WO2013048591A1 - Procédés et compositions pour induire une hypertrophie physiologique sur la base des teneurs en acides gras chez des pythons à jeun par rapport à des pythons alimentés - Google Patents

Procédés et compositions pour induire une hypertrophie physiologique sur la base des teneurs en acides gras chez des pythons à jeun par rapport à des pythons alimentés Download PDF

Info

Publication number
WO2013048591A1
WO2013048591A1 PCT/US2012/041347 US2012041347W WO2013048591A1 WO 2013048591 A1 WO2013048591 A1 WO 2013048591A1 US 2012041347 W US2012041347 W US 2012041347W WO 2013048591 A1 WO2013048591 A1 WO 2013048591A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
acid
aqp7
fatty acid
python
Prior art date
Application number
PCT/US2012/041347
Other languages
English (en)
Inventor
Leslie A. Leinwand
Cecilia Riquelme
Brooke Harrison
Jason Magida
Original Assignee
The Regents Of The University Of Colorado
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US13/272,910 external-priority patent/US20120142776A1/en
Application filed by The Regents Of The University Of Colorado filed Critical The Regents Of The University Of Colorado
Publication of WO2013048591A1 publication Critical patent/WO2013048591A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/08—Solutions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS, COOKING OILS
    • A23D9/00—Other edible oils or fats, e.g. shortenings, cooking oils
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/115—Fatty acids or derivatives thereof; Fats or oils
    • A23L33/12—Fatty acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/201—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having one or two double bonds, e.g. oleic, linoleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention is generally related to molecular biology and cardiology. More specifically, it concerns methods and compositions related to inducing physiologic hypertrophy in a cell, such as a cardiac cell, in therapeutic and preventative applications for cardiovascular diseases and conditions. In specific embodiments, methods and compositions involve fatty acid compositions.
  • Cardiac enlargement more commonly termed cardiac hypertrophy— is a major risk factor of premature cardiovascular morbidity and mortality. In fact, cardiac hypertrophy is the best predictor of mortality. Few drugs are effective in treating the most costly endpoint of these diseases, congestive heart failure. The most commonly used treatments include digoxin, ACE inhibitors, diuretics, and ⁇ adrenergic receptor blockade.
  • An adaptive growth of the heart also occurs during normal postnatal growth or as a consequence of physical conditioning such as exercise. This physiologic hypertrophy is associated with cardiovascular benefit. Indeed, evidence suggests that physiological cardiac growth induced by exercise may protect against pathological stimuli such as pressure overload.
  • Burmese pythons ⁇ Python molurus are opportunistic ambush predators, adapted to consume large meals at infrequent intervals.
  • pythons exhibit a large regulatory response to the digestion process including an increase in its metabolic rate, nutrient transport and organ mass. It has been determined that the python heart can enlarge up to 60% 2 days post-feeding and it reverts to fasting size very rapidly (Secor and Diamond, 1998). Most other regulatory parameters also return to pre-feeding states.
  • Some aspects of the hypertrophic response in the python's heart were reported by Andersen et a/.(2005). These authors determined that the increased mass of the heart does not arise from an increase in the fluid content of the tissue. Moreover, the authors report an increase in the ventricular mRNA levels for cardiac myosin.
  • physiologic hypertrophy is induced in cardiac cells or cardiomyocytes.
  • methods for inducing physiological hypertrophy in a cardiac cell in a subject comprising administering to the subject an effective amount of an aquaporin 7 (AQP7) inducer.
  • methods for inducing physiological cardiac hypertrophy in a patient with hypertension comprising administering to the patient an effective amount of an AQP7 inducer.
  • methods for treating a patient with symptoms or signs of hypertension comprising administering to the patient an effective amount of an AQP7 inducer.
  • methods for preventing or treating cardiac fibrosis in a patient suspected of having cardiac fibrosis or at risk for cardiac fibrosis comprising administering to the patient an effective amount of an AQP7 inducer.
  • Embodiments include methods for inducing physiologic hypertrophy in cardiac cells comprising administering to the cardiac cells an effective amount of a pharmaceutical composition comprising an isolated or purified fatty acid composition, wherein the fatty acid composition comprises a combination of myristic acid, palmitic acid, and palmitoleic acid fatty acid (MPP fatty acids).
  • a pharmaceutical composition comprising an isolated or purified fatty acid composition, wherein the fatty acid composition comprises a combination of myristic acid, palmitic acid, and palmitoleic acid fatty acid (MPP fatty acids).
  • a pharmaceutical composition comprising an isolated or purified fatty acid composition, wherein the fatty acid composition comprises a combination of myristic acid, palmitic acid, and palmitoleic acid fatty acid (MPP fatty acids).
  • MPP fatty acids myristic acid, palmitic acid, and palmitoleic acid fatty acid
  • methods of providing a cardiovascular benefit to a subject comprising administering to the subject an effective amount of a composition comprising or consisting essentially of a combination of MPP fatty acids.
  • the composition further comprises one or more vitamins or other essential nutrients.
  • a composition may be a pharmaceutical composition, but it need not be a pharmaceutical composition. Any embodiment discussing a pharmaceutical composition may also be implemented as a food composition.
  • Additional embodiments concern methods for treating a subject diagnosed with or at risk for a cardiovascular disease or condition. Specific cardiovascular diseases and conditions are discussed herein.
  • a subject is administered an effective amount of a pharmaceutical composition.
  • the pharmaceutical composition comprises a fatty acid composition, which may or may not be a combination of MPP fatty acids.
  • Other embodiments involve methods of treating a patient for a cardiovascular disease or condition comprising providing to the patient an effective amount of a pharmaceutical composition comprising an isolated or purified fatty acid composition, wherein the fatty acid composition comprises a combination of myristic acid, palmitic acid, and palmitoleic acid fatty acid (MPP fatty acids).
  • a pharmaceutical composition comprising an isolated or purified fatty acid composition, wherein the fatty acid composition comprises a combination of myristic acid, palmitic acid, and palmitoleic acid fatty acid (MPP fatty acids).
  • methods concern cardiac cells or cardiomyocytes in a subject.
  • the subject is a mammal.
  • the subject is a human patient.
  • a subject is an adult.
  • the subject is a domestic animal.
  • the subject is in need of exercise.
  • the subject may be overweight or at risk for diabetes.
  • steps for identifying a subject that may benefit from inducement of physiologic hypertrophy are included. Such steps may involve identifying a subject exhibiting symptoms of a cardiovascular disease or condition or at risk for a cardiovascular disease or condition. Such cardiovascular diseases and conditions are discussed in herein.
  • methods include analyzing a subject for a cardiovascular disease or condition or symptoms of a cardiovascular disease or condition. Other embodiments may involve performing tests on a subject to evaluate the subject for symptoms of a cardiovascular disease or condition or for increased risk for a cardiovascular disease or condition. In other embodiments, a subject may be evaluated based on the results of tests for symptoms of a cardiovascular disease or condition. The subject may also be evaluated for symptoms or risk based on the taking of a patient history.
  • a patient is treated with a pharmaceutical composition. This may occur after an evaluation of the patient, after tests are performed on the patients, after results of tests on the patient are obtained, and/or after a diagnosis of the patient with a cardiovascular disease or condition or diagnosis of a significant risk of developing a cardiovascular disease or condition.
  • Other aspects may include monitoring the patient for symptoms of the cardiovascular disease or condition after the patient has been provided with the pharmaceutical composition.
  • a subject may also be evaluated for cardiovascular improvement following administration of a pharmaceutical composition that induces physiologic hypertrophy.
  • the AQP7 inducer is a pharmaceutical composition comprising a fatty acid combination, which means a combination of at least two different fatty acids.
  • a fatty acid composition contains a combination of myristic acid (C:14), palmitic acid (C:16), and palmitoleic acid (C:16.1) (collectively "MPP fatty acids").
  • a pharmaceutical composition and/or fatty acid composition comprises myristic acid, by itself or in combination with other saturated and/or unsaturated fatty acids.
  • a pharmaceutical composition and/or fatty acid compositions comprises palmitic acid, by itself or in combination with other saturated and/or unsaturated fatty acids.
  • a pharmaceutical composition and/or fatty acid compositions comprises palmitoleic acid, by itself or in combination with other saturated and/or unsaturated fatty acids.
  • the ratio of one fatty acid to a second fatty acid may be about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06, 1:0.05, 1:0.04, 1:0.03, 1:0.02, 1:0.01, and any range derivable therein.
  • a composition with more than two fatty acids it is contemplated that the ratio of a first fatty acid to a second fatty acid may be what is described in the previous paragraph.
  • such a composition may have a ratio of the second fatty acid to a third fatty acid, or a ratio of the first fatty acid to a third fatty acid, as follows: about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4
  • a composition containing more than three fatty acids may be what is described in the previous paragraph, and the second and third fatty acids as described earlier in this paragraph.
  • such a composition may have a ratio of the third fatty acid to a fourth fatty acid as follows: about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3
  • any ratios discussed herein refer to molar ratios, however, it is specifically contemplated that any ratios may also be implemented in volume to volume ratios, or weight to weight ratios as well, when specified as such.
  • compositions and/or fatty acid compositions may contain a ratio of myristic acid to palmitic acid that is about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06, 1:0.05, 1:0.04, 1:0.03, 1:0.02, 1:0.01, and any range derivable therein.
  • the composition may contain a ratio of myristic acid or palmitic acid to another component in the composition that is about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06,
  • compositions may contain a ratio of myristic acid to palmitoleic acid that is about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06, 1:0.05, 1:0.04, 1:0.03, 1:0.02, 1:0.01, and any range derivable therein.
  • the composition may contain a ratio of myristic acid or palmitoleic acid to another component in the composition that is about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1::0.07, 1:
  • compositions may contain a ratio of palmitic acid to palmitoleic acid that is about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1:0.06, 1:0.05, 1:0.04, 1:0.03, 1:0.02, 1:0.01, and any range derivable therein.
  • the composition may contain a ratio of palmitic acid or palmitoleic acid to another component in the composition that is about, at least about, or at most about 1:100, 1:95, 1:90, 1:85, 1:80, 1:75, 1:70, 1:65, 1:60, 1:55, 1:50, 1:45, 1:40, 1:35, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1.75, 1:1.5, 1:1.25, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1, 1:0.09, 1:0.08, 1:0.07, 1::0.07, 1:
  • the fatty acid composition comprises or consists essentially of a molar ratio of C14, C16, and C16:l wherein the relative amount of C14 ranges in tenths from about 5.0 to about 7.0, the relative amount of C16 ranges in tenths from about 15 to 17, and the relative amount of C16:l ranges in tenths from about 0.1 to 2.0.
  • the fatty acid composition comprises or consists essentially of a molar ratio of C14, C16, and C16:l, of about 5:16:0.5, 5:16:1, 5:16:2, 5:17:0.5, 5:17:1, 5:17:2, 6:15:0.5, 6:15:1, 6:15:2, 6:16:0.5, 6:16:1, 6:16:2, 6:17:0.5, 6:17:1, 6:17:2, 7:15:0.5, 7:15:1, 7:15:2, 7:16:0.5, 7:16:1, 7:16:2, 7:17:0.5, 7:17:1, 7:17:2.
  • the fatty acid composition comprises or consists essentially of a molar ratio of CI 4, CI 6, and C16:l, of about 5.1:16:1, 5.2:16:1, 5.3:16:1, 5.4:16:1, 5.5:16:1, 5.6:16:1, 5.7:16:1, 5.8:16:1, 5.9:16:1, 6.0:16:1, 6.1:16:1, 6.2:16:1, 6.3:16:1, 6.4:16:1, 6.5:16:1, 6.6:16:1, 6.7:16:1, 6.8:16:1, 6.9:16:1, 7.0:16:1, 6:16:0.1, 6:16:0.2, 6:16:0.3, 6:16:0.4, 6:16:0.5, 6:16:0.6, 6:16:0.7, 6:16:0.8, 6:16:0.9, 6:16:1.0, 6:16:1.1, 6:16:1.2, 6:16:1.3, 6:16:1.4, 6:16:1.5, 6
  • methods and compositions involve a pharmaceutical composition and/or fatty acid composition that is characterized based on the percentage of a particular fatty acid or a combination of fatty acids.
  • a single fatty acid or combination of fatty acids may be about, at least about, or at most about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,
  • each of or a combination of the following is contained in a pharmaceutical or fatty acid composition: myristic acid, palmitic acid, palmitoleic acid, caprylic acid, lauric acid, tridecanoic acid, pentadecanoic acid, stearic acid, oleic acid, linoleic acid, eicosedienoic acid, eicosatrienoic acid, arachidonic acid, and nervonic acid.
  • Each of these listed fatty acids or a combination of them may constitute about, at least about, or at most about 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85
  • one or more of the fatty acids listed in this paragraph are excluded.
  • a composition or method does not include myristoleic acid.
  • myristoleic acid may be present but in amounts less than 25% of a composition; in further embodiments there is trace or nearly undetectable amounts of one or more of the fatty acids discussed above, including, for example myristoleic acid. It is specifically contemplated that whatever the amount of the fatty acid portion of a composition is, the recited ratios of individual fatty acid components may remain.
  • the fatty acid composition is an MPP fatty acid composition.
  • the only fatty acids in the fatty acid composition in noncontaminating amounts are myristic acid, palmitic acid, and palmitoleic acid.
  • the amount of another fatty acid or other fatty acids in a fatty acid composition or pharmaceutical composition containing primarily myristic acid, palmitic acid, and palmitoleic acid is about or at most about 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40
  • a fatty acid composition is composed of a combination of MPP fatty acids.
  • the amount of the MPP combination of fatty acids in the fatty acid composition is about, at least about, or at most about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% (v/v), or any range derivable therein.
  • a fatty acid composition refers to a composition of fatty acids.
  • a pharmaceutical composition comprising a fatty acid composition
  • the components of the fatty acid composition may be mixed or added separately or together to the pharmaceutical composition.
  • a fatty acid composition consists essentially of myristic acid, palmitic acid, and palmitoleic acid fatty acid.
  • compositions have a fatty acid component.
  • a pharmaceutical composition may be composed of varying amounts of a fatty acid composition.
  • a fatty acid composition constitutes about, at least about, or at most about 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73
  • compositions and fatty acid compositions include purified fatty acids.
  • a purified fatty acid may be about or at least about 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 99.1 , 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% pure, or any range derivable therein. It may or may not be purified from a biological source, such as a plant or animal cell (including human).
  • fatty acids may be synthesized, as opposed to isolated and/or purified from a biological source. Synthesized fatty acids may be subsequently isolated or purified. Fatty acids may be isolated from non-fatty acids. In some embodiments, fatty acids may be purified from non-fatty acids, or a specific fatty acid or combination of fatty acids may be purified from other fatty acids.
  • a pharmaceutical or fatty acid composition may include a carrier compound.
  • a fatty acid may be attached or conjugated to the carrier compound.
  • the carrier compound is attached to one or more fatty acids.
  • the carrier compound is conjugated to one or more fatty acids.
  • a carrier compound may be mixed or complexed with one or more fatty acids.
  • a fatty acid is included in a particle that includes or is a carrier compound.
  • the carrier compound is albumin. In certain cases, it is bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • one or more fatty acids are formulated in a lipid vesicle.
  • a fatty acid component or composition is not included or complexed with a tocopherol.
  • a fatty acid employed in compositions or used, administered or produced in methods is not esterified.
  • methods involve administering one or more fatty acids, none of which is esterified at the time of administration.
  • compositions containing one or more fatty acids none of which is esterified.
  • the term "fatty acid" refers to a non-esterified fatty acid.
  • one or more fatty acids may be esterified. It is further contemplated that an esterified fatty acid may be reacted with one or more compounds to make the fatty acid no longer esterified.
  • a subject could be a subject in need of physiological hypertrophy, a subject at risk for a cardiovascular disease or condition (a disease of condition that involves the heart and/or blood vessels such as arteries or veins), or a subject exhibiting one or more symptoms of a cardiovascular disease or condition, or a subject diagnosed with a cardiovascular disease or condition.
  • the subject is a human patient.
  • cardiovascular disease or condition include the following: aneurysm, angina, atherosclerosis, cerebrovascular accident (or stroke), cerebrovascular disease, congestive heart failure, coronary artery disease, myocardial infarction (heart attack), and peripheral vascular disease.
  • the subject has symptoms of hypertension.
  • the subject has symptoms or markers indicative of cardiac fibrosis.
  • Methods may also involve determining whether the patient has symptoms or markers indicative of cardiac fibrosis.
  • Methods may also include monitoring the patient for symptoms or markers of a cardiovascular disease or condition before and/or after administration of an AQP7 inducer, such as a composition comprising MPP fatty acids.
  • Methods may involve testing the subject to determine if the subject is in need of physiological hypertrophy or determining that a subject is in need of physiological hypertrophy.
  • the AQP7 inducer is a small molecule, fatty acid, polypeptide, or nucleic acid.
  • the AQP7 inducer is a nucleic acid.
  • the AQP7 inducer is a nucleic acid expression vector that encodes an AQP7 polypeptide, which refers to the full-length polypeptide.
  • a truncated or partial AQP7 polypeptide is encoded or implemented in embodiments.
  • an expression vector encoding an AQP7 inducer is a viral vector.
