WO2013043758A2 - Compositions et procédés concernant l'utilisation directe de nadh pour produire de l'acide 3-hydroxypropionique, produits chimiques dérivés et autres produits dérivés - Google Patents

Compositions et procédés concernant l'utilisation directe de nadh pour produire de l'acide 3-hydroxypropionique, produits chimiques dérivés et autres produits dérivés Download PDF

Info

Publication number
WO2013043758A2
WO2013043758A2 PCT/US2012/056159 US2012056159W WO2013043758A2 WO 2013043758 A2 WO2013043758 A2 WO 2013043758A2 US 2012056159 W US2012056159 W US 2012056159W WO 2013043758 A2 WO2013043758 A2 WO 2013043758A2
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
malonyl
nadh
activity
coa reductase
Prior art date
Application number
PCT/US2012/056159
Other languages
English (en)
Other versions
WO2013043758A3 (fr
Inventor
Christopher P. Mercogliano
Faith Dizon WATSON
Tanya E.w. LIPSCOMB
Hans H. Liao
Michael D. Lynch
Original Assignee
Opx Biotechnologies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Opx Biotechnologies, Inc. filed Critical Opx Biotechnologies, Inc.
Publication of WO2013043758A2 publication Critical patent/WO2013043758A2/fr
Publication of WO2013043758A3 publication Critical patent/WO2013043758A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01075—Malonyl CoA reductase (malonate semialdehyde-forming)(1.2.1.75)

Definitions

  • the present invention has to deal with the production of malonate semialdehyde, 3- hydroxypropionate, and products derived thereof using a combinations of malonyl CoA reductase domains and 3 -HP dehydrogenase domains with altered cofactor specificities for NADH and NADPH.
  • the present invention also has to deal with the methods for engineering these proteins, the genetically engineered organisms used for production of products with these altered enzymes, the methods for producing such organisms.
  • the present invention deals with the production of malonic acid.
  • the present invention also deals with the methods for engineering the genetically engineered organisms used for production.
  • the present invention regards microbial production of malonate semialdehyde, 3- hydroxypropionate, and products derived thereof, including using a combinations of malonyl CoA reductase domains and 3-HP dehydrogenase domains with altered cofactor specificities for NADH and NADPH.
  • Embodiments of the present invention also include methods for engineering these proteins, including the polynucleotides that encode them, the genetically engineered microorganisms used for production with these altered enzymes, methods for producing such organisms, and methods of making compounds, downstream compounds, and downstream, products.
  • Various embodiments of the invention are directed to a method of making 3-hydroxypropionic acid comprising: combining in a vessel media, a carbon source, and any recombinant microorganism as described herein; maintaining the vessel under suitable conditions to obtain a detectable amount of 3- hydroxypionic acid or its salt in a fermentation broth; and recovering the 3-hydroxypropionic acid or its salt ("3-HP").
  • Various embodiments of the invention comprise an isolated or recombinant polynucleotide encoding a polypeptide that exhibits malonyl-CoA reductase activity, 3-HP dehydrogenase activity, or both, wherein the polypeptide so encoded is selected from the group consisting of:
  • Further embodiments are directed to an isolated or recombinant polynucleotide comprising a nucleic acid sequence that hybridizes under stringent conditions to any one of the above described polynucleotides. More specific embodiments of the above-described isolated or recombinant polynucleotides are where the indicated portion is at least 200, at least 300, at least 400, at least 450, at least 500, or at least 550 contiguous amino acids, or wherein such portion is between about 200, 300, 400 and 500, 500 and 600, 600 and 700, or 700 and 1220 contiguous amino acids. More particularly, in various embodiments the portion is selected from the group consisting of SEQ. ID NOs.: 070, 071, 072, 076, 077, 078, 079, and conservatively modified variants thereof.
  • the above-described isolated or recombinant polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 059, 059, 060, 061, and 062, and optionally SEQ ID NO: 065. Also, in various embodiments any of the above-described isolated or recombinant polynucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 066, 067, 068, and 069.
  • Embodiments variously comprise any of the above-described isolated or recombinant polynucleotides that encode a polypeptide that exhibits malonyl-CoA reductase activity, and/or that encodes a polypeptide that exhibits 3-HP dehydrogenase activity.
  • Embodiments of the invention comprise any of the following:
  • mutant malonyl-CoA reductase encoded by any of the above polynucleotides, wherein the mutant malonyl-CoA reductase preferentially utilizes NADH rather than NADPH;
  • mutant malonyl-CoA reductase encoded by any of the above polynucleotides, wherein the mutant malonyl-CoA reductase demonstrates a switch in cofactor preference fromNADPH to NADH as compared to a corresponding wild-type malonyl-CoA reductase;
  • mutant 3-HP dehydrogenase encoded by any of the above polynucleotides, wherein the mutant 3-HP dehydrogenase preferentially utilizes NADH rather than NADPH;
  • mutant 3-HP dehydrogenase encoded by any of the above polynucleotides, wherein the mutant 3-HP dehydrogenase demonstrates a switch in cofactor preference from NADPH to NADH as compared to a corresponding wild-type 3-HP dehydrogenase.
  • Embodiments of the invention also comprise an isolated or recombinant polypeptide encoded by any of the above-described polynucleotides.
  • embodiments are directed to recombinant microorganisms each comprising at least one of the above-'describedpolynucleotides and/or at least one of the above-described polypeptides.
  • More particular embodiments include such recombinant microorganism wherein the
  • microorganism has one or more of: an increased NADH dependent malonyl-CoA reductase activity; an increased NADH dependent 3-HP dehydrogenase activity.
  • polypeptides in such microorganisms may be selected from the group consisting of SEQ ID NOs: 082-089, 091-095, conservatively modified variants thereof, functional variants and functional homologs thereof.
  • a polypeptide in any such microorganism comprises a fusion of any two or more of the polypeptides of any of the above claims.
  • the recombinant microorganism is additionally engineered for production of 3- hydroxypropionic acid (3-HP), such as by any of the general or specific approaches described herein, including the figures, and also including in particular references that are incorporated by reference herein.
  • 3-HP 3- hydroxypropionic acid
  • any of the above recombinant microorganisms may have an increased utilization of NADH for 3- HP production, and more particularly in various embodiments the increased NADH utilization for 3-HP production is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 percent greater than NADH utilization for 3-HP production in a microorganism lacking the polynucleotide(s).
  • any of the above-described recombinant microorganisms may comprise one or more of the following modifications:
  • any of the above-described recombinant microorganisms may further comprise a modification to increase expression of a transhydrogenase, or alternatively may have transhydrogenase function that remains unmodified or is decreased.
  • any of the above-described recombinant microorganisms may additionally comprising further modification(s) to decrease activity of one or more of the activities in Table 10, in any
  • any of the above-described recombinant microorganisms may comprise any one or more of the modifications of FIGs. 2A-G.
  • any of the above-described recombinant microorganisms has or demonstrates NADH dependent malonyl-CoA reductase activity measured in cell lysate that is greater than 0.01 U/mg of total cell protein.
  • any of the above-described recombinant microorganisms has or demonstrates NADH dependent 3-HP dehydrogenase activity measured in cell lysate is greater than 0.01 U/mg of total cell protein.
  • any of the above-described recombinant microorganisms may further be additionally engineered for production of 3-hydroxypropionaldehyde, such as by modification to provide increased activity of 3- hydroxypropionaldehyde dehydrogenase, which may more particularly comprise providing increased activity of NADH dependent 3- hydroxypropionaldehyde dehydrogenase, such as (but not limited to) providing increased activity of NADH dependent 3-hydroxypropionaldehyde dehydrogenase with a polypeptide encoded by the puuC gene of E. coli or conservatively modified variants or functional variants thereof.
  • any of the above-described recombinant microorganisms which comprises at least one of the polynucleotides or polypeptides described above, may be additionally engineered for production of 1,3 propanediol.
  • a recombinant microorganism may comprise increased activity of 1,3 propanediol dehydrogenase, more particularly an NADH dependent 1,3 propanediol dehydrogenase, such as (but not limited to) providing increased activity of an NADH dependent 1,3 propanediol dehydrogenase with a polypeptide encoded by the dhaT gene of a Clostridia species or conservatively modified variants or functional variants thereof.
  • the recombinant microorganisms of the invention may be or may be developed from any microorganism species, including but not limited to those described and/or listed herein.
  • a malonyl-CoA reductase uses at least 0.25 molecule of NADH for each molecule of 3-HP that is produced, and/or a 3-HP dehydrogenase uses at least 0.25 molecule of NADH for each molecule of 3-HP that is produced, and/or 3-HP is produced at a yield of greater than 50 percent theoretical.
  • any such method may additionally comprise any one or more of the steps of converting the 3-HP to acrylic acid, to an acrylic acid product, and to an acrylic acid-based consumer product (including those described in this specification).
  • Further embodiments of the invention are directed to culture system comprising a carbon source in an aqueous medium and a recombinant microorganism as described above, wherein the recombinant organism is present in an amount selected from greater than 0.05 gDCW/L, 0.1 gDCW/L, greater than 1 gDCW/L, greater than 5 gDCW/L, greater than 10 gDCW/L, greater than 15 gDCW/L or greater than 20 gDCW/L.
  • the volume of the aqueous medium is selected from greater than 5 mL, greater than 100 mL, greater than 0.5L, greater than 1L, greater than 2 L, greater than 10 L, greater than 250 L, greater than 1000L, greater than 10,000L, greater than 50,000 L, greater than 100,000 L or greater than 200,000 L.
  • the volume of the aqueous medium is greater than 250 L and is contained within a steel vessel.
  • the carbon source is selected from dextrose, sucrose, a pentose, a polyol, a hexose, both a hexose and a pentose, and combinations thereof.
  • the invention also regards any of the above culture systems wherein the pH of the aqueous medium is less than 7.5.
  • the invention also regards any of the above culture systems wherein the culture system is aerated, and in more particular embodiments wherein the culture system is aerated with an oxygen transfer rate selected from:
  • any of the above-described culture systems may provide an aqueous broth that comprises:
  • a concentration of 3-hydroxypropionate selected from greater than 5g/L, greater than lOg/L, greater than 15 g/L, greater than 20g/L, greater than 25g/L, greater than 30g/L, greater than 35g/L, greater than 40g/L, greater than 50g/L, greater than 60g/L, greater than 70g/L, greater than 80g/L, greater than 90g/L, or greater than lOOg/L 3-hydroxypropionate; and optionally
  • a concentration of 1,3-propanediol selected from less than 30g/L; less than 20g/L; less than lOg/L; less than 5g/L; less than 1 g/L; or less than 0.5 g/L.
  • Any such aqueous may comprise an amount of biomass selected from less than 20 gDCW/L biomass, less than 15 gDCW/L biomass, less than 10 gDCW/L biomass, less than 5 gDCW/L biomass or less than 1 gDCW/L biomass.
  • variations of the six-polypeptide putative phosphate binding loop sequence may be employed.
  • arginine (R) is not substituted into position 2, and/or aspartic acid (D) is substituted into position 1.
  • the production of malonate semialdehyde, 3-HP, and/or other products of interest is not linked to microorganism growth, that is to say, there are non-growth coupled embodiments in which production rate is not linked metabolically to cellular growth.
  • Products that may be made from 3-HP using the embodiments herein include derived chemicals and derived products, such as those disclosed in Table 12, incorporated into this section.
  • FIG. 1A depicts representative metabolic pathways to produce end products (chemical products) produced from 3-HP which include, but are not limited to, 3-hydroxypropionaldehyde, 1,3 propanediol, poly-3-hydroxypropionate.
  • FIG. IB depicts representative metabolic pathways to produce end products (chemical products) produced from malonate semialdehyde.
  • FIGs. 2A to 2G depict various genetic modifications that may be made in a microorganism cell according to various embodiments of the present invention.
  • gene names such as those of E. coli are shown at certain enzymatic steps. These are provided as an example and are not meant to be limiting.
  • FIG. 3 depicts reactions of a representative fatty acid synthase complex, other reactions directed to embodiments of the present invention, and includes indications of effects of various inhibitors.
  • the gene names of E. coli are shown at various enzymatic steps. These are provided as an example and are not meant to be limiting. A line indicating feedback inhibition also is shown.
