WO2013048734A1

WO2013048734A1 - Treatment and prevention of cardiovascular disease with cell derived lipid vesicles, microvesicles and exosomes

Info

Publication number: WO2013048734A1
Application number: PCT/US2012/054833
Authority: WO
Inventors: Gregory A. IMBRIE; Richard Karas
Original assignee: Tufts Medical Center, Inc.
Priority date: 2011-09-28
Filing date: 2012-09-12
Publication date: 2013-04-04

Abstract

Provided are compositions comprising naturally occurring vesicles, hybrid vesicles and vesicle populations, and methods using vesicle compositions to deliver therapeutic molecules for the treatment of cardiovascular disease.

Description

TREATMENT AND PREVENTION OF CARDIOVASCULAR DISEASE WITH CELL DERIVED LIPID VESICLES, MICRO VESICLES, AND

EXOSOMES

BACKGROUND OF THE INVENTION

Heart disease is the leading cause of illness and death worldwide, and encompasses numerous related diseases, including: coronary heart disease, cardiomyopathy, cardiovascular disease, ischemic heart disease, heart failure, hypertensive heart disease, inflammatory heart disease, and valvular heart disease. Heart disease is a systemic disease that can affect the heart, brain, most major organs, and the extremities. Additionally, heart disease is a multi-factorial disease affected by many independent risk factors, including: age, diabetes, family history, gender, hypertension, smoking, and Low Density Lipoprotein cholesterol (LDL-C) and High Density Lipoprotein cholesterol (HDL-C) levels.

Cardiovascular disease (CVD) refers to any of a number of specific diseases that affect the heart itself and/or the blood vessel system, especially the veins and arteries leading to and from the heart. A central underlying cause of CVD is atherosclerosis, which is caused by the deposition of fatty substances, cholesterol, cellular waste products, calcium and/or fibrin on an inner arterial lining. CVD morbidity and mortality rates are very high, affecting nearly 1 million people per year in the United States alone. Additionally, it is estimated that CVD results in health care costs in excess of 400 billion dollars a year in the United States.

Drug delivery to the cardiovascular system is different from delivery to other systems because of the anatomy and physiology of the vascular system, which supplies blood and nutrients to every organ of the body. Drugs can be introduced into the vascular system for systemic effects, or they can be targeted to a specific organ via the local vascular sub-system that supplies blood to the desired organ.

Drug delivery to the cardiovascular system is generally approached at three different levels: 1) route of drug delivery; 2) formulation of drug to be delivered; and 3) application to a specific disease or diseases. Formulations for drug delivery to the cardiovascular system range from controlled release preparations to delivery of therapeutic agents, nucleotides, proteins, and/or peptides. For example, drugs may be incorporated into a polymer in combination with a device (including but not limited to a drug eluting stent, or formulated as a coating for a device, thereby allowing slow release of drug to a local area.

New cell-based therapeutic strategies are being developed in response to the shortcomings of available treatments for heart disease. Cell therapy approaches include attempts to reinitiate cardiomyocyte proliferation in the adult, conversion of fibroblasts to contractile myocytes, conversion of bone marrow stem cells into cardiomyocytes, and transplantation of myocytes or other cells into injured myocardium. In recent years, a variety of approaches have been studied and used for the delivery of therapeutic nucleic acids, polypeptides, and chemical agents for medical and biological applications. One such set of approaches involves vesicles or liposomes (the two terms will be used interchangeably herein) as delivery systems.

For example, U.S. Patent Application No. 2009/0274630 discloses methods of delivering a substance into a cell with red blood cell derived vesicles (RDVs) that encapsulate an exogenous substance, and allow the cell to internalize the RDV, thereby delivering the substance into the cell. Additionally, European Patent

Application 2127639 discloses methods of using partially, or wholly, synthetic microvesicles derived from vesicle forming phospholipids, such as cholesterol, to deliver drugs.

Such prior art vesicle systems suffer from a number of deficiencies. Prior art vesicles are derived from either anucleate cells, or synthetic lipid systems, and are limited in their ability to serve as delivery vehicles for many types of therapeutic agents. For example, such vesicles do not serve as effective vehicles for delivery of nanoparticles because they are actively scavenged by the liver and spleen of the host subject. Additionally, such prior art vesicles are packaged in vitro, and therefore do not contain naturally occurring biomolecules that are naturally synthesized and modified as they would be in vivo. Such naturally occurring biomolecules are often preferred as therapeutic agents because their in vivo production insures that they are post-translationally and post-transcriptionally modified as they would be in nature.

Prior art vesicles also have limited applicability because they cannot be targeted easily to specific cell and/or tissue types. Additionally, such vesicles are antigenic, and therefore induce an immune response that limits efficacy of the therapeutic agent. Also, the prior art vesicles are not derived from a renewable source, or easily harvested from a cell culture system. In summary, many of the prior art vesicles are poorly directed to specific cell types, are actively scavenged, are difficult to obtain and/or include proteins that may be immunogenic.

In view of the shortcomings in existing vesicle delivery systems, there is an urgent need for improved vesicle delivery systems and vesicle delivery methods that provide enhanced target specificity, and allow for delivery (e.g., translocation) of all types of therapeutic agents (including but not limited to hydrophobic, hydrophilic, small, or macromolecular compounds), including agents that are otherwise incapable of entering target cells and tissues. There is also a need for an improved vesicle delivery system and methods of use that provide enhanced target specificity and facilitate delivery of therapeutic agents, for example, to heart cells, for treatment of cardiovascular disease. The vesicles and methods of the invention allow for delivery of a therapeutic agent to specific cells and/or tissues of interest (including but not limited to heart muscle cells). Additionally, there is a need for vesicles that possess properties suitable for drug delivery, including but not limited to, such as low toxicity and/or antigenicity, ease of formation, ease of loading, and ability to minimize aggregation.

SUMMARY OF THE INVENTION

As described below, the present invention features compositions and methods to facilitate the delivery of therapeutic agents, nucleotides, and polypeptides to a subject in need of treatment of heart disease, and in particular, cardiovascular disease. The invention provides compositions and methods to facilitate the delivery of therapeutic agents, nucleotides, and polypeptides to a subject in need of treatment, for example a subject in need of treatment of heart disease or cardiovascular disease. Compositions defined by the invention are prepared and isolated as described in the examples, and methods of the invention are performed as described in the examples provided below. Other features and advantages of the invention will be apparent from the detailed description, and from the claims. The vesicles of the invention and their methods of use provide the following advantages over methods of delivering therapeutic molecules currently known in the art. Unlike nanoparticles which are known in the art to be used for delivering agents to a cell or a subject in need, the vesicles of the invention are not scavenged by the liver and the spleen and are therefore more efficient and superior to nanoparticles and methods of using nanoparticles for delivery of agents.

The vesicles of the invention offer the advantage of being "self-vesicles" (i.e. they are non-immunogenic, or display reduced immunogenecity) and, in certain embodiments, are derived from the subject to which the vesicles are administered. Unlike other agents known in the art for delivery of therapeutic molecules to a subject, the inventive vesicles therefore allow for personalized treatments, that are tailored precisely to a subject in need, and do not induce an immune response in the subject.

Unlike delivery vehicles and methods known in the art, the new and improved vesicles of the invention can be loaded with a particular therapeutic agent(s) such that they are specific for one or more of a disease, a cell, a regulatory pathway, a disease pathway, a regulatory molecule that regulates, for example, a disease or a particular pathway, an organ, a tissue and or a vessel. That is, the vesicles of the invention can be easily modified to (1) target a wide range of diseases, including but not limited to cardiovascular disease; (2) localize to a specific target (for example, a cell, tissue, organ, interstitial space, media, plasma, and/or blood); and/or (3) target a particular molecule and/or regulatory, signaling or disease pathway. Unlike delivery vehicles known in the art, the inventive vesicles can, be designed and/or selected to target specific cells, tissues, organs and/or regulatory pathways. The targeting specificity of a vesicle of the invention is determined by, at least, the composition and/or derivation of the vesicle.

Unlike stem cell therapies known in the art which may induce an immune response in a subject, the new and improved vesicles of the invention do not stimulate an immune response when introduced into a subject. In certain embodiments, the inventive vesicles comprise endogenous therapeutic agents, for example, mRNA and/or miRNA molecules that are endogenous to a vesicle. These cell derived vesicles naturally protect the endogenous mRNA and miRNA from circulating RNAses and therefore provide for a gene therapy agent that has increased potency as compared to other methods of introducing nucleic acid into a cell or a subject. The vesicles of the invention are not, however, limited to delivery of therapeutic agents that are endogenous to the vesicles or to the cells from which the vesicles are derived. The novel vesicles of the invention are suited for delivery of therapeutic molecules that are either endogenous to the inventive vesicles or to the cells from which the vesicles are derived or therapeutic molecules that are exogenous to the inventive vesicles or to the cells from which the vesicles are derived. Specifically, in relation to their treatment of cardiovascular disease, the invention provides compositions and methods that target specific cardiovascular cells. For example, vesicles, including exosomes, of the invention inhibit smooth muscle cell (SMC) proliferation, but do not inhibit endothelial cell (EC) growth, for example in cells of the cardiovascular system. One limitation of currently available drug eluting stents is that while they inhibit SMC growth (to inhibit stent restenosis), they also inhibit EC growth, and therefore prevent full healing of the arterial wall;

consequently, long term antiplatelet therapy to prevent thrombosis is required. In contrast, vesicles, including exosomes, of the invention offer the advantage of inhibiting pathologic cells, while allowing growth of beneficial cells . The invention relates to a composition comprising naturally occurring vesicles derived from a nucleated cell, wherein the naturally occurring vesicles comprise at least one therapeutic nucleic acid or polypeptide.

The invention also relates to a composition comprising fusion vesicles derived in part from a naturally occurring vesicle, and in part from a synthetic vesicle, wherein the naturally occurring vesicle comprises at least one therapeutic nucleic acid or polypeptide and the synthetic vesicle comprises at least one therapeutic agent.

The invention also relates to a composition comprising a population of vesicles, wherein said population comprises naturally occurring vesicles comprising at least one therapeutic nucleic acid or polypeptide, in combination with synthetic vesicles, and fusion vesicles.

In one embodiment, the naturally occurring vesicles are between about 30 and about 500 nm in diameter. In another embodiment, the naturally occurring vesicles are between about 30 and about 100 nm in diameter.

In another embodiment, the naturally occurring vesicles are between about 100 and about 300 nm in diameter. In another embodiment, the naturally occurring vesicles are between about

300 and about 500 nm in diameter.

In another embodiment, the naturally occurring vesicles are exosomes.

In another embodiment, the therapeutic nucleic acid is selected from the group consisting of siRNA, shRNA, miRNA, dsRNA, and an expression vector comprising a nucleic acid encoding a therapeutic polypeptide.

In another embodiment, the at least one therapeutic nucleic acid is selected from the group consisting of: miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR- 20a, miR-20b, miR-21, miR-23a, miR-24, miR-25, miR-28-5p, miR-29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR-100, miR-106a, miR-125b, miR-126, miR- 128, miR-130a, miR-130b, miR-132, miR-133a, miR- 134, miR-135-3p, miR- 138, miR-139-3p, miR-139-5p, miR-146a, miR-155, miR-185, miR-186, miR-191, miR-193a-5p, miR-193b, miR-197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR-224, miR-320, miR-323-3p, miR-328, miR-331-3p, miR-337-5p, miR- 339-3p, miR-339-5p, miR-342-3p, miR-346, miR-361-5p, miR-370, miR-371-3p, miR-375, miR-376a, miR-422a, miR-423-5p, miR-433, miR-491-5p, miR-493, miR- 423-5p, miR-483-5p, miR-484, miR-495, miR-503, miR-505, miR-517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-579, miR-590-5p, miR-597, miR-618, miR-671-3p, miR-708, miR-885-5p, miR-886-5p, and miR-874.

In another embodiment, the at least one therapeutic nucleic acid is selected from the group consisting of: miR-222, miR-24, miR-484, miR-92a, miR-320, miR- 21, miR-106a, miR-17, miR-100, miR-19b, miR-191, miR-126, miR-99a, miR-423- 5p, miR-197, miR-20a, miR-221, miR-125b, miR-342-3p, miR-16, miR-34a, miR-31, miR-874, miR-223, miR-224, and miR- 193b.

In another embodiment, the at least one therapeutic nucleic acid is selected from the group consisting of: miR-212, miR-130b, miR-532-5p, miR-202, miR-152, miR-618, miR-548c-5p, miR-590-5p, miR-130a, miR-20b, miR-23a, miR-139-3p, miR 339-5p,miR-375, and miR-505. In another embodiment, the at least one therapeutic nucleic acid is miR- 203.

In another embodiment, the therapeutic polypeptide is selected from the group consisting of RGS2, nitric oxide synthase (eNOS, (endothelial NOS)), iNOS

(inducible NOS) , nNOS (neuronal NOS), Ι-κΒα, Ι-κΒβ, Ι-κΒγ, plOO, pl05, Bcl-3, cGMP-dependent protein kinase (PKG), c-Kit and p27Kipl, Sprouty-related protein SPRED1 and phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2/p85-beta), Spl, CDK inhibitors (CDKIs), INK4 family proteins (pl4, pl5, pl6, pl8 and pl9), KIP/CIP family (p21, p27, and p57), p53, TOR/RAFT, PPtase, PIAS, SHP1, eNOS coactivators, tetrahydrobiopterin, folic acid, and 1-arginine. In another embodiment, the nucleated cell is derived from a subject to be treated with the naturally occurring vesicles.

In another embodiment, the vesicles are non-immunogenic when administered to the subject.

In another embodiment, the at least one therapeutic nucleic acid or polypeptide is endogenous to the nucleated cell.

In another embodiment, the nucleated cell over-expresses the endogenous therapeutic nucleic acid or polypeptide.

In another embodiment, the at least one therapeutic nucleic acid or polypeptide is exogenous to the nucleated cell. In another embodiment, the at least one therapeutic nucleic acid or polypeptide is produced by a transgenic construct in the nucleated cell.

In another embodiment, the vesicles are derived from endothelial cells.

In another embodiment, the at least one therapeutic nucleic acid is endogenous to the endothelial cell. In another embodiment, the at least one therapeutic nucleic acid is selected from the group consisting of: miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR- 20a, miR-20b, miR-21, miR-23a, miR-24, miR-25, miR-28-5p, miR-29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR-100, miR-106a, miR-125b, miR-126, miR-128, miR-130a, miR-130b, miR-132, miR-133a, miR-134, miR-135-3p, miR- 138, miR-139-3p, miR-139-5p, miR-146a, miR-155, miR-185, miR-186, miR-191, miR-193a-5p, miR-193b, miR-197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR-224, miR-320, miR-323-3p, miR-328, miR-331-3p, miR-337-5p, miR- 339-3p, miR-339-5p, miR-342-3p, miR-346, miR-361-5p, miR-370, miR-371-3p, miR-375, miR-376a, miR-422a, miR-423-5p, miR-433, miR-491-5p, miR-493, miR- 423-5p, miR-483-5p, miR-484, miR-495, miR-503, miR-505, miR-517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-579, miR-590-5p, miR-597, miR-618, miR-671-3p, miR-708, miR-885-5p, miR-886-5p, and miR-874.

In another embodiment, the at least one therapeutic nucleic acid is selected from the group consisting of: miR-222, miR-24, miR-484, miR-92a, miR-320, miR- 21, miR-106a, miR-17, miR-100, miR-19b, miR-191, miR-126, miR-99a, miR-423- 5p, miR-197, miR-20a, miR-221, miR-125b, miR-342-3p, miR-16, miR-34a, miR-31, miR-874, miR-223, miR-224, and miR-193b.

In another embodiment, the at least one therapeutic nucleic acid is selected from the group consisting of: miR-212, miR-130b, miR-532-5p, miR-202, miR-152, miR-618, miR-548c-5p, miR-590-5p, miR-130a, miR-20b, miR-23a, miR-139-3p, miR 339-5p,miR-375, and miR-505.

In another embodiment, the at least one therapeutic nucleic acid is miR- 203.

In another embodiment, the vesicles are delivered to smooth muscle cells.

In another embodiment, the naturally occurring vesicles are derived from a nucleated cell. In another embodiment, the nucleated cell is derived from a subject to be treated with the vesicles.

In another embodiment, the population of vesicles is non-immunogenic

In another embodiment, the composition is in combination with a medical device. In another embodiment, the composition is formulated as a coating for a medical device.

In another embodiment, the medical device is selected from the group consisting of: a stent, valve, catheter and balloon. In another embodiment, the vesicles are in combination with a container selected from the group consisting of: an intravenous bag, intravenous bottle, pump and syringe.

In another embodiment, the vesicles are delivered to the heart. In another embodiment, the vesicles are delivered to a vein and/or an artery.

In another embodiment, the vesicles are delivered to endothelial cells, smooth muscle cells and or cardiac cells.

In another embodiment, the vesicles comprise a therapeutic nucleic acid or protein that inhibits a heart disease selected from the group consisting of: intimal hyperplasia, smooth muscle proliferation, neointimal hyperplasia, hypertension, atherosclerosis, heart failure, and ischemia.

The invention also relates to a method of delivering a therapeutic nucleic acid or polypeptide to a subject in need thereof, comprising: administering naturally occurring vesicles to the subject, wherein the naturally occurring vesicles are derived from a nucleated cell of the subject, or a nucleated cell of a second subject, wherein the nucleated cells of the second subject are non-immunogenic when administered to the subject, wherein the vesicles comprise a therapeutic nucleic acid or polypeptide; and thereby delivering the therapeutic nucleic acid or polypeptide to the subject in need. In one embodiment, the therapeutic nucleic acid or polypeptide is endogenous to the cell from which the naturally occurring vesicles are derived.

In one embodiment the therapeutic nucleic acid or polypeptide is exogenous to the cell from which the naturally occurring vesicles are derived.

In another embodiment, the method further comprises the step of collecting the naturally occurring vesicles from the subject in need and/or the second subject prior to the step of administering.

The invention also provides for a method of delivering a therapeutic nucleic acid or polypeptide to a subject in need thereof, comprising: transforming a nucleated cell with a nucleic acid encoding a therapeutic RNA or a polypeptide; expressing the therapeutic RNA or polypeptide in the nucleated cell; loading the therapeutic nucleic acid or polypeptide into naturally occurring vesicles derived from the nucleated cell; collecting the loaded naturally occurring vesicles; and administering the loaded naturally occurring vesicles to the subject, thereby delivering the therapeutic nucleic acid or polypeptide.

The invention also provides for a method of delivering a therapeutic nucleic acid or polypeptide to a cell or tissue, comprising: administering the vesicles to the cell or tissue, wherein the vesicles comprise a therapeutic nucleic acid or polypeptide, thereby delivering the therapeutic nucleic acid or polypeptide.

In one embodiment, the method further comprises a step of collecting the naturally occurring vesicles prior to the step of administering. The invention also comprises a method of delivering a therapeutic nucleic acid or polypeptide to a cell or tissue, comprising: transforming a nucleated cell with a nucleic acid encoding a therapeutic RNA or a polypeptide; expressing the therapeutic nucleic acid or polypeptide in the nucleated cell; loading the therapeutic nucleic acid or polypeptide into naturally occurring vesicles derived from the nucleated cell;

collecting the loaded naturally occurring vesicles; and administering the loaded naturally occurring vesicles to the cell or tissue, thereby delivering the therapeutic nucleic acid or polypeptide.

