3H), 2.48 (s, 3H). HRMS (ESI) calcd for C ₂₀ H ₁₆ N ₂ OS (M+H+) 333.1062, found 333.1057. 5--5-acetylthiazole (compound 54)

NMR NMR (400MHz, DMSO) 5 (ppm): 10.68 (s, 1H), 8.33 (s, 1H), 8.13 (d, J = 8.0 Hz, 1H) _: 7.65-7.55 (m, 3H), 7.47 (t , J = 7.2 Hz, 1H), 7.20(t, J = 7.2 Hz, 1H), 4.47-4.42(m, 2H), 2.57(s _: 3H), 2.40(s, 3H), 1.32(t, J= 6.0 Hz, 3H). HRMS (ESI) calcd for C ₂₀ H ₁₉ N ₃ OS (M+H+) 350.1327, found 350.1319. -methyl-5-carboxylic acid ethyl ester thiazole (compound 60)

1H NMR (400MHz, DMSO) 5 (ppm): 10.57 (s, 1H), 8.32 (d, J = 1.6 Hz, 1H), 8.13 (d, J = 7.6 Hz, 1H), 7.65-7.55 (m, 3H) ), 7.47(d, J = 7.6 Hz, 1H), 7.20(d, J = 7.6 Hz, 1H), 4.47-4.42(m, 2H), 4.22-4.16(m, 2H), 2.54(s, 3H) , 1.33 (t, J = 7.2 Hz, 3H), 1.25 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd for C ₂₁ H ₂₁ N ₃ 0 ₂ S (M+H+) 380.1433, found 380.1436. Ester thiazole (compound 63)

 H NMR (400MHz, DMSO) 5 (ppm): 8.51-8.46 (m, 3H), 8.10-8.05 (m, 3H), 7.56-7.46 (m,

3H), 4.28-4.23(m, 2H), 2.62(s, 3H), 1.91(s, 3H), 1.30(t, J Example 4

Compounds 79-88 were prepared using Scheme 4 or a similar method.

NMR NMR (400MHz, CDC1 ₃ ): S 7.52 (s, 1H), 7.14 (d, J = 8.8 Hz, 1H), 7.07 (d, J = 6.0 Hz, 2H), 4.32 (q, J = 7.2 Hz, 2H), 3.06 - 2.99 (m, 1H), 2.28 (s, 3H), 2.26 (s, 3H), 1.36 (t, J= 7.2 Hz _: 3H), 1.10-1.09 (m, 2H), 1.04-1.02 (m, 2H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 167.42, 164.91, 163.14, 137.98, 137.06, 132.92, 130.55, 121.13, 117.14, 108.84, 60.46, 19.95, 19.15, 14.50, 11.65, 9.75. HRMS (ESI) calcd for: C ₁₇ H ₂₀ N ₂ O ₂ S [M+H]+ 317.1324, found 317.1175.

H NMR (400 MHz, CDC1 ₃ ): S 7.19-7.11 (m, 2H), 6.96 (dd, J = 2.0 Hz, J ₂ = 8.0 Hz, 1H) _:

4.33 (q, J= 7.2 Hz, 2H), 3.05-2.99 (m, 1H), 2.27 (s, 3H), 1.37 (t, J= 7.2 Hz, 3H), 1.11-1.09 (m, 2H), 1.07 -1.04 (m, 2H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 165.88, 164.58, 162.87, 162.65, 160.21, 138.35, 138.25, 132.04, 131.97, 120.46, 120.28, 114.35, 109.56, 106.36, 106.10, 60.61, 14.45, 14.03, 14.00, 11.63, 9.85. HRMS (ESI) calcd for: C ₁₆ H ₁₇ FN ₂ 0 ₂ S [M+H]+ 319.0917, found 319.0916.

HL-YRJ-9-1 (Compound 81)

H NMR (400 MHz, CDC1 ₃ ): S 7.40 (d, J = 2.4 Hz, 1H), 7.22 (d, J = 8.4 Hz, 1H), 7.13 (dd, J = 2.4 Hz, J ₂ = 8.0 Hz, 1H), 4.33 (q, J= 7.2 Hz, 2H), 3.05 - 2.99 (m, 1H), 2.37 (s, 3H), 1.37 (t, J= 7.2 Hz, 3H), 1.13-1.09 (m, 2H) ), 1.07-1.03 (m, 2H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 165.96, 164.67, 162.87, 138.04, 135.04, 131.76, 131.55, 119.73, 117.39, 60.60, 29.69, 19.39, 14.47, 11.63 , 9.84. HRMS (ESI) calcd for: C ₁₆ H ₁₇ C1 ₂ 0 ₂ S [M+H]+ 337.0778, found 337.0770.