  • FIG. 4 A, B, and C show a schematic of an entire process of converting biomass to a finished product.
  • FIG. 5 A and B show a schematic of production of a diaper which may be followed using downstream product(s) of the present invention.
  • FIGs. 4A-C and 5A, B are meant to be exemplary and not limiting.
  • FIG. 6 comprises a schematic showing truncated constructs of Chloroflexus aurantiacus bi- functional malonyl-CoA reductase enzyme in relationship to the full length protein.
  • FIG. 7 provides results of malonyl-CoA reductase (Reaction 1) specific activity of N-terminal end MCR truncations assayed without YdfG.
  • FIG. 8 provides results of malonyl-CoA reductase (Reaction 1) specific activity of N-terminal end MCR truncations assayed with YdfG.
  • FIG. 9 provides results of assays 3-HP dehydrogenase activity (Reaction 2) including for specific
  • FIG. 10 provides results of assays using plasmids able to express the putative NADH-specific loop variants (variant 1 thru 4) (SEQ ID NO: 046-049) of the malonyl CoA reductase domain.
  • FIG. 11 provides 3-HP GC-MS results regarding the assays described for FIG. 10.
  • FIG. 12 provides specific activity results for variants 5-8 which comprise the secondary mutation for malonyl-CoA reductase (Reaction 1). This secondary mutation was introduced to each of the mutations made to create variants 1 -4 for the same reaction.
  • FIG. 13 provides a sequence comparison of the cofactor binding regions of the malonyl-CoA reductase and 3-HP dehydrogenase domains of the Chloroflexus aurantiacus bi-functional malonyl-CoA reductase enzyme.
  • FIG. 14 provides results showing the NADH-specific activities and NADPH-specific activities of variants 9-12.
  • FIG. 15 provides a calibration curve for 3-HP conducted with HPLC.
  • FIG. 16 provides a calibration curve for 3-HP conducted for GC/MS.
  • FIG. 17 provides a representative standard curve for the enzymatic assay for 3-HP.
  • FIG. 18 schematically depicts a first metabolic approach to production of malonate from malonyl-
  • FIG. 19 schematically depicts a second metabolic approach to production of malonate from malonyl-CoA
  • FIG. 20 depicts reactions of a representative fatty acid synthase complex, other reactions directed to embodiments of the present invention, and includes indications of effects of various inhibitors.
  • the gene names of E. coli are shown at various enzymatic steps. These are provided as an example and are not meant to be limiting. A line indicating feedback inhibition also is shown.
  • FIG. 21 depicts various genetic modifications that may be made in a microorganism cell according to various embodiments of the present invention.
  • gene names such as those of E. coli are shown at certain enzymatic steps. These are provided as an example and are not meant to be limiting.
  • FIG. 22 depicts various genetic modifications that may be made in a microorganism cell according to various embodiments of the present invention.
  • gene names such as those of E. coli are shown at certain enzymatic steps. These are provided as an example and are not meant to be limiting.
  • FIG. 23 depicts malonate and 3-HP production 20 hours after induction according to Example 6a.
  • IPTG means isopropyl-d-D-thiogalactopyranoiside
  • RBS means ribosome binding site
  • rpm revolutions per minute
  • HPLC high performance liquid
  • an "expression vector” includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to “microorganism” includes a single microorganism as well as a plurality of microorganisms; and the like.
  • DCW dry cell weight
  • microorganism includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eukarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista.
  • microbial cells and “microbes” are used interchangeably with the term microorganism.
  • primers may be used in the methods of making and using embodiments of the invention; such primers generally are synthetic polynucleotide, and more particularly synthetic oligonucleotide, constructs. Thus, it is noted that all primers disclosed herein are artificial sequences.
  • fatty acid synthase whether followed by “pathway,” “system,” or “complex,” is meant to refer to a metabolic pathway, often involving cyclic reactions to elongate to biosynthesize fatty acids in a host cell. It is noted that this may also be referred to as a “fatty acid synthesis,” a “fatty acid biosynthesis,” (or a “fatty acid synthetase”) "pathway,” "system,” or “complex.”
  • reduced enzymatic activity As used herein, “reduced enzymatic activity,” “reducing enzymatic activity,” and the like is meant to indicate that a microorganism cell's, or an isolated enzyme, exhibits a lower level of activity than that measured in a comparable cell of the same species or its native enzyme. That is, enzymatic conversion of the indicated substrate(s) to indicated product(s) under known standard conditions for that enzyme is at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, or at least 90 percent less than the enzymatic activity for the same biochemical conversion by a native (non-modified) enzyme under a standard specified condition. This term also can include elimination of that enzymatic activity.
  • a cell having reduced enzymatic activity of an enzyme can be identified using any method known in the art. For example, enzyme activity assays can be used to identify cells having reduced enzyme activity. See, for example, Enzyme Nomenclature, Academic Press, Inc., New York 2007.
  • heterologous DNA refers to a nucleic acid sequence wherein at least one of the following is true: (a) the sequence of nucleic acids is foreign to (i.e., not naturally found in) a given host microorganism; (b) the sequence may be naturally found in a given host microorganism, but in an unnatural (e.g., greater than expected) amount; or (c) the sequence of nucleic acids comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, regarding instance (c), a heterologous nucleic acid sequence that is recombinantly produced will have two or more sequences from unrelated genes arranged to make a new functional nucleic acid.
  • heterologous is intended to include the term “exogenous” as the latter term is generally used in the art. With reference to the host microorganism's genome prior to the introduction of a heterologous nucleic acid sequence, the nucleic acid sequence that codes for the enzyme is heterologous (whether or not the heterologous nucleic acid sequence is introduced into that genome).
  • increase production By “increase production,” “increase the production,” and like terms is meant to increase the quantity of one or more of enzymes, the enzymatic activity, the enzymatic specificity, and/or the overall flux through an enzymatic conversion step, biosynthetic pathway, or portion of a biosynthetic pathway.
  • a discussion of non-limiting genetic modification techniques is discussed, infra, which may be used either for increasing or decreasing a particular enzyme's quantity, activity, specificity, flux, etc.
  • the terms “disrupt,” “disruption,” “gene disruption,” or grammatical equivalents thereof (and including “to disrupt enzymatic function,” “disruption of enzymatic function,” and the like), are intended to mean a genetic modification to a microorganism that renders the encoded gene product as having a reduced polypeptide activity compared with polypeptide activity in or from a microorganism cell not so modified.
  • the genetic modification can be, for example, deletion of the entire gene, deletion or other modification of a regulatory sequence required for transcription or translation, deletion of a portion of the gene which results in a truncated gene product (e.g., enzyme) or by any of various mutation strategies that reduces activity (including to no detectable activity level) the encoded gene product.
  • a truncated gene product e.g., enzyme
  • a disruption may broadly include a deletion of all or part of the nucleic acid sequence encoding the enzyme, and also includes, but is not limited to other types of genetic modifications, e.g., introduction of stop codons, frame shift mutations, introduction or removal of portions of the gene, and introduction of a degradation signal, those genetic modifications affecting m NA transcription levels and/or stability, and altering the promoter or repressor upstream of the gene encoding the enzyme.
  • a gene disruption is taken to mean any genetic modification to the DNA, mRNA encoded from the DNA, and the corresponding amino acid sequence that results in reduced polypeptide activity.
  • Many different methods can be used to make a cell having reduced polypeptide activity.
  • a cell can be engineered to have a disrupted regulatory sequence or polypeptide-encoding sequence using common mutagenesis or knock-out technology. See, e.g., Methods in Yeast Genetics (1997 edition), Adams et al., Cold Spring Harbor Press (1998).
  • One particularly useful method of gene disruption is complete gene deletion because it reduces or eliminates the occurrence of genetic reversions in the genetically modified microorganisms of the invention.
  • antisense technology can be used to reduce the activity of a particular polypeptide.
  • a cell can be engineered to contain a cDNA that encodes an antisense molecule that prevents a polypeptide from being translated.
  • gene silencing can be used to reduce the activity of a particular polypeptide.
  • antisense molecule encompasses any nucleic acid molecule or nucleic acid analog (e.g., peptide nucleic acids) that contains a sequence that corresponds to the coding strand of an endogenous polypeptide.
  • An antisense molecule also can have flanking sequences (e.g., regulatory sequences).
  • antisense molecules can be ribozymes or antisense oligonucleotides.
  • a ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axhead structures, provided the molecule cleaves RNA.
  • Bio-production and other culture of microorganisms, as used herein, may be aerobic,
  • the language "sufficiently identical” refers to proteins or portions thereof that have amino acid sequences that include a minimum number of identical or equivalent amino acid residues when compared to an amino acid sequence of the amino acid sequences provided in this application (including the SEQ ID Nos./sequence listings) such that the protein or portion thereof is able to achieve the respective enzymatic reaction and/or other function.
  • an assay of enzymatic activity such as those commonly known in the art.
  • nucleic acid sequences may be varied and still encode an enzyme or other polypeptide exhibiting a desired functionality, and such variations are within the scope of the present invention.
  • phrase "equivalents thereof is mean to indicate functional equivalents of a referred to gene, enzyme or the like. Such an equivalent may be for the same species or another species, such as another microorganism species.
  • nucleic acid is "hybridizable" to another nucleic acid when a single stranded form of the nucleic acid can anneal to the other nucleic acid under appropriate conditions of temperature and solution ionic strength.
  • Hybridization and washing conditions are well known and exemplified in Sambrook (1989) supra, (see in particular chapters 9 and 11), incorporated by reference to such teachings.
  • Low stringency hybridization conditions correspond to a Tm of 55°C (for example 5xSSC, 0.1% SDS, 0.25 milk and no formamide or 5xSSC, 0.5% SDS and 30% formamide).
  • Moderate stringency hybridization conditions correspond for example, to Tm of 60°C (for example 6xSSC, 0.1%> SDS, 0.05%> milk with or without formamide, and stringent hybridization conditions correspond for example, to a Tm of 65° C. and O. lxSSC and 0.1% SDS.
  • a sequence of interest may be hybridizable under any such stringency condition -low, moderate or high.
  • the term "identified enzymatic functional variant" means a polypeptide that is determined to possess an enzymatic activity and specificity of an enzyme of interest but which has an amino acid sequence different from such enzyme of interest.
  • variant polynucleotide also, “variant nucleic acid sequence”
  • variant polynucleotide may be constructed that is determined to encode such an identified enzymatic functional variant. These may be identified and/or developed from orthologs, paralogs, or nonorthologous gene displacements. Also, it is recognized that a subset within such functional variants comprises conservatively modified variants of sequences provided herein.
  • segment of interest is meant to include both a gene and any other nucleic acid sequence segment of interest.
  • One example of a method used to obtain a segment of interest is to acquire a culture of a microorganism, where that microorganism's genome includes the gene or nucleic acid sequence segment of interest.
  • the genetic modification of a gene product i.e., an enzyme
  • the genetic modification is of a nucleic acid sequence, such as or including the gene, that normally encodes the stated gene product, i.e., the enzyme.
  • the ability to genetically modify a host cell is essential for the production of any genetically modified (recombinant) microorganism.
  • the mode of gene transfer technology may be by
  • a genetically modified (recombinant) microorganism may comprise modifications other than via plasmid introduction, including modifications to its genomic DNA.
  • OLIGONUCLEOTIDE SYNTHESIS M. J. Gait, ed., 1984
  • PCR THE POLYMERASE CHAIN REACTION, (Mullis et al., eds., 1994); MANUAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, Second Edition (A. L. Demain, et al., eds. 1999); MANUAL OF METHODS FOR GENERAL BACTERIOLOGY (Phillip Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W.
  • the practice of the invention may include cultivating or culturing (meant to be synonymous) cells, including in large-scale fermentations.
  • Batch, fed-batch and other approaches to fermentation practices are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36:227, (1992), and
  • embodiments of the invention may be practiced in large-scale fermentation vessels, such as steel vessels, for cost-effective commercial production of a selected chemical product.
  • a steel or other vessel may be greater than 250 L, greater than 1,000 L, greater than 10,000 L, greater than 50,000 L, greater than 100,000 L or greater than 200,000 L.
  • the specific examples below are not intended to limit the scope of size of vessels in which the any embodiment of the invention may be practiced.