The invention also provides for a method of treating cardiovascular disease in a subject in need thereof, comprising: administering naturally occurring vesicles to the subject, wherein the naturally occurring vesicles are derived from a nucleated cell of the subject, or a nucleated cell of a second subject, wherein the nucleated cells of the second subject are non-immunogenic when administered to the subject, and wherein the vesicles comprise a therapeutic nucleic acid or polypeptide.

In one embodiment, the method further comprises a step of collecting the naturally occurring vesicles from the subject in need and/or the second subject prior to the step of administering.

The invention also provides for a method of treating cardiovascular disease in a subject in need thereof, comprising: transforming a nucleated cell with a nucleic acid encoding a therapeutic nucleic acid or a polypeptide; expressing the therapeutic nucleic acid or polypeptide in the nucleated cell; loading the therapeutic nucleic acid or polypeptide into naturally occurring vesicles derived from the nucleated cell; collecting the loaded naturally occurring vesicles; and administering the loaded naturally occurring vesicles to the subject.

In another embodiment, the naturally occurring vesicles are between about 100 and about 300 nm in diameter.

In another embodiment, the naturally occurring vesicles are between about 300 and about 500 nm in diameter.

(inducible NOS) , nNOS (neuronal NOS), Ι-κΒα, Ι-κΒβ, Ι-κΒγ, plOO, pl05, and Bcl- 3, cGMP-dependent protein kinase (PKG), c-Kit , p27Kipl, Sprouty-related protein SPREDl and phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2/p85-beta), Spl, CDK inhibitors (CDKIs), INK4 family proteins (pl4, pl5, pl6, pl8 and pl9), KIP/CIP family (p21, p27, and p57), p53, TOR/RAFT, PPtase, PIAS, SHP1, eNOS coactivators, tetrahydrobiopterin folic acid, and 1-arginine.

In another embodiment, the nucleated cell is derived from the subject to be treated with the vesicles.

In another embodiment, the composition is formulated as a coating for a medical device.

In another embodiment, the medical device is selected from the group consisting of: a stent, valve, catheter or balloon. In another embodiment, the vesicles are in combination with a container selected from the group consisting of: an intravenous bag, an intravenous bottle, a pump and a syringe.

In another embodiment, the subject in need thereof is identified.

In another embodiment, the vesicles are derived from the subject.

In another embodiment the delivery of the therapeutic nucleic acid or polypeptide is determined. Delivery of a therapeutic agent may be assessed by adding tracking agents, such as gold, gadolinium, and/or the like, to the exosomes to allow identification of the tissues that take up the exosomes with MRI. CVD and atherosclerosis progression may be assessed and monitored with techniques known in the art, for example, angiography, intravascular ultrasound, coronary CT, and cardiac MRI. The efficacy of the delivery of the therapeutic agent may be assessed by evaluating cardiovascular symptoms, and/or improvement in ischemia, for example, during a stress test.

In another embodiment, a method according to the invention, for example, as described in the section entitled "Methods for Identifying a Therapeutic Effect in a Patient" is used to determine that cardiovascular disease has been treated.

Definitions

Unless specifically stated or obvious from context, as used herein, the terms "a," "an," and "the" are understood to be singular or plural. Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.

Unless specifically stated or obvious from context, as used herein, the term "about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about."

By "agent" is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof. An "agent" includes a "therapeutic agent" as defined herein below. The term "administering," as used herein, refers to any mode of transferring, delivering, introducing, or transporting a naturally occurring and/or synthetic vesicle and/or hybrid vesicle and/or vesicle population of the invention to a subject. Such modes include, but are not limited to, oral, topical, intravenous, intraperitoneal, intramuscular, intradermal, intranasal, and subcutaneous administration. Preferably, administration is (1) intravenous, for example, wherein the vesicles are contained in an IV bag or (2) via a medical device, for example, a stent, valve, balloon or a catheter, wherein the medical device is in combination with, or coated with, a vesicle or vesicle population of the invention. In one embodiment, administration is via an implantable or non-implantable drug delivery device in combination with, or coated with, a vesicle or vesicle population of the invention. In another embodiment, administration is via an implantable or non-implantable time release delivery device which may comprise a delivery device coated with the vesicles of the invention. A delivery device coated with vesicles of the invention provides for delivery of the therapeutic nucleic acid or protein contained within the vesicle directly to a blood vessel, including an artery, vein or capillary, directly to an organ (for example the heart), tissue or a specific region of a tissue, or to a cell. For example, organs that may be targeted include the heart, arteries, arterioles, aorta, veins, venules, and capillaries. Similarly, cells that may be targeted include smooth muscle cells, endothelial cells, myocytes, fibroblasts, and macrophages. In another embodiment, administration is via an intravenous drip, wherein the vesicles of the invention are contained in an IV bag. An IV bag useful according to the invention includes but is not limited to, a bag comprising polypropylene film, polyvinyl alcohol, polyvinyl chloride (and plasticized formulations thereof, such as polyolefin, tri-(2- ethylhexyl)trimellitate (TEHTM), dioctyl phthalate (DEHP), and 1,2-Cyclohexane dicarboxylic acid (DINCH)), wherein the bag has dimensions known in the art. For example, IV bags may range from about 1 ml to about 1000 ml in size. Typical IV bag sizes range from about 100 ml to about 500 ml. The vesicles of the invention may also be packaged as a smaller aliquot to be diluted into an IV bag. Such an aliquot may range from about 1 ml to about 50 ml in size, for example, 1 ml, 5 ml, 10 ml, 15 ml, 20 ml, 25 ml, 30 ml, 35 ml, 40 ml, 45 ml or 50 ml in size. In another embodiment, administration of the vesicles of the invention is by coronary catheterization, during angiography, with direct application of the vesicle or exosome solution to the coronary arteries.

In another embodiment, administration of the vesicles of the invention is via injection.

Additional methods of administration are provided below in the section entitled "Dosage and Modes of Administration."

By "ameliorate" is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease. By "alteration" is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein. As used herein, an alteration includes a 10% or more change in expression levels or activity of a gene or polypeptide, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels or activity of a gene or polypeptide.

As used herein an "alteration" also includes a 2-fold or more change in expression levels or activity of a gene or polypeptide, for example, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 500-fold, 1000-fold or more.

By "analog" is meant a molecule that is not identical, but has analogous functional or structural features. For example, a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding. An analog may include an unnatural amino acid.

By "chemical agent" is meant any chemical compound. For example, a chemical agent may be a small molecule chemical compound that acts to modulate vasomotor tone, SMC contraction, and/or inflammation, thereby reducing the risk of cardiovascular disease. By "coating" is meant a gel or other adhesive matrix into which vesicles or exosomes of the invention are incorporated so they may be attached to a medical device. For example, vesicles or exosomes of the invention may be suspended in polyethylene glycol (PEG), which may be heated and dried to a desired thickness, and used to coat balloons and metal stents. The exosomes of the invention may also be suspended in a pluronic gel, which solidifies at body temperature, and dissolves thereafter, releasing the exosomes in a localized manner in vivo. Such a pluronic coating may be used to produce a temporary, dissolvable coating of a medical device. It is expected that about 100 to about 10,000 vesicle or exosome molecules per cell (for example, 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, or 10,000 vesicle or exosome molecules per cell), with about 100,000 to about 1,000,000 vesicle or exosome molecules per tissue target (for example, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000 or 1,000,000 vesicle or exosome molecules per tissue target) would reduce intimal hyperplasia by about 50-90% over two weeks after vessel injury. By "collecting" is meant the process of separating naturally occurring and/or synthetic vesicles from the cells, or media, from which they were produced.

Collecting is performed as described herein below in the section entitled "Isolation of Exosomes."

In one embodiment, "collecting" vesicles according to the invention includes a step of purifying vesicles of the invention. A used herein, a "pure" population means >90% of the vesicles are exosomes, for example 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the vesicles are exosomes.

In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean "includes," "including," and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited are not changed by the presence of more than that which is recited, but excludes prior art embodiments. By "delivering" is meant delivery of a therapeutic agent, nucleic acid, or protein to a subject in need of treatment. For example, a therapeutic agent of the invention may be delivered to a vein, artery, capillary, heart, or tissue of a subject, as well as to a specific population, or sub-population, of cells. Delivery of a therapeutic agent may be assessed by adding tracking agents, such as gold, gadolinium, and/or the like, to the exosomes to allow identification of the tissues that take up the exosomes with MRI. CVD and atherosclerosis progression may be assessed and monitored with techniques known in the art, for example, angiography, intravascular ultrasound, coronary CT, and cardiac MRI. The efficacy of the delivery of the therapeutic agent may be assessed by evaluating cardiovascular symptoms, and/or improvement in ischemia, for example, during a stress test.

The term "derived from," unless otherwise clear from the context, refers to a vesicle that is produced within, by, or from, a specified cell, cell type, population of cells, or tissue. A cell population may be homogeneous or heterogeneous.

The term "derived in part from," unless otherwise clear from the context, refers to a vesicle that is produced from more than one cell, cell type, or population of cells such that the vesicle contains components from at least two different sources. "Detect" refers to identifying the presence, absence or amount of an analyte to be detected, for example, a vesicle, therapeutic nucleic acid, therapeutic polypeptide or therapeutic agent of the invention. For example, vesicles of the invention may be detected by their protein content, or by the makeup of the proteins contained within the vesicle. In one embodiment, CD63 is a preferred marker of protein content of a vesicle or exosome of the invention. In another embodiment, vesicles of the invention may be detected by the miRNA signature of the RNA contained within the vesicle, for example in an exosome (e.g. , exosomes contain a different miRNA signature than their cell of origin). In another embodiment, vesicles of the invention may be detected by assessing the type of RNA that they contain (e.g. , exosomes lack ribosomal RNA).

By "detectable label" is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical,

biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens. By "disease" is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include, but are not limited to heart disease, including: atherosclerosis, coronary heart disease, cardiomyopathy, cardiovascular disease, endothelial dysfunction (e.g. , sepsis), hypertension, ischemic heart disease, heart failure, hypertensive heart disease, inflammatory heart disease, and valvular heart disease.

"Disease," "disorder," and "condition" are commonly recognized in the art and designate the presence of signs and/or symptoms in an individual or patient that are generally recognized as abnormal and/or undesirable. Diseases or conditions may be diagnosed and categorized based on pathological changes.

As used herein, heart disease is treated or cured if at least one symptom of heart disease, including but not limited to including but not limited to, imaging with angiography, nuclear stress test, echocardiography, IVUS, and/or PET or SPECT stress test, symptoms of dyspnea, angina, exercise intolerance, calf pain, paroxysmal nocturnal dyspnea, orthopnea, pulse and pressure improve or disappear, as assessed by techniques known in the art,

By "effective amount" or "therapeutically effective amount" is meant the amount of vesicles or a population of vesicles, and/or the amount of a therapeutic nucleic acid, protein or agent, required to ameliorate the symptoms of a disease, for example, heart disease or CVD, relative to an untreated patient. By "effective amount" or "therapeutically effective amount" is also meant the amount of vesicles or a population of vesicles, and/or the amount of a therapeutic nucleic acid, protein or agent, required to induce a therapeutic or prophylactic effect for use in therapy to treat a disease according to the invention, for example, heart disease. The effective amount of active compound(s), for example, vesicles of the invention, used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount. As used herein, the term "endogenous" refers to originating from the inside.

For example, a cell contains an endogenous miRNA if that miRNA is produced within the cell. As used herein, the term "exogenous" refers to originating from the outside. For example, a polypeptide is exogenous to a cell if it is produced by a different cell, or by an in vitro method {e.g. peptide synthesis).

By "expressing" is meant the transcription or translation of a nucleic acid. By "fragment" is meant a portion of a polypeptide or nucleic acid molecule.

This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids. By "fusion vesicle" or "hybrid vesicle" is meant a vesicle that contains material (such as, e.g., lipids, nucleic acids, polypeptides, chemical agents, and the like) from at least two different sources. For example, a fusion vesicle may be a vesicle that results from the combination of a naturally occurring vesicle and a synthetic vesicle. Such a fusion vesicle may contain lipid membrane derived from each of the progenitor vesicles, as well as a mixture of the contents of the respective progenitor vesicles. Unincorporated vesicles may be separated away from the population of vesicles by techniques known in the art, for example, differential ultracentrifugation or sucrose gradient centrifugation. For example, lipofectamine RNAimax may be separated from the total population by centrifugation at about 80,000 g, whereas the exosomes may be separated from the total population by centrifugation at between about 80,000 g to about 110,000 g. Vesicles may be separated from the total population by centrifugation at between about 80,000 g to about 110,000 g, indicating that they remain close to the size of the original exosomes, but have fused long enough with the synthetic vesicles to allow content transfer. In one embodiment, at least 10% of the fusion vesicles will be from the synthetic lipid source.

By "heart disease" is meant related diseases, including, but not limited to: coronary heart disease, cardiomyopathy, cardiovascular disease, ischemic heart disease, heart failure, hypertensive heart disease, inflammatory heart disease, and valvular heart disease.

Heart disease is a systemic disease that can affect the heart, brain, most major organs, and the extremities. By "cardiovascular disease" is meant any of a number of specific diseases that affect the heart itself and/or the blood vessel system, especially the myocardial tissue, as well as veins and arteries leading to and from the heart. For example, CVD may include, but is not limited to, acute coronary syndromes, arrhythmia, atherosclerosis, heart failure, myocardial infarction, neointimal hyperplasia, pulmonary hypertension, stroke, and/or valvular disease. CVD may be diagnosed by any of a variety of methods known in the art. For example, such methods may include assessing a subject for dyspnea, orthopnea, paroxysmal nocturnal dyspnea, claudication, angina, chest pain, which may present as any of a number of symptoms known in the art, such as exercise intolerance, edema, palpitations, faintness, loss of consciousness, syncope, pre-syncope, and/or cough.

"Hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. By "inhibitory nucleic acid" is meant a double- stranded RNA, siRNA, shRNA, or antisense RNA, or a portion thereof, or a mimetic thereof, that when administered to a mammalian cell results in a decrease (e.g. , by 10%, 25%, 50%, 75%, or even 90-100%) in the expression of a target gene. Typically, a nucleic acid inhibitor comprises at least a portion of a target nucleic acid molecule, or an ortholog thereof, or comprises at least a portion of the complementary strand of a target nucleic acid molecule. For example, an inhibitory nucleic acid molecule comprises at least a portion of any or all of the nucleic acids delineated herein.

By "isolated polynucleotide" is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence. By an "isolated polypeptide" is meant a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.

Preferably, the preparation is a polypeptide of the invention that is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight free from the proteins and naturally occurring organic molecules with which it is naturally associated. An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.

By "loading" is meant the process of incorporating a therapeutic agent, nucleic acid, and/or polypeptide into a naturally occurring and/or synthetic vesicle. In one embodiment, source cells, from which the vesicles are derived, are transfected transiently or stably so as to overexpress particular biomolecules, which are subsequently well expressed in the exosomes.

By "marker" is meant any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder. By "medical device" is meant a product that is used for a medical purpose, or purposes, in a patient, such as diagnosis, surgical intervention, and/or therapy. For example, a medical device could include a stent, a valve, a balloon, a catheter, for example a catheter for insertion in the heart, artery, vein or radial artery, a patch an artificial heart, and the like. By "microRNA (miRNA) is meant an RNA on the order of about 18-25 nucleotides, preferably, 20-25, nucleotides, and for example 20, 21, 22, 23, 24 or 25 nucleotides, that regulates numerous critical cellular processes by post-translational regulation of gene expression.

By "naturally occurring vesicle" is meant a vesicle that is produced within, and released by, a specified cell, cell type, population of cells, or tissue. It is contemplated that a cell population may be homogeneous or heterogeneous. By "non-immunogenic" is meant something that does not produce a reaction from an immune system. A reaction from an immune system means a response from either the innate immune system, or more typically the humoral immune system. A reaction from an immune system is detected by methods known in the art, for example, immune response assays. For example, an immune response assay may identify, characterize, and/or quantify the T-cell response in a subject.

By "nucleated cell" is meant a cell having a nucleus.

As used herein, "obtaining" as in "obtaining an agent" includes synthesizing, purchasing, or otherwise acquiring the agent. As used herein, "over-express," "over-expresses," "over-expressed," and the like, refer to levels of transcription or translation that produce RNA or polypeptide at any level higher than is normally present in a specified cell, cell type, population of cells, or tissue. However, it is to be understood that an assessment of the use of the terms "over-express," "over-expresses," "over-expressed," and the like, does not require a quantitative understanding of the RNA or polypeptide levels normally present in the cell. For the purposes of this disclosure, a RNA or polypeptide is considered to be "over-expressed" if its transcription or translation is induced from an appropriate expression vector.

By "population of vesicles" is meant a group or collection of vesicles, which may be naturally occurring vesicles, synthetic vesicles, fusion vesicles, or any combination thereof. As used herein, a "population of vesicles" means one or more vesicles.

"Primer set" means a set of oligonucleotides that may be used, for example, for PCR. A primer set would consist of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 80, 100, 200, 250, 300, 400, 500, 600, or more primers.

Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

By "reduces" is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%. By "reference" is meant a standard or control condition.

A "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of the reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides or any integer thereabout or there between.

By "siRNA" is meant a double stranded RNA. Optimally, an siRNA is 18, 19, 20, 21, 22, 23 or 24 nucleotides in length and has a 2 base overhang at its 3' end. These dsRNAs can be introduced to an individual cell or to a whole animal; for example, they may be introduced systemically via the bloodstream. Such siRNAs are used to down regulate mRNA levels or promoter activity.

By "small or short hairpin RNA" (shRNA) is meant a sequence of RNA that forms a tight hairpin turn with a stem on the order of, for example, 20-30 base pairs, that can silence gene expression via RNA interference.

By "specifically binds" is meant a compound, protein, nucleic acid, or antibody that recognizes and binds a polypeptide of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample, which naturally includes a polypeptide of the invention. By "specifically binds" is also meant a compound, protein or nucleic acid that recognizes and binds a nucleic acid of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample, which naturally includes a nucleic acid of the invention.

Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double- stranded nucleic acid molecule.

Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double- stranded nucleic acid molecule. By "hybridize" is meant pair to form a double- stranded molecule between complementary

polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).

For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g. , formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include

temperatures of at least about 30°C, more preferably of at least about 37°C, and most preferably of at least about 42°C. Varying additional parameters, such as

hybridization time, the concentration of detergent, e.g. , sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30°C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred

embodiment, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42°C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μ^πύ ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art. For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25°C, more preferably of at least about 42°C, and even more preferably of at least about 68°C. In a preferred embodiment, wash steps will occur at 25°C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et ah, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid level to the sequence used for comparison.

Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative

substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e^"3 and e^"100 indicating a closely related sequence.

A "subject" according to some embodiments is an individual whose signs and symptoms, physical exams findings and/or psychological exam findings are to be determined and recorded in conjunction with the individual's condition (i.e., disease or disorder status) and/or response to a candidate drug or treatment.