  • the viral vector is an adenovirus, adeno-associated virus, lentivirus, retrovirus, herpesvirus, or vaccinia virus. If an adenovirus is employed, the adenovirus may be serotype 5.
  • a virus used in methods of the invention is replication-deficient. In cases involving viruses or viral particles, it is contemplated that about 10 7 to about 10 15 viral particles of the viral vector are administered to the subject for one or more administrations.
  • the viral vector is formulated with protamine. Alternatively or additionally, the viral vector is formulated with one or more lipids.
  • methods involve an AQP7 inducer that is a polypeptide.
  • the polypeptide is a purified polypeptide comprising at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210 220., 230, 240, 250, 260, or 269 contiguous amino acids of AQP7 (or any ranger derivable therein) or at least 80% of the amino acid sequence of AQP7.
  • human AQP7 is employed.
  • methods involve a cardiac cell.
  • the cardiac cell is a myocyte or cardiomyocyte.
  • methods involve an AQP7 inducer that is formulated in a pharmaceutically acceptable composition.
  • the AQP7 inducer is administered to the subject intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intramuscularly, intraperitoneally, subcutaneously, subconjunctival, intravesicularly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.
  • an AQP7 inducer is coated on a stent or via a stent or provided in conjunction with the placement of a stent.
  • a pharmaceutical composition is formulated for oral or intravenous (i.v.) delivery.
  • a pharmaceutical composition is formulated for oral delivery.
  • the pharmaceutical composition is a table, pill, capsule, or lozenge.
  • the pharmaceutical composition is formulated for extended or sustained release.
  • the composition is enterically coated or it has a shell.
  • a composition is formulated with a surfactant.
  • the pharmaceutical composition is not formulated for topical use.
  • an AQP7 inducer is a small molecule. It is contemplated that some AQP7 inducers that are small molecules bind to an AQP7 promoter or portion of the AQP7 promoter ("an AQP7 transcriptional control region"). The small molecule may bind a discrete and specific binding site in the AQP7 promoter.
  • the AQP7 inducer is a fatty acid molecule.
  • a fatty acid molecule refers to a compound that is an aliphatic monocarboxylic acid. It is generally unbranched with multiple carbon atoms, and is either saturated or unsaturated. It can have 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or more carbon atoms, and any range derivable therein.
  • compositions and methods involving a pharmaceutical composition comprising a fatty acid composition.
  • the composition comprises one or more of these fatty acids isolated from Burmese python serum: myristic acid, palmitic acid, palmitoleic acid, caprylic acid, lauric acid, tridecanoic acid, pentadecanoic acid, stearic acid, oleic acid, linoleic acid, eicosedienoic acid, eicosatrienoic acid, arachidonic acid, and nervonic acid ("python serum fatty acids").
  • a composition comprising MPP fatty acids also includes one, two, three, four, or five of the other python serum fatty acids such as: caprylic acid, lauric acid, tridecanoic acid, pentadecanoic acid, stearic acid, oleic acid, linoleic acid, eicosedienoic acid, eicosatrienoic acid, arachidonic acid, and/or nervonic acid.
  • the fatty acid composition comprises myristic acid, alone or combination with palmitic acid and/or palmitoleic acid, and one, two, three, four, or five other python serum fatty acids.
  • the fatty acid composition comprises palmitic acid, alone or combination with myristic acid and/or palmitoleic acid, and one, two, three, four, or five other python serum fatty acids. In further embodiments, the fatty acid composition comprises palmitoleic acid, alone or combination with palmitic acid and/or myristic acid, and one, two, three, four, or five other python serum fatty acids.
  • a composition does not contain certain components. In some embodiments, the composition does not contain an active ingredient that is not a fatty acid. In particular embodiments, a composition does not contain a therapeutic agent that is not a fatty acid. In additional embodiments, a composition contains one or more fatty acids, but does not contain an anti-inflammatory agent in addition to the fatty acid(s). In some embodiments, a composition contains fatty acids that are unsaturated. In specific embodiments, there are only unsaturated fatty acids in the compositions. In additional embodiments, a composition contains fatty acids that are saturated. In specific embodiments, there are only saturated fatty acids in the compositions. In some embodiments, a composition does not include an antioxidant. In other embodiments, a composition does not contain pyruvate or pyruvic acid.
  • an AQP7 inducer is formulated in a pharmaceutically acceptable composition. It is contemplated that formulations may include more than one different inducer, such as 2 or 3 inducers as a cocktail. Alternatively, the AQP7 inducer may be administered before, after, or with a different therapeutic or preventative substance for a cardiovascular disease or condition. Methods of the invention include, in certain embodiments, prescribing or administering one or more other such substances before, after, or in conjunction with an AQP7 inducer to a patient.
  • methods for screening for candidate AQP7 inducers comprising: a) contacting one or more candidate compounds with a test nucleic acid, wherein the test nucleic acid comprises a reporter sequence under the control of an AQP7 transcriptional control region; and, b) evaluating expression of the reporter sequence, wherein an increase in expression of the reporter sequence compared to a control identifies the one or more candidate compounds as a candidate AQP7 inducer.
  • methods include a step of comparing expression levels involving different candidate compounds or comparing expression levels of one or more candidate compounds to a control.
  • the reporter sequence encodes a polypeptide that is fluorescent, colorimetric, or enzymatic.
  • the reporter sequence encodes luciferase or a fluorescent protein such as green fluorescent protein.
  • candidate compounds may be small molecules, nucleic acids, peptides, polypeptides, or antibodies. They may be part of library or used in conjunction with high throughput screening.
  • compositions and methods also include in some embodiments an AQP7 inhibitor such as an siR A targeting AQP7.
  • an siR A that is 12-30 nucleotides in length that is at least 90% complementary to an AQP7 sequence.
  • the siRNA is at least 90% identical to SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24.
  • the siRNA may be at least 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100% identical, or any range derivable therein, to these SEQ ID NOs.
  • the siRNA is identical to SEQ ID NO:24.
  • Methods include administering an effective amount of an siRNA against AQP7 to a cell in order to reduce or inhibit expression of AQP7.
  • multiple different siRNAs targeting AQP7 are administered to a subject or a cell.
  • screening is conducted using a recombinant host cell containing the test nucleic acid.
  • the host cell can be a mammalian host cell.
  • the host cell is a human cell.
  • the host cell is a cardiomyocyte.
  • cells used are NRVM cells or C2C12 cells. Assays to determine expression levels are well known to those of skill in the art. For instance, quantitative PCR may be employed.
  • Other aspects of screening methods include identifying the candidate AQP7 inducer, such as when a pool of different inducers are used in screens. Other steps include producing or manufacturing the candidate AQP7 inducer, testing the candidate AQP7 inducer in an animal model, testing it in clinical trials, and/or administering the candidate AQP7 inducer to a cardiomyocyte at risk for or undergoing hypertrophy.
  • the cardiomyocyte may be in a subject in some embodiments.
  • methods include synthesizing one or more fatty acids.
  • Methods may also include a step of purifying one or more fatty acids.
  • the terms "inhibiting” and “reducing” or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result.
  • the terms “prevention” and “preventing” refer to the expectation that something can be kept from happening to some extent or that the severity, duration, or extent of the condition or disease can be alleviated or reduced. It is contemplated that the terms “treating” or “preventing” in the context of a condition or disease refers to any reduction or inhibition of the disease or condition.
  • the disease or condition is cardiovascular disease or condition.
  • embodiments pertain to cardiovascular diseases or conditions that afflict a certain cell type, tissue, organ or area of the body.
  • the cardiovascular condition or disease is a heart condition or disease, which refers to a disease or condition afflicting the heart.
  • the heart condition or disease is hypertension.
  • subjects who may be considered for AQP7 therapy have high blood pressure or they exhibit markers for fibrosis.
  • compositions can comprise, consist essentially of, or consist of the claimed ingredients.
  • compositions consisting essentially of the claimed ingredients exclude above-contaminating amounts of other ingredients, such as fatty acids.
  • a composition may exclude any other ingredient that materially affects the effect of the composition, such as the ability to induce cardiac hypertrophy in cardiac cells.
  • the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), "including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
  • FIG. 1 shows that serum from fed snakes induces hypertrophy in neonatal cardiomyocytes.
  • Twenty four hours after serum treatment cardiomyocytes were fixed and immunostained for a-actinin to reveal sarcomere organization and cell morphology.
  • Several images were taken for each condition: fasted (upright black triangles), 1 DPF (head down black triangles), 6 DPF (black rhomboids) and 10 DPF (black circles) and cell size was determined using Image J. Each dot represents the size of a particular cell and at least 50 cells were measured in each condition. Average size in each group is depicted by a horizontal line.
  • cardiomyocytes were treated with 10 ⁇ of phenylephrin (PE; open squares).
  • Figure 2 shows the dose-response of python serum effect on NRVM size.
  • Neonatal rat cardiomyocytes were treated with increasing concentrations of python serum. 48 hours later, cells were trypsinized and resuspended in PBS/1% calf serum to be analyzed in a particle size analyzer *Coulter Counter, Beckman). Mean cell volume was obtained and the percentage of cell size change was calculated by comparing each condition to untreated cells. Dark gray and light gray bars represent the effect of increasing concentrations of 3 day post-fed and fasted serum, respectively.
  • FIG. 3 shows that fed serum induces cardiomyocyte growth in a NFAT independent manner.
  • Neonatal rat cardiomyocytes were transduced with an adenoviral vector containing 4 tandem repeats for NFAT binding site along with the cDNA for luciferase. 24 hours later, the cells were untreated (Control) or treated with 0 DPF, 3 DPF and Phenylephrin (PE). Cells were lysed 24 hours later and luciferase activity was measured in the lysates. Each condition was analyzed in triplicate and the average and standard deviation were plotted.
  • FIG 4 shows that hypertrophic growth induced by fed serum does not correlate with the expression of pathologic fetal genes.
  • Neonatal rat cardiomyocytes were untreated (control) or treated with fasted serum, post-fed serum, or PE. After 48 hours, RNA was isolated and cDNA was obtained by standard procedures. The expression of several pathologic hypertrophic markers was measured by quantitative real-time PCR including ⁇ -myosin heavy chain, atrial natriuretic factor (ANF), brain natriuretic peptide (BNP), skeletal actin and sarcoplasmic reticulum calcium ATPase (SERCA).
  • AMF atrial natriuretic factor
  • BNP brain natriuretic peptide
  • SERCA sarcoplasmic reticulum calcium ATPase
  • Figure 5 demonstrates the validation of changes in gene expression by quantitative Real Time PCR. The results for changes in gene expression were graphed, and qPCR results are compared to microarray results.
  • Figure 6 shows the expression levels of AQP7 in NRVMs transduced with an adenovirus expressing AQP7.
  • Figure 7 shows the cell size of NRVMs after AQP7 mRNA induction in comparison to NVRMs treated with fasted serum or fed serum.
  • Figure 8 shows that the inhibition of fatty acid transport blocks python plasma-induced neonatal rat ventricular myocyte hypertrophy.
  • Figure 9 shows the fatty acid composition of python plasma throughout digestion.
  • Figure 10 depicts the fatty acid composition of python plasma throughout digestion in a bar graph.
  • Figure 11 shows the selected fatty acids myristic, palmitic, and palmitoleic, complexed with BSA.
  • Figure 12 shows that fasted plasma supplemented with the appropriate concentration of C16, C14 and C16: l recapitulates fed plasma affect.
  • Figure 13 shows that AQP7 expression is increased in animal models of physiologic hypertrophy (exercise, pregnancy) and decreased in animal models of pathologic hypertrophy (genetic heart disease, aortic banding).
  • Figure 14 shows that AQP7 expression is highly induced by fatty acid treatment.
  • Figure 15 demonstrates the dose-dependent effects of individual fatty acids on AQP7 expression. Each condition was measured in triplicate and the means (+SEM) were plotted. *P ⁇ 0.01 vs. fasted serum alone.
  • Figure 16 shows that siR A-mediated knockdown of AQP7 inhibits NRVM hypertrophy due to python serum. *P ⁇ 0.01 for AQP7 siRNA vs. negative control siR A.
  • Figure 17 shows that infusion of fed plasma or fatty acids triggers cardiac growth in a fasted python. *P ⁇ 0.05 vs. fasted plasma.
  • Figure 18 shows the in vivo effect of infusion of myristic, palmitic, and palmitoleic acids in mice on heart, liver, and skeletal tissues.
  • Figure 19 shows the mRNA expression of a-myosin heavy chain (a-MyHC), ⁇ -myosin heavy chain ( ⁇ -MyHC), atrial natriuretic factor (ANF), and a-skeletal actin in mice infused with myristic, palmitic, and palmitoleic acids.
  • a-MyHC a-myosin heavy chain
  • ⁇ -MyHC ⁇ -myosin heavy chain
  • AMF atrial natriuretic factor
  • a-skeletal actin in mice infused with myristic, palmitic, and palmitoleic acids.
  • Figure 20 shows that fatty acid-induced growth is cardiac-specific and unique to the combination of C14:0, C16:0, and C16: l .
  • Figure 21 shows that postprandial cardiac growth in the python is characterized by cellular hypertrophy and activation of protein synthesis pathways.
  • C The number of nuclei per field is reduced post-feeding.
  • Figure 22 shows postprandial cardiac hypertrophy in the absence of alterations in collagen deposition.
  • HW/BW Python heart weight to body weight ratios
  • C The percent collagen content of the python heart ( ⁇ 13-18%) is higher than typically seen in the rodent heart ( ⁇ l-2%) and relatively unchanged during the postprandial period.
  • Figure 25 depicts the content of non-esterified free fatty acids ( EFA) and plasma triglycerides (TAG) at various timepoints post-feeding.
  • EFA non-esterified free fatty acids
  • TAG plasma triglycerides
  • Figure 27A shows that elevated plasma fatty acid and triglyceride levels do not induce lipid accumulation in python myocardium.
  • Figure 27B shows that mRNA transcript levels of VLDLR are not changed in hypertrophied heart.
  • Figure 28 shows that the postprandial python heart has increased expression of fatty acid transport (CD36), muscle-type fatty acid binding protein (mFABP), carnitine palmitoyltransferase (CPT1B), and the ⁇ -oxidation genes medium chain acyl-CoA dehydrogenase (MCAD), peroxisomal enoyl-CoA hydratase (ECHD) and acetyl-CoA acyltransferase 2 (ACAA2).
  • CD36 fatty acid transport
  • mFABP muscle-type fatty acid binding protein
  • CPT1B carnitine palmitoyltransferase
  • MCAD medium chain acyl-CoA dehydrogenase
  • ECHD peroxisomal enoyl-CoA hydratase
  • ACAA2 acetyl-CoA acyltransferase 2
  • SOD2 mitochondrial superoxide dismutase 2
  • Figure 32 shows that python plasma does not induce the mRNA expression of known cardiac stress markers in NRVMs.
  • PE phenylephrine (included as a positive control);
  • ANF atrial natriuretic factor; MYH6, a-myosin heavy chain; MYH7, a-myosin heavy chain;
  • ACTA1 a-skeletal actin.
  • Figure 35 shows that the treatment of neonatal rat ventricular myocytes with python plasma or fatty acids alters the mRNA levels of genes associated with fatty acid transport, handling and oxidation.
  • A The mRNA expression of CD36, FABP3, and CPTl was increased in NRVMs treated with fasted plasma plus the combination of C14, C16, and C16: l (0 DPF + FAs).
  • Figure 37 demonstrates the complex pattern of change in circulating lipid species during the postprandial time period.
  • concentration of the individual FAs was expressed as the percentage of total FA concentration at each time point.
  • Figure 38 demonstrates that supplementing fasted python plasma with myristic, palmitic, and palmitoleic acids (0 DPF + FAs) results in cellular hypertrophy comparable to that seen with 1 DPF plasma.
  • Figure 39 shows that treatment of neonatal rat ventricular myocytes with python plasma or fasted plasma plus fatty acids does not trigger apoptosis.
  • Staurosporine ST; 10 mM
  • FIG 40 shows that postprandial python plasma fatty acids induce cardiac growth in vivo.
  • A Infusing fasted pythons with fed plasma or myristic, palmitic, and palmitoleic acids (FAs) results in increased heart mass (heart weight/body weight) comparable to that seen with ingestion of a rodent meal (3 DPF).
  • B Seven day infusion of FAs in mice results in increased left ventricular mass (left ventricular mass/tibia length) and increased relative myocyte cross-sectional area.
  • Figure 43 shows that FA administration does not alter glucose tolerance, as measured by fasting blood glucose, response in glucose tolerance test, and insulin-induced glucose clearance in mice administered FAs in comparison to control mice administered BSA.
  • Figure 44 shows that FA administration does not cause insulin resistance.
  • Figure 45 shows the design of a study to test the effects of the FAs in mice fed a high fat diet, and the increased ventricular mass of mice administered FAs while on a high fat diet.
  • Figure 46 shows the increased body mass in grams of overfed pythons in comparison to pythons fed a normal diet.
  • Figure 47 shows the increased metabolic rate of overfed pythons in comparison to pythons fed a normal diet.
  • Figure 48 shows that lipid accumulation is similar among normal fasted, 3 DPF normal, and 3 DPF overfed pythons.
  • Figure 49 shows lipid accumulation, as measured by Oil Red O stating of cardiac tissues, of overfed versus normally fed pythons.
  • Figure 50 shows the similar levels of aberrant cardiac gene expression in overfed versus normally fed pythons.
  • Cardiovascular disease remains the number one cause of mortality in the Western world, with heart failure representing the fastest growing subclass over the past 10 years. Heart failure is induced by a number of common disease stimuli, which first activate a phase of cardiac hypertrophy to normalize wall tension in the heart. However, in the long term, myocardial hypertrophy is the biggest predictor of heart failure and sudden death.
  • the heart responds to a variety of stimuli by an increase in size, also known as
  • hypotrophy There are beneficial types of stimuli such as exercise or detrimental ones like when the heart grows in response to high blood pressure, a heart attack or an inherited condition. Defining the differences between the healthy heart growth compared to unhealthy growth is important.