NMR NMR (400 MHz, CDC1 ₃ ): S 7.56 (s, 1H), 7.09-7.03 (m, 2H), 7.01 (s, 1H), 4.32 (q, J = 7.2 Hz, 2H), 3.06-3.00 ( m, 1H), 2.78-2.76 (m, 4H), 1.81-1.80 (m, 4H), 1.36 (t, J = 7.2 Hz, 3H), 1.11- 1.08 (m, 2H), 1.05-1.00 (m, 2H). "C NMR (100 MHz, CDC1 ₃ ): S 167.37, 164.81, 163.10, 138.55, 136.64, 133.65, 130.13, 120.13, 117.24, 108.83, 60.46, 29.55, 28.88, 23.16, 22.99, 14.51, 11.62, 9.75. HRMS (ESI) calcd for: C ₁₉ H ₂₂ N ₂ 0 ₂ S [M+H]+ 343.1480, found 343.1477.

HL-YRJ-8-2 (compound 83)

H NMR (400MHz, CDC1 ₃ ): S 7.73 (s, 1H), 7.22 (s, 1H), 7.20 (d, J = 8.00 Hz, 1H), 7.07 (d, J = 8.0 Hz, 1H), 4.32 ( q, J= 7.2 Hz, 2H), 3.06-3.00 (m, 1H), 2.95 - 2.88 (m, 4H), 2.15-2.08 (m, 2H), 1.36 (t, J= 7.2 Hz, 3H), 1.11 -1.08 (m, 2H), 1.04 - 1.00 (m, 2H). ¹³ C NMR (100 MHz, CDC1 ₃ ): 167.67, 164.97, 163.15, 145.93, 140.71, 137.57, 125.11, 118.12, 116.16, 108.80, 60.46 33.05 , 32.35, 25.62, 14.51, 11.66, 9.75. HRMS (ESI) calcd for: C ₁₈ H ₂₀ N ₂ O ₂ S [MH] ⁺ 327.1167 _: found 327.1169.

H NMR (400MHz, CDC1 ₃ ): S 7.16 (d, J= 8.8 Hz, 1H), 7.10 (s, 2H), 4.28 (q, J= 7.2 Hz _: 2H), 2.30 (s, 3H), 2.27 ( s, 3H), 1.49 (s, 9H), 1.35 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz,

CDCI3): δ 170.04, 165.38, 161.71, 138.05, 137.17, 132.74, 130.59, 120.84, 116.74, 109.63, 60.70, 36.39, 29.27, 20.02, 19.92, 19.20, 14.41. HRMS (ESI) calcd for: C ₁₈ H ₂₄ N ₂ 0 ₂ S [M+H] ⁴ 333.1637, found 333.1633.

H NMR (400MHz, CDC1 ₃ ): δ 7.20-7.15 (m, 2H), 6.99 (dd, J = 2.0 Hz, J ₂ = 8.0 Hz, 1H) _: 4.29 (q, J = 7.2 Hz, 2H), 2.28 (s, 3H), 1.50 (s, 9H), 1.37 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDCI3): δ 169.59, 163.87, 162.69, 161.51, 160.25, 138.49, 138.38, 132.08, 132.01, 120.23, 120.05, 114.06, 114.03, 110.43, 106.05, 105.78, 60.90, 36.44, 29.26, 14.37. HRMS (ESI) calcd for: C ₁₇ H ₂₁ FN ₂ 0 ₂ S [MH] 十335.1230, found 335.1223.

NMR NMR (400MHz, CDC1 ₃ ): S 7.47 (d, J = 2.0 Hz, IH), 7.23 (d, J = 8.4 Hz, IH), 7.16 (dd, Ji = 2.4 Hz, J ₂ = 8.4 Hz, IH ), 4.29 (q, J = 7.2 Hz, 2H), 2.37 (s, 3H), 1.49 (s, 9H), 1.36 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ) : δ 169.80, 163.94, 161.58, 138.29, 135.03, 131.53, 131.40, 119.43, 117.06, 110.58, 60.87, 36.48, 29.29, 19.39, 14.36. HRMS (ESI) calcd for:

C17H21CI 2O2S [M-H]+ 351.0934, found 351.0937.