"Subject," as used herein, is preferably, but not necessarily limited to, a human subject. The subject is male or female, and may be of any race or ethnicity, including, but not limited to, Caucasian, African- American, African, Asian, Hispanic, Indian, etc. Subject as used herein may also include an animal, particularly a mammal such as a canine, feline, bovine, caprine, equine, ovine, porcine, rodent (e.g., a rat and mouse), a lagomorph, a primate (including non-human primate), etc., that may be treated in accordance with the methods of the present invention or screened for veterinary medicine or pharmaceutical drug development purposes. A subject according to some embodiments of the present invention includes a patient, human or otherwise, in need of therapeutic treatment for a disease according to the invention, for example, heart disease.

As used herein, "control subject" means a subject that has not been diagnosed with a disease according to the invention, for example heart disease or CVD, and/or does not exhibit any detectable symptoms associated with this disease. A "control subject" also means a subject that is not at risk of developing a disease, for example heart disease or CVD, as defined herein.

A subject that is "diagnosed with heart disease" or "CVD" presents with one or more symptoms of heart disease or CVD known to one of skill in the art as assessed by physical exam, murmur, carotid ultrasound, echocardiography, CT, MRI, stress test ECG, nuclear stress test, stress test with echocardiography, and/or angiography. The term "symptoms" as it refers to heart disease means, for example, exercise intolerance, edema, palpitations, faintness, loss of consciousness, syncope, pre- syncope, and/or cough. As used herein, heart disease is treated or cured if, for example, a patient displays angiographic resolution of the atherosclerotic plaque burden as seen by angiography or IVUS, or improvement of exercise tolerance as observed by a stress test.

By "synthetic vesicle" is meant a vesicle or vesicles that is produced in vitro, for example, as described herein below in the section entitled "Hybrid and Synthetic Vesicles." By "therapeutic agent" is meant a substance that has the potential of affecting the function of an organism. Such a compound may be, for example, a naturally occurring, semi- synthetic, or synthetic agent. For example, an agent may be a drug that targets a specific function of an organism, or an antibiotic. A therapeutic agent may decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of disease, disorder, or cell growth in a eukaryotic host organism.

By "therapeutic nucleotide" is meant a nucleotide that has the potential to affect the function of an organism, and may be, for example, a naturally occurring nucleotide, a synthetic nucleotide, a recombinant nucleotide, an epigenetically modified nucleotide, or a nucleotide fragment of any of the foregoing. In one embodiment, a therapeutic nucleotide may function to suppress the cell growth of a specific cell type, such as smooth muscle cells (SMCs), to inhibit cardiovascular disease, for example by suppressing neointimal hyperplasia.

By "therapeutic polypeptide" is meant a polypeptide that has the potential to affect the function of an organism, and may be, for example, a naturally occurring polypeptide, a synthetic polypeptide, a recombinant polypeptide, a post-translationally modified polypeptide, or a polypeptide fragment of any of the foregoing. Therapeutic polypeptides of the invention may include, but are not limited to, RGS2, nitric oxide synthase (such as, e.g., , endothelial NOS (eNOS), inducible NOS ( iNOS), neuronal NOS ( nNOS)), Ι-κΒα, Ι-κΒβ, Ι-κΒγ, plOO, pl05, and Bcl-3, cGMP-dependent protein kinase (PKG), c-Kit and p27Kipl, Sprouty-related protein SPRED1 and

phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2/p85-beta), Spl, CDK inhibitors (CDKIs), INK4 family proteins (pl4, pl5, pl6, pl8 and pl9), KIP/CIP family (p21, p27, and p57), p53, TOR/RAFT, PPtase, PIAS, SHP1, eNOS

coactivators (such as, e.g. , tetrahydrobiopterin and folic acid), and 1-arginine.

Therapeutic polypeptides of the invention may function to inhibit pathologic cell growth in neointimal hyperplasia, to inhibit SMC contraction and proliferation, to inhibit hypertension, atherosclerosis, and to inhibit heart failure.

By "transforming a nucleated cell" is meant the process of genetically altering a nucleated cell to incorporate, and optionally to express, exogenous genetic material. As used herein, the term "transforming" is interchangeable with the term

"transfection" as it is commonly used with respect to the incorporation of exogenous vectors in eukaryotic cells.

By "transgenic construct" is meant exogenous genetic material that is capable of being incorporated into a prokaryotic or eukaryotic cell. Such incorporation may be transient or stable (i.e. replicated and maintained through mitotic divisions of the host cell). In one embodiment, a "transgenic construct" may be an expression vector that contains a gene of interest under the control of an inducible promoter.

As used herein, the terms "treat," "treated," "treating," "treatment," and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated.

A subject is said to be treated for a disease, for example, heart disease or CVD, if following administration of the vesicles of the invention, one or more symptoms of heart disease or CVD is decreased or eliminated.

By "vesicle" is meant any spherical or semi- spherical molecule that comprises a lipid membrane, and is capable of fusing with other cells and other lipid membranes. The membrane may include proteins and cholesterols, which assist with cell fusion. The vesicle may contain substances such as nucleic acids, proteins, and chemicals.

Vesicles of the invention, for example naturally occurring vesicles, can be broadly divided into three types: exosomes (about 10 nm to about 100 nm in diameter), microvesicles (about 100 nm to about 300 nm in diameter), and apoptotic bodies (about 300 nm to about 500 nm in diameter). These small vesicles contain biologically active molecules, including miRNAs, nucleic acids, and protein, and have the ability to transfer these small molecules to another cell thereby influencing mRNA and protein expression.

"Exosomes" as used herein, means small membrane vesicles that are released into the extracellular environment following fusion of multivesicular bodies with the plasma membrane. Exosomes typically range in size from about 10 nm to about 100 nm in diameter, and are constitutively released from the cell in at least some form.

As used herein a "vesicle formulation" means a formulation comprising a vesicle or population of vesicles according to the invention, in combination with a suitable agent. A "vesicle formulation" also refers to a "compound" or "vesicle compound" present in, for example, PBS, normal saline, DMSO, and/or ethanol. A vesicle formulation for intravenous delivery, for example by delivery from an IV bag, comprises a vesicle or population of vesicles in combination with PBS and/or normal saline. A vesicle formulation for intravenous delivery, for example, by injection, comprises a vesicle or population of vesicles in combination with PBS and/or normal saline. A vesicle formulation for delivery via a medical device, for example a stent, valve, balloon or catheter comprises a vesicle or population of vesicles in combination with a formulated as a coating for a medical device as defined herein.

As used herein, the term "pharmaceutically acceptable salt" refers to those salts of the compounds formed by the process of the present invention which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). The salts can be prepared in situ during the final isolation and purification of the compounds of the invention, or separately by reacting the free base function with a suitable organic acid. Examples of pharmaceutically acceptable include, but are not limited to, nontoxic acid addition salts, that is salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate,

methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p- toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. As used herein, the term "pharmaceutically acceptable ester" refers to esters of the compounds formed by the process of the present invention which hydrolyze in vivo and include those that break down readily in the human body to leave the parent compound or a salt thereof. Suitable ester groups include, for example, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkanoic, alkenoic, cycloalkanoic and alkanedioic acids, in which each alkyl or alkenyl moiety advantageously has not more than 6 carbon atoms. Examples of particular esters include, but are not limited to, formates, acetates, propionates, butyrates, acrylates and ethylsuccinates.

The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein. BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A through 1H show microscopic images of endothelial cells treated with vesicles of the invention. Figure 1A shows human aortic smooth muscle cells treated with exosomes from endothelial cells stably expressing exosome marker CD63-GFP and imaged by confocal microscopy with DIC and FITC images merged, revealing GFP positivity throughout the cytoplasm. Figure IB shows untreated human aortic smooth muscle cells imaged in parallel to the treated cells of Figure 1 A. Figures 1C, ID, and IE depict human aortic smooth muscle cells treated with exosomes from endothelial cells stably expressing exosome marker CD63-GFP that were imaged by immunocytochemistry to smooth muscle actin ( SMA) with Cy3 labeled antibody (Figure 1C) and with FITC filter (Figure ID) to image transferred GFP labeled exosomes in cytoplasm. Figure IE shows the merged image of Figures 1C and ID. Figure IF shows a confocal microscopic image of co-cultured endothelial cells stably expressing the exosome marker CD63-GFP and human aortic smooth muscle cells, imaged with immunocytochemistry to SMS (smooth muscle actin) with Cy3 labeled antibody to identify the smooth muscle cells, and with FITC filter to identify endothelial cells and transferred GFP-tagged exosomes. Yellow signal indicates co-localization of SMA and transferred GFP tag to a smooth muscle cell. Blue signal indicates DAPI stained nuclei. Figure 1G shows a confocal microscopic image of human aortic smooth muscle cells treated with exosomes from endothelial cells stably expressing exosome marker Flag-CD63-GFP, imaged by

immunocytochemistry to the Flag tag with Cy3 labeled antibody. Blue signal indicates DAPI stained nuclei. Untreated smooth muscle cells (H) have no background with immunocytochemistry (ICC) to flag. Figures 2A, 2B, and 2C depict a bar graph and two confocal microscopy images, respectively. Figure 2A shows the increase in miR levels of transfected ECs, exosomes derived from the transfected ECs, and SMCs treated with exosomes derived from the transfected ECs . Human endothelial cells were transfected with pre-miR 203 or negative control pre-miR. Figure 2B shows confocal microscopy images of human endothelial cells transfected with Alexa-fluor 555 RNAi. Images are grayscale representation of merged DAPI stained nuclei and red fluorescent RNA, and demonstrate fluorescent RNA in the SMC cytoplasm. Figure 2C shows confocal microscopy images of EC derived exosomes incubated with Alexa-fluor 555 RNAi at 40μΜ for 4 hours, centrifuged at 110,000g to remove unincorporated RNAi, and plated on human aortic smooth muscle cells for 24 hrs. The cells are imaged by fluorescence to confirm uptake by exosomes and transfer to SMCs. Images are grayscale representations of merged DAPI stained nuclei and red fluorescent RNA, and demonstrate fluorescent RNA in the SMC cytoplasm.

Figures 3A and 3B show a graph and a table, respectively. Figure 3A depicts a cell proliferation assay for muscle cells treated with either DME or exosomes.

Figure 3B summarizes the results of a Tunel assay, and shows that DME and exosome treated SMCs display no difference in the rate of apoptosis. Figures 4A, 4B, and 4C show two Bioanalyzer output graphs and a gel, and two Bioanalyzer graphs, and a line graph, respectively. In Figure 4A, RNA from whole endothelial cells or from exosomes is analyzed on a Agilent Bioanalyzer Pico chip. Figure 4B shows the results of the analysis of EC derived exosome RNA with an Agilent Bioanalyzer Small RNA chip. Figure 4C shows the results of the analysis of EC or EC-derived exosome miRNA content by ABI miRNA array of 377 miRNAs. miRNAs are normalized to U6 in either the cell or exosomal compartment and are organized by increasing amount in cell.

Figure 5 shows a bar graph depicting the results of cell growth assays.

Human aortic smooth muscle cells were transfected with either i) negative control RNAi at 20μΜ, ii) RNA derived from EC exosomes using the Qiagen miRNAeasy kit at 20μΜ, or iii) RNA derived from EC exosomes using the Invitrogen PureLink miRNA isolation kit at 20μΜ. Wells are further treated with either whole exosomes from ECs, or with conditioned media supernatant. Cell proliferation was assessed using the Promega CellGlo assay. Figures 6A and 6B show a bar graph and a ven diagram, respectively. In

Figure 6A, human endothelial cells stably cloned with Estrogen Receptor Alpha (ERa) are treated with Estradiol (E2) or vehicle (EtOH) daily, and exosomes are collected from the conditioned media. Exosomes are resuspended in conditioned media supernatant, and either the suspension or the supernatant are plated on human aortic smooth muscle cells. Cell proliferation is evaluated with the Promega CellGlo luminescence assay. Figure 6B shows results of the analysis of endothelial cell and EC derived exosome miRNA content by ABI miRNA array of 377 miRNAs, and their content after exposure to E2 or EtOH.

DETAILED DESCRIPTION OF THE INVENTION

The invention features compositions and methods that are useful for treatment and prevention of heart disease including, but not limited to, coronary heart disease, cardiomyopathy, cardiovascular disease, ischemic heart disease, heart failure, hypertensive heart disease, inflammatory heart disease, and valvular heart disease.

The invention is based, at least in part, on the discovery that vesicles of the invention may be derived from normal cell lines, immortalized cell lines, serum, and tissues, and that such vesicles may be loaded with endogenously produced therapeutic agents, such as, but not limited to, chemical agents, nucleotides, and polypeptides.

Vesicles

Naturally Occurring Vesicles Naturally occurring vesicles of the invention range in size from about 30 nm to about 500nm, and can be broadly divided into three types: exosomes (about 10 nm to about 100 nm in diameter), microvesicles (about 100 nm to about 300 nm in diameter), and apoptotic bodies (about 300 nm to about 500 nm in diameter). These small vesicles contain biologically active molecules, including miRNAs, nucleic acids, and protein, and have the ability to transfer these small molecules to another cell thereby influencing mRNA and protein expression. In one embodiment, naturally occurring vesicles are used to treat and prevent cardiovascular disease using endogenous miRNA, nucleic acids, and polypeptides produced in vivo by the cells from which the vesicles are derived. In another embodiment, naturally occurring vesicles are collected and loaded with exogenously produced therapeutic agents, nucleic acids, and/or polypeptides.

Exosomes are small membrane vesicles that are released into the extracellular environment following fusion of multivesicular bodies with the plasma membrane. Exosomes typically range in size from about 10 nm to about 100 nm in diameter, and are constitutively released from the cell in at least some form. Their surface consists of a lipid bilayer derived from the cell membrane of the donor cell, which may contain membrane proteins from the donor cell. Additionally, exosomes also contain cytosol from the donor. In this regard, exosomes typically exhibit different compositions and possess different functions depending on the cell type from which they are derived. There do not appear to be any "exosome-specific" proteins;

however many exosomes are enriched in certain biomolecules, including: miRNAs, major histocompatibility complex I and II (MHC I and II), tetraspanins, a number of heat shock proteins, actin, tubulins, proteins involved in intracellular membrane fusion, signal transduction proteins, and cytosolic enzymes. Exosomes are produced by many cells including, but not limited to, epithelial cells, B and T lymphocytes, mast cells (MC) as well as dendritic cells (DC), endothelial cells, smooth muscle cells, macrophages, and fibroblasts.

Microvesicles and apoptotic bodies are larger than exosomes, and typically range from about 100 nm to about 300 nm and 300 nm to 500 nm in size,

respectively.

Apoptotic bodies are released upon initiation of a cell death signaling cascade. Naturally occurring vesicles of the invention can fuse with specific target cells, and thereby target miRNAs, nucleic acids, and polypeptides to a specific cell, cell type, or tissue. In another embodiment, naturally occurring vesicles may transfer genetic material into a specific target cell or cells, which will facilitate translation of specific protein or proteins in the target cells. It is also contemplated within the scope of the invention that naturally occurring vesicles may deliver transgenes to a specific cell type to create transgenic cells, tissues, or organs for gene therapy.

Naturally occurring vesicles of the invention can be highly modified for a desired therapeutic purpose. For example, overexpression or knock-down of specific biological molecules (e.g. miRNAs, mRNAs, proteins, etc.) in the donor cells allows naturally occurring vesicles to be modified to contain a specific set of biological molecules, which may then be targeted to specific recipient cells. Such naturally occurring vesicles may be collected from cultured cells, living tissues, explanted tissues, or from patient serum as described below. The vesicles may be delivered intravenously, intramuscularly, or in a site-directed manner. The vesicles may also be bound to a medical device (e.g. a vascular stent) to allow for targeted elution and site directed therapy at surrounding cardiovascular cells. The vesicles may be bound to the medical device by being incorporated into a coating polymer or through binding of a vesicular protein to the device. It is contemplated within the scope of the invention that such a vesicular protein can be endogenously produced by the cell from which the natural vesicle is derived, thereby incorporating it into the vesicle during vesicular formation. Alternatively, such a vesicular protein may be exogenously expressed, and subsequently loaded into the naturally occurring vesicles.

Naturally occurring vesicles of the invention may be isolated from, for example, normal cell lines, immortalized cell lines, serum, and tissue. In one embodiment, exosomes may be isolated from the conditioned media of a desired cell line, and/or a primary cell line from a subject, by any of a variety of isolation methods (e.g. centrifugation). Exemplary isolation methods are described in the Examples below.

Hybrid and Synthetic Vesicles

Naturally occurring vesicles of the invention may also be combined with synthetic vesicles (e.g. lipid vesicles) to create hybrid vesicles that contain a portion of the naturally occurring vesicle and a portion of the synthetic vesicle. For example, a solution of naturally occurring vesicles (e.g. exosomes) and lipid vesicles may be incubated at room temperature for a period of time, including but not limited to 15 minutes, 30 minutes, 1 hour, 2 hours, 5 hours or more, resulting in fusion of some portion of the two vesicle populations into a sub-population of hybrid vesicles.

Hybrid vesicles are particularly useful for combination therapies that require co- delivery of, for example, an endogenously produced miRNA and a therapeutic agent that is refractory to loading into naturally occurring vesicles, but is easily incorporated into a synthetic vesicle such as a lipid vesicle.

The population of hybrid vesicles may be isolated by a variety of methods known to one of skill in the art. For example, depending on the size of the synthetic vesicle used, unincorporated synthetic vesicles may be removed by differential ultracentrifugation. Such isolation methods are described in the Examples below.

Methods of making and loading synthetic vesicles are known in the art. For example, U.S. Patent number 4,192,869, which is hereby incorporated by reference in its entirety for the purpose of written description and enablement, describes a method for creating synthetic lipid vesicles loaded with inosital hexaphosphate (IHP). For example, IHP was dissolved, for example, between room temperature and 50°C in an isotonic bis-Tris buffer (0.10 molar bis-Tris, 0.154 molar NaCl) pH=7.4 up to saturation (0.19 M). A lipid mixture consisting of phosphatidylcholine

(PC):phosphatidylserine (PS):cholesterol (Ch) in the molar ratios 8:2:7 was suspended in this solution and sonicated 45 min under nitrogen at about 50°C. The temperature range for vehicle preparation is limited only by the freezing point of the buffer and by the thermal stability of the polyphosphate. The sonication was performed with an ultrasonic disintegrator (Scholler, Type 125, Frankfurt) with a titan dip-probe (10 kHz). Sonication can be effectively performed at energies preferably above 100 W/cm 2. After sonication, the vesicle suspension was centrifuged for 1 hour at 100,000 g at 25°C in an ultracentrifuge (Beckmann, Typ L5-65, Rotor 60). The supernatant contains the small lipid vesicles, with a diameter of <500 A. When the vesicles are formed, they include the solution in which the lipids are suspended, thereby incorporating IHP into the vesicles. Other methods for producing synthetic vesicles are known to one of skill in the art (see, e.g. U.S. Patent Application No's

2003/0118636; 2008/0318325; and 20090186074 and U.S. Patent No's 4,192,869;

4,397,846; and 4,911,928, which are all hereby incorporated by reference). In another example, the steps of preparing the vesicles and loading the vesicles may be separate. For example, pre-formed lipid synthetic vesicles may be optimized for loading by placing them in low serum media at room temperature for 30 minutes, in the presence of about 1 to about 100 nM of a desired nucleotide.