  • compositions and methods useful for treating diseases and conditions related to the activities of cardiac growth or regression related genes or their expressed proteins are useful for treating diseases and conditions related to the activities of cardiac growth or regression related genes or their expressed proteins.
  • diseases may include, but are not limited to, cachexia, cardiac hypertrophy, high blood pressure, myocardial infarction, cardiac arrhythmia, tachycardia and/or bradycardia.
  • inhibitors or activators of the identified cardiac growth or regression related genes may be known in the art and any such known inhibitors or activators may be used in the practice of the claimed methods.
  • metabolic syndrome refers to a combination of medical disorders associated with heart disease including pathologic hypertrophy and cardiac fibrosis, stroke, and type 2 diabetes. Medical disorders or conditions that can make up metabolic syndrome include obesity, hyperlipoproteinemia, hyperuricemia, hypercholestrolemia, hypertriglyceridemia, hepatic steatosis, glucose intolerance, and hypetension. It is estimated that the prevalence of metabolic syndrome is as high as 25% of the adult population of the United States.
  • the model organisms that are most typically studied to understand cardiac hypertrophy are rodents and humans. Cardiac mass in these organisms can change, but usually slowly and it is rare to see a doubling in heart size without genetic manipulation. Long-term changes in human cardiac mass are not readily amenable to study, as any underlying changes in gene expression or protein activity levels may be difficult to detect. A shorter term model system with greater fluctuations in cardiac mass is desirable, to facilitate detection of genes involved in cardiac hypertrophy or regression.
  • Burmese pythons ⁇ Python molurus are opportunistic ambush predators, adapted to consume large meals at infrequent intervals. As a consequence of their feeding habits, pythons exhibit a large regulatory response to the digestion process including a large increase in its metabolic rate, nutrient transport and organ mass (Secor and Diamond, 1998). Most mammalian species are adapted to consume frequent, small meals, which means that their digestion process does not show a factorial increase like that of pythons. A comparison of the post-feeding response of pythons and mammals is shown below in Table 1.
  • Burmese pythons During fasting conditions, Burmese pythons have a low basal metabolism and most of the organs are maintained with small masses to conserve energy. Upon feeding, the increase in metabolic rate has a peak at 1-2 days and declines to fasting levels at 8-16 days. This rapid increase in energy cost is originated by the rapid start-up of gastrointestinal functions, but also involves the rapid growth of several organs that are not directly involved in digestion, such as the heart.
  • methods and compositions concern aquaporin (AQP) molecules, which are proteins in the cell membrane that control the flow of water.
  • aquaporin proteins in this family of molecules that transport water in and out of a cell.
  • At least 13 different aquaporin proteins have been identified in mammals, numbered one through 13.
  • the different mammalian aquaporins have their own tissue and cell distribution patterns and they have different and specific functions relative to their location.
  • AQPl has been identified in erythrocytes, kidney, lung, eye, choroid plexus, biliary tract, nonfenestrated endothelia, as well as in proximal tubules and descending thin limb of Henle's loop segments.
  • AQP2 has been identified in collecting duct epithelia of kidney. A deficiency of AQP2 can lead to nephrogenic diabetes insipidus, which is characterized by the inability to concentrate urine.
  • AQP3 is located in renal collecting ducts, the gastrointestinal tract, airway epithelia, corneal epithelium and brain.
  • AQP4 is abundant in glial cells and ependymal cell of brain tissue, as well as in retina and airway epithelia.
  • AQP5 can be found in salivary gland; lacrimal gland and lung.
  • AQP6 has been identified in proximal tubular epithelia and collecting duct epithelia of kidney and characteristically acts as intracellular water channel and also is involved in regulation of acid base balance.
  • AQP7 and AQP8 are expressed in germ cells and sperm.
  • AQP9 is abundant in adipocytes (Deen et al, 1999; King et al, 2000; Agre, 2000).
  • Some embodiments concern specifically aquaporin 7 (AQP7), which is needed for the efflux of glycerol from adipocytes and has been reported to influence glucose levels.
  • AQP7 expression is down- regulated. Ceperuelo-Mallafre et al, 2007, which is hereby incorporated by reference.
  • the human AQP7 nucleic acid coding and protein sequences are located at NM 001 170, which is hereby specifically incorporated by reference.
  • Another scientific paper describes AQP7-deficient mice. In Hara-Chikuma et al. (2005), the authors report that older AQP7 null mice showed significant adipocyte hypertrophy and increased body fat. They contemplate that increasing AQP7 expression/function in adipocytes as a way to reduce adipocyte volume and fat mass in obesity.
  • Aquaporin family members have been mentioned or described in a number of different patent applications and/or patents.
  • U.S. Patent 6,506,377 which is specifically incorporated by reference, is entitled “Interferon-alpha mediated upregulation of aquaporin expression.” It concerns applications for improving pulmonary function by administering interferon compounds to lung cells. It is contemplated that compounds discussed in the patent may be implemented in methods described and/or claimed herein.
  • Embodiments concern fatty acid compositions.
  • Fatty acids that may be employed include, but are not necessarily limited to, the following saturated and unsaturated fatty acids: myristic acid, palmitic acid, palmitoleic acid, caprylic acid, lauric acid, tridecanoic acid, pentadecanoic acid, stearic acid, oleic acid, linoleic acid, eicosedienoic acid, eicosatrienoic acid, arachidonic acid, and nervonic acid.
  • a composition may specifically not contain one or more of these listed fatty acids.
  • a composition may exclude eicosedienoic acid, or any of the other fatty acids in the list.
  • Myristic acid also known as tetradecanoic acid, n-Tetradecanoic acid, or C14:0, is a saturated fatty acid.
  • Palmitic acid also known as hexadecanoid acid or C16:0, is the most common saturated fatty acid in plant and animal lipids.
  • Palmitoleic acid also known as (z)-9- hexadecenoic acid or C: 16.1 is an omega-7 monounsaturated fatty acid that is a common component of glycerides in human adipose tissue. It is made from palmitic acid using the enzyme delta-9 desaturase.
  • fatty acids include, but are not limited to, those found in python serum such as caprylic acid (C8:0), lauric acid (C12:0), tridecanoic acid (C13:0), pentadecanoic acid (C15:0), stearic acid (C18:0), oleic acid (C18: ln9), linoleic acid (C: 18:2), eicosedienoic acid (C20:2), eicosatrienoic acid (C20:3), arachidonic acid (C:20:4), and nervonic acid (C20:4).
  • caprylic acid C8:0
  • lauric acid C12:0
  • tridecanoic acid C13:0
  • pentadecanoic acid C15:0
  • stearic acid C18:0
  • oleic acid C18: ln9
  • linoleic acid C: 18:2
  • compositions and methods include any of these fatty acids singly or solely, or they may be used in a combination of fatty acids.
  • a combination includes or is limited to myristic and palmitoleic acids.
  • a combination includes or is limited to myristic and palmitic acids.
  • a combination includes or is limited to palmitic and palmitoleic acids.
  • a combination includes at least myristic, palmitic, and or palmitoleic acids.
  • a composition may specifically not contain one or more python serum fatty acids.
  • Fatty acids may be synthesized or purified from a fatty acid source.
  • the source may be a natural source of a fatty acid or it may be an engineered source of a fatty acid.
  • engineered sources include, but are not limited to, bacterial cells, yeast cells, or cells (or progeny of cells) that previously were chemically or recombinantly altered to make the source produce the fatty acid or produce the fatty acid at increased levels.
  • Fatty acids may be synthesized through a series of chemical reactions, many of which are well known to those of skill in the art. See e.g. Lipid Synthesis and Manufacture, Frank D. Gunstone, ed., 1998, which is hereby incorporated by reference.
  • Some embodiments concern polynucleotides or nucleic acid molecules relating to an aquaporin 7 sequence in diagnostic, therapeutic, and preventative applications.
  • aquaporin 7 is involved in the prevention or treatment of a cardiovascular condition or disease.
  • Nucleic acids or polynucleotides of the invention may be DNA or RNA, and they may be olignonucleotides (100 residues or fewer) in certain embodiments. Moreover, they may be recombinantly produced or synthetically produced.
  • polynucleotides or nucleic acid molecules may be isolatable and purifiable from cells or they may be synthetically produced.
  • an AQP7-encoding nucleic acid is employed.
  • polynucleotide refers to a nucleic acid molecule, RNA or DNA, that has been isolated free of total genomic nucleic acid. Therefore, a “polynucleotide encoding AQP7” refers to a nucleic acid sequence (RNA or DNA) that contains AQP7 coding sequences, yet may be isolated away from, or purified and free of, total genomic DNA and proteins.
  • cDNA is intended to refer to DNA prepared using RNA as a template.
  • the advantage of using a cDNA, as opposed to genomic DNA or an RNA transcript is stability and the ability to manipulate the sequence using recombinant DNA technology (See Sambrook, 2001 ; Ausubel, 1996). There may be times when the full or partial genomic sequence is some. Alternatively, cDNAs may be advantageous because it represents coding regions of a polypeptide and eliminates introns and other regulatory regions.
  • nucleic acids are complementary or identical to cDNA encoding sequences, such as a AQP7 upstream sequence, a NM_001 170 sequence (human), a NM_019157 sequence (rat), or a NM_007473.4 sequence (mouse).
  • a AQP7 upstream sequence such as a AQP7 upstream sequence, a NM_001 170 sequence (human), a NM_019157 sequence (rat), or a NM_007473.4 sequence (mouse).
  • a AQP7 upstream sequence such as a AQP7 upstream sequence, a NM_001 170 sequence (human), a NM_019157 sequence (rat), or a NM_007473.4 sequence (mouse).
  • gene is used for simplicity to refer to a functional protein, polypeptide, or peptide-encoding nucleic acid unit.
  • this functional term includes genomic sequences, cDNA sequences, and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants.
  • the nucleic acid molecule hybridizing to NM 001 170, NM_019157, or NM_007473.4 may comprise a contiguous nucleic acid sequence of the following lengths or at least the following lengths: 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96,
  • sequences may be identical or complementary to SEQ ID NO: l (cDNA for NM 000170), SEQ ID NO:3 (cDNA for NM 019157), SEQ ID NO:5 (cDNA for NM 007473.4), SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 or any other sequences disclosed herein.
  • isolated substantially away from other coding sequences means that the gene of interest forms part of the coding region of the nucleic acid segment, and that the segment does not contain large portions of naturally-occurring coding nucleic acid, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the nucleic acid segment as originally isolated, and does not exclude genes or coding regions later added to the segment by human manipulation.
  • Vectors of the present invention are designed primarily to introduce into cells a therapeutic or preventative AQP7 nucleic acid inducer under the control of a eukaryotic promoter (i.e., constitutive, inducible, repressible, tissue specific). Also, the vectors may contain a selectable marker if, for no other reason, to facilitate their manipulation in vitro. However, selectable markers may play an important role in producing recombinant cells.
  • the AQP7 coding sequence is provided as a nucleic acid expressing the AQP7 polypeptide.
  • the nucleic acid is a viral vector, wherein the viral vector dose is or is at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 or higher pfu or viral particles.
  • the viral vector is an adenoviral vector, a retroviral vector, a vaccinia viral vector, an adeno-associated viral vector, a polyoma viral vector, an alphaviral vector, a rhabdoviral vector, or a herpesviral vector. Most preferably, the viral vector is an adenoviral vector.
  • the nucleic acid is a non-viral vector.
  • the promoters and enhancers that control the transcription of protein encoding genes in eukaryotic cells are composed of multiple genetic elements.
  • the cellular machinery is able to gather and integrate the regulatory information conveyed by each element, allowing different genes to evolve distinct, often complex patterns of transcriptional regulation.
  • promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for R A polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator proteins. [00145] At least one module in each promoter functions to position the start site for R A synthesis.
  • TATA box in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • the promoter for use in the present invention is the cytomegalovirus (CMV) immediate early (IE) promoter.
  • CMV cytomegalovirus
  • IE immediate early
  • Other viral promoters, cellular promo ters/enhancers and inducible promo ters/enhancers may be used in combination with the present invention.
  • any promo ter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of a nucleic acid of interest.
  • Another signal that may prove useful is a polyadenylation signal.
  • Such signals may be obtained from the human growth hormone (hGH) gene, the bovine growth hormone (BGH) gene, or SV40.
  • IRES internal ribosome binding sites
  • IRES elements are able to bypass the ribosome scanning model of 5-methylatd cap-dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988).
  • IRES elements from two members of the picornavirus family polio and encephalomyocarditis
  • IRES elements from two members of the picornavirus family Polio and encephalomyocarditis
  • IRES elements from a mammalian message Macejak and Sarnow, 1991.
  • IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.
  • promoters are DNA elements which when positioned functionally upstream of a gene leads to the expression of that gene.
  • Most transgene constructs of the present invention are functionally positioned downstream of a promoter element.
  • compositions and methods of the invention are provided for administering the compositions of the invention to a patient.
  • nucleic acid molecule of the invention may be comprised in a vector.
  • vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • a nucleic acid sequence can be "exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • a vector may encode non-modified polypeptide sequences such as a tag or targeting molecule.
  • Useful vectors encoding such fusion proteins include pIN vectors (Inouye et al, 1985), vectors encoding a stretch of histidines, and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage.
  • GST glutathione S-transferase
  • a targetting molecule is one that directs the modified polypeptide to a particular organ, tissue, cell, or other location in a subject's body.
  • expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, R A molecules are then translated into a protein, polypeptide, or peptide.
  • Expression vectors can contain a variety of "control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.
  • One method for delivery of the recombinant DNA involves the use of an adenovirus expression vector.
  • Adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a recombinant gene construct that has been cloned therein.
  • the adenovirus vector may be replication defective, or at least conditionally defective; the nature of the adenovirus vector is not believed to be crucial to the successful practice of the invention.
  • the adenovirus may be of any of the 42 different known serotypes or subgroups A-F.
  • Adenovirus type 5 of subgroup C is the starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present invention.
  • the typical vector according to the present invention is replication defective and will not have an adenovirus El region.
  • the position of insertion of the construct within the adenovirus sequences is not critical to the invention.
  • the polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors as described by Karlsson et al. (1986) or in the E4 region where a helper cell line or helper virus complements the E4 defect.
  • the retroviruses are a group of single-stranded R A viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse- transcription (Coffin, 1990).
  • a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
  • a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al., 1983).
  • Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et ah, 1975).
  • Other viral vectors include adeno-associated virus (AAV) (described in U.S.
  • Particular embodiments concern isolated nucleic acid segments and recombinant vectors incorporating DNA sequences that encode AQP7 inducers, such as siRNAs or ribozymes that target nucleic acids encoding inhibitors of AQP7, such as AQP7 transcription repressors.
  • AQP7 inducers such as siRNAs or ribozymes that target nucleic acids encoding inhibitors of AQP7, such as AQP7 transcription repressors.
  • a nucleic acid may encode an antisense construct.
  • Antisense methodology takes advantage of the fact that nucleic acids tend to pair with "complementary sequences."
  • complementary it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.
  • Antisense polynucleotides when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and/or stability.
  • Antisense RNA constructs, or DNA encoding such antisense RNA's may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.
  • Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. It is contemplated that the most effective antisense constructs will include regions complementary to intron/exon splice junctions. Thus, it is proposed that a preferred embodiment includes an antisense construct with complementarity to regions within 50-200 bases of an intron-exon splice junction. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic material included will vary depending on the particular exon and intron sequences used. One can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether normal cellular function is affected or whether the expression of related genes having complementary sequences is affected.
  • complementary or “antisense” means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., ribozyme; see below) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.
  • ribozyme e.g., ribozyme; see below
  • the nucleic acid encodes an interfering RNA or siRNA.
  • RNA interference also referred to as "RNA-mediated interference” or RNAi
  • RNA-mediated interference is a mechanism by which gene expression can be reduced or eliminated.
  • Double-stranded RNA (dsRNA) has been observed to mediate the reduction, which is a multi-step process.
  • dsRNA activates post- transcriptional gene expression surveillance mechanisms that appear to function to defend cells from virus infection and transposon activity (Fire et al, 1998; Grishok et al, 2000; Ketting et al, 1999; Lin and Avery, 1999; Montgomery et al, 1998; Sharp and Zamore, 2000; Tabara et al, 1999). Activation of these mechanisms targets mature, dsRN A- complementary mRNA for destruction.
  • RNAi RNAi
  • Grishok et al, 2000 Ketting et al, 1999; Lin and Avery et al, 1999; Montgomery et al, 1998; Sharp et al, 1999; Sharp and Zamore, 2000; Tabara et al, 1999.
  • dsRNA has been shown to silence genes in a wide range of systems, including plants, protozoans, fungi, C. elegans, Trypanasoma, Drosophila, and mammals (Grishok et al, 2000; Sharp et al, 1999; Sharp and Zamore, 2000; Elbashir et al, 2001).