  • Various embodiments of the present invention are directed to improved use of NADH by polypeptides that catalyze one or by both of the enzymatic functions of a bi-functional malonyl-CoA reductase.
  • the constructs taught herein are, in further various embodiments, used in recombinant microorganisms to increase the biosynthetic production of the chemical malonate semialdehyde (MSA, CAS No. 926-61-4) and/or 3-hydroxypropionic acid (3-HP, CAS No. 503-66-2). These embodiments are believed to substantially improve the economic production of 3-HP and the various chemicals and products that can be made from MSA or 3-HP.
  • Reaction 1 is referred to herein as “malonyl-CoA reductase” reaction, activity, or the like, and reaction 2 is referred to as “3-HP dehydrogenase” reaction, activity, or the like, including in the claims.
  • reaction 2 is referred to as “3-HP dehydrogenase” reaction, activity, or the like, including in the claims.
  • cofactor is nicotinamide adenine dinucleotide phosphate (NADPH), nicotinamide adenine dinucleotide (NADH), or some combination of the two.
  • NADPH nicotinamide adenine dinucleotide phosphate
  • NADH nicotinamide adenine dinucleotide
  • embodiments of the present invention decrease this burden, and thereby increase 3-HP production efficiency, by providing particular variants of polypeptides that are able to catalyze reactions 1 and 2 with increased use of NADH as the cofactor.
  • a portion of the increased 3-HP production efficiency is notable as increased yield from a carbon source such as glucose, sucrose, and other sugars.
  • one, or both, of reactions 1 and 2 utilize increased amounts and/or proportions of NADH.
  • SEQ ID NO: 001 The FASTA sequence is shown in SEQ ID NO: 001 (gil42561982IgbIAAS20429.1 1 malonyl-CoA reductase ⁇ Chloroflexus aurantiacus)).
  • SEQ ID NOs: 002 to 045 present full-length mutant (variant) sequences based on SEQ ID NO: 001 however comprising replacements at one or more locations along a respective sequence ("replacement sequences," or “replacement sequence locations” or “replacement sequence regions”).
  • Targets for the replacement sequences include putative phosphate binding sites that in the native sequence are expected to bind the phosphate of NADPH.
  • polynucleotide sequences may encode for a particular polypeptide sequence of SEQ ID NOs: 002 to 057 based on codon degeneracy. Any such
  • polynucleotides may be referred to as isolated polynucleotides, as may be applicable during construction, or recombinant polynucleotides, as may be applicable both during construction and also when incorporated into a recombinant microorganism.
  • embodiments of the present invention may be directed to the full length variant sequences based on the full length Chloroflexus aurantiacus malonyl-CoA reductase (i.e., SEQ ID NOs: 002 to 045), or alternatively to truncated sequences (e.g., SEQ ID NOs: 070 to 081) that similarly may comprise one or more of the replacement sequence locations, such as are shown (not to be limiting) in SEQ ID NOs: 046 to 057.
  • SEQ ID NOs: 002 to 045 full length Chloroflexus aurantiacus malonyl-CoA reductase
  • truncated sequences e.g., SEQ ID NOs: 070 to 081
  • Table 1 lists variant sequences when compared to the parent sequence (SEQ ID NO: 001), that have increase specificity and or activity with NADH compared to NADPH. Additionally, Table 1 describes how to construct these sequences by combining different wild type and mutant sequences into a total complete sequence with NADH dependent malonyl-CoA reductase activity or NADH dependent 3-HP dehydrogenase activity or both. [0096] Table 1
  • Table 2 provides a summary of sequence numbers and respective measured enzymatic activities for full length C. aurantiacus bi-functional malonyl-CoA reductase (SEQ ID NO: 001) and various truncated polypeptide sequences of this sequence. Each of the latter is named "MCR(x-y)" where x is the start of the truncated sequence, y is the end of the truncated sequence, based on the polypeptide sequence numbering of the native full length C. aurantiacus bifunctional malonyl-CoA reductase (SEQ ID NO: 001). "MCR” is an abbreviation for the latter gene or enzyme, “malonyl-CoA reductase,” as the case may be, but does not necessarily refer to the enzymatic function of a truncated sequence.
  • substitutions may be made to SEQ ID NOs:059-062 and 066-069 and such newly substituted sequences may be employed as taught for the respective non-substituted sequences.
  • Such substituted sequences which may include conservatively modified variants, may be evaluated for performance as described herein.
  • arginine (R) is not substituted into position 2
  • aspartic acid (D) is substituted into position 1.
  • these replacement sequences may be inserted into sequences that are homologous to, and/or have a specified identity with, the respective portions of Chloroflexus aurantiacus malonyl CoA reductase.
  • a BLAST for homology with Chloroflexus aurantiacus malonyl CoA reductase provides the following 8 different sequences when searching over the entire protein.
  • the portion of a CLUSTAL 2.0.11 multiple sequence alignment identifies these eight sequences with respective SEQ ID NOs: 001, and 082-087, as shown in the following table.
  • These sequences represent non- limiting examples of homologues to Chloroflexus aurantiacus malonyl CoA reductase that may be modified with mutations listed in Table 1 , to confer NADH dependent activity.
  • malonyl-CoA reductase is known in Metallosphaera sedula (Msed_709, identified as malonyl-CoA reductase/succinyl-CoA reductase), and a malonyl-CoA reductase identified as mono- functional in Sulfolobus tokodaii (sequence provided below).
  • a genetically modified microorganism may comprise an effective 3-HP pathway to convert malonyl-CoA to 3-HP in accordance with the embodiments of the present invention. It is further appreciated that the advances taught herein for reactions 1 and 2 may be employed in microorganisms to produce 3-HP. This chemical can be further converted by use of various metabolic pathways, which may be engineered, introduced, and/or enhanced in a recombinant microorganism. Examples of commercially useful end products produced from such 3-HP include, but are not limited to, 3-hydroxypropionaldehyde, 1 ,3 propanediol, poly3-hydroxypropionate. Figure 1A provides representative pathways for such conversions.
  • reaction 1 the malonyl-CoA reductase reaction
  • microorganisms to produce malonate semialdehyde.
  • This chemical can be further converted by use of various metabolic pathways, which may be engineered, introduced, and/or enhanced in a recombinant microorganism.
  • Examples of commercially useful end products produced from such malonate semialdehyde include, but are not limited to, propenoate and 0-alanine.
  • Figure IB provides representative pathways for such conversions. The conversions and noted genes/enzymes are not meant to be limiting. Embodiments also include additional
  • genetic modifications are provided to delete or otherwise decrease activity of enzymes to reduce formation of undesired metabolites and chemical end products.
  • genetic modifications are made to increase overall enzymatic activity of certain enzymatic functions.
  • enzymatic activities as provided in Table 4 may be provided with any of the other modifications described herein, in any combination.
  • the protein function for converting malonate semialdehyde to 3-HP is a native or mutated form of mmsB from Pseudomonas aeruginosa, or a functional equivalent thereof.
  • this protein function can be a native or mutated form of ydfG from E. coli , or a functional equivalent thereof.
  • this protein function can be a native or mutated form of nemA or rutE from E. coli, or a functional equivalent thereof.
  • these may supplement such activity of a bi-functional malonyl-CoA reductase as described above, having increased NADH utilization, and/or of a mono-functional dehydrogenase having increased NADH utilization (in which latter case a polypeptide having reaction 1 function also may be provided).
  • FIGs. 2A to 2G also summarize various genetic modifications that may be made to a
  • microorganism cell using E. coli gene names, underlining those to be, introduced according to the present teachings, increased and/or overexpressed, and providing Xs and dashed Xs to those steps/reactions to be eliminated (e.g., disrupted) or reduced (such as transiently), respectively.
  • El is taken to refer to sequences providing Reaction 1 activity
  • E2 is taken to refer to sequences providing Reaction 2 activity, noting that a single sequence can be introduced that provides both reaction functions.
  • any one or more enzymes of a microorganism cell's fatty acid synthase (synthetase) system may be modified so reduce or eliminate its function, including by use of temperature-sensitive mutants and shifting culture temperature to a temperature (such as after a desired biomass is achieved) at which there is reduced activity. This leads to a shifting use of malonyl-CoA toward production of 3-HP (or alternatively other chemicals of interest).
  • Reaction 1 is referred to herein as “malonyl-CoA reductase” reaction, activity, or the like, and reaction 2 is referred to as “malonate semialdehyde dehydrogenase” reaction, activity, or the like, including in the claims.
  • Reaction 3 is referred to as “malonyl-CoA thioesterase” reaction, activity, or the like.
  • These terms for reactions 1 and 2 may be used whether the cofactor is nicotinamide adenine dinucleotide phosphate (NADPH), nicotinamide adenine dinucleotide (NADH), or some combination of the two.
  • NADPH nicotinamide adenine dinucleotide phosphate
  • NADH nicotinamide adenine dinucleotide
  • eznymes have been characterized to perform reaction 2. These include dehydrogenases that operate on malonate semialdehyde and use either NADH or NADPH as a reductant.
  • dehydrogenases that operate on malonate semialdehyde and use either NADH or NADPH as a reductant.
  • glycoaldehyde dehydrogenase encoded by the aldA gene of E. coli,( Tani, Y.; Morita, H.; Nishise, H.; Ogata, K.; Agric. Biol. Chem. 42, 63-68 (1978)) and succinate semialdehyde dehydrogenase of Euglena gracilis (Tokunaga, M.; Nakano, Y.; Kitaoka, S.; Biochim. Biophys.
  • malonate dehydrogenases may be obtained from polypeptide or corresponding polynucleotide sequences that are homologous to, and/or have a specified identity with, the respective portions of aldA gene of E. coli. .
  • a BLAST for homology with aldA gene of E. coli provides 18 different sequences when searching over the entire polynucleotide. These sequences represent non- limiting examples of homologues to the aldA gene of E. coli. Methods in the art can be used to improve the use of malonate semialdehyde as a substrate with any of these sequences, by mutation and screening.
  • fermentable sugars may be obtained from cellulosic and lignocellulosic biomass through processes of pretreatment and saccharification, as described, for example, in U.S. Patent Publication No. 2007/0031918A1, which is herein incorporated by reference.
  • Biomass refers to any cellulosic or lignocellulosic material and includes materials comprising cellulose, and optionally further comprising hemicellulose, lignin, starch, oligosaccharides and/or monosaccharides. Biomass may also comprise additional components, such as protein and/or lipid.
  • Biomass may be derived from a single source, or biomass can comprise a mixture derived from more than one source; for example, biomass could comprise a mixture of corn cobs and corn stover, or a mixture of grass and leaves.
  • Biomass includes, but is not limited to, bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste.
  • biomass examples include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure. Any such biomass may be used in a bio-production method or system to provide a carbon source.
  • crop residues such as corn husks, corn stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure. Any such biomass may be used in a bio-production method or system to provide a carbon
  • Various approaches to breaking down cellulosic biomass to mixtures of more available and utilizable carbon molecules, including sugars include: heating in the presence of concentrated or dilute acid (e.g., ⁇ 1% sulfuric acid); treating with ammonia; treatment with ionic salts; enzymatic degradation; and combinations of these. These methods normally follow mechanical separation and milling, and are followed by appropriate separation processes.
  • Bio-production media which is used in the present invention with recombinant microorganisms having a biosynthetic pathway for 3 -HP or malonic acid, must contain suitable carbon sources or substrates for the intended metabolic pathways.
  • Suitable substrates may include, but are not limited to, monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Additionally the carbon substrate may also be one-carbon substrates such as carbon dioxide, carbon monoxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated.
  • carbon substrates and mixtures thereof are suitable in the present invention as a carbon source
  • common carbon substrates used as carbon sources are glucose, fructose, and sucrose, as well as mixtures of any of these sugars.
  • suitable substrates include xylose, arabinose, other cellulose-based C-5 sugars, high- fructose corn syrup, and various other sugars and sugar mixtures as are available commercially.
  • Sucrose may be obtained from feedstocks such as sugar cane, sugar beets, cassava, bananas or other fruit, and sweet sorghum.
  • Glucose and dextrose may be obtained through saccharification of starch based feedstocks including grains such as corn, wheat, rye, barley, and oats. Also, in some embodiments all or a portion of the carbon source may be glycerol. Alternatively, glycerol may be excluded as an added carbon source.