Vesicle Targeting

Vesicles of the invention are targeted to specific cells by the specific proteins contained within the lipid membrane of the exosome, which interact with the target cell and facilitate endocytosis of the exosome. Without being bound by any particular theory, the target cell specificity of naturally occurring vesicles (or hybrid vesicles) of the invention is believed to depend on the cell type from which the exosomes are produced. For example, exosomes produced from endothelial cells are readily taken up by SMCs. Many cell types may take up a particular exosome, however, the miPvNA content of the exosome may affect different target cell types differently. For example, a particular miRNA may have a potent effect on SMCs because SMCs contain the binding partner mRNAs of the miRNA of the SMC, but that same miRNA may not have an effect in a fibroblast or endothelial cell because those cell types lack the target binding partner mRNA. The specific miRNAs in the exosomes, both singly and in combination, will target mRNAs in the target cells. For example, exosomes derived from ECs naturally inhibit SMCs; however, when the miRNA signature of the exosomes is changed, the potency of this inhibition changes. Additionally, exosomes specific for a certain cell type may be loaded with specific miRNAs, thereby allowing a specific pathologic molecular pathway in the target cell to be targeted.

Therapeutic Polypeptides

If desired, nucleic acid molecules that encode therapeutic polypeptides are delivered to stem cells, such as bone marrow-derived stem cells, hematopoietic stem cells, their precursors, or progenitors. Such cell types are of special interest in the treatment of heart disease because bone marrow has been shown to contain cell types capable of regenerating cardiac myocytes when injected into infarcted myocardium (see, e.g. Orlic et al. Bone marrow cells regenerate infarcted myocardium. Nature. 410:701-705; 2001). In other approaches, nucleic acid molecules are delivered to cells of a tissue (including but not limited to heart tissue, arterial tissue, liver tissue, etc.). The nucleic acid molecules must be delivered to the cells of a subject in a form in which they can be taken up so that therapeutically effective levels of the therapeutic polypeptide (including but not limited to a cardiocyte growth factor, such as TGF-βΙ and FGF; stem cell recruiting factor, such as SDF-1 ; a hepatocyte growth factor; etc.), or fragment thereof, can be produced. Such therapeutic polypeptides may include, but are not limited to, RGS2, nitric oxide synthase (such as, e.g. , , endothelial NOS

(eNOS), inducible NOS ( iNOS), neuronal NOS ( nNOS)), Ι-κΒα, Ι-κΒβ, Ι-κΒγ, plOO, pl05, and Bcl-3, cGMP-dependent protein kinase (PKG), c-Kit and p27Kipl, Sprouty-related protein SPRED1 and phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2/p85-beta), Spl, CDK inhibitors (CDKIs), INK4 family proteins (pl4, pl5, pl6, pl8 and pl9), KIP/CIP family (p21, p27, and p57), p53, TOR/RAFT, PPtase, PIAS, SHP1, eNOS coactivators (such as, e.g., tetrahydrobiopterin and folic acid), and 1-arginine.

A variety of expression systems exist for the production of therapeutic polypeptides. Expression vectors useful for producing such polypeptides include, without limitation, chromosomal, episomal, and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculo viruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof.

One particular bacterial expression system for polypeptide production is the E. coli pET expression system (e.g., pET-28) (Novagen, Inc., Madison, Wis). According to this expression system, DNA encoding a polypeptide is inserted into a pET vector in an orientation designed to allow expression. Since the gene encoding such a polypeptide is under the control of the T7 regulatory signals, expression of the polypeptide is achieved by inducing the expression of T7 RNA polymerase in the host cell. This is typically achieved using host strains that express T7 RNA polymerase in response to IPTG induction. Once produced, recombinant polypeptide is then isolated according to standard methods known in the art, for example, those described herein.

Another bacterial expression system for polypeptide production is the pGEX expression system (Pharmacia). This system employs a GST gene fusion system that is designed for high-level expression of genes or gene fragments as fusion proteins with rapid purification and recovery of functional gene products. The protein of interest is fused to the carboxyl terminus of the glutathione S-transferase protein from Schistosoma japonicum and is readily purified from bacterial lysates by affinity chromatography using Glutathione Sepharose 4B. Fusion proteins can be recovered under mild conditions by elution with glutathione. Cleavage of the glutathione S- transferase domain from the fusion protein is facilitated by the presence of recognition sites for site-specific proteases upstream of this domain. For example, proteins expressed in pGEX-2T plasmids may be cleaved with thrombin; those expressed in pGEX-3X may be cleaved with factor Xa.

Once the recombinant polypeptide of the invention is expressed, it is isolated, for example, using affinity chromatography. In one example, an antibody (e.g., produced as described herein) raised against a polypeptide of the invention may be attached to a column and used to isolate the recombinant polypeptide. Lysis and fractionation of polypeptide-harboring cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al., supra). Alternatively, the polypeptide is isolated using a sequence tag, such as a hexahistidine tag, that binds to a nickel column. Once isolated, the recombinant protein can, if desired, be further purified, e.g. , by high performance liquid chromatography (see, e.g. , Fisher, Laboratory Techniques In Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980). Polypeptides of the invention, particularly short peptide fragments, can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed., 1984 The Pierce Chemical Co., Rockford, 111.). These general techniques of polypeptide expression and purification can also be used to produce and isolate useful peptide fragments or analogs (described herein).

Transducing viral (e.g. , retroviral, adenoviral, and adeno-associated viral) vectors can be used for somatic cell gene therapy, especially because of their high efficiency of infection and stable integration and expression (see, e.g. , Cayouette et al., Human Gene Therapy 8:423-430, 1997; Bloomer et al., Journal of Virology 71 :6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. U.S.A. 94: 10319, 1997). For example, a polynucleotide encoding a stem cell recruiting factor, variant, or a fragment thereof, can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a tissue or cell of interest. Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus (also see, for example, the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244: 1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1 :55-61, 1990; Sharp, The Lancet 337: 1277- 1278, 1991 ; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311- 322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991 ; Miller et al., Biotechnology 7:980-990, 1989; Le Gal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346). Most preferably, a viral vector is used to administer a therapeutic polynucleotide in heart, vascular tissue, bone marrow, pancreas, liver, or another tissue or organ of interest.

Non-viral approaches can also be employed for the introduction of a therapeutic agent to a cell of a subject (e.g., a cell or tissue). For example, a nucleic acid molecule can be introduced into a cell by administering the nucleic acid in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci.

298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by micro-injection under surgical conditions (Wolff et al., Science 247:1465, 1990). Preferably the nucleic acids are administered in combination with a liposome and protamine.

Gene transfer can also be achieved using non- viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell. Transplantation of normal genes into the affected tissues of a subject can also be accomplished by transferring a normal nucleic acid into a cultivatable cell type ex vivo (e.g., an autologous or heterologous primary cell or progeny thereof), after which the cell (or its descendants) are injected into a targeted tissue. cDNA expression for use in therapeutic polypeptide methods can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element. Exemplary constitutive promoters include the promoters for the following genes which encode certain constitutive or "housekeeping" functions: hypoxanthine phosphoribosyl transferase (HPRT), dihydrofolate reductase (DHFR) (Scharfmann et al., Proc. Natl. Acad. Sci. USA 88:4626-4630 (1991)), adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase, phosphoglycerol mutase, the actin promoter (Lai et al., Proc. Natl. Acad. Sci. USA 86: 10006-10010 (1989)), and other constitutive promoters known to those of skill in the art. In addition, many viral promoters function constitutively in eukaryotic cells. These include: the early and late promoters of SV40; the long terminal repeats (LTR) of Moloney Leukemia Virus and other retroviruses; and the thymidine kinase promoter of Herpes Simplex Virus, among many others. Accordingly, any of the above-referenced constitutive promoters can be used to control transcription of a heterologous gene insert.

Genes that are under the control of inducible promoters are expressed only or to a greater degree, in the presence of an inducing agent, (e.g., transcription under control of the metallothionein promoter is greatly increased in presence of certain metal ions). Inducible promoters include responsive elements (REs) which stimulate transcription when their inducing factors are bound. For example, there are REs for serum factors, steroid hormones, retinoic acid and cyclic AMP. Promoters containing a particular RE can be chosen in order to obtain an inducible response and in some cases, the RE itself may be attached to a different promoter, thereby conferring inducibility to the recombinant gene. Thus, by selecting the appropriate promoter (constitutive versus inducible; strong versus weak), it is possible to control both the existence and level of expression of a therapeutic agent in the genetically modified stem cell and/or in a cell of the tissue having a deficiency in cell number. Selection and optimization of these factors for delivery of a therapeutically effective dose of a particular therapeutic agent is deemed to be within the scope of one of ordinary skill in the art without undue experimentation, taking into account the above-disclosed factors and the clinical profile of the subject. In addition to at least one promoter and at least one heterologous nucleic acid encoding the therapeutic agent, the expression vector preferably includes a selection gene, for example, a neomycin resistance gene, for facilitating selection of stem cells that have been transfected or transduced with the expression vector.

If desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers. Alternatively, if a genomic clone is used as a therapeutic construct, regulation can be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.

Another therapeutic approach included in the invention involves

administration of a recombinant therapeutic, such as a recombinant stem cell recruiting factor, variant, or fragment thereof, either directly to the site of a potential or actual disease-affected tissue or systemically (for example, by any conventional recombinant protein administration technique). The dosage of the administered protein depends on a number of factors, including the size and health of the individual subject. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions. Delivery of therapeutic agents may be assessed, for example, by formation of hybrid vesicles containing tracer molecules such as radiotracers, gold, and gadolinium, which can be tracked by MRI. Such methods may also facilitate the ability to determine accurate dosing for a subsequent administration.

Therapeutic Nucleic Acids

Inhibitory nucleic acid molecules are those oligonucleotides that inhibit the expression or activity of a polypeptide and thereby treat, ameliorate the symptoms of and/or prevent a disease according to the invention, for example, heart disease. Such oligonucleotides include single and double stranded nucleic acid molecules (including but not limited to DNA, RNA, and analogs thereof) that bind a nucleic acid molecule that encodes a target polypeptide (including but not limited to antisense molecules, siRNA, shRNA) as well as nucleic acid molecules that bind directly to a target polypeptide to modulate its biological activity (e.g. , aptamers). MicroRNAs (miRNAs)

MicroRNAs (miRNAs) are endogenous -21 nucleotide RNA molecules that regulate gene expression post-transcriptionally by interacting with protein-encoding messenger RNAs. miRNAs are similar to short interfering RNAs (siRNAs) in size and function; however, unlike siRNAs, miRNAs are endogenous transcripts encoded by the genome that function to regulate endogenous gene expression. Approximately 1400 human miRNA sequences have been identified, and it is estimated that they play a role in regulating the expression of >30% of genes encoded by the human genome. miRNAs possess antisense activity that negatively regulates the expression of genes with sequences that are complementary to specific miRNAs. Each miRNA appears to regulate the expression of many genes (e.g. about 10 to about 100). In this regard, miRNAs appear to function as high-level switches that regulate many genetic networks (e.g. developmental patterning pathways, cellular growth and proliferation, immunity, etc.).

The introduction of specific miRNAs into disease cells and tissues induces favorable therapeutic responses. For example, miRNAs are frequently mis-regulated and expressed at aberrant levels in diseased tissues when compared to normal tissues. Often, altered expression results from genetic mutations that lead to increased or reduced expression of particular miRNAs. In fact, various diseases display unique miRNA expression patterns that can be exploited as diagnostic and prognostic markers.

As an example of the therapeutic uses of miRNAs, mis-regulated miRNAs contribute to the development and progression of cancer by functioning as oncogenes or tumor suppressors. Oncogenes are defined as genes whose over-expression or inappropriate activation leads to oncogenesis. Tumor suppressors are genes that are required to keep cells from becoming cancerous; the down-regulation or inactivation of tumor suppressors is a common inducer of cancer. Both types of genes represent preferred intervention points to specifically target the molecular basis for a given cancer. Examples of oncogenic miRNAs are miR-21, miR-17 and miR-92; let-7 and miR-34 are examples of tumor suppressive miRNAs.

Administration of miRNA induces a therapeutic response by blocking or reducing tumor growth in pre-clinical animal studies, and restoring miRNA function can prevent or reduce the growth of cancer cells in vitro and in animal models. For example, the let-7 miRNA exhibits anti-tumor activity in both breast and lung cancer models (Johnson et al. 2007 The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 67(16):7713-22;iiEsquela-Kerscher et al. 2008 The let-7 microRNA reduces tumor growth in mouse models of lung cancer. Cell Cycle. 7(6):759-64; Trang et al. 2010 Regression of murine lung tumors by the let-7 microRNA. Oncogene 29(11): 1580-7; Trang et al. 2011 Systemic delivery of tumor suppressor microRNA mimics using a neutral lipid emulsion inhibits lung tumors in mice. Mol Ther. 19(6): 1116-22.) miRNAs act as high level switches for the genome, regulating multiple gene products and coordinating multiple genetic networks. Since a given miRNA may control multiple cellular pathways, it is expected that it may have superior therapeutic activity. Additionally, miRNAs are natural molecules, and therefore less likely to induce non-specific side-effects.

In one embodiment, miRNAs directed against mRNAs, gene products, and genetic networks that are involved in heart disease may be delivered with the vesicles of the invention. For example, such miRNAs include, but are not limited to, miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR-20a, miR-20b, miR-21, miR-23a, miR-24, miR-25, miR-28-5p, miR-29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR- 100, miR-106a, miR-125b, miR-126, miR-128, miR-130a, miR-130b, miR- 132, miR-133a, miR-134, miR-135-3p, miR-138, miR-139-3p, miR-139-5p, miR- 146a, miR-155, miR- 185, miR- 186, miR- 191, miR-193a-5p, miR- 193b, miR- 197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR-224, miR-320, miR-323-3p, miR-328, miR-331-3p, miR-337-5p, miR-339-3p, miR-339-5p, miR- 342-3p, miR-346, miR-361-5p, miR-370, miR-371-3p, miR-375, miR-376a, miR- 422a, miR-423-5p, miR-433, miR-491-5p, miR-493, miR-423-5p, miR-483-5p, miR- 484, miR-495, miR-503, miR-505, miR-517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-579, miR-590-5p, miR-597, miR-618, miR- 671-3p, miR-708, miR-885-5p, miR-886-5p, and miR-874.

miRNAs useful according to the invention include but are not limited to those presented in Table 1.

TABLE 1

miR-197 uuca ccaccuucucca cccagc miR-198 (gguccagaggggagauagguuc) miR-19b (ugugcaaaucca

m i R-202 ( a g a g g u a u a g g g ca u g g g a a ) miR-203 (gu gaaa uguuu aggaccacuag) m i R- 20 a ( u a a agug cu uauag ugcagguag) m i R- 2 Ob (caaag ugcucauag ugcagguag) miR-21 (u agcuuaucagacugaug u uga) miR-212 (uaacagucuccagucacggcc) m i R - 221 ( a g c u a ca u u g u c u g c u g g g u u u c ) m i R- 222, (agcuacaucuggcuacugggu) m i R-223 (ugucaguuugucaaauacccca) miR-224 (caagucacuagugguuccguu) m i R- 23 a ( a u cacauugccagggauuucc) miR-24, (uggcucagu ucagcagga acag) miR-25 (cauugcacuugu

m i R- 28 - 5 p ( a a g g a g cuca ca g u cu a u u g a g ) miR-29a ( u a g caeca u cu g a a a u eg g u u a ) miR-3 Oc (ug uaaaca uccuacacucucagc) m i R- 31 ( a g g ca a g a u g c u g g ca u a g cu ) m i R-320 , (aaaagcuggguugagagggega) mi R- 323 - 3 p ( cacau uacacggucgaccucu) miR-328 (cuggcccucucugcccu

miR-331-3p (gccccugggccuauccuagaa) miR-337-5p (gaacggcuucauacaggaguu) miR-339-3p (cuccuauaugaugccuuucuuc) miR-339-5p (ucccuguccuccaggagcu miR-342- 3p (ucucacacagaaaucgcacccgu) miR-346 (ugucug cccgcaugccugccucu) m i R- 34 a ( u g g ca g u g u cu u a g cu g g u u g u ) miR-34c-5p (aggcaguguaguuagcugauugc) m i R- 361 - 5p (uuaucagaaucuccagggguac) miR-370 (gccugcugggguggaaccuggu miR-371-3p (aagugccgccaucuuuugagugu) miR-375 ( u u u g u u eg u u eg g c u eg eg uga) miR-376a (aucauagaggaaaaucca m i R-422a (acuggacu uagggucaqaaggc) m i R- 423 - 5 p (ugaggggcagag agegagacu uu) m i R-433 ( aucau gaugggcuccucggugu) miR-483-5p (aagaegggaggaaaga imiR-484 (ucaggcucaguccccucccgau) miR-491 - 5 p ( a gug gggaacccuuccaugagg) miR-493 (ugaaggucuacu

miR-495 (aaacaaacauggugcacuu cuu) m iR-503 ( u a g c a g eg g g a a ca g u u c u g c a g ) m iR-505 (cgu caacacuugcuggu uuecu) miR-517c (aucgugcauccuuuuagagugu) miR-520g (acaaagugcuucccuuuagagugu) miR-523 (gaacgcgcuucccuauagagggu) miR-532-5p (caugccuugaguguaggaccgu) miR-545 (ucagcaaacauuuauugugugc) miR-548c- 5 p (aaaaguaauugcgguuuuugcc) miR-57 la (ugaguuggecaucugagugag) miR-579 (uucauuugguauaaaccgcgauu)

miR 590-5p (gagcu

I miR-597 (ugugucacucgaugaccacugu)

miR-618 (aaacucuacuuguccuucugagu)

miR-671-3p (uccggu

miR-708 (aaggagcuua

miR-874 (cu gcccug gcccgag ggaccga)

miR-885 - 5 p (uccauuacacuacccu gccucu)

miR-92a (uauugcac

m i R-99a (aacccg uagauccgaucuugug)

Ribozymes

Catalytic RNA molecules or ribozymes that include an antisense sequence specific for a target of the present invention can be used to inhibit expression of the target nucleic acid molecule in vivo. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs. The design and use of target RNA-specific ribozymes is described in Haseloff et al., Nature 334:585-591. 1988, and U.S. Patent Application Publication No. 2003/0003469 Al, each of which is incorporated by reference. Accordingly, the invention also features a catalytic RNA molecule that includes, in the binding arm, an antisense RNA having between eight and nineteen consecutive nucleobases. In preferred embodiments of this invention, the catalytic nucleic acid molecule is formed in a hammerhead or hairpin motif. Examples of such hammerhead motifs are described by Rossi et al., Aids Research and Human

Retroviruses, 8:183, 1992. Example of hairpin motifs are described by Hampel et al., "RNA Catalyst for Cleaving Specific RNA Sequences," filed Sep. 20, 1989, which is a continuation-in-part of U.S. Ser. No. 07/247,100 filed Sep. 20, 1988, Hampel and Tritz, Biochemistry, 28:4929, 1989, and Hampel et al., Nucleic Acids Research, 18: 299, 1990. These specific motifs are not limiting in the invention and those skilled in the art will recognize that what is critical for an enzymatic nucleic acid molecule of this invention is that it has a specific substrate binding site which is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule. Small hairpin RNAs consist of a stem-loop structure with optional 3' UU- overhangs. While there may be variation, stems can range from 21 to 31 bp (desirably 25 to 29 bp), and the loops can range from 4 to 30 bp (desirably 4 to 23 bp). For expression of shRNAs within cells, plasmid vectors containing either the polymerase III Hl-RNA or U6 promoter, a cloning site for the stem-looped RNA insert, and a 4- 5-thymidine transcription termination signal can be employed. The Polymerase III promoters generally have well-defined initiation and stop sites and their transcripts lack poly(A) tails. The termination signal for these promoters is defined by the polythymidine tract, and the transcript is typically cleaved after the second uridine. Cleavage at this position generates a 3' UU overhang in the expressed shRNA, which is similar to the 3' overhangs of synthetic siRNAs. Additional methods for expressing the shRNA in mammalian cells are described in the references cited above. siRNA

Short twenty-one to twenty-five nucleotide double-stranded RNAs are effective at down-regulating gene expression (Zamore et al., Cell 101: 25-33; Elbashir et al., Nature 411: 494-498, 2001, hereby incorporated by reference). The therapeutic effectiveness of an siRNA approach in mammals was demonstrated in vivo by McCaffrey et al. (Nature 418: 38-39.2002).