H NMR (400MHz, CDC1 ₃ ): S 7.11-7.07 (m, 2H), 7.05 (s, IH), 4.28 (q, J= 7.2 Hz, 2H), 2.80-2.77 (m, 4H), 1.83 (s , 4H), 1.49 (s, 9H), 1.35 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDCI3): δ 169.81, 165.27, 161.64, 138.62, 136.68, 133.51, 130.20, 119.82, 116.88, 109.62, 60.71, 36.35, 29.25, 26.64, 23.16, 22.99, 14.40. HRMS (ESI) calcd for: C ₂₀ H ₂₆ N ₂ O ₂ S [M+H] 359.1793, found 359.1782.

H NMR (400MHz, CDC1 ₃ ): S 7.45 (s, IH), 7.25-7.21 (m, 2H), 7.09 (dd, J = 2.0 Hz, J ₂ = 8.0 Hz, IH), 4.27 (q, J= 7.2 Hz, 2H), 2.97-2.90 (m, 4H), 2.17-2.09 (m, 2H), 1.49 (s, 9H), 1.35 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): 169.96, 165.58, 161.68, 146.03, 140.59, 137.61, 125.17, 117.73, 115.82, 109.57, 60.69, 36.36, 33.07, 32.36, 29.26, 25.63, 14.41. HRMS (ESI) calcd for: C ₁₉ H ₂₄ N ₂ 0 ₂ S [MH] ⁺ 343.1480, found 343.1482. Example 5

 The following compound 93-97 was obtained by the procedure 5 or the like.

Sodium ethoxide (41 mmol) was dissolved in 40 mL of ethanol. The solution was slowly added dropwise to ethanol (25 mL) and substituted isothiocyanate (41 mmol) in ethanol (25 mL). After the mixture was stirred overnight, ethyl chloroacetate (41 mmol) was added dropwise and the mixture was stirred overnight. After the reaction was completed, a large amount of ethanol solvent was removed under reduced pressure, and the crude product was extracted with ethyl acetate and brine, and the organic phase was dried over anhydrous sodium sulfate. =2/1, v/v), get white pure.

HL-251-133 (compound 93)

 Methyl 2-(3-chloro-4-trifluoromethyl)-anilino-4-amino-5-thiazolecarboxylate

 e

H NMR (400MHz, DMSO-t3⁄4): δ 11.00 (s, IH), 8.20 (d, J = 2.4 Hz, IH), 7.91 (dd, J corp. 2.4 Hz, J ₂ = 8.8 Hz, IH), 7.67 ( d, J = 8.4 Hz, IH), 7.01 (s, 2H), 3.32 (s, 3H). ¹³ C NMR (100 MHz, DMSO-t3⁄4): δ 164.75, 164.17, 139.79, 132.67, 127.59, 127.29, 124.52 , 123.25, 123.07, 121.80, 117.25, 117.20, 117.14, 51.17. HRMS (ESI) calcd for: C ₁₂ H ₉ C1F ₃ N ₃ 0 ₂ S [M+H] ⁺ 352.0134, found 352.0130c

HL-251-135 (Compound 94)

 Ethyl-4-amino-5-thiazolecarboxylic acid ethyl ester

1H NMR (400MHz, DMSO-t3⁄4): δ 10.98 (s, IH), 8.17 (d, J = 2.4 Hz, IH), 7.92 (dd, J corp. 2.4 Hz, J ₂ = 8.8 Hz, IH), 7.67 ( d, J= 8.8 Hz, IH), 6.98 (s, 2H), 4.15 (q, J= 7.2 Hz, 2H), 1.23 (t J = 7.2 Hz, 3H). "C NMR (100 MHz, DMSO-t3⁄4): δ 164.71, 163.86, 139.80, 132.68, 127.60, 127.29, 124.52, 123.22, 123.05, 121.80, 117.27, 117.22, 117.16, 117.10, 59.60 , 15.09. HRMS (ESI) calcd for: C ₁₃ H „C1F ₃ N ₃ 0 ₂ S [M+H] ⁺ 366.0291, found 366.0292.

HL-251-137 (Compound 95)

 Ethyl 5-5-thiazolecarboxylate

H NMR (400MHz, DMSO-t3⁄4): δ 10.40 (s, 1H), 7.34 (d, J = 9.6 Hz, 1H), 7.31 (s, 1H), 7.09 (d, J = 8.4 Hz, 1H), 6.89 (s, 2H), 4.12 (q, J = 7.2 Hz, 2H), 2.21 (s, 3H), 2.18 (s, 3H), 1.21 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz , DMSO-t ₆ ): δ 166.06, 163.90, 138.14, 137.29, 131.40, 130.37, 120.46, 116.76, 59.30, 20.14, 19.22, 15.14. HRMS (ESI) calcd for: C ₁₄ H ₁₇ N ₃ 0 ₂ S

[M+H] ⁺ 292.1120, found 292.1117.