  • siR As are designed so that they are specific and effective in suppressing the expression of the genes of interest. Methods of selecting the target sequences, i.e., those sequences present in the gene or genes of interest to which the siRNAs will guide the degradative machinery, are directed to avoiding sequences that may interfere with the siRNA's guide function while including sequences that are specific to the gene or genes. Typically, siRNA target sequences of about 21 to 23 nucleotides in length are most effective. This length reflects the lengths of digestion products resulting from the processing of much longer RNAs as described above (Montgomery et ah, 1998).
  • methods concern an siRNA that is capable of triggering RNA interference, a process by which a particular RNA sequence is destroyed.
  • siRNA are dsRNA molecules that are 100 bases or fewer in length (or have 100 basepairs or fewer in its complementarity region). In some cases, it has a 2 nucleotide 3' overhang and a 5' phosphate.
  • the particular RNA sequence is targeted as a result of the complementarity between the dsRNA and the particular RNA sequence. It will be understood that dsRNA or siRNA of the invention can effect at least a 20, 30, 40, 50, 60, 70, 80, 90 percent or more reduction of expression of a targeted RNA in a cell.
  • dsRNA of the invention is distinct and distinguishable from antisense and ribozyme molecules by virtue of the ability to trigger RNAi.
  • dsRNA molecules for RNAi differ from antisense and ribozyme molecules in that dsR A has at least one region of complementarity within the RNA molecule.
  • the complementary (also referred to as "complementarity") region comprises at least or at most 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220,
  • an inhibitor, activator or binding agent of use may be an aptamer.
  • Aptamers are usually single-stranded, short molecules of RNA, DNA or a nucleic acid analog, that may adopt three-dimensional conformations complementary to a wide variety of target molecules.
  • Methods of constructing and determining the binding characteristics of aptamers are well known in the art. For example, such techniques are described in U.S. Patent Nos. 5,582,981, 5,595,877 and 5,637,459, each incorporated herein by reference.
  • Aptamers may be prepared by any known method, including synthetic, recombinant, and purification methods, and may be used alone or in combination with other ligands specific for the same target. In general, a minimum of approximately 3 nucleotides, preferably at least 5 nucleotides, are necessary to effect specific binding. Aptamers of sequences shorter than 10 bases may be feasible, although aptamers of 10, 20, 30 or 40 nucleotides may be preferred. [00167] Aptamers need to contain the sequence that confers binding specificity, but may be extended with flanking regions and otherwise derivatized.
  • the target-binding sequences of aptamers may be flanked by primer-binding sequences, facilitating the amplification of the aptamers by PCR or other amplification techniques.
  • the flanking sequence may comprise a specific sequence that preferentially recognizes or binds a moiety to enhance the immobilization of the aptamer to a substrate.
  • Aptamers may be isolated, sequenced, and/or amplified or synthesized as conventional DNA or R A molecules.
  • aptamers of interest may comprise modified oligomers. Any of the hydroxyl groups ordinarily present in aptamers may be replaced by phosphonate groups, phosphate groups, protected by a standard protecting group, or activated to prepare additional linkages to other nucleotides, or may be conjugated to solid supports.
  • One or more phosphodiester linkages may be replaced by alternative linking groups, such as P(0)0 replaced by P(0)S, P(0)NR 2 , P(0)R, P(0)OR', CO, or CNR 2 , wherein R is H or alkyl (1-20C) and R' is alkyl (1-20C); in addition, this group may be attached to adjacent nucleotides through O or S. Not all linkages in an oligomer need to be identical.
  • the aptamers used as starting materials in the process to determine specific binding sequences may be single-stranded or double-stranded DNA or RNA.
  • the sequences are single-stranded DNA, which is less susceptible to nuclease degradation than RNA.
  • the starting aptamer will contain a randomized sequence portion, generally including from about 10 to 400 nucleotides, more preferably 20 to 100 nucleotides.
  • the randomized sequence is flanked by primer sequences that permit the amplification of aptamers found to bind to the target. For synthesis of the randomized regions, mixtures of nucleotides at the positions where randomization is desired may be added during synthesis.
  • Each cycle results in an enrichment of aptamers with high affinity for the target.
  • Repetition for between three to six selection and amplification cycles may be used to generate aptamers that bind with high affinity and specificity to the target.
  • Aptamers may be selected to bind to and inhibit or activate one or more proteins products of cardiac growth or regression related genes.
  • Protamine may also be used to form a complex with an expression construct. Such complexes may then be formulated with the lipid compositions described above for adminstration to a cell.
  • Protamines are small highly basic nucleoproteins associated with DNA. Their use in the delivery of nucleic acids is described in U.S. Patent 5,187,260, which is incorporated by reference.
  • a nucleic acid may be entrapped in a liposome or lipid formulation.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated is a gene construct complexed with Lipofectamine (Gibco BRL).
  • DOTAPxholesterol lipid formulation is said to form a unique structure termed a "sandwich liposome". This formulation is reported to "sandwich" DNA between an invaginated bi-layer or 'vase' structure. Beneficial characteristics of these lipid structures include a positive colloidal stabilization by cholesterol, two dimensional DNA packing and increased serum stability.
  • the liposome is further defined as a nanoparticle.
  • nanoparticle is defined herein to refer to a submicron particle.
  • the submicron particle can be of any size.
  • the nanoparticle may have a diameter of from about 0.1 , 1 , 10, 100, 300, 500, 700, 1000 nanometers or greater.
  • the nanoparticles that are administered to a subject may be of more than one size.
  • any method known to those of ordinary skill in the art can be used to produce nanoparticles.
  • the nanoparticles are extruded during the production process.
  • Information pertaining to the production of nanoparticles can be found in U.S. Patent App. Pub. No. 20050143336, U.S. Patent App. Pub. No. 20030223938, U.S. Patent App. Pub. No. 20030147966, each of which is herein specifically incorporated by reference into this section.
  • an anti-inflammatory agent is administered with the lipid to prevent or reduce inflammation secondary to administration of a lipid:nucleic acid complex.
  • the anti-inflammatory agent may be a non-steroidal anti-inflammatory agent, a salicylate, an anti-rheumatic agent, a steroid, or an immunosuppressive agent.
  • Synthesis of DOTAP:Chol nanoparticles is by any method known to those of ordinary skill in the art.
  • the method can be in accordance with that set forth in Chada et al., 2003, or Templeton et al., 1997 ' , both of which are herein specifically incorporated by reference.
  • DOTAP:Chol-DNA complexes were prepared fresh two to three hours prior to injection in mice.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated is a gene construct complexed with Lipofectamine (Gibco BRL).
  • Lipid based non-viral formulations provide an alternative to adenoviral gene therapies. Although many cell culture studies have documented lipid based non-viral gene transfer, systemic gene delivery via lipid based formulations has been limited. A major limitation of non-viral lipid based gene delivery is the toxicity of the cationic lipids that comprise the non-viral delivery vehicle. The in vivo toxicity of liposomes partially explains the discrepancy between in vitro and in vivo gene transfer results. Another factor contributing to this contradictory data is the difference in liposome stability in the presence and absence of serum proteins. The interaction between liposomes and serum proteins has a dramatic impact on the stability characteristics of liposomes (Yang and Huang, 1997).
  • Cationic liposomes attract and bind negatively charged serum proteins. Liposomes coated by serum proteins are either dissolved or taken up by macrophages leading to their removal from circulation.
  • Current in vivo liposomal delivery methods use subcutaneous, intradermal, intratumoral, or intracranial injection to avoid the toxicity and stability problems associated with cationic lipids in the circulation.
  • liposomes and plasma proteins are responsible for the disparity between the efficiency of in vitro (Feigner et ah, 1987) and in vivo gene transfer (Zhu et ah, 1993; Solodin et ah, 1995; Liu et ah, 1995; Thierry et ah, 1995; Tsukamoto et ah, 1995; Aksentijevich et ah, 1996).
  • lipid structures can be used to encapsulate compounds that are toxic (chemotherapeutics) or labile (nucleic acids) when in circulation. Liposomal encapsulation has resulted in a lower toxicity and a longer serum half- life for such compounds (Gabizon et ah, 1990). Numerous disease treatments are using lipid based gene transfer strategies to enhance conventional or establish novel therapies, in particular therapies for treating hyperproliferative diseases.
  • the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome - encapsulated DNA (Kaneda et ah, 1989).
  • HVJ hemagglutinating virus
  • the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG- 1) (Kato et ah, 1991).
  • HMG- 1 nuclear non-histone chromosomal proteins
  • the liposome may be complexed or employed in conjunction with both HVJ and HMG- 1.
  • a nucleic acid for nonviral delivery may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, column chromatography or by any other means known to one of ordinary skill in the art (see for example, Sambrook et ah, 2001 , incorporated herein by reference).
  • the present invention concerns a nucleic acid that is an isolated nucleic acid.
  • isolated nucleic acid refers to a nucleic acid molecule ⁇ e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components, and/or the bulk of the total genomic and transcribed nucleic acids of one or more cells.
  • Methods for isolating nucleic acids e.g., equilibrium density centrifugation, electrophoretic separation, column chromatography are well known to those of skill in the art.
  • the present invention is directed to methods and compositions involving an
  • an AQP7 inducer that is a polypeptide.
  • an AQP7 inducer is an AQP7 peptide or polypeptide.
  • methods involve AQP7 peptides or polypeptides in the treatment or prevention of cardiovascular conditions or diseases.
  • protein and “polypeptide” are used interchangeably herein and they both cover what is understood as a "peptide” (a polypeptide molecule having 100 or fewer amino acid residues).
  • the AQP7 inducer is a protein, polypeptide, or peptide; in particular embodiments, the AQP7 inducer is protein or polypeptide that is an antibody.
  • the antibody binds to an AQP7 inhibitor, that is, a molecule that inhibits AQP7 expression, stability or activity.
  • an AQP7 inhibitor that is, a molecule that inhibits AQP7 expression, stability or activity.
  • Peptides and polypeptides may be based on SEQ ID NO:2 (human protein from
  • NM 00170 SEQ ID NO:4 (rat protein from NM 019157) or SEQ ID NO:6 (mouse protein from NM_007473.4).
  • residues are shown to be particularly important to the biological or structural properties of a protein or peptide, e.g., residues in the binding site of an antibody, such residues may not generally be exchanged.
  • Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
  • An analysis of the size, shape, and type of the amino acid side-chain substituents reveals that arginine, lysine, and histidine are all positively charged residues; that alanine, glycine, and serine are all a similar size; and that phenylalanine, tryptophan, and tyrosine all have a generally similar shape.
  • arginine, lysine, and histidine biologically functional equivalents: arginine, lysine, and histidine; alanine, glycine, and serine; and phenylalanine, tryptophan, and tyrosine.
  • hydropathic index of amino acids may be considered.
  • Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • One embodiment of the foregoing involves the use of gene transfer to immortalize cells for the production and/or presentation of proteins.
  • the gene for the protein of interest may be transferred as described above into appropriate host cells followed by culture of cells under the appropriate conditions.
  • the gene for virtually any polypeptide may be employed in this manner.
  • the generation of recombinant expression vectors, and the elements included therein, are discussed above.
  • the protein to be produced may be an endogenous protein normally synthesized by the cell in question.
  • Another embodiment of the present invention uses autologous B lymphocyte cell lines, which are transfected with a viral vector that expresses an immunogene product, and more specifically, a protein having immunogenic activity.
  • mammalian host cell lines include Vero and HeLa cells, other B- and T- cell lines, such as CEM, 721.221 , H9, Jurkat, Raji, etc., as well as cell lines of Chinese hamster ovary, W138, BHK, COS-7, 293, HepG2, 3T3, RTN and MDCK cells.
  • a host cell strain may be chosen that modulates the expression of the inserted sequences, or that modifies and processes the gene product in the manner desired.
  • Such modifications e.g., glycosylation
  • processing e.g., cleavage
  • protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to insure the correct modification and processing of the foreign protein expressed.
  • a number of selection systems may be used including, but not limited to, HSV thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase genes, in tk-, hgprt- or aprt- cells, respectively.
  • anti-metabolite resistance can be used as the basis of selection: for dhfr, which confers resistance to; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G418; and hygro, which confers resistance to hygromycin.
  • Animal cells can be propagated in vitro in two modes: as non-anchorage- dependent cells growing in suspension throughout the bulk of the culture or as anchorage- dependent cells requiring attachment to a solid substrate for their propagation (i.e., a monolayer type of cell growth).
  • Non-anchorage dependent or suspension cultures from continuous established cell lines are the most widely used means of large scale production of cells and cell products.
  • suspension cultured cells have limitations, such as tumorigenic potential and lower protein production than adherent cells.
  • Embodiments concern AQP7 inducers that are small molecules, which refers to a small compound that is biologically active but is not a polymer. It does refer to a monomer.
  • the small molecule is capable of inducing AQP7 expression or activity.
  • the small molecule induces AQP7 transcription.
  • the small molecule interacts with the AQP7 promoter or other transcription controlling region to allow for more AQP7 transcription.
  • Putative AQP7 inducers may be may be tested for the ability to increase AQP7 expression and/or activity.
  • compositions may be tested for an ability to increase AQP7 transcripts or protein or for increased AQP7 activity. In some embodiments this is achieved by evaluating transcript or protein levels of AQP7 or by measuring transcription activity from an AQP7 transcription region controlling expression of a marker gene. For instance, transcription from an endogenous AQP7 gene can be measured or evaluated or transcription can be measured from a recombinant and/or exogenous AQP7 coding sequence under the control of an AQP7 promoter and/or enhancer region. Transcription levels can be measured by a number of assays that are well known to those of skill in the art.
  • inducers may be screened based on protein or activity levels. These may be of AQP7 itself or of proteins in an AQP7-dependent pathway. Protein levels may be evaluated by a number of assays well known to those of skill in the art including flow cytometric assay, affinity column chromatography, solid-phase binding assay or any binding assays known in the art. The ability of putative inducers to affect expression of AQP7 genes may be determined by known assays, as described in more detail below. For example, model cell lines or intact organs or tissues may be assayed for the levels of expressed proteins in the presence or absence of putativeinducers using antibodies against one or more AQP7 protein products. Alternatively, AQP7 activity is known and assays to evaluate that activity are employed. For instance, assays may involve assessing or evaluating the amount of water inside and/or outside a cell. Assays may also involve quantitative assessments of activity.
  • test substance(s) may be or include a nucleic acid, polypeptide, or small molecule.
  • a test substance may be or include a nucleic acid, polypeptide, or small molecule.
  • in vitro assays may be performed using an AQP7 sequence.
  • purified or semi-purified AQP7 protein can be used.
  • purified protein or a fragment thereof may be immobilized by attachment to the bottom of the wells of a microtiter plate.
  • the test molecule(s) can then be added either one at a time or simultaneously to the wells. After incubation, the wells can be washed and assayed to determine the degree of protein binding to the test molecule.
  • Binding may be determined by a multiplicity of known techniques, for example by "tagging" the test molecule(s) with a detectable radioactive, fluorescent, luminescent or other label.
  • the test molecule(s) may be attached to the solid substrate and purified or semi-purified protein product added. Binding of protein to the substrate may be monitored, for example, using labeled primary or secondary antibodies against the protein of interest. Typically, the molecule will be tested over a range of concentrations, and a series of control wells lacking one or more elements of the test assays are used to detect non-specific binding.
  • the test substances may comprise python serum or purified or partially purified components thereof, collected at different stages in the post-prandial cardiac growth and regression cycle. Serum may be subjected to various treatments, such as heat inactivation, protease, lipase or nuclease treatment, or may be fractionated using any known techniques for molecular and/or complex separation.
  • an AQP7 inducer may act by increasing transcription of a gene, such as AQP7.
  • Such assays may be conducted in vivo or in vitro. They need not involve the entire AQP7 gene and may contain only a region that regulates AQP7 transcription.
  • a reporter gene may be used to measure the level of expression from a transcriptional regulatory region(s) that controls AQP7 transcription.
  • a transcriptional regulatory region includes all or part of SEQ ID NO:21 or a sequence in another organism that corresponds to SEQ ID NO:21. SEQ ID NO:21 is the upstream sequence from the rat AQP7 gene.
  • the assay may involve a single transcription binding site, multiple sites, or all or part of the AQP7 promoter region.
  • the AQP7 regulatory region may involve a PPARy agonist binding site.
  • PPAR perixosome proliferator-activated receptor
  • assays are conducted in a cell-free system, while in others, tissue culture cells are employed. It is contemplated that high throughput screening assays may be employed to identify AQP7 inducers. In specific embodiments, a reporter gene assay will be used in conjunction with high throughput screening. It is specifically contemplated that such screening may involve a variety of small molecule candidates, such as can be found in a library.