Given the sequence of a heart disease specific target gene, siRNAs may be designed to inactivate that gene. Such siRNAs, for example, could be administered directly to an affected tissue, or administered systemically. The nucleic acid sequence of a heart disease specific target gene can be used to design small interfering RNAs (siRNAs). The 21 to 25 nucleotide siRNAs may be used, for example, as therapeutics to treat heart disease, cardiovascular disease or a cardiac disorder.

The inhibitory nucleic acid molecules of the present invention may be employed as double- stranded RNAs for RNA interference (RNAi)-mediated knockdown of heart disease specific gene expression. In one embodiment, expression of a heart disease specific gene is reduced in a cardiac myocyte. RNAi is a method for decreasing the cellular expression of specific proteins of interest (reviewed in Tuschl, Chembiochem 2:239-245, 2001; Sharp, Genes & Devel. 15:485-490, 2000; Hutvagner and Zamore, Curr. Opin. Genet. Devel. 12:225-232, 2002; and Hannon, Nature 418:244-251, 2002). The introduction of siRNAs into cells either by transfection of dsRNAs or through expression of siRNAs using a plasmid-based expression system is increasingly being used to create loss-of-function phenotypes in mammalian cells. In one embodiment, siRNAs may be targeted to heart disease specific cells, for example cardiac myocytes, in vivo with the vesicles of the invention.

In one embodiment of the invention, a double- stranded RNA (dsRNA) molecule is made that includes between eight and nineteen consecutive nucleobases of a nucleobase oligomer of the invention. The dsRNA can be two distinct strands of RNA that have duplexed, or a single RNA strand that has self-duplexed (small hairpin (sh)RNA). Typically, dsRNAs are about 21 or 22 base pairs, but may be shorter or longer (up to about 29 nucleobases) if desired. dsRNA can be made using standard techniques (e.g., chemical synthesis or in vitro transcription). Kits are available, for example, from Ambion (Austin, Tex.) and Epicentre (Madison, Wis.). Methods for expressing dsRNA in mammalian cells are described in Brummelkamp et al. Science 296:550-553, 2002; Paddison et al. Genes & Devel. 16:948-958, 2002. Paul et al. Nature Biotechnol. 20:505-508, 2002; Sui et al. Proc. Natl. Acad. Sci. USA 99:5515- 5520, 2002; Yu et al. Proc. Natl. Acad. Sci. USA 99:6047-6052, 2002; Miyagishi et al. Nature Biotechnol. 20:497-500, 2002; and Lee et al. Nature Biotechnol. 20:500- 505 2002, each of which is hereby incorporated by reference.

Delivery of Nucleobase Oligomers

Naked inhibitory nucleic acid molecules, or analogs thereof, are capable of entering mammalian cells and inhibiting expression of a gene of interest.

Nonetheless, it may be desirable to utilize a formulation that aids in the delivery of oligonucleotides or other nucleobase oligomers to cells (see, e.g., U.S. Pat. Nos.

5,656,611, 5,753,613, 5,785,992, 6,120,798, 6,221,959, 6,346,613, and 6,353,055, each of which is hereby incorporated by reference). In one embodiment, naked inhibitory nucleic acid molecules, or analogs, thereof, may be targeted to specific cardiac cell types in vivo with the vesicles of the invention.

A nucleobase oligomer of the invention, or other negative regulator for use in the treatment of heart disease, may be administered within a pharmaceutically- acceptable diluent, carrier, or excipient, in unit dosage form. Conventional

pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the compounds to patients suffering from a disease that is caused by excessive cell proliferation. Administration may begin before the patient is symptomatic. Any appropriate route of administration may be employed, for example, administration may be parenteral, intravenous, intraarterial, subcutaneous,

intratumoral, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intrahepatic, intracapsular, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, suppository, or oral administration. For example, therapeutic formulations may be in the form of liquid solutions or suspensions; formulations may be associated with a medical device as described herein, or formulated as a coating for a medical device; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.

Methods well known in the art for making formulations are found, for example, in "Remington: The Science and Practice of Pharmacy" Ed. A. R. Gennaro, Lippincourt Williams & Wilkins, Philadelphia, Pa., 2000. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer,

lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for IAP modulatory compounds include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.

The formulations can be administered to human patients in therapeutically effective amounts (e.g., amounts which prevent, eliminate, or reduce a pathological condition) to provide therapy for a heart disease or condition. The preferred dosage of a nucleobase oligomer of the invention is likely to depend on such variables as the type and extent of the heart disease, the overall health status of the particular patient (e.g. weight, lipid and cholesterol profile, and family history), the formulation of the compound excipients, and its route of administration. If desired, treatment with a nucleobase oligomer of the invention may be combined with other therapies for the treatment of heart disease (e.g., diet

modification, ACE inhibitors, Beta Blockers, aspirin, statins, etc.). For any of the methods of application described above, a nucleobase oligomer of the invention is desirably administered intravenously or is applied to the site of the needed apoptosis event (e.g., by injection). Oligonucleotides and other Nucleobase Oligomers

At least two types of oligonucleotides induce the cleavage of RNA by RNase H: polydeoxynucleotides with phosphodiester (PO) or phosphorothioate (PS) linkages. Although 2'-OMe-RNA sequences exhibit a high affinity for RNA targets, these sequences are not substrates for RNase H. A desirable oligonucleotide is one based on 2'-modified oligonucleotides containing oligodeoxynucleotide gaps with some or all internucleotide linkages modified to phosphorothioates for nuclease resistance. The presence of methylphosphonate modifications increases the affinity of the oligonucleotide for its target RNA and thus reduces the IC₅₀. This modification also increases the nuclease resistance of the modified oligonucleotide. It is understood that the methods and reagents of the present invention may be used in conjunction with any technologies that may be developed, including covalently-closed multiple antisense (CMAS) oligonucleotides (Moon et al., Biochem J. 346:295-303, 2000; PCT Publication No. WO 00/61595), ribbon-type antisense (RiAS) oligonucleotides (Moon et al., J. Biol. Chem. 275:4647-4653, 2000; PCT Publication No. WO

00/61595), and large circular antisense oligonucleotides (U.S. Patent Application Publication No. US 2002/0168631 Al).

As is known in the art, a nucleoside is a nucleobase-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3 Or 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric structure can be further joined to form a circular structure; open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

Specific examples of preferred nucleobase oligomers useful in this invention include oligonucleotides containing modified backbones or non-natural

internucleoside linkages. As defined in this specification, nucleobase oligomers having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are also considered to be nucleobase oligomers.

Nucleobase oligomers that have modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphor amidate and

aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriest- ers, and boranophosphates having normal 3'-5' linkages, 2'- 5' linked analogs of these, and those having inverted polarity, wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676;

5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821;

5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.

Nucleobase oligomers having modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH₂ component parts. Representative United States patents that teach the preparation of the above oligonucleotides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564;

5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;

5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704;

5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

In other nucleobase oligomers, both the sugar and the internucleoside linkage, i.e., the backbone, are replaced with novel groups. The nucleobase units are maintained for hybridization with an IAP. One such nucleobase oligomer, is referred to as a Peptide Nucleic Acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Methods for making and using these nucleobase oligomers are described, for example, in "Peptide Nucleic Acids: Protocols and Applications" Ed. P. E. Nielsen, Horizon Press, Norfolk, United Kingdom, 1999. Representative United States patents that teach the

preparation of PNAs include, but are not limited to, U.S. Pat. Nos. 5,539,082;

5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497- 1500. In particular embodiments of the invention, the nucleobase oligomers have phosphorothioate backbones and nucleosides with heteroatom backbones, and in particular -CH₂-NH-0-CH₂-, -CH₂-N(CH₃)-0-CH₂- (known as a methylene

(methylimino) or MMI backbone), -CH₂-0-N(CH₃)-CH₂-, -CH₂-N(CH₃)-N(CH₃)- CH₂-, and -0-N(CH₃)-CH₂-CH₂-. In other embodiments, the oligonucleotides have morpholino backbone structures described in U.S. Pat. No. 5,034,506.

Nucleobase oligomers may also contain one or more substituted sugar moieties. Nucleobase oligomers comprise one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl may be substituted or unsubstituted Q to C₁₀ alkyl or C₂ to C₁₀ alkenyl and alkynyl. Particularly preferred are 0[(CH₂)_nO] _nCH₃, 0(CH₂) _nOCH₃, 0(CH₂) _nNH₂, 0(CH₂) _nCH₃, 0(CH₂) _nONH₂, and 0(CH₂) nON[(CH₂) _nCH₃)]₂, where n and m are from 1 to about 10. Other preferred nucleobase oligomers include one of the following at the 2' position: Q to C₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl, or O-aralkyl, SH, SCH₃, OCN, CI, Br, CN, CF₃, OCF₃, SOCH₃, S0₂CH₃, ON0₂, N0₂, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a nucleobase oligomer, or a group for improving the pharmacodynamic properties of an nucleobase oligomer, and other substituents having similar properties. Preferred modifications are 2'-0-methyl and 2'- methoxyethoxy (2'-0-CH₂CH₂OCH₃, also known as 2'-0-(2-methoxyethyl) or 2'- MOE). Another desirable modification is 2'-dimethylaminooxyethoxy (i.e., 0(CH₂) ₂ON(CH₃) ₂), also known as 2'-DMAOE. Other modifications include, 2'- aminopropoxy (2'-OCH₂CH₂CH₂NH₂) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on an oligonucleotide or other nucleobase oligomer, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Nucleobase oligomers may also have sugar mimetics such as cyclobutyl moieties in place of the

pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos.

4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786;

5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;

5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is herein incorporated by reference in its entirety.

Nucleobase oligomers may also include nucleobase modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2- thiouracil, 2-thiothymine and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine and thymine; 5-uracil (pseudouracil); 4- thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines; 5-halo (e.g. , 5-bromo), 5-trif uoromethyl and other 5- substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8- azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3- deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of an antisense oligonucleotide of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2. degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are desirable base substitutions, even more particularly when combined with 2'-0-methoxyethyl or 2'-0- methyl sugar modifications. Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066;

5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;

5,525,711 ; 5,552,540; 5,587,469; 5,594,121, 5,596,091 ; 5,614,617; 5,681,941 ; and 5,750,692, each of which is herein incorporated by reference.

Another modification of a nucleobase oligomer of the invention involves chemically linking to the nucleobase oligomer one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 86:6553-6556, 1989), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let, 4: 1053-1060, 1994), a thioether, e.g. , hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 660:306-309, 1992; Manoharan et al., Bioorg. Med. Chem. Let., 3:2765-2770, 1993), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 20:533-538: 1992), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 10:1111-1118, 1991; Kabanov et al., FEBS Lett., 259:327-330, 1990; Svinarchuk et al., Biochimie, 75:49-54, 1993), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 36:3651-3654, 1995; Shea et al., Nucl. Acids Res., 18:3777-3783, 1990), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &

Nucleotides, 14:969-973, 1995), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 36:3651-3654, 1995), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1264:229-237, 1995), or an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 277:923-937, 1996. Representative United States patents that teach the preparation of such nucleobase oligomer conjugates include U.S. Pat. Nos. 4,587,044; 4,605,735; 4,667,025;

4,762,779; 4,789,737; 4,824,941; 4,828,979; 4,835,263; 4,876,335; 4,904,582;

4,948,882; 4,958,013; 5,082,830; 5,109,124; 5,112,963; 5,118,802; 5,138,045;

5,214,136; 5,218,105; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250;

5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,414,077; 5,416,203, 5,451,463;

5,486,603; 5,510,475; 5,512,439; 5,512,667; 5,514,785; 5,525,465; 5,541,313;

5,545,730; 5,552,538; 5,565,552; 5,567,810; 5,574,142; 5,578,717; 5,578,718;

5,580,731; 5,585,481; 5,587,371; 5,591,584; 5,595,726; 5,597,696; 5,599,923;

5,599,928; 5,608,046; and 5,688,941, each of which is herein incorporated by reference.

The present invention also includes nucleobase oligomers that are chimeric compounds. "Chimeric" nucleobase oligomers are nucleobase oligomers, particularly oligonucleotides, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide. These nucleobase oligomers typically contain at least one region where the nucleobase oligomer is modified to confer, upon the nucleobase oligomer, increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the nucleobase oligomer may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of nucleobase oligomer inhibition of gene expression. Consequently, comparable results can often be obtained with shorter nucleobase oligomers when chimeric nucleobase oligomers are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.

Chimeric nucleobase oligomers of the invention may be formed as composite structures of two or more nucleobase oligomers as described above. Such nucleobase oligomers, when oligonucleotides, have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference in its entirety.

The nucleobase oligomers used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the

phosphorothioates and alkylated derivatives.

The nucleobase oligomers of the invention may also be admixed,

encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291;

5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556;

5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016;

5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152;

5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference. Therapeutic agents

In general, therapeutic agents that treat or prevent a disease according to the invention, for example, heart disease, are identified from large libraries of natural products or synthetic (or semi-synthetic) extracts or chemical libraries, or from polypeptide or nucleic acid libraries, according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the treatment and prophylaxis procedure(s) of the invention. Therapeutic agents used in the invention may include those known as therapeutics for the treatment and prevention of disease for example, heart disease. Alternatively, virtually any number of unknown chemical extracts or compounds can be screened for their ability to treat and prevent heart disease using methods known to one of skill in the art. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as the modification of existing polypeptides.

Examples of therapeutic agents of the invention may include, but are not limited to: Angiotensin converting enzyme (ACE) inhibitors including Capoten® (captopril), Vasotec® (enalapril), Prinivil®, Zestril® (lisinopril), Lotensin®

(benazepril), Monopril® (fosinopril), Altace® (ramipril), Accupril® (quinapril), Aceon® (perindopril), Mavik® (trandolapril), and Univasc® (moexipril));

Angiotensin II receptor blockers (ARBs) including Cozaar® (losartan), Diovan® (valsartan), Avapro® (irbesartan), Atacand® (candesartan), and Micardis®

(telmisartan); Antiarrhythmia drugs including Tambocor® (flecainide), Procanbid® (procainamide), Cordarone® (amiodarone), and Betapace® (sotalol); Antiplatelet drugs; Beta Blockers including Sectral® (acebutolol), Zebeta® (bisoprolol),

Brevibloc® (esmolol), Inderal® (propranolol), Tenormin® (atenolol), Normodyne®, Trandate® (labetalol), Coreg® (carvedilol), Lopressor®, and Toprol-XL®

(metoprolol); and Calcium Channel Blockers including Norvasc® (amlodipine), Plendil® (felodipine), Cardizem®, Cardizem CD®, Cardizem SR®, Dilacor XR®, Diltia XT®, Tiazac® (diltiazem), Calan®, Calan SR®, Covera-HS®, Isoptin®, Isoptin SR®, Verelan®, Verelan PM® (verapamil), Adalat®, Adalat CC®,

Procardia®, Procardia XL® (nifedipine), Cardene®, Cardene SR® (nicardipine), Sular® (nisoldipine), Vascor® (bepridil); aspirin; digoxin; diuretic drugs; Heart Failure Drugs including Dobutrex® (dobutamine) and Primacor® (milrinone);

Vasodialators such as Dilatrate-SR®, Iso-Bid®, Isonate®, Isorbid®, Isordil®, Isotrate®, Sorbitrate® (isosorbide dinitrate), IMDUR® (isorbide mononitrate), Apresoline® (hydralazine), and BiDil® (hydralazine with isosorbide dinitrate);

warfarin; and surgery. In one preferred embodiment, an agent of the invention is administered in combination with a statin, such as Advicor® (niacin extended- release/lovastatin), Altoprev® (lovastatin extended-release), Caduet® (amlodipine and atorvastatin), Crestor® (rosuvastatin), Lescol® (fluvastatin), Lescol XL

(fluvastatin extended-release), Lipitor® (atorvastatin), Mevacor® (lovastatin), Pravachol® (pravastatin), Simcor® (niacin extended-release/simvastatin), Vytorin® (ezetimibe/simvastatin), and Zocor® (simvastatin).

Other examples of therapeutic agents include chemotherapeutic agents such as paclitaxel, sirolimus, everolimus, zotarolimus, biolimiis. and Rapamycin.

Libraries of natural polypeptides in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including

Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, Fla.), and PharmaMar, U.S.A. (Cambridge, Mass.). Such polypeptides can be modified to include a protein transduction domain using methods known in the art and described herein. In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90:6909, 1993; Erb et al, Proc. Natl. Acad. Sci. USA 91:11422, 1994; Zuckermann et al, J. Med. Chem. 37:2678, 1994; Cho et al, Science 261:1303, 1993; Carrell et al., Angew. Chem. Int. Ed. Engl. 33:2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33:2061, 1994; and Gallop et al., J. Med. Chem. 37:1233, 1994. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.

Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of polypeptides, chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, N.H.) and Aldrich Chemical (Milwaukee, Wis.). Alternatively, chemical compounds to be used as candidate therapeutic agents may be synthesized from readily available starting materials using standard synthetic techniques and methodologies known to those of ordinary skill in the art. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the therapeutic agents used herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.

Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:412-421, 1992), or on beads (Lam, Nature 354:82-84, 1991), chips (Fodor, Nature 364:555-556, 1993), bacteria (Ladner, U.S. Patent No. 5,223,409), spores (Ladner U.S. Patent No. 5,223,409), plasmids (Cull et al, Proc Natl Acad Sci USA 89:1865-1869, 1992) or on phage (Scott and Smith, Science 249:386-390, 1990; Devlin, Science 249:404-406, 1990; Cwirla et al. Proc. Natl. Acad. Sci. 87:6378- 6382, 1990; Felici, J. Mol. Biol. 222:301-310, 1991; Ladner supra.).

In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their activity should be employed whenever possible.