  • the carbon source is selected from glucose, fructose, sucrose, dextrose, lactose, glycerol, and mixtures thereof.
  • the amount of these components in the carbon source may be greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or more, up to 100% or essentially 100% of the carbon source.
  • methylotrophic organisms are known to utilize a number of other carbon containing compounds in addition to one and two carbon substrates, such as methylamine, glucosamine and a variety of amino acids for metabolic activity.
  • methylotrophic yeasts are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth CI Compd. (Int. Symp.), 7th (1993), 415-32. Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK).
  • various species of Candida will metabolize alanine or oleic acid (Suiter et al., Arch. Microbiol. 153:485-489 (1990)).
  • the source of carbon utilized in embodiments of the present invention may encompass a wide variety of carbon-containing substrates.
  • any of a wide range of sugars including, but not limited to sucrose, glucose, xylose, cellulose or hemicellulose
  • a microorganism such as in an industrial system comprising a reactor vessel in which a defined media (such as a minimal salts media including but not limited to M9 minimal media, potassium sulfate minimal media, yeast synthetic minimal media and many others or variations of these), an inoculum of a microorganism providing one or more of the 3-HP or malonic acid biosynthetic pathway alternatives, and the a carbon source may be combined.
  • a defined media such as a minimal salts media including but not limited to M9 minimal media, potassium sulfate minimal media, yeast synthetic minimal media and many others or variations of these
  • an inoculum of a microorganism providing one or more of the 3-HP or malonic acid biosynthetic pathway alternatives, and the a carbon source may be combined.
  • the carbon source enters the cell and is catabolized by well-known and common metabolic pathways to yield common metabolic intermediates, including phosphoenolpyruvate (PEP).
  • PEP phosphoenolpyruvate
  • Bio-based carbon can be distinguished from petroleum-based carbon according to a variety of methods, including without limitation ASTM D6866, or various other techniques.
  • carbon- 14 and carbon- 12 ratios differ in bio-based carbon sources versus petroleum-based sources, where higher carbon- 14 ratios are found in bio-based carbon sources.
  • the carbon source is not petroleum-based, or is not predominantly petroleum based.
  • the carbon source is greater than about 50% non-petroleum based, greater than about 60%> non-petroleum based, greater than about 70%) non-petroleum based, greater than about 80% non-petroleum based, greater than about 90% non-petroleum based, or more.
  • the carbon source has a carbon- 14 to carbon- 12 ratio of about 1.0 x 10 "14 or greater.
  • the carbon source may be less than about 50% glycerol, less than about 40% glycerol, less than about 30% glycerol, less than about 20% glycerol, less than about 10% glycerol, less than about 5% glycerol, less than about 1% glycerol, or less.
  • the carbon source may be essentially glycerol-free. By essentially glycerol-free is meant that any glycerol that may be present in a residual amount does not contribute substantially to the production of the target chemical compound.
  • microorganism selected from the listing herein, or another suitable microorganism, that also comprises one or more natural, introduced, or enhanced chemical product biosynthesis pathway.
  • the microorganism comprises an endogenous chemical product biosynthesis pathway (which may, in some such
  • microorganism be enhanced), whereas in other embodiments the microorganism does not comprise an endogenous biosynthesis pathway for the selected chemical product (such as 3-HP or malonic acid).
  • Varieties of these genetically modified microorganisms may comprise genetic modifications and/or other system alterations as may be described in other patent applications of one or more of the present inventor(s) and/or subject to assignment or license to the owner of the present patent application.
  • a microorganism used for the present invention may be selected from bacteria, cyanobacteria, filamentous fungi and yeasts.
  • microbial hosts initially selected for 3-HP or malonic acid or other chemical product biosynthesis should also utilize sugars including glucose at a high rate.
  • Most microbes are capable of utilizing carbohydrates.
  • certain environmental microbes cannot utilize carbohydrates to high efficiency, and therefore may not be suitable hosts for such
  • the present invention easily may be applied to an ever-increasing range of suitable microorganisms. Further, given the relatively low cost of genetic sequencing, the genetic sequence of a species of interest may readily be determined to make application of aspects of the present invention more readily obtainable (based on the ease of application of genetic modifications to an organism having a known genomic sequence).
  • suitable microbial hosts for the biosynthesis of a chemical product generally may include, but are not limited to, any gram negative organisms, more particularly a member of the family Enterobacteriaceae, such as E. coli, or Oligotropha carboxidovorans, or Pseudomononas sp.; any gram positive microorganism, for example Bacillus subtilis, Lactobaccilus sp.
  • suitable microbial hosts for the biosynthesis of a chemical product generally include, but are not limited to, members of the genera Clostridium,
  • Hosts that may be particularly of interest include: Oligotropha carboxidovorans (such as strain OMS), Escherichia coli, Alcaligenes eutrophus (Cupriavidus necator), Bacillus licheniformis, Paenibacillus macerans, Rhodococcus erythropolis, Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, Bacillus subtilis and Saccharomyces cerevisiae.
  • Oligotropha carboxidovorans such as strain OMS
  • Escherichia coli Alcaligenes eutrophus (Cupriavidus necator)
  • Bacillus licheniformis Bacillus licheniformis
  • Paenibacillus macerans Rhodococcus erythropolis
  • Pseudomonas putida Lactobacill
  • suitable microbial hosts for the biosynthesis of 3-HP or malonic acid and other chemical products generally include, but are not limited to, members of the genera Clostridium,
  • Hosts that may be particularly of interest include: Oligotropha carboxidovorans (such as strain 0M5T), Escherichia coli, Alcaligenes eutrophus (Cupriavidus necator), Bacillus licheniformis, Paenibacillus macerans, Rhodococcus erythropolis, Pseudomonas putida, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, Bacillus subtil is and Saccharomyces cerevisiae.
  • any of the known strains of these species may be utilized as a starting microorganism, as may any of the following species including respective strains thereof- Cupriavidus basilensis, Cupriavidus campinensis, Cupriavidus gilardi, Cupriavidus laharsis, Cupriavidus metallidurans, Cupriavidus oxalaticus, Cupriavidus pauculus, Cupriavidus pinatubonensis, Cupriavidus respiraculi, and Cupriavidus taiwanensis.
  • the recombinant microorganism is a gram-negative bacterium.
  • the recombinant microorganisms are selected from the genera Zymomonas, Escherichia, Pseudomonas, Alcaligenes, and Klebsiella.
  • the recombinant microorganisms are selected from the species Escherichia coli, Cupriavidus necator, Oligotropha carboxidovorans, and Pseudomonas putida.
  • the recombinant microorganism is an E. coli strain.
  • the recombinant microorganism is a gram-positive bacterium. In some embodiments, the recombinant microorganism is selected from the genera Clostridium, Salmonella, Rhodococcus, Bacillus, Lactobacillus, Enterococcus, Paenibacillus, Arthrobacter, Corynebacterium, and Brevibacterium.
  • the recombinant microorganism is selected from the species Bacillus licheniformis, Paenibacillus macerans, Rhodococcus erythropolis, Lactobacillus plantarum, Enterococcus faecium, Enterococcus gallinarium, Enterococcus faecalis, and Bacillus subtilis.
  • the recombinant microorganism is a B. subtilis is strain.
  • the recombinant microorganism is a yeast. In some embodiments, the recombinant microorganism is selected from the genera Pichia, Candida, Hansenula and Saccharomyces. In particular embodiments, the recombinant microorganism is Saccharomyces cerevisiae.
  • microorganisms that may be used in the practice of various embodiments of the invention, these microorganisms include any species of microorganism, and more particularly, any species of any taxonomic group disclosed herein, and more particularly, any species disclosed herein.
  • the ability to genetically modify the host is essential for the production of any recombinant microorganism.
  • the mode of gene transfer technology may be by electr op oration, conjugation, transduction or natural transformation.
  • a broad range of host conjugative plasmids and drug resistance markers are available.
  • the cloning vectors are tailored to the host organisms based on the nature of antibiotic resistance markers that can function in that host.
  • bio-production media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for 3 -HP or malonic acid production, or other products made under the present invention.
  • Another aspect of the invention regards media and culture conditions that comprise genetically modified microorganisms of the invention and optionally supplements.
  • Suitable growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, M9 minimal media, Sabouraud Dextrose (SD) broth, Yeast medium (YM) broth, (Ymin) yeast synthetic minimal media, and minimal media as may be described herein, such as M9 minimal media.
  • LB Luria Bertani
  • SD Sabouraud Dextrose
  • YM Yeast medium
  • Ymin yeast synthetic minimal media
  • minimal media as may be described herein, such as M9 minimal media.
  • Other defined or synthetic growth media may also be used, and the appropriate medium for growth of the particular microorganism will be known by one skilled in the art of microbiology or bio-production science.
  • a minimal media may be developed and used that does not comprise, or that has a low level of addition of various components, for example less than 10, 5, 2 or 1 g/L of a complex nitrogen source including but not limited to yeast extract, peptone, tryptone, soy flour, corn steep liquor, or casein.
  • a complex nitrogen source including but not limited to yeast extract, peptone, tryptone, soy flour, corn steep liquor, or casein.
  • These minimal medias may also have limited supplementation of vitamin mixtures including biotin, vitamin B12 and derivatives of vitamin B12, thiamin, pantothenate and other vitamins.
  • Minimal medias may also have limited simple inorganic nutrient sources containing less than 28, 17, or 2.5 mM phosphate, less than 25 or 4 mM sulfate, and less than 130 or 50mM total nitrogen.
  • Bio-production media which is used in embodiments of the present invention with genetically modified microorganisms, must contain suitable carbon substrates for the intended metabolic pathways.
  • suitable carbon substrates include carbon monoxide, carbon dioxide, and various monomeric and oligomeric sugars.
  • Suitable pH ranges for the bio-production are between pH 3.0 to pH 10.0, where pH 6.0 to pH 8.0 is a typical pH range for the initial condition.
  • pH 6.0 to pH 8.0 is a typical pH range for the initial condition.
  • the actual culture conditions for a particular embodiment are not meant to be limited by these pH ranges.
  • Bio-productions may be performed under aerobic, microaerobic, or anaerobic conditions, with or without agitation.
  • the amount of 3 -HP or malonic acid or other product(s) produced in a bio- production media generally can be determined using a number of methods known in the art, for example, high performance liquid chromatography (HPLC), gas chromatography (GC), GC/Mass Spectroscopy (MS), or spectrometry.
  • any of the recombinant microorganisms as described and/or referred to herein may be introduced into an industrial bio-production system where the microorganisms convert a carbon source into a selected chemical product, such as 3 -HP or malonic acid, in a commercially viable operation.
  • the bio-production system includes the introduction of such a recombinant
  • microorganism into a bioreactor vessel, with a carbon source substrate and bio-production media suitable for growing the recombinant microorganism, and maintaining the bio-production system within a suitable temperature range (and dissolved oxygen concentration range if the reaction is aerobic or microaerobic) for a suitable time to obtain a desired conversion of a portion of the substrate molecules to 3 -HP or malonic acid.
  • Industrial bioproduction systems and their operation are well-known to those skilled in the arts of chemical engineering and bioprocess engineering.
  • Bio-productions may be performed under aerobic, microaerobic, or anaerobic conditions, with or without agitation.
  • the operation of cultures and populations of microorganisms to achieve aerobic, microaerobic and anaerobic conditions are known in the art, and dissolved oxygen levels of a liquid culture comprising a nutrient media and such microorganism populations may be monitored to maintain or confirm a desired aerobic, microaerobic or anaerobic condition.
  • syngas is used as a feedstock
  • aerobic, microaerobic, or anaerobic conditions may be utilized.
  • sugars are used, anaerobic, aerobic or microaerobic conditions can be implemented in various embodiments.
  • any of the recombinant microorganisms as described and/or referred to herein may be introduced into an industrial bio-production system where the microorganisms convert a carbon source into 3 -HP or malonic acid, and optionally in various embodiments also to one or more downstream compounds of 3 -HP or malonic acid in a commercially viable operation.
  • the bioproduction system includes the introduction of such a recombinant microorganism into a bioreactor vessel, with a carbon source substrate and bio-production media suitable for growing the recombinant microorganism, and maintaining the bio-production system within a suitable temperature range (and dissolved oxygen concentration range if the reaction is aerobic or microaerobic) for a suitable time to obtain a desired conversion of a portion of the substrate molecules to 3 -HP or malonic acid.