  • Certain embodiments include methods for screening for candidate AQP7 inducers comprising: a) contacting a candidate AQP7 compound with a nucleic acid molecule comprising a reporter gene under the control of a cardiocyte AQP7 control region, where the AQP7 control region is all or part of a nucleic acid sequence that controls the transcriptional regulation of the AQP7 gene in cardiocytes and b) assaying for expression of the reporter gene.
  • a candidate AQP7 compound that induces expression of the reporter gene relative to one or more controls is a candidate AQP7 inducer.
  • Controls include but are not limited to a parallel assay conducted with the nucleic acid molecule in the absence of the candidate AQP7 compound or involving the same candidate compund but with a different nucleic acid molecule, such as one under the control of a different transcriptional regulation region. It is contemplated that methods may be conducted partly or fully in a cell-free system, though in other embodiments, the nucleic acid molecule is in a host cell. In some embodiments, the host cell is a cardiomyocyte. It is specifically contemplated that nucleic acid molecules, control regions, and/or host cells may be of human origin or other mammalian origin.
  • nucleic acids may be analyzed to determine levels of expression, particularly using nucleic acid amplification methods.
  • Nucleic acid sequences (mRNA and/or cDNA) to be used as a template for amplification may be isolated from cells contained in a biological sample, according to standard methodologies.
  • the nucleic acid may be fractionated or whole cell RNA. Where RNA is used, it may be desired to convert the RNA to a complementary cDNA.
  • the RNA is whole cell RNA and is used directly as the template for amplification.
  • the determination of expression is performed by amplifying (e.g. by PCR) the mRNA or cDNA sequences and detecting and/or quantifying an amplification product by any methods known in the art, including but not limited to TaqMan assay (Applied Biosystems, Foster City, CA), agarose or polyacrylamide gel electrophoresis and ethidium bromide staining, hybridization to a microarray comprising a specific probe, Northern blotting, dot-blotting, slot-blotting, etc.
  • TaqMan assay Applied Biosystems, Foster City, CA
  • agarose or polyacrylamide gel electrophoresis and ethidium bromide staining hybridization to a microarray comprising a specific probe, Northern blotting, dot-blotting, slot-blotting, etc.
  • amplification involves the use of one or more primers that hybridize selectively or specifically to a target nucleic acid sequence to be amplified.
  • One of the best-known amplification methods is the polymerase chain reaction (referred to as PCR) which is described in detail in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159.
  • PCR polymerase chain reaction
  • One embodiment of the invention may comprise obtaining a suitable sample from an individual and detecting a messenger R A.
  • the sample may be prepared for isolation of the nucleic acids by standard techniques (e.g., cell isolation, digestion of membranes, Oligo dT isolation of mRNA etc.)
  • the isolation of the mRNA may also be performed using kits known to the art (Pierce, AP Biotech, etc).
  • a reverse transcriptase PCR amplification procedure may be performed in order to quantify an amount of mRNA amplified. Methods of reverse transcribing RNA into cDNA are well known and described in Sambrook et ah, 1989. Alternative methods for reverse transcription utilize thermostable DNA polymerases.
  • one or more candidate molecules may be isolated or purified.
  • Molecular purification techniques are well known to those of skill in the art.
  • the molecule(s) of interest may be purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity).
  • Analytical methods particularly suited to molecular purification are ion-exchange chromatography, gel exclusion chromatography, HPLC, FPLC, polyacrylamide gel electrophoresis, affinity chromatography, immuno affinity chromatography and isoelectric focusing.
  • An example of purification by affinity chromatography is disclosed in U.S. Patent No. 5,206,347.
  • Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of molecule or complex, or in maintaining the activity of a regulatory molecule.
  • Affinity chromatography is a chromatographic procedure that relies on the specific affinity between a substance to be isolated and a molecule to which it can specifically bind. This is a receptor-ligand type of interaction.
  • the column material is synthesized by covalently coupling one of the binding partners to an insoluble matrix. The column material is then able to specifically adsorb the substance from the solution. Elution occurs by changing the conditions to those in which binding will not occur (e.g., altered pH, ionic strength, temperature, etc.).
  • the matrix should be a substance that itself does not adsorb molecules to any significant extent and that has a broad range of chemical, physical and thermal stability.
  • the ligand should be coupled in such a way as to not affect its binding properties. The ligand should also provide relatively tight binding. And it should be possible to elute the substance without destroying the sample or the ligand.
  • one or more fatty acids may be administered to or ingested by a subject for a physiological effect.
  • Such agents may be administered in the form of pharmaceutical or food compositions. Generally, this will entail preparing compositions that are essentially free of impurities that could be harmful to humans or animals.
  • a composition may be a nutritional substance.
  • the nutritional substance may be a food preparation containing a fatty acid composition described herein.
  • the nutritional substance may contain one or more essential nutrients.
  • the nutritional substance can be a food preparation, an essential nutrient preparation, or a combination of a food preparation and an essential nutrient preparation.
  • the fatty acid content of the nutritional substance may be an MPP composition and/or one that achieves increased cardiac hypertrophy in the subject.
  • compositions can be made or provided according to methods well known in the art of food and essential nutrient preparation, such as by homegenizing, coating, spraying, coarsely mixing, tossing, kneading, pilling, and extruding one or more fatty acids, singly or in combination, onto or with the nutritional substance.
  • a composition such as an essential nutrient preparation, contains one or more essential nutrients.
  • a composition contains one or more vitamins.
  • a composition contains one or more of the following ingredients: vitamin C, Bi, B 2 , B 3 , B 6 , folic acid (B 9 ) (or a natural isomer of reduced folate), Bi 2 , B 5 (pantothenate), H (biotin), A, E, D 3 , Ki, potassium iodide, cupric (sulfate anhydrous, picolinate, sulfate monohydrate, trioxide), selenomethionine, borate(s), zinc, calcium, magnesium, chromium, manganese, molybdenum, betacarotene, and iron.
  • Other formulas may include additional ingredients such as other carotenes (e.g. lutein, lycopene), higher than RDA amounts of B, C or E vitamins including gamma-tocopherol, "near" B vitamins (inositol, choline, PABA), trimethylglycine (anhydrous betaine), betaine hydrochloride, vitamin K 2 as menaquinone-7, lecithin, citrus bioflavinoids or nutrient forms variously described as more easily absorbed.
  • carotenes e.g. lutein, lycopene
  • B e.g. lutein, lycopene
  • E vitamins including gamma-tocopherol, "near" B vitamins (inositol, choline, PABA), trimethylglycine (anhydrous betaine), betaine hydrochloride, vitamin K 2 as menaquinone-7, lecithin, citrus bioflavinoids or nutrient forms variously described as more easily absorbed.
  • the amounts of such ingredients in a composition or for use in a method may be about, at least about, or at most about 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83,
  • the amounts of any ingredients discussed herein may be expressed as international units (IU) instead of milligrams or microgram quantities.
  • the ingredient composition may be about, at least about, or at most about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95,
  • Aqueous compositions may comprise an effective amount of an inhibitor or activator, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • pharmaceutically acceptable refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art.
  • the pharmaceutical forms suitable for use include sterile aqueous solutions or dispersions and sterile powders for the preparation of sterile solutions or dispersions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • an effective amount of a therapeutic agent must be administered to the subject.
  • An "effective amount" is the amount of the agent that produces a desired effect. An effective amount will depend, for example, on the efficacy of the agent and on the intended effect. An effective amount of a particular agent for a specific purpose can be determined using methods well known to those in the art.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • the active compound may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • a "pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see e.g., Berge et ah, 1977). Examples of such salts include acid addition salts and base addition salts.
  • the optimal pharmaceutical composition will be determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format, and desired dosage. See for example, Remington's Pharmaceutical Sciences, supra. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the specific antibody.
  • An effective amount of a pharmaceutical composition to be employed therapeutically will depend, for example, upon the therapeutic context and objectives.
  • One skilled in the art will appreciate that the appropriate dosage levels for treatment will thus vary depending, in part, upon the molecule delivered, the indication for which the therapeutic agent is being used, the route of administration, and the size (body weight, body surface or organ size) and condition (the age and general health) of the patient. Accordingly, the clinician may titer the dosage and modify the route of administration to obtain the optimal therapeutic effect.
  • a therapeutically effective amount is typically an amount such that when administered in a physiologically tolerable composition is sufficient to achieve a plasma of, for example, from about 0.01 ⁇ g/ml to about 300 ⁇ g/ml.
  • the concentration may be from about 1 ⁇ g/ml to about 300 ⁇ g/ml.
  • the concentration may be from about 1 ⁇ g/ml to about 75 ⁇ g/ml.
  • the concentration may be from about 15 ⁇ g/ml to about 50 ⁇ g/ml. Dosages may, of course, vary according to frequency and duration of administration.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models such as mice, rats, rabbits, dogs, pigs, or monkeys. An animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • the exact dosage will be determined in light of factors related to the subject requiring treatment. Dosage and administration are adjusted to provide sufficient levels of the active compound or to maintain the desired effect. Factors that may be taken into account include the severity of the disease state, the general health of the subject, the age, weight, and gender of the subject, time and frequency of administration, drug combination(s), reaction sensitivities, and response to therapy. Long-acting pharmaceutical compositions may be administered every 3 to 4 days, every week, or biweekly depending on the half-life and clearance rate of the particular formulation.
  • a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required.
  • the physician or veterinarian could start doses of the compounds employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • a suitable daily dose of a composition will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect.
  • the route of administration of the pharmaceutical composition is in accord with known methods, e.g. orally, through injection by intravenous, intraperitoneal, intracerebral (intra-parenchymal), intracerebroventricular, intramuscular, intra-ocular, intraarterial, intraportal, intralesional routes, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, urethral, vaginal, or rectal means, by sustained release systems or by implantation devices.
  • the compositions may be administered by bolus injection or continuously by infusion, or by implantation device.
  • the composition may be administered locally via implantation of a catheter, membrane, sponge, or another appropriate material on to which the desired molecule has been absorbed or encapsulated.
  • the device may be implanted into any suitable tissue or organ, and delivery of the desired molecule may be via diffusion, timed-release bolus, or continuous administration.
  • a pharmaceutical composition is administered via a catheter delivery system. In certain cases the delivery is to the left ventricle. Examples include, but are not limited to, U.S.
  • a side port needle is employed.
  • compositions can be administered with medical devices known in the art.
  • a therapeutic composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. Pat. Nos. 5,399,163; 5,383,851 ; 5,312,335; 5,064,413; 4,941 ,880; 4,790,824; or 4,596,556.
  • a needleless hypodermic injection device such as the devices disclosed in U.S. Pat. Nos. 5,399,163; 5,383,851 ; 5,312,335; 5,064,413; 4,941 ,880; 4,790,824; or 4,596,556.
  • Examples of well-known implants and modules useful in the present invention include: U.S. Pat. No. 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; U.S. Pat. No.
  • sustained- or controlled-delivery formulations include formulations involving binding agent molecules in sustained- or controlled-delivery formulations.
  • Techniques for formulating a variety of other sustained- or controlled-delivery means such as liposome carriers, bio-erodible microparticles or porous beads and depot injections, are also known to those skilled in the art. See for example, PCT/US93/00829 that describes controlled release of porous polymeric microparticles for the delivery of pharmaceutical compositions.
  • sustained-release preparations include semipermeable polymer matrices in the form of shaped articles, e.g. films, or microcapsules. Sustained release matrices may include polyesters, hydrogels, polylactides (U.S.
  • compositions in an ex vivo manner.
  • cells, tissues, or organs that have been removed from the patient are exposed to the pharmaceutical compositions after which the cells, tissues and/or organs are subsequently implanted back into the patient.
  • Various embodiments of the claimed methods and/or compositions may concern one or more therapeutic peptides to be administered to a subject. Administration may occur by any route known in the art. In certain embodiments, oral administration is contemplated.
  • Unmodified peptides administered orally to a subject can be degraded in the digestive tract and depending on sequence and structure may exhibit poor absorption across the intestinal lining.
  • methods for chemically modifying peptides to render them less susceptible to degradation by endogenous proteases or more absorbable through the alimentary tract are known (see, for example, Blondelle et ah, 1995; Ecker and Crooke, 1995; Goodman and Ro, 1995; Goodman and Shao, 1996).
  • preparation and administration of peptide mimetics that mimic the structure of any selected peptide may be used within the scope of the claimed methods and compositions.
  • Peptide mimetics may exhibit enhanced stability and/or absorption in vivo compared to their peptide analogs.
  • therapeutic peptides may be administered by oral delivery using N- terminal and/or C-terminal capping to prevent exopeptidase activity.
  • the C- terminus may be capped using amide peptides and the N-terminus may be capped by acetylation of the peptide.
  • Peptides may also be cyclized to block exopeptidases, for example by formation of cyclic amides, disulfides, ethers, sulfides and the like.
  • Peptide stabilization may also occur by substitution of D-amino acids for naturally occurring L-amino acids, particularly at locations where endopeptidases are known to act. Endopeptidase binding and cleavage sequences are known in the art and methods for making and using peptides incorporating D-amino acids have been described (e.g., U.S. Patent Application Publication No. 20050025709). The skilled artisan will be aware that peptide modification should be followed by testing for target binding activity to direct the course of peptide modification. In certain embodiments, peptides and/or proteins may be orally administered by co-formulation with proteinase- and/or peptidase-inhibitors.
  • compositions and methods concerning nutraceuticals which refers to a food or food product with health and medical benefits.
  • a food or food product that can induce cardiac hypertrophy.
  • a composition or method involves a medical food.
  • the FDA considers medical foods to be "formulated to be consumed or administered internally under the supervision of a physician, and which is intended for the specific dietary management of a disease or condition for which distinctive nutritional requirements, on the basis of recognized scientific principles, are established by medical evaluation.” Nutraceuticals and supplements do not meet these requirements and are not classified as Medical Foods. It is contemplated that oral compositions or compositions administered orally may be prepared as a liquid, semi-liquid, gel, or solid. In solid form, compositions may be in a tablet, pill, troche, other form.
  • compositions refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal or human, as appropriate.
  • a “pharmaceutical composition” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceuticals and nutraceuticals is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the composition.
  • the composition can include supplementary inactive ingredients.
  • the composition for use as a toothpaste may include a flavorant or the composition may contain supplementary ingredients to make the formulation timed-release. Formulations are discussed in greater detail in the following sections.
  • compositions are formulated for oral delivery.
  • Oral delivery includes administration via the mouth of an animal or other mammal, as appropriate.
  • Oral delivery also includes topical administration to any part of the oral cavity, such as to the gums, teeth, oral mucosa, or to a lesion in the mouth, such as a pre-neoplastic or neoplastic lesion.
  • topical administration is defined to include administration to a surface of the body such as the skin, oral mucosa, gastrointestinal mucosa, eye, anus, cervix or vagina, or administration to the surface of the bed of an excised lesion in any of these areas or administration to the surface of a hollow viscus, such as the bladder.
  • the composition is an enteric formulation.
  • An enteric formulation is defined to include a pill, a capsule with a protective coating, or a suspension designed to withstand the low pH of the stomach. Such an enteric formulation would allow the delivery of the fatty acids to the small or large intestine.
  • compositions may be formulated as a solid or semi-solid.
  • Solid and semi-solid formulations refer to any formulation other than aqueous formulations.
  • agents include a gel, a matrix, a foam, a cream, an ointment, a lozenge, a lollipop, a gum, a powder, a gel strip, a film, a hydrogel, a dissolving strip, a paste, a toothpaste, or a solid stick.
  • a gel is defined herein as an apparently solid, jelly-like material formed from a colloidal solution.
  • a colloidal solution is a solution in which finely divided particles which are dispersed within a continuous medium in a manner that prevents them from being filtered easily or settled rapidly.