When a crude extract is found to have a positive effect in treating heart disease, further fractionation of the positive lead extract is necessary to isolate molecular constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract that reduces the effects of heart disease in a patient. Methods of fractionation and purification of such heterogeneous extracts are known in the art. If desired, compounds shown to be useful as therapeutics are chemically modified according to methods known in the art. The present invention provides methods of treating disease (including but not limited to cardiovascular disease) and/or disorders or symptoms thereof which comprise administering a therapeutically effective amount of a pharmaceutical composition comprising a compound of the formula herein to a subject (e.g. , a mammal such as a human). Thus, one embodiment is a method of treating a subject suffering from or susceptible to heart disease. The method includes the step of administering to the mammal a therapeutic amount of a compound herein via a vesicle of the invention sufficient to treat the heart disease or heart disorder or symptom thereof, under conditions such that the heart disease or heart disorder is treated. The methods herein include administering to the subject (including a subject identified as in need of such treatment) an effective amount of a compound described herein, or a composition described herein, via a vesicle of the invention to produce such effect. Identifying a subject in need of such treatment for heart disease may be in the judgment of a subject or a health care professional and can be subjective (e.g. opinion) and/or objective (e.g. measurable by a test or diagnostic method).

In one embodiment, the invention provides a method of monitoring treatment progress. The method includes the step of determining a level of diagnostic marker (Marker) (e.g. HDL levels, LDL levels, ApoEI levels, etc.) or diagnostic measurement (e.g., screen, assay) in a subject suffering from or susceptible to a disorder or symptoms thereof associated with heart disease, in which the subject has been administered a therapeutic amount of a therapeutic agent, nucleotide, or polypeptide described herein sufficient to treat the heart disease or symptoms thereof. The level of Marker determined in the method can be compared to known levels of Marker in either healthy normal controls or in other afflicted patients to establish the subject's disease status. In preferred embodiments, a second level of Marker in the subject is determined at a time point later than the determination of the first level, and the two levels are compared to monitor the course of disease or the efficacy of the therapy. In certain preferred embodiments, a pre-treatment level of Marker in the subject is determined prior to beginning treatment according to this invention; this pre-treatment level of Marker can then be compared to the level of Marker in the subject after the treatment commences, to determine the efficacy of the heart disease treatment.

In one embodiment, therapeutic agents useful according to the invention are agents that decrease neointimal formation and increase re-endothelialization of the treated vessel. For example, SMCs may be targeted with exosomes containing therapeutic nucleotides and/or polypeptides that will alter specific molecular pathways such that SMC proliferation and migration is inhibited, for example, expression of "contractile phenotype" proteins (e.g., smooth muscle actin) is increased, while expression of "proliferative phenotype" proteins (e.g. myocardin, transforming growth factor Beta (TGF-beta), Bone morphogenic protein (BMP)) is decreased.

In another embodiment, chemotherapeutic agents (e.g. , sirolimus, everolimus, zotarolimus, biolimus or paclitaxel) may be delivered to SMCs, via a vesicle of the invention, to act as cytostatic or cytotoxic agents to inhibit cell cycle progression, thereby inhibiting SMC proliferation. The therapeutic effect is to reduce neointimal formation and in-stent restenosis, which may be assessed using non-invasive imaging (e.g., coronary CT or cardiac MRI) or invasive imaging (e.g. angiography of coronary arteries). Such imaging methods may reveal decreased restenosis of the vessel compared to vessels treated with current protocols. The use of these

chemotherapeutic agents may require co-administration of plavix during the time that the exosomes are still acting; however, unlike drug eluting stents, they will not require long-term treatment with plavix.

In another embodiment, cells may be targeted with miRNA specific to SMC proliferative pathways. SMCs are typically senescent, but when activated, they change from a "contractile" phenotype to a "proliferative" phenotype. One of skill in the art will appreciate that the pathways involved in this transition are well recognized. For example, PDGF induces miR-221 ; therefore, an antagomir to miR- 221 may be useful in inhibiting the downstream effects of PDGF, and reduce neointima formation and SMC migration.

Medical Devices

A medical device is a product that is used for medical purposes in a subject, such as diagnosis, treatment, prophylaxis, therapy, and/or surgery. Medical devices generally exert their effect by means such as physical means, mechanical means, thermal means, physico-chemical means, and/or chemical means. Medical devices of the invention may include any instrument, apparatus, appliance, software, material or other article, whether used alone or in combination, including the software intended by its manufacturer to be used specifically for diagnostic and/or therapeutic purposes, and necessary for its proper application, intended by the manufacturer to be used for human beings. It is contemplated within the scope of the invention that such devices may be used for the purpose of diagnosis, prevention, monitoring, treatment, or alleviation of heart disease. Additionally, such devices may also be used for investigation, replacement or modification of the anatomy, or of a physiological process related to heart disease. It is to be understood that medical devices of the invention include devices that do not achieve their principal intended action in or on the human body by pharmacological, immunological or metabolic means, but which may be assisted in their function by such means. Diseases

Heart disease (also known as cardiac disease or cardiopathy) is a term that encompasses a number of disorders that affect the heart, including, but not limited to, coronary heart disease, cardiomyopathy, cardiovascular disease, endothelial disorders, ischemic heart disease, heart failure, hypertensive heart disease, inflammatory heart disease, pulmonary hypertension, sepsis, smooth muscle cell disorders, and valvular heart disease. Heart disease is a systemic disease that can affect the heart, brain, most major organs, and the extremities.

Coronary heart disease (CHD) refers to the failure or dysfunction of the coronary circulation system to supply adequate circulation to the cardiac muscle and surrounding tissues. Coronary heart disease is most commonly equated with coronary artery disease (CAD); however, it is important to note that coronary heart disease may be due to other causes (including but not limited to coronary vasospasm). Coronary artery disease is a disease of the arteries that is caused by the accumulation of atherosclerotic plaques within the walls of the arteries that supply the myocardium. CHD may be associated with angina pectoris (i.e. chest pain) and myocardial infarction (i.e. heart attack), which are both symptoms of, and conditions caused by, CHD.

Cardiomyopathy refers to a condition that involves the deterioration of the function of the myocardium (i.e., the actual heart muscle). Patients with

cardiomyopathy are at risk of arrhythmia and/or sudden cardiac death.

Cardiomyopathy is difficult to detect, making it especially dangerous to carriers of the disease. Cardiomyopathies are typically categorized as extrinsic or intrinsic. An extrinsic cardiomyopathy has a primary pathology that is outside the myocardium itself (e.g. alcoholic cardiomyopathy, ischemic cardiomyopathy, hypertensive cardiomyopathy, etc.). An intrinsic cardiomyopathy is defined as weakness in the muscle of the heart that is not due to an identifiable external cause (e.g. hypertrophic cardiomyopathy, dilated cardiomyopathy, noncompaction cardiomyopathy, etc.). To make a diagnosis of an intrinsic cardiomyopathy, significant coronary artery disease should be ruled out by differential diagnosis.

Cardiovascular disease refers to any of a number of specific diseases that affect the heart itself and/or the blood vessel system, especially the veins and arteries leading to and from the heart. Combination Therapies

Optionally, a heart disease therapeutic may be administered in combination with any other standard heart disease therapeutic regimen; such methods are known to the skilled artisan and described in Remington's Pharmaceutical Sciences by E. W. Martin. If desired, agents of the invention (for example, agents including miRNA's such as miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR-20a, miR-20b, miR- 21, miR-23a, miR-24, miR-25, miR-28-5p, miR-29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR-100, miR-106a, miR-125b, miR-126, miR-128, miR- 130a, miR-130b, miR-132, miR-133a, miR-134, miR-135-3p, miR-138, miR-139-3p, miR-139-5p, miR-146a, miR-155, miR-185, miR-186, miR-191, miR-193a-5p, miR- 193b, miR-197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR- 224, miR-320, miR-323-3p, miR-328, miR-331-3p, miR-337-5p, miR-339-3p, miR- 339-5p, miR-342-3p, miR-346, miR-361-5p, miR-370, miR-371-3p, miR-375, miR- 376a, miR-422a, miR-423-5p, miR-433, miR-491-5p, miR-493, miR-423-5p, miR- 483-5p, miR-484, miR-495, miR-503, miR-505, miR-517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-579, miR-590-5p, miR-597, miR-618, miR-671-3p, miR-708, miR-885-5p, miR-886-5p, miR-874, and pharmaceutically acceptable salts thereof) are administered in combination with any conventional anti-heart disease therapy, including but not limited to, Angiotensin converting enzyme (ACE) inhibitors including Capoten® (captopril), Vasotec® (enalapril), Prinivil®, Zestril® (lisinopril), Lotensin® (benazepril), Monopril® (fosinopril), Altace® (ramipril), Accupril® (quinapril), Aceon® (perindopril), Mavik® (trandolapril), and Univasc® (moexipril)); Angiotensin II receptor blockers (ARBs) including Cozaar® (losartan), Diovan® (valsartan), Avapro® (irbesartan), Atacand® (candesartan), and Micardis® (telmisartan); Antiarrhythmia drugs including Tambocor® (f ecainide), Procanbid® (procainamide), Cordarone®

(amiodarone), and Betapace® (sotalol); Antiplatelet drugs; Beta Blockers including Sectral® (acebutolol), Zebeta® (bisoprolol), Brevibloc® (esmolol), Inderal®

(propranolol), Tenormin® (atenolol), Normodyne®, Trandate® (labetalol), Coreg® (carvedilol), Lopressor®, and Toprol-XL® (metoprolol); and Calcium Channel Blockers including Norvasc® (amlodipine), Plendil® (felodipine), Cardizem®, Cardizem CD®, Cardizem SR®, Dilacor XR®, Diltia XT®, Tiazac® (diltiazem), Calan®, Calan SR®, Covera-HS®, Isoptin®, Isoptin SR®, Verelan®, Verelan PM® (verapamil), Adalat®, Adalat CC®, Procardia®, Procardia XL® (nifedipine),

Cardene®, Cardene SR® (nicardipine), Sular® (nisoldipine), Vascor® (bepridil); aspirin; digoxin; diuretic drugs; Heart Failure Drugs including Dobutrex®

(dobutamine) and Primacor® (milrinone); Vasodialators such as Dilatrate-SR®, Iso- Bid®, Isonate®, Isorbid®, Isordil®, Isotrate®, Sorbitrate® (isosorbide dinitrate), IMDUR® (isorbide mononitrate), Apresoline® (hydralazine), and BiDil®

(hydralazine with isosorbide dinitrate); warfarin; and surgery. In one preferred embodiment, an agent of the invention is administered in combination with a statin, such as Advicor® (niacin extended-release/lovastatin), Altoprev® (lovastatin extended-release), Caduet® (amlodipine and atorvastatin), Crestor® (rosuvastatin), Lescol® (fluvastatin), Lescol XL (fluvastatin extended-release), Lipitor®

(atorvastatin), Mevacor® (lovastatin), Pravachol® (pravastatin), Simcor® (niacin extended-release/simvastatin), Vytorin® (ezetimibe/simvastatin), Zocor®

(simvastatin).

If desired, agents of the invention (for example, agents including miRNA's such as miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR-20a, miR-20b, miR- 21, miR-23a, miR-24, miR-25, miR-28-5p, miR-29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR-100, miR-106a, miR-125b, miR-126, miR-128, miR- 130a, miR-130b, miR-132, miR-133a, miR-134, miR-135-3p, miR-138, miR-139-3p, miR-139-5p, miR-146a, miR-155, miR-185, miR-186, miR-191, miR-193a-5p, miR- 193b, miR-197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR- 224, miR-320, miR-323-3p, miR-328, miR-331-3p, miR-337-5p, miR-339-3p, miR- 339-5p, miR-342-3p, miR-346, miR-361-5p, miR-370, miR-371-3p, miR-375, miR- 376a, miR-422a, miR-423-5p, miR-433, miR-491-5p, miR-493, miR-423-5p, miR- 483-5p, miR-484, miR-495, miR-503, miR-505, miR-517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-579, miR-590-5p, miR-597, miR-618, miR-671-3p, miR-708, miR-885-5p, miR-886-5p, miR-874, and pharmaceutically acceptable salts thereof) are administered in combination with any conventional anti-heart disease therapy including but not limited to surgical procedures to reduce or eliminate blockages in the heart, for example, atheroectomy, balloon angioplasty (e.g. POBA), coronary angioplasty and coronary artery bypass, implantation of a pacemaker or an implantable cardioverter-defibrillator, open heart surgery, placement of bare metal or drug eluting stents, heart transplant,

valvuloplasty, for example, balloon valvuloplasty, valve repair, valve replacement, cardioversion or cardio ablation.

Dosages and Modes Of Administration

In general, vesicles of the invention will be administered in therapeutically effective amounts via any of the usual and acceptable modes known in the art, and in particular intravenously or via a medical device, either singly or in combination with one or more therapeutic agents or vesicles that deliver a therapeutic agent. A therapeutically effective amount may vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the vesicles and therapeutic molecules delivered by the vesicles used and other factors. In general, satisfactory results are indicated to be obtained systemically at daily dosages of from about 0.00001 to about 1 mg/kg per body weight. An indicated daily dosage in the larger mammal, e.g. humans, is in the range from about 0.001 mg to about 70 mg, conveniently administered, e.g. in divided doses up to four times a day or in retard form. Suitable unit dosage forms for intravenous administration comprise from about 0.001 to about 1 mg active ingredient.

In g general, treatment regimens according to the present invention comprise administration to a patient in need of such treatment from about 0.001 mg to about 70 mg of the compound(s) of this invention per day in single or multiple doses.

Therapeutic amounts or doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents. Therapeutic amounts or dosages of the vesicles of the invention will also vary depending on the level of expression of the therapeutic molecules delivered by the vesicles. Upon improvement of a subject's condition, a maintenance dose of a vesicle and the therapeutic molecule contained therein, either alone or in combination with one or more additional therapeutic agents, may be administered, if necessary.

Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained and when the symptoms have been alleviated to the desired level, treatment should cease. The subject may, however, require intermittent treatment on a long-term basis upon any recurrence of disease symptoms.

It will be understood, however, that the total daily usage of a vesicle(s) of the present invention, and the therapeutic molecules contained within or delivered by the vesicle(s) will be decided by the attending physician within the scope of sound medical judgment. The specific dose for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion or breakdown of the specific compound, for example, vesicle or therapeutic molecule delivered by the vesicle, employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.

It is contemplated that global administration of a therapeutic composition to a subject is not needed in order to achieve a highly localized effect. Localized administration of a therapeutic composition according to the invention is preferably by injection, via a device, for example, a stent, valve, balloon or catheter or by means of a drip device, drug pump or drug- saturated solid matrix from which the

composition can diffuse implanted at the target site. Systemic administration of a therapeutic composition according to the invention may be performed by methods of whole-body drug delivery well known in the art. These include, but are not limited to, intravenous drip or injection, subcutaneous, intramuscular, intraperitoneal, intracranial and spinal injection, ingestion via the oral route, inhalation, trans- epithelial diffusion (such as via a drug-impregnated, adhesive patch) or by the use of an implantable, time-release drug delivery device. Note that injection may be performed either by conventional means (i.e. using a hypodermic needle) or by hypospray (see Clarke and Woodland, 1975, Rheumatol. Rehabil, 14: 47-49).

Systemic administration is advantageous when a pharmaceutical composition must be delivered to a target tissue that is widely-dispersed, inaccessible to direct contact or, while accessible to topical or other localized application, is resident in an environment (such as the digestive tract) wherein the native activity of the nucleic acid or other agent might be compromised, e.g. by digestive enzymes or extremes of pH.

A therapeutic composition of use in the invention can be given in a single- or multiple dose. A multiple dose schedule is one in which a primary course of administration can include 1-10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the level of the therapeutic agent. Such intervals are dependent on the continued need of the recipient for the therapeutic agent, and/or the half-life of a therapeutic agent. The efficacy of administration may be assayed by monitoring the reduction in the levels of a symptom indicative or associated with heart disease, as defined herein, which it is designed to inhibit. The assays can be performed as described herein or according to methods known to one skilled in the art.

A therapeutically effective regimen may be sufficient to arrest or otherwise ameliorate symptoms of a disease. An effective dosage regimen requires providing the vesicle composition or formulation or drug over a period of time to achieve noticeable therapeutic effects wherein symptoms are reduced to a clinically acceptable standard or ameliorated. The symptoms are specific for the disease in question. For example, when the disease is associated with blockage of a blood vessel, the claimed invention is successful when blockage is reduced to below 70% stenosis, or reduced by at least 25%. Coronary flow reduces significantly when stenosis is >70%, and therefore this level of stenosis is an indication that treatment is necessary. Stenting will drop that to 0-10%, but with time and restenosis, the blockage may increase significantly. The stent would not be re-stented unless the stenosis returns to 70%. Pharmaceutical Compositions In another aspect, the invention provides a pharmaceutical composition comprising one or more vesicles of the invention, or a pharmaceutically acceptable ester, salt, or prodrug thereof, together with a pharmaceutically acceptable carrier.

Vesicles of the invention can be administered as pharmaceutical compositions by any conventional route, in particular, intravenously, or via an implantable device, enterally, e.g., orally, e.g., in the form of tablets or capsules, or parenterally, e.g., in the form of injectable solutions or suspensions, topically, e.g., in the form of lotions, gels, ointments or creams, or in a nasal or suppository form. Pharmaceutical compositions comprising vesicles of the present invention in free form or in a pharmaceutically acceptable salt form in association with at least one

pharmaceutically acceptable carrier or diluent can be manufactured in a conventional manner by mixing, granulating or coating methods. For example, injectable compositions can be aqueous isotonic solutions or suspensions, and suppositories can be prepared from fatty emulsions or suspensions. The compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances. Oral compositions can be tablets or gelatin capsules comprising the active ingredient together with a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethylene glycol; for tablets also c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and or polyvinylpyrrolidone; if desired d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and/or e) absorbents, colorants, flavors and sweeteners. Suitable formulations for transdermal applications include an effective amount of a compound, for example a vesicle(s) of the present invention with a carrier. A carrier can include absorbable

pharmacologically acceptable solvents to assist passage through the skin of the host. For example, transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound, for example, the inventive vesicle(s) optionally with carriers, optionally a rate controlling barrier to deliver the compound to the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin. Matrix transdermal formulations may also be used. Suitable formulations for topical application, e.g., to the skin and eyes, are preferably aqueous solutions, ointments, creams or gels well-known in the art. Such may contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives. Vesicles of the invention can be administered in therapeutically effective amounts in combination with one or more therapeutic agents (pharmaceutical combinations). For example, synergistic effects can occur with other agents suitable for treating heart disease, anti-proliferative, anti-cancer, immunomodulatory or antiinflammatory substances. Where the vesicles of the invention are administered in conjunction with other therapies, dosages of the co-administered compounds will of course vary depending on the type of co-drug employed, on the specific drug employed, on the condition being treated and so forth.

Combination therapy includes the administration of a vesicle of the invention in further combination with other biologically active ingredients (such as, but not limited to, an agent for treating heart disease that differs from the agent being delivered by the vesicle) and non-drug therapies (such as, but not limited to, surgery, for example angioplasty or radiation treatment). For instance, the vesicles of the invention can be used in combination with other pharmaceutically active compounds, preferably compounds that are able to enhance the effect of the compounds delivered by the vesicles of the invention. The vesicles of the invention can be administered simultaneously (as a single preparation or separate preparation) or sequentially to the other drug therapy. In general, a combination therapy envisions administration of two or more drugs during a single cycle or course of therapy.