  • syngas components or sugars are provided to a microorganism, such as in an industrial system comprising a reactor vessel in which a defined media (such as a minimal salts media including but not limited to M9 minimal media, potassium sulfate minimal media, yeast synthetic minimal media and many others or variations of these), an inoculum of a microorganism providing an embodiment of the biosynthetic pathway(s) taught herein, and the carbon source may be combined.
  • the carbon source enters the cell and is catabolized by well-known and common metabolic pathways to yield common metabolic intermediates, including phosphoenolpyruvate (PEP).
  • PEP phosphoenolpyruvate
  • a classical batch bioreactor system is considered "closed” meaning that the composition of the medium is established at the beginning of a respective bio-production event and not subject to artificial alterations and additions during the time period ending substantially with the end of the bio-production event.
  • the medium is inoculated with the desired organism or organisms, and bio-production is permitted to occur without adding anything to the system.
  • a "batch" type of bio-production event is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration.
  • the metabolite and biomass compositions of the system change constantly up to the time the bio-production event is stopped.
  • cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of a desired end product or intermediate.
  • a variation on the standard batch system is the fed-batch system.
  • Fed-batch bio-production processes are also suitable in the present invention and comprise a typical batch system with the exception that the nutrients, including the substrate, are added in increments as the bio-production progresses.
  • Fed- Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media.
  • Measurement of the actual nutrient concentration in Fed-Batch systems may be measured directly, such as by sample analysis at different times, or estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO 2 .
  • Batch and fed-batch approaches are common and well known in the art and examples may be found in Thomas D.
  • Continuous bioproduction is considered an "open" system where a defined bio-production medium is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing.
  • Continuous bioproduction generally maintains the cultures within a controlled density range where cells are primarily in log phase growth.
  • Two types of continuous bioreactor operation include a chemostat, wherein fresh media is fed to the vessel while simultaneously removing an equal rate of the vessel contents. The limitation of this approach is that cells are lost and high cell density generally is not achievable. In fact, typically one can obtain much higher cell density with a fed-batch process.
  • Another continuous bioreactor utilizes perfusion culture, which is similar to the chemostat approach except that the stream that is removed from the vessel is subjected to a separation technique which recycles viable cells back to the vessel.
  • This type of continuous bioreactor operation has been shown to yield significantly higher cell densities than fed-batch and can be operated continuously.
  • Continuous bio- production is particularly advantageous for industrial operations because it has less down time associated with draining, cleaning and preparing the equipment for the next bio-production event. Furthermore, it is typically more economical to continuously operate downstream unit operations, such as distillation, than to run them in batch mode.
  • Continuous bio-production allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration.
  • one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate.
  • a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant.
  • embodiments of the present invention may be practiced using either batch, fed-batch or continuous processes and that any known mode of bio-production would be suitable. It is contemplated that cells may be immobilized on an inert scaffold as whole cell catalysts and subjected to suitable bio-production conditions for 3 -HP or malonic acid production, or be cultured in liquid media in a vessel, such as a culture vessel.
  • embodiments used in such processes, and in bio-production systems using these processes include a population of genetically modified microorganisms of the present invention, a culture system comprising such population in a media comprising nutrients for the population, and methods of making 3 -HP or malonic acid and thereafter, a downstream product of 3 -HP or malonic acid.
  • Embodiments of the invention include methods of making 3-HP or malonic acid in a bio-production system, some of which methods may include obtaining 3-HP or malonic acid after such bio-production event.
  • a method of making 3-HP or malonic acid may comprise: providing to a culture vessel a media comprising suitable nutrients; providing to the culture vessel an inoculum of a genetically modified microorganism comprising genetic modifications described herein such that the microorganism produces 3-HP or malonic acid from syngas and/or a sugar molecule; and maintaining the culture vessel under suitable conditions for the genetically modified microorganism to produce 3-HP or malonic acid.
  • bio-production methods and systems including industrial bio-production systems for production of 3-HP, a recombinant microorganism genetically engineered to modify one or more aspects effective to increase tolerance to 3-HP (and, in some embodiments, also 3-HP bio-production) by at least 20 percent over control microorganism lacking the one or more modifications.
  • the invention is directed to a system for bioproduction of acrylic acid as described herein, said system comprising: a fermentation tank suitable for microorganism cell culture; a line for discharging contents from the fermentation tank to an extraction and/or separation vessel; an extraction and/or separation vessel suitable for removal of 3-hydroxypropionic acid from cell culture waste; a line for transferring 3-hydroxypropionic acid to a dehydration vessel; and a dehydration vessel suitable for conversion of 3-hydroxypropionic acid to acrylic acid.
  • the system includes one or more pre-fermentation tanks, distillation columns, centrifuge vessels, back extraction columns, mixing vessels, or combinations thereof.
  • bio-production methods and systems including industrial bio-production systems for production of a selected chemical product other than 3 -HP, a recombinant microorganism genetically engineered to modify one or more aspects effective to increase the selected chemical product's bio-production by at least 20 percent over control microorganism lacking the one or more modifications.
  • the invention is directed to a system for bio-production of a chemical product as described herein, said system comprising: a fermentation tank suitable for microorganism cell culture; a line for discharging contents from the fermentation tank to an extraction and/or separation vessel; and an extraction and/or separation vessel suitable for removal of the chemical product from cell culture waste.
  • the system includes one or more pre-fermentation tanks, distillation columns, centrifuge vessels, back extraction columns, mixing vessels, or combinations thereof.
  • Embodiments of the present invention may result from introduction of an expression vector into a host microorganism, wherein the expression vector contains a nucleic acid sequence coding for an enzyme that is, or is not, normally found in a host microorganism.
  • the ability to genetically modify a host cell is essential for the production of any genetically modified (recombinant) microorganism.
  • the mode of gene transfer technology may be by
  • a genetically modified (recombinant) microorganism may comprise modifications other than via plasmid introduction, including modifications to its genomic DNA.
  • Embodiments of the present invention may involve various nucleic acid sequences, such as heterologous nucleic acid sequences introduced into a cell's genome or may be episomal, and also encompasses antisense nucleic acid molecules, i.e., molecules which are complementary to a sense nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence.
  • antisense nucleic acid molecules i.e., molecules which are complementary to a sense nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence.
  • nucleic acid constructs can be prepared comprising an isolated polynucleotide encoding a polypeptide having enzyme activity operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a microorganism, such as E. coli, under conditions compatible with the control sequences.
  • the isolated polynucleotide may be manipulated to provide for expression of the polypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well established in the art.
  • nucleic acid constructs can be prepared comprising an isolated polynucleotide encoding a polypeptide having enzyme activity operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a microorganism, such as E. coli, under conditions compatible with the control sequences.
  • the isolated polynucleotide may be manipulated to provide for expression of the polypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well established in the art.
  • the control sequence may be an appropriate promoter sequence, a nucleotide sequence that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter sequence contains transcriptional control sequences that mediate the expression of the polypeptide.
  • the promoter may be any nucleotide sequence that shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. Examples of suitable promoters for directing transcription of the nucleic acid constructs, especially in an is.
  • coli host cell are the lac promoter (Gronenborn, 1976, MoT Gen. Genet. 148: 243-250), tac promoter (DeBoer et al 1983, Proceedings of the National Academy of Sciences USA 80: 21 - 25), trc promoter (Brosius et al, 1985, J. Biol. Chem. 260: 3539-3541), T7 RNA polymerase promoter (Studier and Moffatt, 1986, J. Mol. Biol.
  • the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in an E. coli cell may be used in the present invention. It may also be desirable to add regulatory sequences that allow regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those that cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems.
  • the genetic manipulations may be described to include various genetic manipulations, including those directed to change regulation of, and therefore ultimate activity of, an enzyme or enzymatic activity of an enzyme identified in any of the respective pathways.
  • Such genetic modifications may be directed to transcriptional, translational, and post-translational modifications that result in a change of enzyme activity and/or selectivity under selected and/or identified culture conditions and/or to provision of additional nucleic acid sequences such as to increase copy number and/or mutants of an enzyme related to 3-HP production.
  • Random mutagenesis may be practiced to provide genetic modifications that may fall into any of these or other stated approaches.
  • the genetic modifications further broadly fall into additions (including insertions), deletions (such as by a mutation) and substitutions of one or more nucleic acids in a nucleic acid of interest.
  • a genetic modification results in improved enzymatic specific activity and/or turnover number of an enzyme.
  • changes may be measured by one or more of the following: K M ; K ⁇ ; and [00167]
  • a microorganism may comprise one or more gene deletions. For example, in E.
  • lactate dehydrogenase (ldhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB), and pyruvate-formate lyase (pflB) may be disrupted, including deleted.
  • lactate dehydrogenase (ldhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB), and pyruvate-formate lyase (pflB)
  • lactate dehydrogenase (ldhA)
  • pta phosphate acetyltransferase
  • poxB pyruvate oxidase
  • pflB pyruvate-formate lyase
  • Gene deletions may be effectuated by any of a number of known specific methodologies, including but not limited to the RED/ET methods using kits and other reagents sold by Gene Bridges (Gene Bridges GmbH, Dresden, Germany, «www.genebridges.com»).
  • the host organism expressing k-red recombinase is transformed with a linear DNA product coding for a selectable marker flanked by the terminal regions (generally— 50 bp, and alternatively up to about— 300 bp) homologous with the target gene.
  • the marker could then be removed by another recombination step performed by a plasmid vector carrying the FLP-recombinase, or another recombinase, such as Cre.
  • Targeted deletion of parts of microbial chromosomal DNA or the addition of foreign genetic material to microbial chromosomes may be practiced to alter a host cell's metabolism so as to reduce or eliminate production of undesired metabolic products. This may be used in combination with other genetic modifications such as described herein in this general example.
  • amino acid "homology” includes conservative substitutions, i.e. those that substitute a given amino acid in a polypeptide by another amino acid of similar
  • Recognized conservative amino acid substitutions comprise (substitutable amino acids following each colon of a set): ala:ser; arg:lys; asn:gln or his; asp:glu; cys:ser; gln:asn; glu:asp; gly:pro; his:asn or gin; ile:leu or val; leu:ile or val; lys: arg or gin or glu; met:leu or ile; phe:met or leu or tyr; ser:thr; thr:ser; trp:tyr; tyr:trp or phe; val:ile or leu.
  • replacements of an aliphatic amino acid such as Ala, Val, Leu and Ile with another aliphatic amino acid replacement of a Ser with a Thr or vice versa
  • replacement of an acidic residue such as Asp or Glu with another acidic residue
  • conservatively modified variants also include truncated sequences, of polynucleotides as well as polypeptides, that maintain one or both functions with regard to Reaction 1 and Reaction 2.
  • the present disclosure teaches that many deletions at either the N- or C- terminals can provide a construct (truncation) that nonetheless provides a desired functionality. Also, in various embodiments deletions and/or substitutions at either end, or in other regions, of a
  • polynucleotide or polypeptide may be practiced for other sequences, based on the present teachings and knowledge of those skilled in the art, and remain within the scope of conservatively modified variants. Accordingly, functionally equivalent polynucleotides and polypeptides (functional variants), which may include conservatively modified variants as well as more extensively varied sequences, which are well within the skill of the person of ordinary skill in the art, and
  • nucleic acid sequences encoding sufficiently homologous proteins or portions thereof are within the scope of the invention. More generally, nucleic acids sequences that encode a particular amino acid sequence employed in the invention may vary due to the degeneracy of the genetic code, and nonetheless fall within the scope of the invention. The following table provides a summary of similarities among amino acids, upon which conservative substitutions may be based, and also various codon redundancies that reflect this degeneracy. [00172] Table 5
  • codon preferences and codon usage tables for a particular species can be used to engineer isolated nucleic acid molecules that take advantage of the codon usage preferences of that particular species.
  • the isolated nucleic acid provided herein can be designed to have codons that are preferentially used by a particular organism of interest. Numerous software and sequencing services are available for such codon-optimizing of sequences. It also is noted that less conservative substitutions may be made and still provide a functional variant.