HL-251-139 (Compound 96)

 Ethyl 2-(3,4-dichloro)-anilino-4-amino-5-thiazolecarboxylate

H NMR (400MHz, DMSO-t3⁄4): δ 10.87 (s, 1H), 8.11 (d, J = 2.4 Hz, 1H), 7.73 (d, J = 8.8 Hz, 1H), 7.47 (dd, J corp. 2.4 Hz , J ₂ = 9.0 Hz, 1H), 7.02 (s, 2H), 4.14 (q, J = 7.2 Hz, 2H), 1.23 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, DMSO- T3⁄4): δ 164.72, 163.88, 140.43, 131.77, 131.20, 124.16, 119.58, 118.57, 59.57, 15.10. HRMS (ESI) calcd for: C ₁₂ H„C1 ₂ N ₃ 0 ₂ S [M+H]+ 332.0027, Found 332.0025.

HL-251-143 (compound 97)

Ethyl 2-(3-fluoro-4-methyl)-anilino-4-amino-5-thiazolecarboxylate

NMR NMR (400MHz, DMSO-t3⁄4): δ 10.68 (s, 1H), 7.68 (d, J = 8.4 Hz, 1H), 7.23 (t, J = 8.4 Hz, 1H), 7.16 (dd, J= 1.6, 8.0 Hz, 1H), 6.97 (s, 2H), 4.13 (q, J= 7.2 Hz, 2H), 2.18 (s, 3H), 1.22 (t, J= 7.2 Hz, 3H). ¹³ C NMR (100 MHz , DMSO-t3⁄4): 3 165.17, 163.93, 162.18, 159.79, 139.82, 139.71, 132.07, 132.00, 118.27, 118.09, 114.29, 105.68, 105.40, 59.44, 15.09, 14.03. HRMS (ESI) calcd for: C ₁₃ H ₁₄ FN ₃ 0 ₂ S [M+H] ⁺ 296.0869, found 296.0865. Example 6

 TM: HL-251-147, 149, 151, 179, 183, 189

 Weigh 4-amino-2-(substituted anilino)thiazole-5-carboxylic acid ethyl ester (304 μη)1) In a 25 mL single-necked flask, add 5 mL of toluene, add 15 drops of triethylamine, and mix until evenly. The benzoyl chloride (456 μηιοΐ) was slowly added dropwise under ice bath conditions, and the addition was completed. After stirring for 10 min in an ice bath, the temperature was raised to 90 ° C, and the reaction was continued, and TLC was traced until the starting material was completely converted. The reaction mixture was cooled to room temperature, and the solvent was evaporated to dryness. EtOAcjjjjjjjjj

HL-251-147 (Compound 98)

 4-cyclopropyl-2-(3,4-dimethyl)-anilino-4-amino-5-thiazolecarboxylic acid ethyl ester

H NMR (400MHz, CDC1 ₃ ): ^ 7.31 (d, J = 7.6 Hz, 1H), 7.13 (s,l H), 7.10 (d, J = 8.0 Hz, 1H), 5.62 (s, 1H), 4.27 (q, J= 7.2 Hz, 2H), 2.36 (s, 3H), 2.35 (s, 3H), 1.43-1.40 (m, 1H), 1.33 (t J= 7.2 Hz, 3H), 1.20 - 1.18 (m , 2H), 0.84-0.81 (m, 2H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 173.98, 165.07, 162.69, 159.21, 138.58, 138.17, 136.47, 130.99, 129.84, 126.20, 59.82, 19.93, 19.67, 14.53, 13.63, 10.62. HRMS (ESI) calcd for: C ₁₈ H ₂₁ N ₃ 0 ₃ S [M+H] 136 360.1382, found 360.1388.

HL-251-149 (Compound 99)

 -4-amino-5-thiazolecarboxylic acid ethyl ester

H NMR (400MHz, CDC1 ₃ ): δ 7.66 (d, J = 8.4 Hz, 1H), 7.53 (d, J = 2.4 Hz, 1H), 7.26 (dd Ji= 2.4 Hz, J ₂ = 8.8 Hz, 1H) , 4.28 (q, J= 7.2 Hz, 2H), 1.43-1.37 (m, 1H), 1.34 (t, J= 7.2 Hz, 3H), 1.26-1.23 (m, 2H), 0.95-0.90 (m, 2H) ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 173.00, 165.07, 161.88, 158.80, 138.10, 133.92, 133.87, 131.55, 131.33, 128.70, 60.04, 14.50, 13.87, 10.92. HRMS (ESI) calcd for: C ₁₆ H ₁₅ C1 ₂ N ₃ 0 ₃ S [M+H]+ 400.0289, found 400.0289.