In certain embodiments, these vesicle compositions optionally further comprise one or more additional therapeutic agents. Alternatively, a compound of this invention, for example a vesicle(s) may be administered to a patient in need thereof in combination with the administration of one or more other therapeutic agents. For example, additional therapeutic agents for conjoint administration or inclusion in a pharmaceutical composition with a vesicle of the invention may be an approved agent for treating heart disease, or it may be any one of a number of agents undergoing approval in the Food and Drug Administration that ultimately obtains approval for the treatment of a disease including but not limited to any of the diseases recited herein. If desired, agents of the invention (for example, agents including miRNA's such as miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR-20a, miR-20b, miR- 21, miR-23a, miR-24, miR-25, miR-28-5p, miR-29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR-100, miR-106a, miR-125b, miR-126, miR-128, miR- 130a, miR-130b, miR-132, miR-133a, miR-134, miR-135-3p, miR-138, miR-139-3p, miR-139-5p, miR-146a, miR-155, miR-185, miR-186, miR-191, miR-193a-5p, miR- 193b, miR-197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR- 224, miR-320, miR-323-3p, miR-328, miR-331-3p, miR-337-5p, miR-339-3p, miR- 339-5p, miR-342-3p, miR-346, miR-361-5p, miR-370, miR-371-3p, miR-375, miR- 376a, miR-422a, miR-423-5p, miR-433, miR-491-5p, miR-493, miR-423-5p, miR- 483-5p, miR-484, miR-495, miR-503, miR-505, miR-517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-579, miR-590-5p, miR-597, miR-618, miR-671-3p, miR-708, miR-885-5p, miR-886-5p, miR-874, and pharmaceutically acceptable salts thereof) are administered in combination with any conventional anti-heart disease therapy, including but not limited to, Angiotensin converting enzyme (ACE) inhibitors including Capoten® (captopril), Vasotec® (enalapril), Prinivil®, Zestril® (lisinopril), Lotensin® (benazepril), Monopril® (fosinopril), Altace® (ramipril), Accupril® (quinapril), Aceon® (perindopril), Mavik® (trandolapril), and Univasc® (moexipril)); Angiotensin II receptor blockers (ARBs) including Cozaar® (losartan), Diovan® (valsartan), Avapro® (irbesartan), Atacand® (candesartan), and Micardis® (telmisartan); Antiarrhythmia drugs including Tambocor® (flecainide), Procanbid® (procainamide), Cordarone®

(simvastatin). It is further contemplated that the above agents may further include

chemotherapeutic agents such as paclitaxel, sirolimus, everolimus, zotarolimus, bioiimus, and Rapamycin.

It will also be appreciated that the compounds and pharmaceutical

compositions comprising the vesicles of the present invention can be employed in combination therapies, that is, the compounds and pharmaceutical compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. The particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder (for example, an inventive vesicle delivering an agent useful for treating heart disease may be administered concurrently with another agent useful for treating heart disease), or with an agent that achieves different effects (e.g. , control of any adverse effects or side effects of treatment).

In certain embodiments, the pharmaceutical vesicle compositions of the present invention further comprise one or more additional therapeutically active ingredients (e.g. , for treatment of heart disease and/or palliative). For purposes of the invention, the term "palliative" refers to treatment that is focused on the relief of symptoms of a disease and/or side effects of a therapeutic regimen, but is not curative. For example, palliative treatment encompasses painkillers, antinausea medications, anti-pyretics, and anti-sickness drugs. The present compounds and compositions can be administered together with hormonal, steroidal anti-inflammatory agents, such as but not limited to, estradiol, conjugated estrogens (e.g. , PREMARIN, PREMPRO, AND PREMPHASE), 17 beta estradiol, calcitonin-salmon, levothyroxine, dexamethasone, medroxyprogesterone, prednisone, cortisone, flunisolide, and hydrocortisone; non-steroidal antiinflammatory agents, such as but not limited to, tramadol, fentanyl, metamizole, ketoprofen, naproxen, nabumetone, ketoralac, tromethamine, loxoprofen, ibuprofen, aspirin, and acetaminophen; disease-modifying antirheumatic agents (DMARDs), such as but not limited to, methotrexate, biologic disease-modifying anti-rheumatic agents, such as but not limited to, anti-TNF-oc antibodies, such as infliximab

(REMICADE ) and adalimumab (Humira ), fusion proteins containing the ligand- binding domain of TNF-oc, such as etanercept (ENBREL™), and interleukin-1 (IL-1) receptor antagonist, such as anakinra (KINERET™).

The pharmaceutical compositions of the present invention comprise a therapeutically effective amount of a compound, for example a vesicle(s) of the present invention formulated together with one or more pharmaceutically acceptable carriers. As used herein, the term "pharmaceutically acceptable carrier" means a nontoxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The pharmaceutical compositions of this invention can be administered to humans and other animals intravenously, via an implantable device, orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, ointments, or drops), buccally, or as an oral or nasal spray.

Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S. P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

In certain embodiments, the vesicle compositions may be in the form of ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches. In certain exemplary embodiments, formulations of the compositions according to the invention are creams, which may further contain saturated or unsaturated fatty acids such as stearic acid, palmitic acid, oleic acid, palmito-oleic acid, cetyl or oleyl alcohols, stearic acid being particularly preferred. Creams of the invention may also contain a non-ionic surfactant, for example, polyoxy-40- stearate. In certain embodiments, the active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. Ophthalmic formulation, eardrops, and eye drops are also contemplated as being within the scope of this invention. Additionally, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms are made by dissolving or dispensing the compound in the proper medium. As discussed above, penetration enhancing agents can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.

In order to prolong the effect of a drug, or agent, for example, a vesicle of the invention or a therapeutic agent delivered by a vesicle of the invention, it is often desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle. The effect of the vesicles of the invention or the therapeutic agents delivered by the vesicles can be prolonged accordingly. Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds of this invention with suitable non- irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.

Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

The active compounds, for example, vesicles of the invention, can also be in micro-encapsulated form with one or more excipients as noted above. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. Dosage forms for topical or transdermal administration of a compound of this invention, for example, a vesicle(s), include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches. The active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. Ophthalmic formulation, ear drops, eye ointments, powders and solutions are also contemplated as being within the scope of this invention. The ointments, pastes, creams and gels may contain, in addition to an active compound of this invention, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof. Powders and sprays can contain, in addition to the compounds of this invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons.

Transdermal patches have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel. According to the methods of treatment of the present invention, heart disease or disorders are treated or prevented in a subject, such as a human or other animal, by administering to the subject a therapeutically effective amount of a vesicle of the invention or a therapeutic compound delivered by a vesicle of the invention, in such amounts and for such time as is necessary to achieve the desired result. The term "therapeutically effective amount" of a compound of the invention, as used herein, means a sufficient amount of the compound, meaning vesicle or therapeutic molecule delivered by the vesicle, so as to decrease the symptoms of a disorder in a subject. As is well understood in the medical arts a therapeutically effective amount of a compound of this invention will be at a reasonable benefit/risk ratio applicable to any medical treatment.

The invention also provides for a pharmaceutical combination, e.g. a kit, comprising a first agent which is a vesicle of the invention as disclosed herein, in free form or in pharmaceutically acceptable salt form. The kit may comprise vesicles of the invention in a preloaded syringe, an intravenous bag or bottle or in combination with a medical device, for example, a stent, a valve, a balloon or a catheter. The kit can comprise instructions for its administration to a subject suffering from or susceptible to a disease or disorder. The kit may also comprise a second therapeutic agent.

The terms "co-administration" or "combined administration" or the like as utilized herein are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time.

The term "pharmaceutical combination" as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g., a vesicle of the invention or a therapeutic molecule delivered by a vesicle of the invention and a co-agent, are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g., a vesicle of the invention or a therapeutic molecule delivered by a vesicle of the invention and a co- agent, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g., the administration of three or more active ingredients. Some examples of materials which can serve as pharmaceutically acceptable carriers include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, or potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, polyacrylates, waxes, polyethylene -polyoxypropylene-block polymers, wool fat, sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes, oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; corn oil and soybean oil; glycols; such a propylene glycol or polyethylene glycol; esters such as ethyl oleate and ethyl laurate, agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen- free water, isotonic saline; Ringer's solution; ethyl alcohol, and phosphate

Combinations of substituents and variables envisioned by this invention are only those that result in the formation of stable compounds or vesicles of the invention. The term "stable", as used herein, refers to compounds which possess stability sufficient to allow manufacture and which maintain the integrity of the compound for a sufficient period of time to be useful for the purposes detailed herein (e.g., therapeutic or prophylactic administration to a subject).

The terms "isolated," "purified," or "biologically pure" refer to material that is substantially or essentially free from components that normally accompany it as found in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. Particularly, in certain embodiments, the compound is at least 85% pure, more preferably at least 90% pure, more preferably at least 95% pure, and most preferably at least 99% pure.

Kits of Pharmaceutical Systems

The present compositions may be assembled into kits or pharmaceutical systems for use in treatment of heart disease. Kits or pharmaceutical systems according to this aspect of the invention comprise a carrier means, for example one or more vesicles of the invention contained within a preloaded syringe, and IV bag or bottle or in combination with a medical device, for example, a stent, valve, balloon or catheter. Alternatively, the carrier means may comprise any one of a box, carton, tube or the like, having in close confinement therein one or more container means, such as vials, tubes, ampules, bottles and the like. The vesicles of the kits or pharmaceutical systems of the invention may have any one of the functional properties described herein for the vesicles of the methods of the invention.

The invention provides kits for treating and preventing disease, for example, heart disease. In one embodiment, the kit includes a vesicle composition containing at least one therapeutic agent, nucleotide, or polypeptide that binds a chemical, polypeptide, or polynucleotide whose expression is altered in a disease of interest, for example, heart disease. In another embodiment, the invention provides a kit that contains a therapeutic agent that binds a nucleic acid molecule whose expression is altered in a disease of interest, for example, heart disease, where the agent is present in a vesicle of the invention. In some embodiments, the kit comprises a sterile container which contains the binding agent; such containers can be a syringe, an IV bag or bottle, and/or a medical device, for example, a stent, valve, balloon or catheter, boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.

If desired, the kit is provided together with instructions for using the kit to treat and prevent a disease of interest, for example, heart disease. The instructions will generally include information about the use of the composition or therapeutic agent for treating a subject having a disease, for example, heart disease, or having a propensity to develop heart disease. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent; warnings; indications; counter- indications; animal study data; clinical study data; and/or references. The instructions may be printed directly on the container (when present), as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.

Animal Models

The vesicles of the invention are also applicable to animals, and may also be used to facilitate biomedical research of heart disease in a variety of animal model systems. For example, mouse models of neointima formation include, but are not limited to, carotid artery wire injury and carotid artery ligation. Rabbit models of neointima formation include femoral artery wire injury. Mouse models for atherosclerosis include ApoE -/- mice fed a high fat diet. The neointima models are evaluated by histology of the vessel.

Mouse models for cardiomyopathy include thoracic aorta banding (TAC), Abdominal Aorta Banding, and specific transgenic and knockout animals. The cardiomyopathy can be followed with implanted pressure transducer catheters, flow loop catheters, and echocardiography in live animals, and by histology in sacrificed animals.

Porcine models are performed on wild type animals, and enable both coronary catheterization and hemodynamic modeling.

Recombinant Polypeptide Expression

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the vesicles and assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.

EXAMPLES

Example 1:

Targeting of Human Aortic Smooth Muscle Cells With GFP Labeled Vesicles Figures 1A through 1H are microscopic images of endothelial cells treated with vesicles of the invention. These Figures show the ability of the inventive vesicles to target human aortic smooth muscle cells and deliver their contents into the targeted cells. Figure 1A shows human aortic smooth muscle cells (HASMCs) treated with exosomes from endothelial cells stably expressing the exosome marker CD63-GFP. Cells are imaged by confocal microscopy with DIC and FITC images being merged, thereby revealing GFP positivity throughout the cytoplasm. Figure IB shows untreated human aortic smooth muscle cells imaged in parallel to the treated cells of Figure 1A. Figures 1C, ID, and IE depict human aortic smooth muscle cells treated with exosomes from endothelial cells stably expressing the exosome marker CD63-GFP that are imaged by immunocytochemistry to smooth muscle actin ( SMA) with Cy3 labeled antibody (Figure 1C) and with a FITC filter (Figure ID) to image transferred GFP labeled exosomes in cytoplasm. Figure IE shows the merged image of Figures 1C and ID. Figure IF shows a confocal microscopic image of co-cultured endothelial cells stably expressing the exosome marker CD63-GFP and human aortic smooth muscle cells, imaged with immunocytochemistry to SMS (smooth muscle actin) with Cy3 labeled antibody to identify the smooth muscle cells, and with a FITC filter to identify endothelial cells and transferred GFP-tagged exosomes. Yellow signal indicates co-localization of SMA and transferred GFP tag to a smooth muscle cell. Blue signal indicates DAPI stained nuclei. Figure 1G shows a confocal microscopic image of human aortic smooth muscle cells treated with exosomes from endothelial cells stably expressing the exosome marker Flag-CD63-GFP, imaged by immunocytochemistry to the Flag tag with Cy3 labeled antibody. Blue signal indicates DAPI stained nuclei. Untreated smooth muscle cells (H) have no background as detected by immunocytochemistry (ICC) to flag. CD63 is known to be loaded into exosomes by many cell types; however, the mechanisms for selection of protein loading are currently unknown.

In one embodiment, the exosomes of the invention are obtained from conditioned media by centrifugation. The pellet is resuspended in PBS, media, or media with serum, or a portion of the conditioned media. The volume used for suspension is approximately 1 ml per each T150 plate used as source of the conditioned media. The exosomes are pipetted up and down to break up any aggregates, and the tube is incubated at 37°C for 30 minutes, after which time the media is pipetted again. The exosome mixture is added (e.g. about 20 μΐ to about 100 μΐ) to a tissue culture well containing about 100 ul of media and HASMCs, which have been plated 12-24 hrs prior at a confluence 20-50%.

Example 2:

Targeting of Epithelial Cells With miRNA Loaded Vesicles

Figures 2A through 2C show the ability of miR (also known as miRNA) loaded vesicles to target smooth muscle cells (SMCs) and deliver their miRNA to the SMCs. Human ECs are transfected with pre-miR 203 or negative control pre-miR (e.g. , hsa-mir-203 MI0000283:

GUGUUGGGGACUCGCGCGCUGGGUCCAGUGGUUCUUAACAGUUCAACA GUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGGG CGCGGCGACAGCGA; mature mir-203: GUGA AAUGUUUAGGACCACUAG) . Cells are washed with PBS ten times, and conditioned media collected over 48 hrs. Exosomes are isolated from the conditioned media of a 100 mm dish of endothelial cells by serial centrifugation at 300 g, 24,000 g, and 110,000 g. The exosome pellet is collected after the 110,000 g centrifugation step, resuspended in 1 ml of media, and plated on a 100 mm dish of human aortic SMCs at 50% confluence. The SMCs are incubated at 37°C for 24 hrs, the media is removed, the cells are washed with PBS ten times, and then collected after trypsinization. Cellular RNA is obtained with the Qiagen miRNAeasy kit. RT and qPCR of U6 and miR-203 is performed using ABI kits to U6 and miR-203. The level of miR-203 in ECs, exosomes and recipient SMC is quantified by qPCR, normalized to U6 RNA, and is represented as a ratio of the level of miR-203 in the transfected cell group to the level of miR-203 in the control miR transfected group (see Figure 2A). By qPCR, miR-203 increases 317 fold in exosomes, as compared to exosomes obtained from ECs transfected with negative control miR. By qPCR, miR 203 increases 126 fold in smooth muscle cells after treatment with those exosomes, as compared to SMCs treated with exosomes derived from ECs.

Figure 2B shows confocal microscopy images of human aortic smooth muscle cells (HASMCs) treated with exosomes from human endothelial cells transfected with Alexa-fluor 555 RNAi. ECs are transfected with Alexafluor555 RNAi, cells are washed, and conditioned media collected over 48 hrs. Exosomes are isolated, and plated onto HASMCs. Cells are imaged 24 hours later by fluorescence, revealing transfer of fluorescently labeled RNA from transfected endothelial cells, to exosomes, and then to smooth muscle cell. Images are grayscale representations of merged DAPI stained nuclei, and red fluorescent RNA, and reveal fluorescent RNA in the SMC cytoplasm. Figure 2C shows confocal microscopy images of SMCs treated with EC derived exosomes incubated with Alexa-fluor 555 RNAi at 40μΜ for 4 hours, and centrifuged at 110,000 g to remove unincorporated RNAi. The exosomes are plated on human aortic smooth muscle cells for 24 hrs. The EC derived exosomes in combination with the human aortic smooth muscle cells are imaged by fluorescence to confirm uptake by exosomes and transfer to SMCs. Images are grayscale

representations of merged DAPI stained nuclei, and red fluorescent RNA, and reveal fluorescent RNA in the SMC cytoplasm.

In one embodiment, vesicles are loaded with miR203 as follows. The cells are transfected with pre-mir203 at 20 uM with lipofectamine. After 24 hrs, the media is removed, and cells washed with PBS to remove unincorporated lipid reagent. New media is added, and after 48hrs, the conditioned media of the cell culture is used as a source for exosome isolation.

Example 3:

Vesicle Treated Human Aortic Smooth Muscle Cells Show Decreased

Proliferation

Figures 3A and 3B show that exosomes carrying endogenous miRNA reduce proliferation of human aortic smooth muscle cells, as compared to cells treated with Delbucco' s Minimal Essential (DME) medium alone. Figure 3A depicts the results of a cell proliferation assay for muscle cells treated with either DME or exosomes.

Approximately 2000 Human aortic smooth muscle cells are plated in 100 μΐ 10% serum DME per well in a 96 well plate, grown overnight, and treated with either an additional 100 μΐ 10% serum DME, or exosomes from human endothelial cells that are resuspended in 10% serum DME. Cell proliferation iss assessed using Promega CellGlo assay at 24 h, 48 h, and 72 h. There is decreased proliferation in exosome treated cells as compared to cells grown in DME alone. Particularly, inhibition of cell growth in the presence of exosomes is on the order of 6.5-fold as compared to cell growth in the presence of DME alone. Figure 3B summarizes the results of a Tunel assay, which shows that DME and exosome treated SMCs display no difference in the level of apoptosis, thereby demonstrating that the exosome mediated inhibition of cell growth is not due to an increase in apoptosis.

Example 4:

miRNA Loaded Vesicles Do Not Contain Non-specific RNAs

Figures 4A, 4B, and 4C show data demonstrating the purity of the content of miRNA loaded vesicles. In Figure 4A, RNA from whole endothelial cells or from endothelial cell derived exosomes is analyzed on a Agilent Bioanalyzer Pico chip. No ribosomal or large RNA contamination of the exosomal RNA is detected. Figure 4B shows the results of the analysis of EC derived exosome RNA with an Agilent Bioanalyzer Small RNA chip and demonstrates that RNA in exosomes is less than 60 nt in length, with a peak length occurring at approximately 20-24 nt. Figure 4C shows the results of the analysis of EC or EC-derived exosome miRNA content by ABI miRNA array of 377 miRNA. miRNA levels are normalized to U6 RNA in either the cell or exosomal compartment and organized by increasing amount in the cell (see data presented at Figure 4C). miRNA levels in cells or exosomes do not correlate, with a best fit line with an R2 value of 0.38.