  • E. coli metabolic alterations exemplified herein can readily be applied to other species by incorporating the same or analogous encoding nucleic acid from species other than the referenced species.
  • Such genetic alterations include, for example, genetic alterations of species homologs, in general, and in particular, orthologs, paralogs or nonorthologous gene displacements.
  • An ortholog is a gene or genes that are related by vertical descent and are responsible for substantially the same or identical functions in different organisms. Genes are related by vertical descent when, for example, they share sequence similarity of sufficient amount to indicate they are homologous, or related by evolution from a common ancestor. Genes can also be considered orthologs if they share three-dimensional structure but not necessarily sequence similarity, of a sufficient amount to indicate that they have evolved from a common ancestor to the extent that the primary sequence similarity is not identifiable. Genes that are orthologous can encode proteins with sequence similarity of about 25% to 100% amino acid sequence identity. Genes encoding proteins sharing an amino acid similarity less that 25%o can also be considered to have arisen by vertical descent if their three-dimensional structure also shows similarities. Members of the serine protease family of enzymes, including tissue plasminogen activator and elastase, are considered to have arisen by vertical descent from a common ancestor.
  • Orthologs include genes or their encoded gene products that through, for example, evolution, have diverged in structure or overall activity. For example, where one species encodes a gene product exhibiting two functions and where such functions have been separated into distinct genes in a second species, the three genes and their corresponding products are considered to be orthologs.
  • An example of orthologs exhibiting separable activities is where distinct activities have been separated into distinct gene products between two or more species or within a single species.
  • a specific example is the separation of elastase proteolysis and plasminogen proteolysis, two types of serine protease activity, into distinct molecules as plasminogen activator and elastase.
  • paralogs are homologues related by, for example, duplication followed by
  • Paralogs can originate or derive from, for example, the same species or from a different species.
  • microsomal epoxide hydrolase epoxide hydrolase I
  • soluble epoxide hydrolase epoxide hydrolase II
  • Paralogs are proteins from the same species with significant sequence similarity to each other suggesting that they are homologous, or related through co-evolution from a common ancestor.
  • a nonorthologous gene displacement is a nonorthologous gene from one species that can substitute for a referenced gene function in a different species. Substitution includes, for example, being able to perform substantially the same or a similar function in the species of origin compared to the referenced function in the different species.
  • a nonorthologous gene displacement will be identifiable as structurally related to a known gene encoding the referenced function, less structurally related but functionally similar genes and their corresponding gene products nevertheless will still fall within the meaning of the term as it is used herein.
  • a nonorthologous gene includes, for example, a paralog or an unrelated gene.
  • microorganisms that encode an enzyme catalyzing a similar or substantially similar metabolic reaction those skilled in the art also can utilize these evolutionarily related genes.
  • Orthologs, paralogs and nonorthologous gene displacements can be determined by methods well known to those skilled in the art. For example, inspection of nucleic acid or amino acid sequences for two polypeptides will reveal sequence identity and similarities between the compared sequences. Based on such similarities, one skilled in the art can determine if the similarity is sufficiently high to indicate the proteins are related through evolution from a common ancestor.
  • Align Align, BLAST, Clustal Wand others compare and determine a raw sequence similarity or identity, and also determine the presence or significance of gaps in the sequence which can be assigned a weight or score.
  • Such algorithms also are known in the art and are similarly applicable for determining nucleotide sequence similarity or identity. Parameters for sufficient similarity to determine relatedness are computed based on well-known methods for calculating statistical similarity, or the chance of finding a similar match in a random polypeptide, and the significance of the match determined.
  • a computer comparison of two or more sequences can, if desired, also be optimized visually by those skilled in the art.
  • Related gene products or proteins can be expected to have a high similarity, for example, 25% to 100% sequence identity.
  • Proteins that are unrelated can have an identity which is essentially the same as would be expected to occur by chance, if a database of sufficient size is scanned (about 5%). Sequences between 5% and 24% sequence identity may or may not represent sufficient homology to conclude that the compared sequences are related. Additional statistical analysis to determine the significance of such matches given the size of the data set can be carried out to determine the relevance of these sequences.
  • Exemplary parameters for determining relatedness of two or more sequences using the BLAST algorithm can be as set forth below. Briefly, amino acid sequence alignments can be performed using BLASTP version 2.0.8 (Jan-05-1999) and the following parameters: Matrix: 0
  • polypeptides such as enzymes, obtained by the expression of the any of the various polynucleotide molecules (i.e., nucleic acid sequences) of the present invention may have at least approximately 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to one or more amino acid sequences encoded by the genes and/or nucleic acid sequences described herein.
  • variants and portions of particular nucleic acid sequences, and respective encoded amino acid sequences recited herein may be exhibit a desired functionality, e.g., enzymatic activity at a selected level, when such nucleic acid sequence variant and/or portion contains a 15 nucleotide sequence identical to any 15 nucleotide sequence set forth in the nucleic acid sequences recited herein including, without limitation, the sequence starting at nucleotide number 1 and ending at nucleotide number 15, the sequence starting at nucleotide number 2 and ending at nucleotide number 16, the sequence starting at nucleotide number 3 and ending at nucleotide number 17, and so forth.
  • nucleic acid that contains a nucleotide sequence that is greater than 15 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides) in length and identical to any portion of the sequence set forth in nucleic acid sequences recited herein.
  • the invention provides isolated nucleic acid that contains a 25 nucleotide sequence identical to any 25 nucleotide sequence set forth in any one or more (including any grouping of) nucleic acid sequences recited herein including, without limitation, the sequence starting at nucleotide number 1 and ending at nucleotide number 25, the sequence starting at nucleotide number 2 and ending at nucleotide number 26, the sequence starting at nucleotide number 3 and ending at nucleotide number 27, and so forth.
  • Additional examples include, without limitation, isolated nucleic acids that contain a nucleotide sequence that is 50 or more nucleotides (e.g., 100, 150, 200, 250, 300, or more nucleotides) in length and identical to any portion of any of the sequences disclosed herein.
  • isolated nucleic acids can include, without limitation, those isolated nucleic acids containing a nucleic acid sequence represented in any one section of discussion and/or examples, such as regarding 3 -HP production pathways, nucleic acid sequences encoding enzymes of the fatty acid synthase system, or 3 -HP tolerance.
  • the invention provides an isolated nucleic acid containing a nucleic acid sequence listed herein that contains a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e. g., single deletion together with multiple insertions).
  • Such isolated nucleic acid molecules can share at least 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99 percent sequence identity with a nucleic acid sequence listed herein (i.e., in the sequence listing).
  • Additional examples include, without limitation, isolated nucleic acids that contain a nucleic acid sequence that encodes an amino acid sequence that is 50 or more amino acid residues (e.g., 100, 150, 200, 250, 300, or more amino acid residues) in length and identical to any portion of an amino acid sequence listed or otherwise disclosed herein.
  • isolated polynucleotide nucleic acid
  • the invention provides isolated polynucleotide (nucleic acid) that contains a nucleic acid sequence that encodes an polypeptide amino acid sequence having a variation of an amino acid sequence listed or otherwise disclosed herein.
  • the invention provides isolated polypeptide containing a nucleic acid sequence encoding an amino acid sequence listed or otherwise disclosed herein that contains a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions).
  • isolated nucleic acid molecules can contain a nucleic acid sequence encoding an amino acid sequence that shares at least 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99 percent sequence identity with an amino acid sequence listed or otherwise disclosed herein.
  • substitutions may be made of one polar uncharged (PU) amino acid for a polar uncharged amino acid of a listed sequence, optionally considering size/molecular weight (i.e., substituting a serine for a threonine).
  • the invention provides polypeptides that contain the entire amino acid sequence of an amino acid sequence listed or otherwise disclosed herein.
  • the invention provides polypeptides that contain a portion of an amino acid sequence listed or otherwise disclosed herein.
  • the invention provides polypeptides that contain a 15 amino acid sequence identical to any 15 amino acid sequence of an amino acid sequence listed or otherwise disclosed herein including, without limitation, the sequence starting at amino acid residue number 1 and ending at amino acid residue number 15, the sequence starting at amino acid residue number 2 and ending at amino acid residue number 16, the sequence starting at amino acid residue number 3 and ending at amino acid residue number 17, and so forth. It will be appreciated that the invention also provides polypeptides that contain an amino acid sequence that is greater than 15 amino acid residues (e.
  • the invention provides polypeptides that contain a 25 amino acid sequence identical to any 25 amino acid sequence of an amino acid sequence listed or otherwise disclosed herein including, without limitation, the sequence starting at amino acid residue number 1 and ending at amino acid residue number 25, the sequence starting at amino acid residue number 2 and ending at amino acid residue number 26, the sequence starting at amino acid residue number 3 and ending at amino acid residue number 27, and so forth.
  • Additional examples include, without limitation, polypeptides that contain an amino acid sequence that is 50 or more amino acid residues (e.g., 100, 150, 200, 250, 300 or more amino acid residues) in length and identical to any portion of an amino acid sequence listed or otherwise disclosed herein. Further, it is appreciated that, per above, a 15 nucleotide sequence will provide a 5 amino acid sequence, so that the latter, and higher-length amino acid sequences, may be defined by the above-described nucleotide sequence lengths having identity with a sequence provided herein.
  • the invention provides polypeptides that an amino acid sequence having a variation of the amino acid sequence set forth in an amino acid sequence listed or otherwise disclosed herein.
  • the invention provides polypeptides containing an amino acid sequence listed or otherwise disclosed herein that contains a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions).
  • Such polypeptides can contain an amino acid sequence that shares at least 60, 65, 70, 75, 80, 85, 90, 95, 97, 98 or 99 percent sequence identity with an amino acid sequence listed or otherwise disclosed herein.
  • a particular variant amino acid sequence may comprise any number of variations as well as any combination of types of variations.
  • Certain embodiments of the invention additionally comprise a genetic modification to increase the availability of the cofactor NADPH, which can increase the NADPH/NADP+ ratio as may be desired.
  • Non-limiting examples for such genetic modification are pgi (E.C. 5.3.1.9, in a mutated form), pntAB (E.C. 1.6.1.2), overexpressed, gapA (E.C. 1.2.1.12):gapN (E.C. 1.2.1.9, from Streptococcus mutans) substitution/replacement, and disrupting or modifying a soluble transhydrogenase such as sthA (E.C. 1.6.1.2), and/or genetic modifications of one or more of zwf (E.C.
  • genetic modifications may be provided to add functionality for breakdown of more complex carbon sources, such as cellulosic biomass or products thereof, for uptake, and/or for utilization of such carbon sources.
  • complex carbon sources such as cellulosic biomass or products thereof
  • numerous cellulases and cellulase-based cellulose degradation systems have been studied and characterized (see, for example, and incorporated by reference herein for such teachings, Beguin, P and Aubert, J-P (1994) FEMS Microbial. Rev. 13 : 25- 58; Ohima, K. et al. (1997) Biotechnol. Genet. Eng. Rev. 14: 365414).
  • any subgroup of genetic modifications may be made to decrease cellular production of fermentation product(s) selected from the group consisting of acetate, acetoin, acetone, acrylic, malate, fatty acid ethyl esters, isoprenoids, glycerol, ethylene glycol, ethylene, propylene, butylene, isobutylene, ethyl acetate, vinyl acetate, other acetates, 1 ,4-butanediol, 2,3- butanediol, butanol, isobutanol, sec-butanol, butyrate, isobutyrate, 2-OH-isobutryate, 30H-butyrate, ethanol, isopropanol, D-lactate, L-lactate, pyruvate, itaconate, levulinate, glucarate, glutarate, caprolactam
  • the 3-HP or malonic acid may be separated and purified by the approaches described in the following paragraphs, taking into account that many methods of separation and purification are known in the art and the following disclosure is not meant to be limiting.
  • Osmotic shock, sonication, homogenization, and/or a repeated freeze-thaw cycle followed by filtration and/or centrifugation, among other methods, such as pH adjustment and heat treatment, may be used to produce a cell-free extract from intact cells. Any one or more of these methods also may be employed to release 3-HP or malonic acid from cells as an extraction step.
  • a bio-production broth comprising 3-HP or malonic acid various methods may be practiced to remove biomass and/or separate 3-HP or malonic acid from the culture broth and its components.