HL-251-151 (Compound 100)

 4-cyclopropyl -2-(3,trifluoromethyl-4-chloro)-anilino-4-amino-5-thiazolecarboxylic acid ethyl ester

H NMR (400MHz, CDC1 ₃ ): δ 7.73-7.71 (m, 2H), 7.53 (dd, J corp. 2.0 Hz, J ₂ = 8.4 Hz, 1H), 4.28 (q, J= 7.20 Hz, 2H), 1.36 -1.32 (m, 4H), 1.28-1.26 (m, 2H), 0.94-0.89 (m, 2H). ¹³ C NMR (100 MHz, CDCI3): δ 172.82, 164.89, 161.82, 158.73, 137.63, 133.80, 133.46 , 133.10, 130.27, 129.95, 128.81, 128.75, 128.70, 128.65, 123.50, 120.78, 60.07, 14.49, 13.98, 10.95. HRMS (ESI) calcd for: C ₁₇ H ₁₅ C1F ₃ N ₃ 0 ₃ S [M+H] ⁺ 434.0553, found 434.0556.

HL-251-179 (Compound 101)

H NMR (400MHz, CDC1 ₃ ): δ 7.55 (d, J = 2.4 Hz, 1H), 7.48 (d, J = 8.8 Hz, 1H) _: 7.40-7.27 (m, 6H), 5.63 (s, 2H), 4.32 (q, J = 7.2 Hz, 2H), 1.38 (t, J = 7.2 Hz, 3H). "C NMR (100 MHz, CDC1 ₃ ) : δ 169.13, 164.83, 161.83, 158.70, 138.11, 133.95, 133.26, 132.59, 132.23, 131.17, 129.39, 129.12, 129.07, 129.01, 128.96, 128.43, 128.34, 123.38, 120.66, 60.25, 14.55.

HL-251-183 (Compound 102)

NMR NMR (400MHz, CDC1 ₃ ): S 7.40-7.30 (m, 6H), 7.26-7.20 (m, 4H), 5.64 (s, 2H), 4.32 (q, J = 12 Hz, 2H), 1.38 (t , J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 169.64, 165.02, 162.63, 159.07, 139.38, 134.03, 130.60, 129.68, 129.17, 128.78, 128.59, 127.89, 60.06, 14.60.

HL-251-189 (Compound 103)

NMR NMR (400MHz, CDC1 ₃ ): δ 7.31 (d, J = 8.0 Hz, 3H), 7.21 (t, J = 8.0 Hz, 2H), 7.09 (d, J = 8.0 Hz, 1H), 6.99 (s, 1H), 6.95 (d, J= 8.0 Hz, 1H), 5.67 (s, 2H), 4.31 (q, J= 7.2 Hz, 2H), 2.25 (s, 3H), 2.20 (s, 3H), 1.37 ( t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 169.77, 165.03, 162.97, 159.19, 137.68, 137.43, 136.88, 134.28, 130.45, 130.35, 130.23, 128.56, 127.79, 126.75, 59.99, 19.73, 19.53, 14.58.

 Example 7

TM: HL-251-191, 193

Weigh 4-phenyl-2-(arylamino)thiazole-5-carboxylic acid ethyl ester (617 μιηοΐ) in a 25 mL flask, add 3 mL DMF, add NaH (1 mmol) under argon, stir. After homogenization, Etl (617 μιηο1) dissolved in 2 mL of DMF was added dropwise to the reaction solution, and the reaction was stirred at room temperature for 2 h after the dropwise addition. After the reaction is over, use Saturated aqueous NH ₄ C1 the reaction was quenched with ethyl acetate / aqueous reaction solution was extracted with saturated brine, dried resulting organic phase was dried over anhydrous Na ₂ S0 _4, the solvent was removed under reduced pressure to give the crude product further purified by silica gel column chromatography ( PE: EA = 15:1), obtained white pure. 104)

H NMR (400MHz, CDC1 ₃ ): δ 7.80 (dd, J = 2.4 Hz, J ₂ = 8.0 Hz, 2H), 7.55-7.51 (m, 2H) 7.45-7.39 (m, 6H), 4.19-4.08 (m , 4H), 1.30 (t, J = 7.2 Hz, 3H), 1.21 (t, J = 7.2 Hz, 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 170.44, 161.95, 159.51, 143.88, 134.93, 130.30, 129.87, 128.86, 128.19, 127.52, 127.36, 110.41, 60.47, 47.44, 14.23, 13.15.