Example 5:

Human Aortic Smooth Muscle Cells Treated With Vesicles Display Decreased

Proliferation

Figure 5 shows a bar graph depicting the results of cell growth assays. Human aortic smooth muscle cells are plated in 500 μΐ 10% serum DME per well at 40% confluence in a 12 well plate, and transfected with either i) negative control RNAi at 20μΜ for "supernatant" and "exosome treated" controls, ii) RNA derived from EC exosomes using the Qiagen miRNAeasy kit at 20μΜ (labeled "whole RNA from exosomes"), or iii) RNA derived from EC exosomes using the Invitrogen PureLink miRNA isolation kit at 20μΜ (labeled "small RNA from Exosomes"). After 24 hours, the media is changed to 500μ1 of 10% serum DME. Wells are further treated with either lOOul of supernatant, or whole exosomes from ECs in ΙΟΟμΙ of the conditioned media supernatant. Experiments were performed in triplicate. Cell proliferation is assessed using the Promega CellGlo assay at 72 hours and reveals decreased proliferation in exosome treated cells, and in cells transfected with exosomal RNA. Example 6:

Characteristics of miRNA Loaded Vesicles

Human endothelial cells stably cloned with Estrogen Receptor Alpha (ERa) are treated with ΙΟηΜ 17-β Estradiol (E2) or vehicle (EtOH) daily for 72 hours. Exosomes are collected from the conditioned media by serial ultracentrifugation and resuspended in 2 ml of conditioned media supernatant. 100 μΐ of the resuspended exosomes or the supernatant alone is plated on human aortic smooth muscle cells in a 96 well format. Cell proliferation is evaluated with the Promega CellGlo

luminescence assay. As presented in Figure 6A, ECs exposed to E2 produce exosomes that inhibit cell growth of SMCs approximately 1.7-fold more than exosomes derived from endothelial cells exposed to vehicle alone. Figure 6B shows the results of ABI miRNA array analysis of 377 miRNAs, either from exosomes derived from EC exposed to E2 or from exosomes derived from EC exposed to vehicle alone. miRNAs with an exosome expression greater than twice that of the cellular level were compared between exosomes derived from EtOH and E2 treated cell populations. 33 miRNAs are uniquely more abundant in the E2 exosome compared to their cell content.

Example 7:

Transfer of microRNA Contained in Secreted Exosomes

EC mediated inhibition of vascular smooth muscle cell (VSMC) proliferation plays an important role in maintaining vascular wall homeostasis and preventing atherosclerosis. EC secreted exosomes contain abundant miRs and protect their contents from degradation by circulating RNases. The miR population in secreted exosomes differs significantly from the cytoplasmic miR population, indicating regulation of miR packaging in ECs.

Conditioned media of ECs inhibits human aortic VSMC (HA VSMC) proliferation by 37.4% (n=4, p=0.0006) at 120 hours, while exosome-depleted conditioned media lacks this inhibitory effect (n=4, p=0.0001). Purified exosomes applied directly to VSMCs inhibits HA VSMC proliferation by 28.8% at 72 hours (n= 8, p= 0.0107) and by 26.9% at 96 hours (n=8, p=0.0596). Similar results are found with coronary artery SMC proliferation (data not shown). EC-derived exosomes are taken up into recipient SMCs, as seen by ICC to an exosome marker, GFP-CD63, and by qPCR of transferred miRNAs. Transfection of RNA purified from EC secreted exosomes into VSMC is sufficient to inhibit SMC proliferation (34.8%, n= 9, p=0.0001), and provides a similar level of inhibition compared to whole exosome treatment (33.5%, n=9, p=0.001). The miRNA population of exosomes can be engineered through transfection of the progenitor EC; transfection with pre-mir-203 leads to a 317-fold increase in exosomal mir-203 levels, and a 126-fold increase in SMCs treated with EC-derived conditioned media.

Methods and Materials

Isolation of Exosomes. Exosomes are isolated from the conditioned media of cell lines. Primary cell lines from a patient or immortalized cells are grown in media that has been ultracentrifuged at 110,000 g to remove any vesicles. Cells are grown to confluence and the conditioned media is removed after 24 to 72 hours.

A general protocol for isolation of exosomes from conditioned media or serum involves serial centrifugation and ultracentrifugation. The conditioned media is centrifuged at lOOOg for 6 minutes to remove cells; the supernatant is removed and centrifuged at 12,000 g for 30 minutes to remove cell debris; the supernatant from this step is ultracentrifuged at 110,000 g for 70 minutes, and the resulting pellet contains the exosomes. This pellet is washed with phosphate buffered saline, and is pooled with pellets from multiple tubes, and ultracentrifuged again at 110,000 g for 70 minutes. The supernatant is removed, and the pellet of exosomes is resuspended in PBS, media or a portion of the supernatant depending on the planned downstream application.

The first centrifugation step may be replaced with filtration through a 0.45 micrometer filter to remove cells; the wash through is serially centrifuged at 12,000 g and 110,000 g as above. An alternative protocol uses pull down isolation of the exosomes from solution with immuno-isolation using paramagnetic sepharose beads coated with antibody to CD63 or MHC II. Hybrid and Synthetic Vesicles:

A solution of exosomes and lipid vesicles is incubated at room temperature for an hour, resulting in fusion of some portion of these populations into a hybrid vesicle, wherein the resulting hybrid vesicles comprise portions of the patient-derived vesicles and portions of the synthetic vesicle. Depending on the size of the synthetic vesicle used, the unincorporated synthetic vesicles are removed from solution by differential ultracentrifugation. In one embodiment, the synthetic vesicles are removed from solution by ultracentrifugation at 30,000 g, and the supernatant containing the exosomes and hybrid exosomes is ultracentrifuged at 110,000 g, producing a pellet containing both the primary exosomes and the hybrid exosomes. In other

embodiments different synthetic vesicles, which are removed from solution at different speeds are used.

Vesicle Loading

Transfection of the Donor Cells Established cell lines or primary cell lines from patients are cultured using standard cell culture techniques with the exception that all media is ultracentrifuged to remove any contaminating small vesicles. These cells are transfected using standard transfection methods, including lipid transfection, adenoviral infection, retroviral infection or electroporation such that the cells overexpress a particular RNA, miRNA, siRNA or other nucleic acid. After 24 hours the media is removed from cells, which are washed thoroughly with phosphate buffered solution, after which fresh media is added. The media is maintained on the cells for 24-72 hours and then collected as conditioned media. Exosomes in solution are isolated as above. The enrichment of the biomolecule in the exosomes is determined by isolation of the RNA and miRNA and comparison by an appropriate method (qPCR, western blot analysis) to the RNA of exosomes from control transfected cells. The exosomes are applied to target cells in culture or injected in vivo.

Direct Transfection of Vesicles with Lipid Transfection Reagent

Lipid based transfection reagents are loaded with RNA, miRNA, or siRNA by standard incubation of the lipid reagent in media with the molecule of choice. These lipid transfection vesicles are then incubated with a preparation of exosomes in low serum media for one to six hours. This incubation allows direct fusion of the synthetic lipid vesicles with the patient derived exosomes, resulting in hybrid vesicles containing components of both the synthetic vesicles and the natural exosomes.

Removal of unincorporated synthetic vesicles from solution is as described above. The final pellet of the 110,000 g ultracentrifugation contains both hybrid exosomes and naive exosomes. This mixture of exosomes is then resuspended in media for future application to cell lines. The uptake of the new biomolecule into the exosomes is evaluated by qPCR to the RNA or miRNA to confirm enrichment.

Direct Loading of Vesicles with Small RNA Molecules

Exosomes are prepared from cell lines and conditioned media as outlined above. Exosomes are resuspended in low serum media or serum free media, to which the miRNA, siRNA, RNA or biomolecule is added and incubated for 1 hour to 6 hours. Without being bound by any particular theory, the nucleic acids are taken up into the exosomes, and the resulting exosomes are enriched in the biomolecule. The unincorporated miRNA or siRNA is removed from solution by ultracentrifugation at 110,000 g for 20 minutes; the pellet contains the exosomes, while the supernatant contains the unincorporated small nucleic acid such as miRNA. The pellet is further washed with PBS, and ultracentrifuged again at 110,000 g for 20 minutes to achieve a pure preparation of small vesicles. These vesicles are then placed on recipient cells or injected in vivo. Uptake of the biomolecule is confirmed by standard qPCR assay or imaging of a labeled fluorescent biomolecule.

Methods for Identifying Therapeutic Effect in a Patient

One of skill in the art will appreciate that there are a variety of methods available for monitoring the effect of therapeutic agents according to the invention, that treat or prevent heart disease. These methods include, but are not limited to, the following:

1. Exercise Stress Test - with echocardiography, nuclear imaging or

ECG;

2. Echocardiography to evaluate for ventricular dysfunction, ejection fraction; 3. Endothelial Function Tests; a. Pulse Wave Velocity(PWV); b. Pressure Pulsation Signal;

4. Carotid Duplex Ultrasound;

5. Nuclear Perfusion Scan;

6. Cardiac Computed Tomography - CT coronary angiography;

7. Cardiac Magnetic Resonance - Coronary MR angiography;

8. Angiography;

9. Intravascular Ultrasound;

10. Symptoms of coronary and heart disease, including shortness of breath, dizziness, fatigue, chest pain;

11. 6 minute walk test;

12. ECG - electrocardiogram;

13. Biomarkers - CRP, ESR, troponin;

14. Optical coherence tomography.

Other Embodiments

From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Claims

We claim:

1. A composition comprising naturally occurring vesicles derived from a nucleated cell, wherein said naturally occurring vesicles comprise at least one therapeutic nucleic acid or polypeptide.

2. A composition comprising fusion vesicles derived in part from a naturally occurring vesicle, and in part from a synthetic vesicle, wherein said naturally occurring vesicle comprises at least one therapeutic nucleic acid or polypeptide and said synthetic vesicle comprises at least one therapeutic agent.

3. A composition comprising a population of vesicles, wherein said population comprises naturally occurring vesicles comprising at least one therapeutic nucleic acid or polypeptide, in combination with synthetic vesicles, and fusion vesicles.

4. The composition of claim 1, 2 or 3, wherein said naturally occurring vesicles are between about 30 and about 500 nm in diameter.

5. The composition of claim 1, 2 or 3, wherein said naturally occurring vesicles are between about 30 and about 100 nm in diameter.

6. The composition of claim 1, 2 or 3, wherein said naturally occurring vesicles are between about 100 and about 300 nm in diameter.

7. The composition of claim 1, 2 or 3, wherein said naturally occurring vesicles are between about 300 and about 500 nm in diameter.

8. The composition of claim 1, 2 or 3, wherein said naturally occurring vesicles are exosomes.

9. The composition of claim 1, 2 or 3, wherein said therapeutic nucleic acid is selected from the group consisting of siRNA, shRNA, miRNA, dsRNA, and an expression vector comprising a nucleic acid encoding a therapeutic polypeptide.

10. The composition of claim 1, 2 or 3, wherein said at least one therapeutic nucleic acid is selected from the group consisting of: miR-1, let-7b, miR-15, miR-16, miR-17, miR-19b, miR-20a, miR-20b, miR-21, miR-23a, miR-24, miR-25, miR-28-5p, miR- 29a, miR-30c, miR-31, miR-34a, miR-34c-5p, miR-92a, miR-100, miR-106a, miR- 125b, miR-126, miR-128, miR-130a, miR-130b, miR-132, miR-133a, miR-134, miR- 135-3p, miR-138, miR-139-3p, miR-139-5p, miR-146a, miR-155, miR-185, miR- 186, miR-191, miR-193a-5p, miR-193b, miR-197, miR-198, miR-202, miR-212, miR-221, miR-222, miR-223, miR-224, miR-320, miR-323-3p, miR-328, miR-331- 3p, miR-337-5p, miR-339-3p, miR-339-5p, miR-342-3p, miR-346, miR-361-5p, miR- 370, miR-371-3p, miR-375, miR-376a, miR-422a, miR-423-5p, miR-433, miR-491- 5p, miR-493, miR-423-5p, miR-483-5p, miR-484, miR-495, miR-503, miR-505, miR- 517c, miR-520g, miR-523, miR-532-5p, miR-545, miR-548c-5p, miR-571a, miR-

579, miR-590-5p, miR-597, miR-618, miR-671-3p, miR-708, miR-885-5p, miR-886- 5p, and miR-874.

11. The composition of claim 1, 2 or 3, wherein said at least one therapeutic nucleic acid is selected from the group consisting of: miR-222, miR-24, miR-484, miR-92a, miR-320, miR-21, miR-106a, miR-17, miR-100, miR-19b, miR-191, miR-126, miR- 99a, miR-423-5p, miR-197, miR-20a, miR-221, miR-125b, miR-342-3p, miR-16, miR-34a, miR-31, miR-874, miR-223, miR-224, and miR-193b.

12. The composition of claim 1, 2 or 3, wherein said at least one therapeutic nucleic acid is selected from the group consisting of: miR-212, miR-130b, miR-532-5p, miR- 202, miR-152, miR-618, miR-548c-5p, miR-590-5p, miR-130a, miR-20b, miR-23a, miR-139-3p, miR 339-5p,miR-375, and miR-505.

13. The composition of claim 1, 2 or 3, wherein said at least one therapeutic nucleic acid is miR-203.

14. The composition of claim 1, 2 or 3, wherein said therapeutic polypeptide is selected from the group consisting of RGS2, nitric oxide synthase (eNOS,

(endothelial NOS)), iNOS (inducible NOS) , nNOS (neuronal NOS), Ι-κΒα, Ι-κΒβ, I- κΒγ, plOO, pl05, Bcl-3, cGMP-dependent protein kinase (PKG), c-Kit and p27Kipl, Sprouty-related protein SPRED1, phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2/p85-beta), Spl, CDK inhibitors (CDKIs), INK4 family proteins (pl4, pl5, pl6, pl8 and pl9), KIP/CIP family (p21, p27, and p57), p53, TOR/RAFT, PPtase, PIAS, SHP1, eNOS coactivators, tetrahydrobiopterin and folic acid, and 1-arginine.

15. The composition of claim 1, wherein said nucleated cell is derived from a subject to be treated with said naturally occurring vesicles.

16. The composition of claim 15, wherein said vesicles are non-immunogenic when administered to said subject.

17. The composition of claim 1, wherein said at least one therapeutic nucleic acid or polypeptide is endogenous to said nucleated cell.

18. The composition of claim 17, wherein said nucleated cell over-expresses said endogenous therapeutic nucleic acid or polypeptide.

19. The composition of claim 1, wherein said at least one therapeutic nucleic acid or polypeptide is exogenous to said nucleated cell.

20. The composition of claim 19, wherein said at least one therapeutic nucleic acid or polypeptide is produced by a transgenic construct in said nucleated cell.

21. The composition of claim 1, 2 or 3, wherein said vesicles are derived from endothelial cells.

22. The composition of claim 21, wherein said at least one therapeutic nucleic acid is endogenous to said endothelial cell.

23. The composition of claim 21 previous, wherein said vesicles are delivered to smooth muscle cells.

24. The composition of claim 1, 2 or 3, wherein said composition is in combination with a medical device or is formulated as a coating for a medical device.

25. The composition of claim 24, wherein said medical device is selected from the group consisting of a stent, valve, catheter and balloon.

26. The composition of claim 1, 2 or 3, wherein said vesicles are in combination with a container selected from the group consisting of: an intravenous bag, intravenous bottle, pump and syringe.

27. The composition of claims 1, 2 or 3, wherein said vesicles are delivered to at least one of the heart, a vein and an artery.

28. The composition of claims 1, 2 or 3, wherein said vesicles are delivered to endothelial cells, smooth muscle cells and or cardiac cells.

29. The composition of claims 1, 2 or 3, wherein said vesicles comprise a therapeutic nucleic acid or protein that inhibits a heart disease selected from the group consisting: of intimal hyperplasia, smooth muscle proliferation, neointimal hyperplasia, hypertension, atherosclerosis, heart failure, and ischemia.

30. A method of delivering a therapeutic nucleic acid or polypeptide to a cell or tissue, comprising: administering said vesicles to said cell or tissue, wherein said vesicles comprise a therapeutic nucleic acid or polypeptide, thereby delivering said therapeutic nucleic acid or polypeptide.

31. A method of delivering a therapeutic nucleic acid or polypeptide to a subject in need thereof, comprising: administering naturally occurring vesicles to said subject, wherein said naturally occurring vesicles are derived from a nucleated cell of said subject, or a nucleated cell of a second subject, wherein said nucleated cells of said second subject are non-immunogenic when administered to said subject, wherein said vesicles comprise a therapeutic nucleic acid or polypeptide; thereby delivering said therapeutic nucleic acid or polypeptide.

32. A method of delivering a therapeutic nucleic acid or polypeptide to a subject in need thereof, comprising: transforming a nucleated cell with a nucleic acid encoding a therapeutic RNA or a polypeptide; expressing said therapeutic RNA or polypeptide in said nucleated cell; loading said therapeutic nucleic acid or polypeptide into naturally occurring vesicles derived from said nucleated cell; collecting said loaded naturally occurring vesicles; and administering said loaded naturally occurring vesicles to said subject, thereby delivering said therapeutic nucleic acid or polypeptide.

33. A method of delivering a therapeutic nucleic acid or polypeptide to a cell or tissue, comprising: transforming a nucleated cell with a nucleic acid encoding a therapeutic RNA or a polypeptide; expressing said therapeutic nucleic acid or polypeptide in said nucleated cell; loading said therapeutic nucleic acid or polypeptide into naturally occurring vesicles derived from said nucleated cell; collecting said loaded naturally occurring vesicles; and administering said loaded naturally occurring vesicles to said cell or tissue, thereby delivering said therapeutic nucleic acid or polypeptide.

34. A method of treating cardiovascular disease in a subject in need thereof, comprising: administering naturally occurring vesicles to said subject, wherein said naturally occurring vesicles are derived from a nucleated cell of said subject, or a nucleated cell of a second subject, wherein said nucleated cells of said second subject are non-immunogenic when administered to said subject, and wherein said vesicles comprise a therapeutic nucleic acid or polypeptide.

35. A method of treating cardiovascular disease in a subject in need thereof, comprising: transforming a nucleated cell with a nucleic acid encoding a therapeutic nucleic acid or a polypeptide; expressing said therapeutic nucleic acid or polypeptide in said nucleated cell; loading said therapeutic nucleic acid or polypeptide into naturally occurring vesicles derived from said nucleated cell; collecting said loaded naturally occurring vesicles; and administering said loaded naturally occurring vesicles to said subject.

36. The method of any one of claims 30-35 wherein said composition is in combination with, or is formulated as a coating for, a medical device selected from the group consisting of a stent, valve, catheter or balloon.

37. The method of any one of claims 30-35, wherein said vesicles are in combination with a container selected from the group consisting of: an intravenous bag, an intravenous bottle, a pump and a syringe.