  • Methods pertaining to the formulation of gels are set forth in U.S. Pat. No. 6,828,308, U.S. Pat. No. 6,280,752, U.S. Pat. No. 6,258,830, U.S. Pat. No. 5,914,334, U.S. Pat. No. 5,888,493, and U.S. Pat. No. 5,571 ,314, each of which is herein specifically incorporated by reference in its entirety.
  • compositions set forth herein are formulated as a topical gel.
  • one or more fatty acids may be formulated as a hydrophobic gel based pharmaceutical or nutraceutical formulation.
  • a hydrophobic gel may be formulated, for example, by mixing a pentamer cyclomethacone component (Dow Corning 245 fluid.TM.) with a liquid suspension of a nucleic acid expression construct, hydrogenated castor oil, octyl palmitate and a mixture of cyclomethicone and dimethiconol in an 8:2 ratio.
  • An oral gel formulation for delivery of fatty acid(s) may also be prepared using any method known to those of ordinary skill in the art. Further details are provided in U.S. Patent Publication 2007/0066552, which is hereby incorporated by reference.
  • a matrix is defined herein as a surrounding substance within which something else is contained, such as a pharmaceutical or nutraceutical ingredient.
  • Methods pertaining to the formulation of a conducting silicone matrix is set forth in U.S. Pat. No. 6,1 19,036, which is herein specifically incorporated by reference in its entirety. Also referenced are methods pertaining to formulation of a collagen based matrix, as in Doukas et al., 2001., and Gu et al. 2004.
  • a foam is defined herein as is a composition that is formed by trapping many gas bubbles in a liquid.
  • Methods pertaining to the formulation and administration of foams are set forth in U.S. Pat. No. 4,1 12,942, U.S. Pat. No. 5,652,194, U.S. Pat. No. 6,140,355, U.S. Pat. No. 6,258,374, and U.S. Pat. No. 6,558,043, each of which is herein specifically incorporated by reference in its entirety.
  • a cream is defined herein as semi-solid emulsion, which is defined herein to refer to a composition that includes a mixture of one or more oils and water. Lotions and creams are considered to refer to the same type of formulation. Methods pertaining to the formulation of creams are set forth in U.S. Pat. No. 6,333,194, U.S. Pat. No. 6,620,451 , U.S. Pat. No. 6,261 ,574, U.S. Pat. No. 5,874,094, and U.S. Pat. No. 4,372,944, each of which is herein specifically incorporated by reference in its entirety.
  • An ointment is defined herein as a viscous semisolid preparation used topically on a variety of body surfaces. Methods pertaining to the formulation of ointments are set forth in U.S. Pat. No. 5,078,993, U.S. Pat. No. 4,868,168, and U.S. Pat. No. 4,526,899, each of which is herein specifically incorporated by reference in its entirety.
  • an ointment pharmaceutical formulation may comprise approximately 23.75 w/v % isostearyl benzoate, 23.85 w/v % bis(2-ethylhexyl)malate, 10.00 w/v % cyclomethicone, 5.00 w/v % stearyl alcohol, 10.00 w/v % microporous cellulose, 15.00 w/v % ethylene/vinyl acetate copolymer, 0.1 w/v % butylparaben, 0.1 w/v % propylparaben and 2.20 w/v % of the nucleic acid expression construct.
  • the particular concentration of the nucleic acid expression construct in the first solution will be determined by the type of fatty acids or other components and the administrative goal.
  • Non-active strip ingredients include pullulan, flavors, aspartame, potassium acesulfame, copper gluconate, polysorbate 80, carrageenan, glyceryl oleate, locust bean gum, propylene glycol and xanthan gum.
  • a pharmaceutical or nutraceutical film, lozenge, or lollipop of the present invention may be composed of ingredients, which may include, for example, xanthan gum, locust bean gum, carrageenan and pullulan.
  • the ingredients may be hydrated in purified water and then stored overnight at 4°C, after which, coloring agents, copper gluconate, sweeteners, flavorants and polyoxyethylene sorbitol esters such as polysorbate 80, and fatty acid(s) may be added to the mixture.
  • ingredients may include, for example, xanthan gum, locust bean gum, carrageenan and pullulan.
  • the ingredients may, for example, be hydrated in purified water and then stored overnight at 4. degree. C, after which, coloring agents, copper gluconate, sweetners, flavorants and polyoxyethylene sorbitol esters such as polysorbate 80 and Atmos 300TM (ICI Co.), and the fatty acid(s) may be added to the mixture.
  • oral compositions will comprise an inert diluent and/or assimilable edible carrier, and/or they may be enclosed in hard and/or soft shell gelatin capsule, and/or they may be compressed into tablets, and/or they may be incorporated directly with the food of the diet.
  • the active compounds may be incorporated with excipients and/or used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and/or the like. Solid forms suitable for solution in, or suspension in, liquid prior to topical use are also contemplated.
  • the solid and semisolid formulations may contain the following: a binder, as gum tragacanth, acacia, cornstarch, and/or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and/or the like; a lubricant, such as magnesium stearate; a fragrance, and/or a sweetening agent, such as sucrose, lactose and/or saccharin may be added and/or a flavoring agent, such as peppermint, oil of wintergreen, and/or cherry flavoring.
  • a binder as gum tragacanth, acacia, cornstarch, and/or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and/or the like
  • a lubricant such as magnesium stearate
  • a fragrance and/or a sweetening agent,
  • the solid and semisolid formulations contemplated for use on skin surfaces may include other ingredients, which are commonly blended in compositions for cosmetic purposes.
  • cosmetic ingredients include: waxes, oils, humectants, preservatives, antioxidants, ultraviolet absorbers, ultraviolet scattering agents, polymers, surface active agents, colorants, pigments, powders, drugs, alcohols, solvents, fragrances, flavors, etc, are contemplated.
  • Specific examples of cosmetic compositions include, but are not limited to: make-up cosmetics such as lipstick, lip-gloss, lip balm, skin blemish concealer, and lotion.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
  • Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to well-known parameters.
  • Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and/or the like. These compositions take the form of solutions such as mouthwashes and mouthrinses. Such compositions and/or preparations should contain at least 0.1% of active compound. The percentage of the compositions and/or preparations may, of course, be varied and/or may conveniently be between about 2 to about 75% of the weight of the unit, and/or preferably between 25-60%. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • compositions for application to topical surfaces include emulsions or pharmaceutically acceptable carriers such as solutions of the active compounds as free base or pharmacologically acceptable salts, active compounds mixed with water and a surfactant, and emulsions.
  • Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ in diameter. (Idson, 1988; Rosoff, 1988; Block, 1988; Higuchi et al., 1985). Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
  • emulsions may be either water in oil (w/o) or of the oil in water (o/w) variety.
  • compositions for application to the skin may also include dispersions in glycerol, liquid polyethylene glycols and mixtures thereof. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • liposomes and/or nanoparticles are also contemplated.
  • the formation and use of liposomes is generally known to those of skill in the art, and is also described below.
  • Nanocapsules can generally entrap compounds in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 ⁇ ) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use in the present invention, and such particles may be are easily made. Methods pertaining to the use of nanoparticles that may be used with the methods and compositions of the present invention include U.S. Pat. No. 6,555,376, U.S. Pat. No. 6,797,704, U.S. Patent Appn. 20050143336, U.S. Patent Appn. 20050196343 and U.S. Patent Appn. 20050260276, each of which is herein specifically incorporated by reference in its entirety.
  • compositions contemplated for esophageal or stomach delivery include liquid antacids and liquid alginate-raft forming compositions.
  • Liquid antacids and liquid sucralfate or alginate-raft forming compositions are well known to those skilled in the art.
  • Alginates are pharmaceutical excipients generally regarded as safe and used therefore to prepare a variety of pharmaceutical systems well documented in the patent literature, for example, in U.S. U.S. Pat. No. 6,348,502, U.S. Pat. No. 6,166,084, U.S. Pat. No. 6,166,043, U.S. Pat. No. 6,166,004, U.S. Pat. No. 6,165,615 and U.S. Pat. No. 5,681,827, each of which is herein specifically incorporated by reference into this section of the specification and all other sections of the specification.
  • a food product containing one or more fatty acids described herein can be in the form of various food compositions, including fresh bakery products (fresh bread, cakes, muffins, waffles etc.), dry bakery products (crispbread, biscuits, crackers etc.), cereal products (breakfast cereals, fibre and sterol enriched flours, mueslis, cereal based and muesli bars, such bars possibly containing chocolate, pasta products, snacks etc.), bran products (granulated and/or toasted bran products, flavoured and/or sterol coated bran products and bran-bran mixes etc.), beverages (alcoholic or non-alcoholic drinks, juices and juice-type mixed drinks, and dietary supplement and meal replacement drinks etc.
  • An especially preferred food product is a cereal milk product, preferably oat milk product or a product based on that, such as ice cream, ready mixes (for baking e.g. breads, cakes, muffins, waffles, pizzas, pancakes; or for cooking e.g.
  • soups, sauces, desserts, puddings to be used in preparing or manufacturing of foods meat products (sausages, meat-balls, cold cuts etc.) vegetable oil based products (spreads, salad oils, mayonnaise etc.). Steps of ingesting or administering such food products are included in methods described herein.
  • kits containing components suitable for treating or diagnosing diseased tissue in a patient such as AQP7 inducers.
  • the kit components may be packaged together or separated into two or more separate containers.
  • the containers may be vials that contain sterile, lyophilized formulations of a composition that are suitable for reconstitution.
  • a kit may also contain one or more buffers suitable for reconstitution and/or dilution of other reagents.
  • Kit components may be packaged and maintained sterilely within the containers. Another component that can be included is instructions for use of the kit.
  • Burmese pythons were purchased commercially (Captive Bred Reptiles) and they were maintained individually in 20 1 plastic boxes at 27-29 °C under a 14 L: 10 D photoperiod.
  • snakes were fed biweekly with a diet of rodents with water available ad libitum.
  • Juvenile Burmese pythons with body masses ranging from 600g-700g were fasted for 30 days.
  • rodent meals equivalent to 25% of the snake's body mass.
  • Masson trichrome-stained sections were made of a fasted and a fed snake after 3 days of a rodent meal. The increase in size of hearts among similar size snakes was observed. Collagen staining was employed and no obvious differences between the two conditions were observed.
  • a-actinin (A5044) antibody was purchased from Sigma- Aldrich. Alexa Fluor 488
  • Aquaporin 7 (Aqp7) rat cDNA was obtained by PCR from neonatal rat cardiomyocytes total cDNA using the following primers:
  • the PCR product was cloned directly into the multiple cloning site of the pShuttle-CMV vector using Bgl II and Xbal restriction sites and confirmed by sequencing.
  • the Aqp7 recombinant adenovirus was generated by using the full-length rat Aqp7 into the pShuttle with the AdEasy Adenoviral Vector System according to the manufacturer's instructions (Qbiogene, Inc).
  • RVMs neonatal rat cardiac myocytes
  • cells were obtained from the hearts of Sprague-Dawley rat pups (1-2 days old) by trypsinization and plated in MEM medium (Hanks' salts) with 5% calf serum. After 48 h in culture, cells were transferred to serum- free medium supplemented with transferring and insulin (each 10 ⁇ g/ml). Cells were maintained in 60- or 35-mm culture dishes at a density of 200,000 cells/ml. Contaminating non-muscle cells were kept at ⁇ 10% by pre -plating and addition of 0.1 mM bromodeoxyuridine to the medium though day 3 of culture.
  • Cells were transduced with an adenovirus expressing Aqp7 or with a control adenovirus at a multiplicity of infection of 20 plaque-forming units/cell. 48h after, cells were fixed and stained for analysis. The stained cells were analyzed and images from representative fields were acquired. Sarcomeres were observed.
  • Cardiomyocytes grown on gelatin-coated coverslips were infected with Ad_Aqp7 for 48 h. Immunofluorescence was performed according to Harrison et al. (2004). Cells were washed with Tris-buffered saline/Tween 20 (TBST) and fixed with 4% paraformaldehyde for 15 min. Cells were again washed with TBST and incubated with 0.1 % Triton X for 30 min. Cells were then blocked with 2% horse serum in TBST for 1 h followed by 1 h incubation each with 1 :200 dilution of a-actinin antibody and 1 :500 Alexa fluor 488 secondary antibody.
  • TBST Tris-buffered saline/Tween 20
  • Images were captured at a 40x magnification with a fluorescence microscope (Nikon E800) equipped with a digital camera (AxioCam) and Axiovision, version 3.0.6.36 imaging software (Carl Zeiss, Thornwood, NY).
  • the surface areas were measured using NIH image software (Image J) and at least 100 individualized cells were analyzed per each experiment. Cell size was also determined by particle size analyzer, Coulter Counter Multisizer 3 (Beckman Dickinson).
  • RNA was purified with RNeasy Micro Kit MinElute Spin Columns (Qiagen) and eluted into 14 ⁇ of RNase-free.
  • the quality of the RNA is essential to the overall success of gene expression analysis using microarray technology; thus stringent quality checks were carried out at all stages.
  • the concentration and purity of the total RNA samples were first assessed by spectrophotometry (Qubit, Invitrogen). Samples were further analyzed for quantity and integrity using the Agilent Bioanalyzer (Agilent Technologies).
  • Samples that met the quality control criteria were used as templates for cRNA synthesis and biotin labeling, incorporating a single round of linear amplification, using the GeneChip Expression 3 '-Amplification One-cycle cDNA synthesis kit followed by IVT labeling reaction (Affimetrix, Inc). Samples were subsequently prepared for hybridization using the Affymetrix hybridization control kit (Affymetrix, Inc). All samples were hybridized to Rat Genome 230 plus 2.0 GeneChip arrays for 16 h. Following hybridization, the GeneChip arrays were stained and washed and fluorescent signals were detected using the Affymetrix GeneChip Scanner 3000 (Affymetrix, Inc), which provides an image of the array and automatically stores high-resolution fluorescence intensity data. These data were initially documented using Affymetrix Microarray Suite software which generates an expression report file that lists the quality control parameters. All of these parameters were scrutinized to ensure that array data had reached the necessary quality standards. For each time point three different samples were analyzed.
  • Neonatal rat cardiomyocytes were untreated (C) or treated with fasted (F), 3 DPF (P) and phenylephrin (P) for 48 hours. Each condition was assayed in triplicates. RNA was extracted and the samples were analyzed for changes in gene expression by microarray using rat gene chips from Affymetrix. The gene chip results were normalized and analyzed by hierarchical clustering, were statistical analysis group similar changes in gene expression within a same group by connecting them with brackets.
  • aMyHC R CAGGCAAAGTCAAGCATTCATATTTATTGTG (SEQ ID NO: 10)
  • cardiac hypertrophy The enlargement of the heart is known as cardiac hypertrophy and there are two types: physiologic and pathologic hypertrophy.
  • Physiologic hypertrophy is beneficial for the heart function and does not correlate with heart disease; however, pathologic hypertrophy is detrimental for the heart and progresses to cardiac dilation and heart failure.
  • Burmese pythons ⁇ Python molurus are opportunistic ambush predators, adapted to consume large meals at infrequent intervals. As a consequence of their feeding habits, pythons exhibit a large regulatory response to the digestion process including a large increase in metabolic rate, nutrient transport and organ mass including the heart. Understanding the cellular and molecular components of this rapid and reversible enlargement of the heart provides a better understanding of the mechanisms that regulate cardiac growth under physiological conditions in mammals.
  • the inventors have conducted experiments to gain insights into the remodeling process that occurs during the response of the snake heart to feeding. Histological analyses of the hearts dissected in both experimental conditions have been performed. In accordance with a physiological hypertrophy, Masson's trichrome staining showed no increased collagen deposition in the hypertrophied heart.
  • snake serum contains a pro- hypertrophic factor by treating neonatal ventricular myocytes with 2% fed snake serum and measuring changes in cell size.
  • Serum from a fed snake one day after a rodent meal (1 DPF) induced a significant increase in cardiomyocyte size compared to a fasted one.
  • the magnitude of the cell growth is comparable to a well-known pro-hypertrophic agonist such as phenylephrin (PE) ( Figure 1).
  • PE pro-hypertrophic agonist
  • the inventors have also determined that there is a dose-dependent response to the molecule present in the serum ( Figure 2).
  • a key feature of the cardiomyocytes growth is the increase in protein synthesis.
  • mTOR and the IGF signaling pathway are good candidate molecules that may be induced by snake serum.
  • activation of NFAT an indicator of pathological hypertrophic signalling, was repressed upon fed serum treatment (Figure 3).
  • Aquaporin 7 belongs to a family of water-selective membrane channels. Specifically, AQP7 facilitates water, glycerol and urea transport.
  • AQP7 is expressed in the mammalian heart, but its function and relevance to heart function remain to be determined. Based on the array analysis performed on the cardiomyocytes wherein AQP7 was 60-fold up-regulated upon treatment with fed serum, the inventors hypothesized that this protein could be an important molecule for the regulation of physiologic cardiac growth.
  • the inventors cloned the rat sequence in an adenoviral vector.
  • the AQP7-containing adenoviral constructs were transduced in NVRMs and the induction of cardiac cell growth was visualized by alpha actinin staining (and DAPI for nuclei).
  • the overexpression of AQP7 mRNA in transduced NRVMs is shown in Figure 6.
  • SSO Sulfo-N-succinimidyl oleate
  • Neonatal rat ventricular myocytes were cultured in serum-free media (MEM/Hepes/PB12) containing insulin, transferrin, BSA, and BrdU.
  • NRVMs were treated with serum (2%) in the presence and absence of SSO (400 ⁇ ) for 48 hours and cell size was determined using a Coulter Counter.
  • python serum 125 ⁇ of python serum was heated in 1 ml methanol (2.5% H 2 SO 4 ) at 80°C for 1 hour and then cooled to room temperature. 450 ⁇ of hexane was added and the samples were mixed and centrifuged. The upper phase (fatty acyl methyl esters) was then transferred to a new tube, 100 ⁇ of FAME was added, and gas chromatography was performed on an Agilent HP6890N platform equipped with a DB-23 column (30 m x 250 ⁇ x 0.25 ⁇ ).
  • Fasted plasma supplemented with C16, C16:l, and C14 recapitulates the fed plasma effect.