H NMR (400 MHz, CDC1 ₃ ): δ 7.79 (dd, J = 2.4 Hz, J ₂ = 7.6 Hz, 2H), 7.45-7.42 (m, 3H)

7.18-7.13 (m, 3H), 4.17 (q, J=7.2 Hz, 2H), 3.58 (s, 3H), 2.83 (s, 4H), 1.86 (s, 4H), 1.22 (t, J = 7.2 Hz , 3H). ¹³ C NMR (100 MHz, CDC1 ₃ ): δ 170.81, 162.00, 159.55, 142.90, 139.22, 137.04, 134.92, 130.76, 129.83, 128.87, 127.56, 125.99, 122.62, 110.52, 60.50, 40.13, 29.44, 29.12, 23.01, 22.87, 14.27.

DH0DH activity test section

 Example 1

 In vitro inhibitory effect of the compound provided by the present invention on dihydroorotate dehydrogenase (DHODH) activity Material: The full-length plasmid of human DHODH gene is provided by Prof. Jon Clardy (Harvard Medical School) (J. Bio. Chem. 2008) , 283 (50), 35078-35085) or can be purchased from Ao Rui Dongyuan Biotechnology Co., Ltd. The pET-19b vector, E. coli DH5a and E. coli BL21 (DE3) strains were purchased from Novagen. Restriction enzymes Nde I and Bam HI were purchased from NEB Corporation. The primers were synthesized by Shanghai Yingjun Biotechnology Co., Ltd. All other reagents were purchased from sigma.

Primers were designed based on the human DHODH gene sequence in GenBank. The forward primer was Fw: 5 ' -TGAACTACATATGGCCACGGGAGATGAG-3 '; reverse primer Rv: 5 ' - ATATGGATCCTCACCTCCGATGATCTGC -3 '. The plasmid containing the DHODH gene was used as a template for amplification. The amplification conditions were: pre-denaturation at 95 ° C for 2 min; denaturation at 94 ° C for 30 s; annealing at 60 ° C for 45 s; extension at 72 ° C for 1 min for 50 s; 29 cycles, fully extended at 72 ° C 10min. After the reaction, 1% agarose gel electrophoresis was performed at 2000 bp.

The DNA standard is a relative molecular weight reference, the relative molecular weight of the amplified product is verified, the gel is cut, and the amplified product is recovered by a kit.

 The PCR product and the vector pET-19b were digested with Nde I and Bam HI respectively, and the digested target gene and vector fragment were recovered and ligated with T4 DNA ligase at 16 ° C overnight to construct a recombinant expression vector pET-19b-DHODH. . The recombinant plasmid was transformed into E. coli DH5a competent form, inoculated on LB plate containing Penicillium ampicillin, and positive colonies were randomly picked and inoculated into 2 mL of a small centrifuge tube containing Penicillium ampicillin. After the expansion, the plasmid was extracted and the plasmid was extracted and identified by enzyme digestion and PCR. The DNA sequence was determined by Shanghai Yingjun Biotechnology Co., Ltd.

 The correctly sequenced recombinant plasmid pET-19b-DHODH was transformed into E. coli BL21 DE3) competent form, plated on LB plate containing ampicillin, and picked up for inoculation into LB medium containing 100 μM ampicillin. Incubate overnight at ° C, 230 rpm shaker. Inoculation was carried out in a ratio of 1:200 in 500 mL of LB medium containing 100 μM ampicillin at 37 ° C and expanded at 230 rpm. When the OD value of the cells reached 0.8-1, IPTG was added to the medium to make the final concentration of IPTG 0.5 mM. Expression was induced overnight at 25 °C. The induced cells were collected by centrifugation at 4 ° C and 4000 rpm, washed with deionized water, and centrifuged again to collect the bacterial pellet, which was stored at -80 ° C.

 When the protein is purified, the cells are resuspended in the lysate. The lysate contained 50 mM HEPES (pH 8.0), 0.15 M NaCl, 10 mM imidazole, 10% glycerol, 0.1% Triton X-100, added a little soy protease inhibitor, and resuspended and mixed to supersonically disrupt the cells. The crushed liquid was centrifuged at 4 ° C, 1000 rpm for 30 min. The supernatant and precipitate were taken for protein electrophoresis to determine the presence of the protein. The supernatant was combined in a prepared Ni-NTA column and collected through a solution. The resin was washed 3-5 times with a lysate containing 20 mM imidazole, and finally the protein was eluted with a lysate containing 300 mM imidazole, and the eluted protein solution was collected. Take the above 10 protein samples for SDS-PAGE electrophoresis to detect the target protein content. The eluted protein solution was dialyzed against the imidazole in a dialyzate containing 50 mM HEPES (pH 8.0), 0.15 M NaCl, 10% glycerol, 0.1% Triton X-100.