  • Methods to separate and/or concentrate the 3-HP or malonic acid include centrifugation, filtration, extraction, chemical conversion such as esterification, distillation (which may result in chemical conversion, such as dehydration to acrylic acid, under some reactive- distillation conditions), crystallization, chromatography, and ion-exchange, in various forms.
  • cell rupture may be conducted as needed to release 3-HP or malonic acid from the cell mass, such as by sonication, homogenization, pH adjustment or heating.
  • 3-HP or malonic acid may be further separated and/or purified by methods known in the art, including any combination of one or more of centrifugation, liquid-liquid separations, including extractions such as solvent extraction, reactive extraction, two-phase aqueous extraction and two- phase solvent extraction, membrane separation technologies, distillation, evaporation, ion-exchange chromatography, adsorption chromatography, reverse phase chromatography and crystallization. Any of the above methods may be applied to a portion of a bioproduction broth (i.e., a fermentation broth, whether made under aerobic, anaerobic, or microaerobic conditions), such as may be removed from a bio-production event gradually or periodically, or to the broth at termination of a bio- production event. Conversion of 3-HP or malonic acid to downstream products, such as described herein, may proceed after separation and purification, or, such as with distillation, thin- film evaporation, or wiped- film evaporation optionally also in part as a separation means.
  • a counter-current strategy or a sequential or iterative strategy, such as multi-pass extractions.
  • a given aqueous solution comprising 3-HP or malonic acid may be repeatedly extracted with a non-polar phase comprising an amine to achieve multiple reactive extractions.
  • the spent broth may be transferred to a seperate tank, or remain in the culture vessel, and in either case the temperature may be elevated to at least 60°C for a minimum of one hour in order to kill the microorganisms. (Alternatively, as noted above other approaches to killing the microorganisms may be practiced, or centrifugation may occur prior to heating.)
  • spent broth is meant the final liquid volume comprising the initial nutrient media, cells grown from the microorganism inoculum (and possibly including some original cells of the inoculum), 3-HP or malonic acid, and optionally liquid additions made after providing the initial nutrient media, such as periodic additions to provide additional carbon source, etc.
  • the spent broth may comprise organic acids other than 3-HP or malonic acid, such as for example acetic acid and/or lactic acid.
  • a centrifugation step may then be practiced to filter out the biomass solids (e.g., microorganism cells). This may be achieved in a continuous or batch centrifuge, and solids removal may be at least about 80%, 85%o, 90%), or 95% in a single pass, or cumulatively after two or more serial centrifugations.
  • biomass solids e.g., microorganism cells
  • An optional step is to polish the centrifuged liquid through a filter, such as microfiltration or ultrafiltration, or may comprise a filter press or other filter device to which is added a filter aid such as diatomaceous earth.
  • a filter such as microfiltration or ultrafiltration
  • Alternative or supplemental approaches to this and the centrifugation may include removal of cells by a flocculent, where the cells floe and are allowed to settle, and the liquid is drawn off or otherwise removed.
  • a flocculent may be added to a fermentation broth after which settling of material is allowed for a time, and then separations may be applied, including but not limited to centrifugation.
  • a spent broth comprising 3-HP or malonic acid and substantially free of solids is obtained for further processing.
  • substantially free of solids is meant that greater than 98%, 99%, or 99.5%) of the solids have been removed.
  • this spent broth comprises various ions of salts, such as Na, CI, S04, and P04 .
  • these ions may be removed by passing this spent broth through ion exchange columns, or otherwise contacting the spent broth with appropriate ion exchange material.
  • "contacting” is taken to mean a contacting for the stated purpose by any way known to persons skilled in the art, such as, for example, in a column, under appropriate conditions that are well within the ability of persons of ordinary skill in the relevant art to determine.
  • these may comprise sequential contacting with anion and cation exchange materials (in any order), or with a mixed anion/cation material.
  • This demineralization step should remove most such inorganic ions without removing the 3-HP or malonic acid. This may be achieved, for example, by lowering the pH sufficiently to protonate 3-HP or malonic acid and similar organic acids so that these acids are not bound to the anion exchange material, whereas anions, such as CI and S04, that remain charged at such pH are removed from the solution by binding to the resin. Likewise, positively charged ions are removed by contacting with cation exchange material. Such removal of ions may be assessed by a decrease in conductivity of the solution. Such ion exchange materials may be regenerated by methods known to those skilled in the art.
  • the spent broth (such as but not necessarily after the previous
  • demineralization step is subjected to a pH elevation, after which it is passed through an ion exchange column, or otherwise contacted with an ion exchange resin, that comprises anionic groups, such as amines, to which organic acids, ionic at this pH, associate.
  • anionic groups such as amines
  • Other organics that do not so associate with amines at this pH may be separated from the organic acids at this stage, such as by flushing with an elevated pH rinse. Thereafter elution with a lower pH and/or elevated salt content rinse may remove the organic acids. Eluting with a gradient of decreasing pH and/or increasing salt content rinses may allow more distinct separation of 3- HP from other organic acids, thereafter simplifying further processing.
  • a first alternative approach comprises reactive extraction (a form of liquid- liquid extraction) as exemplified in this and the following paragraphs.
  • the spent broth which may be at a stage before or after the demineralization step above, is combined with a quantity of a tertiary amine such as Alamine336® (Cognis Corp., Cincinnati, OH USA) at low pH.
  • Co-solvents for the Alamine336 or other tertiary amine may be added and include, but are not limited to benzene, carbon tetrachloride, chloroform, cyclohexane, di-isobutyl ketone, ethanol, #2 fuel oil, isopropanol, kerosene, nbutanol, isobutanol, octanol, and n-decanol that increase the partition coefficient when combined with the amine.
  • a period of time for phase separation transpires, after which the non-polar phase, which comprises 3-HP associated with the Alamine336 or other tertiary amine, is separated from the aqueous phase.
  • a distilling step may be used to remove the co-solvent, thereby leaving the 3 -HP -tertiary amine complex in the non-polar phase.
  • a stripping or recovery step may be used to separate the 3-HP from the tertiary amine.
  • An inorganic salt such as ammonium sulfate, sodium chloride, or sodium carbonate, or a base such as sodium hydroxide or ammonium hydroxide, is added to the 3- HP/tertiary amine to reverse the amine protonation reaction, and a second phase is provided by addition of an aqueous solution (which may be the vehicle for provision of the inorganic salt).
  • aqueous solution which may be the vehicle for provision of the inorganic salt.
  • hot water may also be used without a salt or base to recover the 3HP from the amine.
  • phase separation and extraction of 3-HP to the aqueous phase can serve to concentrate the 3-HP. It is noted that chromatographic separation of respective organic acids also can serve to concentrate such acids, such as 3-HP.
  • suitable, non-polar amines which may include primary, secondary and quaternary amines, may be used instead of and/or in combination with a tertiary amine.
  • a second alternative approach is crystallization.
  • the spent broth (such as free of biomass solids) may be contacted with a strong base such as ammonium hydroxide, which results in formation of an ammonium salt of 3-HP.
  • a strong base such as ammonium hydroxide
  • ammonium-3-HP crystals are formed and may be separated, such as by filtration, from the aqueous phase.
  • ammonium-3-HP crystals may be treated with an acid, such as sulfuric acid, so that ammonium sulfate is regenerated, so that 3-HP and ammonium sulfate result.
  • aqueous two-phase extraction methods may be utilized to separate and/or concentrate a desired chemical product from a fermentation broth or later- obtained solution.
  • polymers such as dextran and glycol polymers, such as polyethylene glycol (PEG) and polypropylene glycol (PPG)
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • a desired chemical product may segregate to one phase while cells and other chemicals partition to the other phase, thus providing for a separation without use of organic solvents.
  • solvent extraction is another alternative. This may use any of a number of and/or combinations of solvents, including alcohols, esters, ketones, and various organic solvents. Without being limiting, after phase separation a distillation step or a secondary extraction may be employed to separate 3-HP from the organic phase.
  • 3-hydroxypropionic acid 3-HP
  • This organic acid, 3-HP may be converted to various other products having industrial uses, such as but not limited to acrylic acid, esters of acrylic acid, and other chemicals obtained from 3-HP, referred to as "downstream products.”
  • downstream products such as acrylic acid, esters of acrylic acid, and other chemicals obtained from 3-HP, referred to as "downstream products.”
  • the 3-HP may be converted to acrylic acid, acrylamide, and/or other downstream chemical products, in some instances the conversion being associated with the separation and/or purification steps. Many conversions to such downstream products are described herein.
  • the methods of the invention include steps to produce downstream products of 3-HP.
  • acrylic acid first converted from 3-HP by dehydration, may be esterified with appropriate compounds to form a number of commercially important acrylate-based esters, including but not limited to methyl acrylate, ethyl acrylate, methyl acrylate, 2-ethylhexyl acrylate, butyl acrylate, and lauryl acrylate.
  • 3 HP may be esterified to form an ester of 3 HP and then dehydrated to form the acrylate ester.
  • 3-HP can be converted into derivatives starting (i) substantially as the protonated form of 3-hydroxypropionic acid; (ii) substantially as the deprotonated form, 3- hydroxypropionate; or (iii) as mixtures of the protonated and deprotonated forms.
  • the fraction of 3- HP present as the acid versus the salt will depend on the pH, the presence of other ionic species in solution, temperature (which changes the equilibrium constant relating the acid and salt forms), and to some extent pressure.
  • Many chemical conversions may be carried out from either of the 3-HP forms, and overall process economics will typically dictate the form of 3-HP for downstream conversion.
  • 3-HP in an amine salt form such as in the extraction step herein disclosed using Alamine 336 as the amine
  • a dehydration catalyst such as aluminum oxide
  • an elevated temperature such as 170 to 180 C, or 180 to 190 C, or 190 to 200 C
  • passing the collected vapor phase over a low temperature condenser operating conditions, including 3-HP concentration, organic amine, co-solvent (if any), temperature, flow rates, dehydration catalyst, and condenser temperature, are evaluated and improved for commercial purposes.
  • Conversion of 3-HP to acrylic acid is expected to exceed at least 80 percent, or at least 90 percent, in a single conversion event.
  • the amine may be re-used, optionally after clean-up.
  • Other dehydration catalysts, as provided herein, may be evaluated. It is noted that U.S. Patent
  • the methods of the present invention can also be used to produce "downstream" compounds derived from 3-HP, such as polymerized-3-HP (poly-3-HP), acrylic acid, polyacrylic acid (polymerized acrylic acid, in various forms), and methyl acrylate.
  • polymerized-3-HP poly-3-HP
  • acrylic acid polyacrylic acid
  • methyl acrylate a compound that is a compound that is a compound that has a high degree of polymerized acrylic acid
  • Numerous approaches may be employed for such downstream conversions, generally falling into enzymatic, catalytic (chemical conversion process using a catalyst), thermal, and combinations thereof (including some wherein a desired pressure is applied to accelerate a reaction).
  • an important industrial chemical product that may be produced from 3-HP is acrylic acid.
  • one of the carbon-carbon single bonds in 3-HP must undergo a dehydration reaction, converting to a carbon-carbon double bond and rejecting a water molecule.
  • Dehydration of 3-HP in principle can be carried out in the liquid phase or in the gas phase. In some embodiments, the dehydration takes place in the presence of a suitable homogeneous or heterogeneous catalyst. Suitable dehydration catalysts are both acid and alkaline catalysts.
  • an acrylic acid-containing phase is obtained and can be purified where appropriate by further purification steps, such as by distillation methods, extraction methods, or crystallization methods, or combinations thereof.
  • Making acrylic acid from 3-HP via a dehydration reaction may be achieved by a number of commercial methodologies including via a distillation process, which may be part of the separation regime and which may include an acid and/or a metal ion as catalyst. More broadly, incorporated herein for its teachings of conversion of 3-HP, and other B-hydroxy carbonyl compounds, to acrylic acid and other related downstream compounds, is U.S. Patent Publication No. 2007/0219390 Al, published September 20, 2007, now abandoned. This publication lists numerous catalysts and provides examples of conversions, which are specifically incorporated herein. Also among the various specific methods to dehydrate 3-HP to produce acrylic acid is an older method, described in U.S. Patent No. 2,469,701 (Redmon).