  • Individual fatty acids were complexed to BSA as described by de Vries et al. (1997), which is hereby incorporated by reference. Briefly, C16, C16: l, and C14 were dissolved in ethanol to yield a concentration of 18.75 mM. An equal volume of Na 2 C0 3 (10 mM) was added and the ethanol was evaporated at 60°C under continuous N 2 flow. The fatty acid mix was added dropwise to 10% BSA. BSA fatty acid complexes were then dialyzed four times at 4°C during 4-6 hours in NH 4 HCO 3 (0.1 M).
  • NRVM rinse media MEM/PB12/Hepes
  • NRVMs were treated with fasted serum, 1 day post-fed serum, or fasted serum + individual fatty acids. Serum was added for a final concentration of 2%; individual fatty acids were supplemented to 1 day post-fed levels (C14, 40 ⁇ ; C16, 137 ⁇ ; C16: l, 7.5 ⁇ ).
  • NRVM gene expression and mean cell diameter were determined after either 24 or 48 hours, respectively.
  • the graph shows that although the cardiomyocytes were smaller in the presence of SSO and no serum (control) , the inhibitor completely blocked the cell growth induced by the fed-serum (2% 1 DPF), indicating that indeed the fatty acids present in the fed serum are key to induce growth in cardiac cells.
  • the total amount of free fatty acid was determined by the sum of all species detected at each time point and the composition of the python plasma fatty acids is presented here as averaged percentage of each individual FFA from the total amount at a given time point.
  • Fed plasma between 1 DPF to 3 DPF had significantly higher total plasma FFAs than did earlier or later fed plasma samples.
  • CI 6, CI 8, CI 8: 1 , CI 8:2, C20:4 were found to be the most abundant ones and the plasma concentration of C16, CI 8: 1 and C18:2 increased between 1-3 DPF, but it was not as significant as other fatty acids.
  • CI 2 and CI 6: 1 were the FFA species that stood out, showing an increase of 4, 6 and 4 times their percentage from total, respectively ( Figures 9 and 10).
  • Aquaporin 7 expression is highly induced by fatty acid treatment.
  • lipids extracted from whole plasma recapitulated the hypertrophic effect induced in cardiomyocytes in culture supplemented with python plasma.
  • a microarray analysis was performed on cells treated with fasted and fed python plasma.
  • One of the genes that was highly up-regulated in cardiomyocytes that were fed plasma is aquaporin 7 (Aqp7), a transmembrane protein of the family of aqua/glycerol pore proteins.
  • Aqp7 is up-regulated in other animal models of physiologic hypertrophy such as exercise training and pregnancy in mice ( Figure 13).
  • Aqp7 is down- regulated in pathologic hypertrophy such as mice with genetic heart disease or aortic banding ( Figure 13).
  • C14, C16, and C16: l were evaluated to determine if their induction of hypertrophy was also associated with the induction of Aqp7.
  • cardiomyocytes cultured in the presence of fasted serum, fed serum, or fasted serum supplemented with FFAs were analyzed by qPCR in order to quantitate changes in Aqp7 mR A levels upon each experimental condition ( Figure 14).
  • Neonatal rat cardiomyocytes were treated with fasted python serum alone, fasted python serum supplemented with 1 DPF levels of C14 (40 ⁇ ), C16 (137 ⁇ ), and C16: l (7.5 ⁇ ), or fasted python serum supplemented with the fatty acids individually (C14: 10, 33, or 100 ⁇ ; C16: 33, 100, or 300 ⁇ ; C16: l : 3, 10, or 33 ⁇ ). Fasted serum (2% final) and fatty acids were diluted in serum- free media (MEM/Hepes/PB12) containing insulin, transferrin, BSA, and BrdU. Cells were treated for 48 hours and AQP7 mRNA expression was determined using qPCR with 18S as the normalizing gene.
  • siRNA studies Rat AQP7 mRNA sequence was analyzed for potential small interfering RNA (siRNA) target regions using a sequence identification tool (Ambion, Inc., Austin, TX). Potential target sequences were transcribed from oligonucleotide templates using the Silencer siRNA Construction kit (Ambion, Inc., Austin, TX). To test for the ability of siRNAs to effectively reduce AQP7 expression, NRVMs were transfected with siRNA (100 nM) using Lipofectamine Plus reagent as specified by the manufacturer (Invitrogen, Carlsbad, CA).
  • rat AQP7-specific siRNA sequences (#1 : 5 ' - AAAGGCTTGGC AGCTATCTTG-3 ' (SEQ ID NO:22); #2: AACCACTATGCAGGTGGAGAA-3 ' (SEQ ID NO:23); #3 5'- AAGTTGAACAGTCCAGC ACTT-3 ' (SEQ ID NO:24)) were tested for efficacy of gene knockdown using qPCR.
  • Target sequence #3 was determined to be the most effective in reducing endogenous AQP7 mRNA expression in neonatal rat cardiomyocytes.
  • a nonspecific siRNA ⁇ Silencer Negative Control #2; Ambion, Inc., Austin, TX) was used as a negative control.
  • Infusion volumes were 500 ⁇ L per infusion.
  • Fatty acids were complexed to fatty acid-free BSA as described previously (de Vries et al., 1997) and quantified using a colorimetric assay ( EFA kit, Wako Diagnostics, Richmond, VA).
  • Fatty acid stock solutions were approximately 7 mM and the infused fatty acid volumes were calculated based on the approximate fatty acid plasma concentrations, with final infused volumes of 110 ⁇ , for CI 4, 360 ⁇ , for CI 6; and 30 ⁇ , for CI 6: 1.
  • siRNA-mediated knockdown of AQP7 inhibits NRVM hypertrophy due to python serum.
  • AQP7 siRNA reduced AQP7 mRNA expression approximately 3-fold (P ⁇ 0.01) in the presence of 1 DPF python serum as compared to the negative control siRNA ( Figure 16A).
  • Rat cardiomyocyte cellular hypertrophy in response to 1 DPF python serum was significantly reduced by gene-specific knockdown of AQP7.
  • cellular hypertrophy in response to the alpha-adrenergic agonist phenyephrine (PE) was unaffected by AQP7 siRNA (Figure 16B).
  • BSA bovine serum albumin
  • BSA bovine serum albumin
  • the final fatty acid mixtures were approximately 7 mM with molar ratios of 1 :3:0.2 for C14, C16, and C16: l; or 1 : 1.5:0.04 for C18: l, C18:2, and C20:4.
  • Mice were sacrificed 7 days after pump implantation.
  • Heart, skeletal muscle (tibialis anterior), and liver were harvested for morphological analyses. Tissue mass was normalized to tibia length to control for body size.
  • Example 7 Fatty Acids Identified in Burmese Python Promote Beneficial Cardiac Growth
  • Pythons were fed rats as meals bi-weekly and had continuous access to water. Rats were obtained from the rodent facility at the University of Colorado at Boulder and kept frozen; rats were thawed in clean warm water before feeding. Python care and study were conducted under approval from the IACUC of the University of Colorado and the University of Alabama. Prior to experimentation, pythons were fasted for a minimum of 30 days to ensure that they were post- absorptive. Pythons used in this study were of both sexes, between 6 and 12 months old, and weighed approximately 400 g.
  • pythons were fed rodent meals equivalent to 25% of their body mass. Prior to dissection and tissue collection, pythons were sedated with Isofluorane and subsequently euthanized. Tissue to be used for non- histochemical analyses and plasma were collected from four pythons at each prandial state (0, 0.5, 1 , 2, 3, 6 and 10 DPF) Samples were snap-frozen in liquid nitrogen and stored at -80°C prior to experimentation. For the bromodeoxyuridine (BrdU) incorporation assay, two pythons were fasted for 30 days followed by four intraperitoneal injections per python with BrdU (100 mg/kg every two hours) upon feeding.
  • bromodeoxyuridine (BrdU) incorporation assay two pythons were fasted for 30 days followed by four intraperitoneal injections per python with BrdU (100 mg/kg every two hours) upon feeding.
  • Python or mouse ventricle was either fixed in 10% neutral-formalin buffer or snap frozen in liquid nitrogen. H&E and Masson's Tri chrome staining was performed using standard procedures. For BrdU staining, sections were pretreated in 2N HC1 to quench endogenous peroxidase activity, treated with 3.0% hydrogen peroxide, and further retrieved with Proteinase K (S3020; Dako, Carpinteria, CA, USA). The rat anti-mouse BrdU antibody (Mas 250b; Harlan Sera Laboratories, Loughborough, UK) was prepared at a working dilution of 5 mg/ml. As a positive control, python intestinal sections were also stained as previously described (Helmstetter et ah, 2009).
  • mouse or python ventricle was fixed in 10% neutral- formalin buffer or snap frozen, stained with Oil red O, and counterstained with hematoxylin.
  • mouse aortic sections from an induced-heart disease model were also stained.
  • WGA Texas Red-conjugated wheat germ agglutinin
  • DAPI Invitrogen
  • Mouse or python ventricle was homogenized in RIPA buffer (50 mM Tris-HCl pH 8, 150mM NaCl, 0.5% Sodium Deoxycholate, 1% NP-40, 0.1% SDS), supplemented with protease inhibitors (Complete EDTA free; Roche, Indianapolis, IN, USA; 1 mM PMSF) and phosphatase inhibitors (Cocktail Set I, Calbiochem/EMD, Gibbstown, NJ, USA; ImM Sodium Orthovanadate; 20mM Sodium Fluoride), centrifuged at 14,000 g for 5 minutes.
  • RIPA buffer 50 mM Tris-HCl pH 8, 150mM NaCl, 0.5% Sodium Deoxycholate, 1% NP-40, 0.1% SDS
  • protease inhibitors Complete EDTA free; Roche, Indianapolis, IN, USA; 1 mM PMSF
  • phosphatase inhibitors Cocktail Set I, Calbiochem/EMD, Gibbstown, NJ, USA;
  • Neonatal rat ventricular myocytes were prepared according to the method described in Waspe et ah (1990). In brief, cells were obtained from the hearts of Sprague-Dawley rat pups (1 -2 days old), isolated by trypsinization, and plated in Minimum Essential Medium (MEM, 1 1575; Gibco/Invitrogen, Carlsbad, CA, USA) with 10% calf serum. After 24 hours in culture, cells were transferred to serum-free medium supplemented with transferrin and insulin (10 ug/ml each). Cells were maintained in 60- or 35-mm gelatinized culture dishes at a density of 100,000 cells/ml. To assay NFAT activity, cells were transduced with an adenoviral NFAT reporter construct at a multiplicity of infection of 20 plaque-forming units/cell. [00327] Plasma extraction, NRVM Treatment, Cell Size Quantification and
  • Blood samples were obtained from euthanized pythons in blood collection tubes with 7.5% K 3 EDTA solution (Vacutainer®, BD, Franklin Lakes, NJ, USA). The collected blood samples were centrifuged at 3000 x g for 10 min. to separate plasma, then aliquoted and snap- frozen in liquid nitrogen. For longer storage, plasma samples were kept at -80°C. Plasma used for NRVM treatments was heat inactivated at 58°C for 30 min. NRVMs were supplemented with heat-inactivated plasma at final concentration of 2% (unless stated otherwise) for 48 hours. Immunofluorescence was performed according to Harrison et al. (2004) using a-actinin antibody (A5044, Sigma-Aldrich, St.
  • Unlabeled sulfo-succinimidyl oleate (SSO) was synthesized as described by Harmon et al., (1991 (by the Sammakia Laboratory (University of Colorado, Department of Chemistry). CD36 inhibition studies were performed by treating NRVMs with 400 ⁇ SSO dissolved in DMSO (1% final concentration) for 30 min. After the treatment, NRVMs were washed twice with serum free media to remove SSO/DMSO before adding the python plasmas. A vehicle control of DMSO (final concentration 0.1 %) was added to NRVMs that were not supplemented with SSO.
  • Gene expression was normalized to either 18S ribosomal RNA (mouse) or hypoxanthine guanine phosphoribosyl transferase (HPRT, python) and depicted as normalized mRNA expression.
  • Mn-SOD Myocardial Mn-superoxide dismutase
  • the pellet (containing mitochondrial Mn-SOD) was resuspended in 20 mM HEPES buffer with 1 mM potassium cyanide added to inhibit Cu/Zn-SOD and extracellular SOD activity (MacMillan_Crow et al, 1996). SOD activity is expressed as U/ml*mg protein.
  • NRVM caspase activity was measured as described previously (Konhilas et al, 2006). Briefly, Caspase-3 activity was determined by monitoring the rate of cleavage of a fluorogenic caspase-3 specific substrate (Acetyl-AspGluValAsp-AMC; Calbiochem/Merck, Rockland, MA, USA). NRVMs were mechanically disrupted in an ice-cold lysis buffer containing: (in mmol/L) Tris(hydroxymethyl)-aminomethane (20); NaCl (137); EDTA (0.2); EGTA (0.5); Triton X-100 (1%); Glycerol (10%) (pH 7.4).
  • Cleavage of the substrate was monitored by excitation at 380 nm and emission at 460 nm with a Fluorskan Ascent Microplate Fluoro meter (Thermo Electron Corp., Milford, MA, USA). Caspase-3 activity was determined by calculating the slope of the linear portion of the cleaved substrate and then normalized to protein content (fluorescent units/minute/mg protein). Activity was normalized to the activity of the serum free (NP) control.
  • TAG Plasma triglyceride
  • EFA free-fatty acid
  • Fatty acid methyl esters were separated and quantified by capillary gas chromatography (Model 6890N, Agilent Technologies, Santa Clara, CA, USA) equipped with a DB-23 column (30m x 250 ⁇ x 0.25 ⁇ ) and a flame - ionization detector.
  • BSA bovine serum albumin
  • FFA BSA fatty acid-free bovine serum albumin
  • the molar ratio of 6: 16: 1 the molar ratio of myristic, palmitic, and palmitoleic found in fasted pythons (i.e., 3uM myristic, 37uM palmitic, and 1.2uM palmitoleic) was subtracted from the molar ratio found in fed pythons at 1 DPF.
  • the resulting molar ratio was 37uM myristic, lOOuM palmitic, and 6.3uM palmitoleic (6: 16: 1) was considered the corrected fed molar ratio.
  • Boluses 0.5 mL) of python plasma (fasted or fed [2 DPF]), bovine serum albumin (BSA; 10% in physiological saline), or the 6: 16: 1 mixture of myristic, palmitic, and palmitoleic were infused through surgically implanted catheters at 12-hr intervals into the hepatic vein of pythons over a 48-hr period (4 infusions per snake). Plasma originated from snakes that were siblings to those infused.
  • Catheters were implanted under isofluorane anesthesia cranial to the liver and exteriorized through an opening in the body wall. Snakes typically recovered from anesthesia within 30 min and were then maintained at a constant 30°C until dissection and tissue collection.
  • ALZET® mini-osmotic pumps (Model 2001 , Durect Corporation, Cupertino, CA, USA) containing either BSA (10% in sterile saline), the 6: 16: 1 mixture of C14:0, C16:0, and C16: l described above, or a control mixture of C18: l , C18:2, and C20:4, in the 1 DPF molar ratio (27:40: 1) were implanted subcutaneously in mice under inhaled isofluorane anesthesia. Pumps delivered 1 ⁇ L per hour for 7 days; mice were sacrificed on the 7th day after implantation.
  • the postprandial python heart demonstrated an atypical pattern of gene expression, with increased expression of both SERCA2 and a-skeletal actin mR A, as well as a progressive increase in both MYH7 ( ⁇ -MyHC) and a less-characterized striated muscle myosin heavy chain gene, MYH15 which is also the predominant MyHC isoform expressed in the chicken heart (Figure 23A-C) (Rossi et ah, 2010).
  • Western blot analyses revealed increased phosphorylation of AMPK, Akt, GSK3 , and mTOR during the postprandial period ( Figure 21D and Figure 24 A-D), indicating robust activation of protein synthetic pathways in the postprandial python heart.
  • RVMs neonatal rat ventricular myocytes
  • Fasted and post-fed python plasma was analyzed by gas chromatography (GC) and observed a highly complex composition of circulating fatty acids with distinct patterns of abundance over the course of digestion (Figure 37).
  • 5 candidate fatty acids were selected for further analysis, and it was determined that supplementing fasted python plasma with the 1 DPF molar ratio of C14:0 (myristic acid), C16:0 (palmitic acid), and C16: ln7 (palmitoleic acid), corrected for the fasted levels of these fatty acids to arrive at a molar ratio of 6: 16: 1 , effectively recapitulated the increase in NRVM cell diameter seen with 1 DPF plasma (Figure 38).
  • palmitoleic acid combined with increased oxidative capacity and free-radical scavenging capacity may act to reduce the generation of toxic, pro-apoptotic intermediates such as ceramide and reactive oxygen species, and enhance the activity of cardioprotective pathways such as triglyceride biosynthesis and ⁇ -oxidation (Miller et al, 2005; de Vries et al , 1997; Hickson-Bick et al, 2000).
  • the inventors also administered a mixture of oleic (C18: l), linoleic (C18:2), and arachidonic (C20:4) acid in the molar ratio observed in the 1 DPF python and saw no evidence of cardiac hypertrophy ( Figure 42B), indicating that the pro-hypertrophic effects were specific to the mixture of myristic, palmitic, and palmitoleic acid.
  • palmitoleic acid has previously been characterized as a lipokine that can modulate systemic insulin sensitivity (Cao et ah, 2008).
  • fatty acid ethanolamides have been described as potent regulators of energy intake, and levels of the palmitoleic acid ethanolamide, palmitoleoylethanolamide (and other FAEs), are dramatically increased in the fed python gastrointestinal tract (Astarita et ah, 2006). Together, these data suggested multiple roles for palmitoleic acid and its metabolites in the regulation of insulin sensitivity, organ size, cardiac metabolism, and energy balance (Cao et ah , 2008; Astarita et ah, 2006; van der Lee et ah, 2000).
  • mice were fed a test diet that included 40% fat for 3 weeks, then administered fatty acids or control BSA for one week (Figure 45).
  • ALZET® mini-osmotic pumps (Model 2001 , Durect Corporation, Cupertino, CA, USA) containing either BSA (10% in sterile saline) or the 6: 16: 1 mixture of C14:0, C16:0, and CI 6: 1 A were implanted subcutaneously in mice under anesthesia. Pumps delivered BSA or FA for 7 days, and mice were sacrificed on the 7 th day post-implantation.
  • mice fed the high fat diet significantly increased compared to control mice ( Figure 45), similar to previous studies in which mice were fed a typical laboratory diet.
  • fatty acid supplementation may provide a new mechanism for modulating cardiac gene expression and function in mammals, and that such interventions could augment cardiac performance in the context of human disease.
  • Example 9 Aortic banding in mice administered FAs
  • the following prophetic example provides a proposed study wherein the effects of FAs in a murine model of aortic banding will be determined. This prophetic example is intended to illustrate the principles of the present invention.
  • compositions disclosed herein will be assessed using a mouse model of aortic banding wherein the transverse aorta is surgically constricted.
  • a molar ratio of 6: 16: 1 myristic:palmitic:palmitoleic will be administered intravenously, orally, or via a mini-osmotic pump to animals beginning either prior to surgical constriction of the aorta in order to assess the preventative effect of the compositions, or following surgical constriction.
  • the FAs will be administered once per day for 6-10 weeks. Animals from each group will be sacrificed periodically in order to make the following assessments.
  • Cardiac function will be assessed by measuring arterial pressure; cardiac morphology will be determined by echnocardiography; gene expression particularly for pathological markers, AQP7, oxidative capacity, and free radical scavengering machinery will be assessed by PCR; off-target toxicity profiling (liver, skeletal muscle) will be performed by histology; and systemic toxicity profiling including serum/plasma analysis will be conducted.
  • a formulation comprising a myristic, palmitic, and palmitoleic acid composition described herein, suitable for oral administration may be administered to a subject at risk of congestive heart failure. Indications of risk of congestive heart failure are known, and may include high blood pressure.
  • the formulations disclosed herein may be administered as a preventative measure against cardiovascular events in a subject at risk thereof, or may be administered to treat cardiac hypertrophy that is already underway in the subject.
  • the subject may additionally be administered other therapeutic agents for heart failure prior to, concurrent with, or subsequent to administration of the fatty acid composition.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