DHODH activity was determined by measuring the decrease of DCIP. In the presence of coenzyme Q0, DHODH catalyzes the substrate DHO, and transfers two H to the auxiliary group FMN of DHODH, which is then transferred to coenzyme Q0, and finally passed to coenzyme Q0. DCIP, the DCIP is restored. Enzyme activity was determined by measuring the amount of DCIP reduced per minute. The assay was read by a BioTek microplate reader using a 96-well plate. Each well contained 199 μL of test fluid (50 mM HEPES (pH 8.0), 0.15 M KC1, 100 μΜ coenzyme Q0, 100 μΜ DCIP). Add 0.2 μΜ inhibitor (dissolved in DMSO), let the final concentration of inhibitor 10 μΜ, incubate for 10 min at room temperature, and finally add 1 substrate DHO to make DHO final concentration. It is 500 μΜ. After mixing, read with a microplate reader at 600 nm for 6 min, and read the data once every 30 s. Set at least 3 parallels for each experiment. Finally, the half effective inhibitory concentration was calculated by the inhibition ratio of the compound at different concentrations (IC _{5 ()} ) The activities of the compounds 1-65 and 77 and the following compounds 66-76 and 78 were tested according to the above methods, and the results are shown in the following table:

 o

 Compound structure and hDHODH inhibition rate

Compound editing

No. IC ₅ . Value number IC ₅ . value

 1 9.7270 39 24.4507

 2 44.8247 40 82.3038 0.3109±0.0185

3 12.7260 41 48.3306

 4 4.1765 42 37.6784

 5 28.8169 43 38.4990

 6 26.2065 44 91.6029 0.0260±0.0047

7 7.0808 45 71.2 0.99

 o

 8 13.4580 46 82 0.0297

 9 6.8469 47 69.6331 2.8589±0.2796

 Speak

 10 46.6015 48 79.2238 1.0149±0.0579

11 16.5413 49 82.6398 0.4350±0.0155

12 46.1820 50 72.8908 0.9628±0.1849

13 13.6697 51 28.8674

 14 27.4907 52 20.1885

 15 23.3942 55 36.8049

 16 32.0062 56 0.5432±0.0750

17 57 62.7295 2.8750±0.1911

18 39.5901 58

 19 74.9719 0.7838±0.0164 59 82.1540 0.9834 + 0.0822

20 90.8832 0.0575±0.0003 61 78.8106 0.2798±0.0233

21 0.0354±0.0042 62 53.8973 9.0737±0.9535

22 67.3839 1.4398±0.5117 63 61.7799 3.6998±0.1659

23 0.1281±0.0180 64 85.6 0.93

 24 87.8278 0.1743 + 0.0142 65 53.0 7.58

25 79.2829 0.2389±0.0068 66 51.4 4.17 26 67 34.2

27 0.4534±0.0223 68 52.1 8.90

28 87.6048 0.1310±0.0006 69 37.9

 29 76.3375 0.4082±0.0145 70 19.0

 o

 30 38.0253 71 5.1

 31 76.2914 1.1082±0.1435 72 47.4

 32 47.4559 73 13.8

 33 76.3759 0.3931±0.0058 74 5.1

 34 90.0581 0.0186±0.0052 75 22.0

 35 72.0719 0.2844±0.0124 76 45.8

 36 92.9568 0.0489±0.0035 77 43.7

 37 35.9963 78 39.5

 38 33.8809

Ϋ3/: O 9ϊ8981£99s0iAV

Claims

1. The compound of formula I below:

R ^{1 is} selected from H, dC ₆ alkyl, C ₂ -C ₆ alkenyl or alkynyl, optionally substituted aryl, nitro, amino, NR ⁴ R ⁵ , halogen;

R ^{2 is} selected from the group consisting of H, dC ₆ alkyl, halogen-substituted dC ₆ alkyl, dC ₆ unsaturated alkyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, aminocarbonyl, dC ₆ alkoxy Carbonyl, hydroxy, dC ₆ alkoxy, optionally substituted aryl, optionally substituted heteroaryl, amino, C ₃ Uf alkyl, NHR ⁶ ;

R ^{3 is} selected from H, dC ₆ alkyl, -C(0)NHR ⁷ , dC ₆ alkoxycarbonyl, halogen substituted alkyl, C ₂ -C ₆ alkenyl or alkynyl, optionally substituted phenyl , dC ₄ alkylcarbonyl, optionally substituted benzoyl, optionally substituted pyridylcarbonyl, dC ₃ alkylcarboxy, amide, amino, d-do alkyl substituted amino, halogen;

R ⁴ and R ⁵ are each independently selected from H, an optionally substituted aryl group, an optionally substituted heterocyclic group, an optionally substituted arylcarbonyl group, an optionally substituted heterocyclic carbonyl group, and an optionally substituted aryloxy group. Alkylcarbonyl group;

R ^{6 is} selected from a Ci-alkyl group, an optionally substituted phenyl group, a C ₃ -C ₈ cycloalkylcarbonyl group, a benzoyl group, or a 6-membered ring with a N attached thereto, such as a piperidine ring, or a 6-membered An oxygen or nitrogen heterocycle such as a piperidine ring and a morpholine ring;

R ^{7 is} selected from the group consisting of an optionally substituted aryl group and an optionally substituted heterocyclic group.

2. A compound according to claim 1 wherein the compound is selected from the group consisting of the compounds of formula II:

 Ar is selected from the group consisting of an optionally substituted aryl group, an optionally substituted heterocyclic group, an optionally substituted arylcarbonyl group, an optionally substituted heterocyclic carbonyl group, and an optionally substituted aryloxyalkylcarbonyl group;

R ^{2 is} selected from dC ₆ alkyl, halogen-substituted dC ₆ alkyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, aminocarbonyl, dC ₆ alkoxycarbonyl, hydroxy, dC ₆ alkoxy , optionally substituted aryl or heteroaryl, amino, NHR ⁶ ;

R ^{3 is} selected from the group consisting of Ci-alkyl, dC ₆ alkoxycarbonyl, optionally substituted phenyl, dC ₄ alkylcarbonyl, optionally substituted benzoyl, dC ₃ alkylcarboxy, amide, optionally substituted Aniline formyl.

3. The compound according to claim 2, substituents selected from d-do-alkyl group on Ar, C ₃ -C ₈ cycloalkyl, The dC ₄ alkoxy group, the optionally substituted phenyl group, the optionally substituted phenoxy group, the benzyloxy group, the CF ₃ group, and the halogen, the number of the substituents is 1, 2, 3, 4 or 5.

The compound according to claim 2, wherein R ^{2 is} selected from the group consisting of dC ₆ alkyl, CF ₃ , phenyl, acetyl, benzoyl, carboxyl, carbamoyl, dC ₆ alkoxycarbonyl, The amino group is more preferably a methyl group, a CF ₃ group or a phenyl group.

The compound according to claim 2, wherein R ^{3 is} selected from the group consisting of dC ₆ alkyl, phenyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxyl, dC ₆ alkoxycarbonyl, Amido group, optionally substituted benzoyl group; preferably dC ₃ alkylcarbonyl, dC ₆ alkoxycarbonyl.

 6. The compound of claim 1 wherein the compound is selected from the group consisting of the compounds of formula III:

R ^{2 is} selected from dC ₆ alkyl, halogen-substituted dC ₆ alkyl, optionally substituted phenyl, dC ₃ alkylcarbonyl, optionally substituted benzoyl, carboxy, carbamoyl, dC ₆ alkoxycarbonyl , hydroxy, dC ₆ alkoxy, optionally substituted aryl or heteroaryl, amino, optionally substituted amino;

R ^{3 is} selected from the group consisting of dC ₆ alkyl, optionally substituted phenyl, dC ₃ alkylcarbonyl, dC ₃ alkoxycarbonyl, optionally substituted benzoyl, carboxy, amide, optionally substituted benzoyl;

R ^{8 is} selected from C ₅ or more alkyl or cycloalkyl, optionally substituted phenyl, 5 or 6 membered aromatic heterocyclic group, or optionally substituted phenoxy group.

 The compound according to claim 1, wherein the compound is selected from the group consisting of Compounds 1-65, 77, and 79-105.

 A pharmaceutical composition, comprising the compound according to any one of claims 1 to 7, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or form Agent.

 9. Use of a compound according to any one of claims 1 to 7 for the manufacture of a medicament for the treatment or prevention of a disease in which a double-frostate dehydrogenase is mediated.

 10. The use according to claim 9, wherein the bis-orotate dehydrogenase mediated disease is selected from the group consisting of cancer, organ transplant rejection and autoimmune diseases.

 The use of the compound according to any one of claims 1 to 7 for the preparation of a medicament for inhibiting the activity of the double-frostate dehydrogenase.