La présente invention concerne des procédés et des compositions permettant d'induire une hypertrophie physiologique dans une cellule pour le traitement ou la prévention d'une maladie ou d'un trouble cardiovasculaire, les compositions étant basées sur les teneurs en acides gras chez des pythons à jeun par rapport à des pythons alimentés. L'invention concerne également des procédés d'utilisation d'une composition pharmaceutique comprenant une combinaison d'acide gras d'acide myristique, d'acide palmitique et d'acide palmitoléique pour le traitement d'un patient souffrant de maladie cardiovasculaire.
PCT/US2012/041347 2011-09-29 2012-06-07 Procédés et compositions pour induire une hypertrophie physiologique sur la base des teneurs en acides gras chez des pythons à jeun par rapport à des pythons alimentés WO2013048591A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161540935P 2011-09-29 2011-09-29
US61/540,935 2011-09-29
US13/272,910 2011-10-13
US13/272,910 US20120142776A1 (en) 2009-04-09 2011-10-13 Methods and compositions for inducing physiological hypertrophy

Publications (1)

Publication Number Publication Date
WO2013048591A1 true WO2013048591A1 (fr) 2013-04-04

Family

ID=47996281

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/041347 WO2013048591A1 (fr) 2011-09-29 2012-06-07 Procédés et compositions pour induire une hypertrophie physiologique sur la base des teneurs en acides gras chez des pythons à jeun par rapport à des pythons alimentés

Country Status (1)

Country Link
WO (1) WO2013048591A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090209757A1 (en) * 2008-01-10 2009-08-20 Santiago Ini Processes for the preparation and purification of paliperidone palmitate
WO2010118362A1 (fr) * 2009-04-09 2010-10-14 The Regents Of The University Of Colorado, A Body Corporate Procédés et compositions pour induire une hypertrophie physiologique
US20100285105A1 (en) * 2006-08-01 2010-11-11 Helia Radianingtyas Oil producing microbes adn method of modification thereof
US20110195128A1 (en) * 2008-10-09 2011-08-11 Kay Patricia Palmano Treating or preventing gout
US20110206741A1 (en) * 2010-02-18 2011-08-25 Martek Biosciences Corporation DHA Triglyceride Emulsions

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100285105A1 (en) * 2006-08-01 2010-11-11 Helia Radianingtyas Oil producing microbes adn method of modification thereof
US20090209757A1 (en) * 2008-01-10 2009-08-20 Santiago Ini Processes for the preparation and purification of paliperidone palmitate
US20110195128A1 (en) * 2008-10-09 2011-08-11 Kay Patricia Palmano Treating or preventing gout
WO2010118362A1 (fr) * 2009-04-09 2010-10-14 The Regents Of The University Of Colorado, A Body Corporate Procédés et compositions pour induire une hypertrophie physiologique
US20120101162A1 (en) * 2009-04-09 2012-04-26 The Regents Of The University Of Colorado, A Body Corporate Methods and compositions for inducing physiological hypertrophy
US20110206741A1 (en) * 2010-02-18 2011-08-25 Martek Biosciences Corporation DHA Triglyceride Emulsions

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DEBIERRE-GROCKIEGO ET AL.: "Fatty Acids from Plasmodium falciparum Down-Regulate theToxic Activity of Malaria Glycosylphosphatidylinositols.", INFECT IMMUN., vol. 74, no. 10, 2006, pages 5487 - 96 *
GUARRASI ET AL.: "Quantification of Underivatized Fatty Acids From Vegetable Oils by HPLC with UV Detection.", J CHROMATOGR SCI., vol. 48, no. 8, 2010, pages 663 - 8 *
LEMAITRE ET AL.: "Endogenous red blood cell membrane fatty acids and sudden cardiac arrest.", METABOLISM., vol. 59, no. 7, 2010, pages 1029 - 1034, XP027069617, DOI: doi:10.1016/j.metabol.2009.10.026 *
RIQUELME ET AL.: "Fatty Acids Identified in the Burmese Python Promote Beneficial Cardiac Growth.", SCIENCE., vol. 334, no. 6055, 28 October 2011 (2011-10-28), pages 528 - 31 *

Similar Documents

Publication Publication Date Title
CN110087647B (zh) 氨基酸组合物及肝疾病的治疗方法
Tsai et al. Functional potato bioactive peptide intensifies Nrf2-dependent antioxidant defense against renal damage in hypertensive rats
Chen et al. The effects of hydrogen-rich saline on the contractile and structural changes of intestine induced by ischemia-reperfusion in rats
Yu et al. Antihypertensive effect of angiotensin-converting enzyme inhibitory peptide RVPSL on spontaneously hypertensive rats by regulating gene expression of the Renin–Angiotensin System
Zhang et al. Baicalin attenuates cardiac dysfunction and myocardial remodeling in a chronic pressure-overload mice model
KR20120060945A (ko) 환경대사적 전환인자, 다차원 세포내 분자 또는 환경적 영향인자를 사용한 대사적 장애의 치료 방법
Hiroyama et al. Vasopressin promotes cardiomyocyte hypertrophy via the vasopressin V1A receptor in neonatal mice
JP2023022318A (ja) ペプチドｗｋｄｅａｇｋｐｌｖｋを含む組成物
EP1896049B1 (fr) Tripeptides faisant baisser l'activite de transporteurs membranaires du plasma incluant le cotransporteur sglt1 (sodium-d-glucose)
Khoo et al. Nitrated fatty acids: from diet to disease
US20220241227A1 (en) Compositions comprising hdac inhibitors and retinoids
Wang et al. Transcriptome analysis provides insight into the anti-diabetic mechanism of theaflavins in high-fat diet and streptozotocin-induced mice
Tian et al. Voltage-dependent anion channel 1 (VDAC1) overexpression alleviates cardiac fibroblast activation in cardiac fibrosis via regulating fatty acid metabolism
EP2556839B1 (fr) Composition pharmaceutique destinée à prévenir ou à traiter l'insuffisance cardiaque et méthode pour identifier par criblage un agent apte à prévenir ou à traiter l'insuffisance cardiaque
EP2886650B1 (fr) Agent induisant la différenciation d'adipocytes bruns
Liu et al. Lutein suppresses ferroptosis of cardiac microvascular endothelial cells via positive regulation of IRF in cardiac hypertrophy
Zheng et al. Exenatide regulates substrate preferences through the p38γ MAPK pathway after ischaemia/reperfusion injury in a rat heart
US20150045433A1 (en) Methods and compositions for inducing physiological hypertrophy
AU2016363511A1 (en) Method for improving cognition
Xu et al. Remimazolam attenuates myocardial ischemia-reperfusion injury by inhibiting the nf-ĸb pathway of macrophage inflammation
US9925162B2 (en) Methods and compositions for inducing physiological hypertrophy
WO2013048591A1 (fr) Procédés et compositions pour induire une hypertrophie physiologique sur la base des teneurs en acides gras chez des pythons à jeun par rapport à des pythons alimentés
JP5879356B2 (ja) ペプチド
EP3329930A1 (fr) Compositions pharmaceutiques
US10105414B2 (en) Peptides derived from RS1 which down-regulate glucose absorption after a glucose rich meal and increase insulin sensitivity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12834895

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12834895

Country of ref document: EP

Kind code of ref document: A1