  • This reference teaches a method for the preparation of acrylic acid by heating 3-HP to a temperature between 130 and 190°C, in the presence of a dehydration catalyst, such as sulfuric acid or phosphoric acid, under reduced pressure.
  • a dehydration catalyst such as sulfuric acid or phosphoric acid
  • U.S. Patent Publication No. 2005/0222458 Al also provides a process for the preparation of acrylic acid by heating 3- HP or its derivatives. Vapor- phase dehydration of 3-HP occurs in the presence of dehydration catalysts, such as packed beds of silica, alumina, or titania.
  • the dehydration catalyst may comprise one or more metal oxides, such as Ab03, Si02, or Ti02.
  • the dehydration catalyst is a high surface area Ab03 or a high surface area silica wherein the silica is substantially Si02.
  • High surface area for the purposes of the invention means a surface area of at least about 50, 75, 100 m 2 /g, or more.
  • the dehydration catalyst may comprise an aluminosilicate, such as a zeolite.
  • 3-HP may be dehydrated to acrylic acid via various specific methods, each often involving one or more dehydration catalysts.
  • One catalyst of particular apparent value is titanium, such as in the form of titanium oxide, Ti0(2).
  • a titanium dioxide catalyst may be provided in a dehydration system that distills an aqueous solution comprising 3-HP, wherein the 3-HP dehydrates, such as upon volatilization, converting to acrylic acid, and the acrylic acid is collected by condensation from the vapor phase.
  • an aqueous solution of 3-HP is passed through a reactor column packed with a titanium oxide catalyst maintained at a temperature between 170 and 190 C and at ambient atmospheric pressure. Vapors leaving the reactor column are passed over a low temperature condenser, where acrylic acid is collected.
  • the low temperature condenser may be cooled to 30 C or less, 2 C or less, or at any suitable temperature for efficient condensation based on the flow rate and design of the system.
  • the reactor column temperatures may be lower, for instance when operating at a pressure lower than ambient atmospheric pressure.
  • catalysts including chemical classes
  • Such catalysts may be used in any of solid, liquid or gaseous forms, may be used individually or in any combination.
  • This listing of catalysts is not intended to be limiting, and many specific catalysts not listed may be used for specific dehydration reactions.
  • catalyst selection may depend on the solution pH and/or the form of 3-HP in a particular conversion, so that an acidic catalyst may be used when 3-HP is in acidic form, and a basic catalyst may be used when the ammonium salt of 3-HP is being converted to acrylic acid.
  • some catalysts may be in the form of ion exchange resins.
  • the dehydration of 3-HP may also take place in the absence of a dehydration catalyst.
  • the reaction may be run in the vapor phase in the presence of a nominally inert packing such as glass, ceramic, a resin, porcelain, plastic, metallic or brick dust packing and still form acrylic acid in reasonable yields and purity.
  • the catalyst particles can be sized and configured such that the chemistry is, in some embodiments, mass-transfer-limited or kinetically limited.
  • the catalyst can take the form of powder, pellets, granules, beads, extrudates, and so on.
  • the support may assume any physical form such as pellets, spheres, monolithic channels, etc.
  • the supports may be co-precipitated with active metal species; or the support may be treated with the catalytic metal species and then used as is or formed into the aforementioned shapes; or the support may be formed into the aforementioned shapes and then treated with the catalytic species.
  • a reactor for dehydration of 3-HP may be engineered and operated in a wide variety of ways.
  • the reactor operation can be continuous, semi-continuous, or batch. It is perceived that an operation that is substantially continuous and at steady state is advantageous from operations and economics perspectives.
  • the flow pattern can be substantially plug flow, substantially well-mixed, or a flow pattern between these extremes.
  • a "reactor" can actually be a series or network of several reactors in various arrangements.
  • acrylic acid may be made from 3-HP via a dehydration reaction, which may be achieved by a number of commercial methodologies including via a distillation process, which may be part of the separation regime and which may include an acid and/or a metal ion as catalyst.
  • 3-HP may be dehydrated to acrylic acid via various specific methods, each often involving one or more dehydration catalysts.
  • One catalyst of particular apparent value is titanium, such as in the form of titanium oxide, Ti02.
  • a titanium dioxide catalyst may be provided in a dehydration system that distills an aqueous solution comprising 3-HP, wherein the 3-HP dehydrates, such as upon volatilization, converting to acrylic acid, and the acrylic acid is collected by condensation from the vapor phase.
  • an aqueous solution of 3-HP is passed through a reactor column packed with a titanium oxide catalyst maintained at a temperature between 170 and 190°C and at ambient atmospheric pressure. Vapors leaving the reactor column are passed over a low temperature condenser, where acrylic acid is collected.
  • the low temperature condenser may be cooled to 30°C or less, 20°C or less, 2°C or less, or at any suitable temperature for efficient condensation based on the flow rate and design of the system.
  • the reactor column temperatures may be lower, for instance when operating at a pressure lower than ambient atmospheric pressure. It is noted that Example 1 of U.S. Patent Publication No.
  • crystallization are known in the art, including crystallization of esters.
  • a salt of 3-HP is converted to acrylic acid or an ester or salt thereof.
  • U.S. Patent No.7, 186,856 (Meng et al.) teaches a process for producing acrylic acid from the ammonium salt of 3-HP, which involves a first step of heating the ammonium salt of 3-HP in the presence of an organic amine or solvent that is immiscible with water, to form a two-phase solution and split the 3-HP salt into its respective ionic constituents under conditions which transfer 3-HP from the aqueous phase to the organic phase of the solution, leaving ammonia and ammonium cations in the aqueous phase.
  • Methyl acrylate may be made from 3-HP via dehydration and esterification, the latter to add a methyl group (such as using methanol), acrylamide may be made from 3-HP via dehydration and amidation reactions, acrylonitrile may be made via a dehydration reaction and forming a nitrile moiety, propriolactone may be made from 3-HP via a ring-forming internal esterification reaction (eliminating a water molecule), ethyl-3-
  • HP may be made from 3-HP via esterification with ethanol
  • malonic acid may be made from 3-HP via an oxidation reaction
  • 1,3-propanediol may be made from 3-HP via a reduction reaction.
  • Malonic acid may be produced from oxidation of 3-HP as produced herein.
  • U.S. Patent No. 5,817,870 discloses catalytic oxidation of 3-HP by a precious metal selected from Ru, Rh, Pd, Os, Ir or Pt. These can be pure metal catalysts or supported catalysts.
  • the catalytic oxidation can be carried out using a suspension catalyst in a suspension reactor or using a fixed-bed catalyst in a fixed-bed reactor. If the catalyst, such as a supported catalyst, is disposed in a fixed-bed reactor, the latter can be operated in a trickle- bed procedure as well as also in a liquid-phase procedure.
  • the aqueous phase comprising the 3-HP starting material, as well as the oxidation products of the same and means for the adjustment of pH, and oxygen or an oxygen-containing gas can be conducted in parallel flow or counter-flow.
  • the liquid phase and the gas phase are conveniently conducted in parallel flow.
  • the conversion is carried out at a pH equal or greater than 6, such as at least 7, and in particular between 7.5 and 9.
  • the pH is kept constant, such as at a pH in the range between 7.5 and 9, by adding a base, such as an alkaline or alkaline earth hydroxide solution.
  • the oxidation is usefully carried out at a temperature of at least 10°C and maximally 70°C.
  • the flow of oxygen is not limited. In the suspension method it is important that the liquid and the gaseous phase are brought into contact by stirring vigorously. Malonic acid can be obtained in nearly quantitative yields.
  • U.S. Patent No. 5,817,870 is incorporated by reference herein for its methods to oxidize 3-HP to malonic acid.
  • addition reactions may yield acrylic acid or acrylate derivatives having alkyl or aryl groups at the carbonyl hydroxyl group.
  • Such additions may be catalyzed chemically, such as by hydrogen, hydrogen halides, hydrogen cyanide, or Michael additions under alkaline conditions optionally in the presence of basic catalysts.
  • Alcohols, phenols, hydrogen sulfide, and thiols are known to add under basic conditions.
  • Aromatic amines or amides, and aromatic hydrocarbons may be added under acidic conditions.
  • Acrylic acid obtained from 3-HP made by the present invention may be further converted to various chemicals, including polymers, which are also considered downstream products in some embodiments.
  • Acrylic acid esters may be formed from acrylic acid (or directly from 3 -HP) such as by condensation esterification reactions with an alcohol, releasing water. This chemistry described in Monomeric Acrylic Esters, E. H. Riddle, Reinhold, NY (1954), incorporated by reference for its esterification teachings.
  • esters that are formed are methyl acrylate, ethyl acrylate, n-butyl aery late, hydroxypropyl acrylate, hydroxy ethyl acrylate, isobutyl acrylate, and 2-ethylhexyl acrylate, and these and/or other acrylic acid and/or other acrylate esters may be combined, including with other compounds, to form various known acrylic acid-based polymers.
  • acrylamide is produced in chemical syntheses by hydration of acrylonitrile, herein a conversion may convert acrylic acid to acrylamide by amidation.
  • Acrylic acid obtained from 3-HP made by the present invention may be further converted to various chemicals, including polymers, which are also considered downstream products in some embodiments.
  • Acrylic acid esters may be formed from acrylic acid (or directly from 3-HP) such as by condensation esterification reactions with an alcohol, releasing water. This chemistry is described in Monomeric Acrylic Esters, E. H. Riddle, Reinhold, NY (1954), incorporated by reference for its esterification teachings. Among esters that are formed are methyl acrylate, ethyl acrylate, n-butyl acrylate, hydroxypropyl acrylate, hydroxy ethyl acrylate, isobutyl acrylate, and 2- ethylhexyl acrylate, and these and/or other acrylic acid and/or other acrylate esters may be combined, including with other compounds, to form various known acrylic acid-based polymers.
  • acrylamide is produced in chemical syntheses by hydration of acrylonitrile
  • a conversion may convert acrylic acid to acrylamide by amidation.
  • Direct esterification of acrylic acid can take place by esterification methods known to the person skilled in the art, by contacting the acrylic acid obtained from 3-HP dehydration with one or more alcohols, such as methanol, ethanol, 1- propanol, 2-propanol, n-butanol, tert-butanol or isobutanol, and heating to a temperature of at least 50, 75, 100, 125, or 150°C.
  • the water formed during esterification may be removed from the reaction mixture, such as by azeotropic distillation through the addition of suitable separation aids, or by another means of separation. Conversions up to 95%, or more, may be realized.
  • esterification catalysts are commercially available, such as from Dow Chemical (Midland, Michigan US).
  • AmberlystTM 131 Wet Monodisperse gel catalyst confers enhanced hydraulic and reactivity properties and is suitable for fixed bed reactors.
  • AmberlystTM 39Wet is a macroreticular catalyst suitable particularly for stirred and slurry loop reactors.
  • AmberlystTM 46 is a macroporous catalyst producing less ether byproducts than conventional catalyst (as described in U.S. Patent No. 5,426,199 to Rohm and Haas, which patent is incorporated by reference for its teachings of esterification catalyst compositions and selection considerations).
  • Acrylic acid and any of its esters, may be further converted into various polymers.
  • Superabsorbent polymers are prepared from acrylic acid (such as acrylic acid derived from 3 -HP provided herein) and a crosslinker, by solution or suspension polymerization.
  • acrylic acid such as acrylic acid derived from 3 -HP provided herein
  • crosslinker such as 1,3-HP provided herein
  • Exemplary methods include U.S. Patent Nos. 5,145,906; 5,350,799; 5,342,899; 4,857,610; 4,985,518; 4,708, 997; 5,180,798;
  • Each pad thereafter may be further processed, such as to cut it to a proper shape for the diaper, or the pad may be in the form of a long roll sufficient for multiple diapers. Thereafter, the pad is sandwiched between a top sheet and a bottom sheet of fabric (one generally being liquid pervious, the other liquid
  • FIG. 4 A, B, and C and FIG. 5 A and B show a schematic of an entire process of converting biomass to a finished product such as a diaper. These are meant to be exemplary and not limiting.
  • Low molecular-weight polyacrylic acid has uses for water treatment, flocculants, and thickeners for various applications including cosmetics and pharmaceutical preparations.
  • the polymer may be uncrosslinked or lightly crosslinked, depending on the specific application.
  • the molecular weights are typically from about 200 to about 1,000,000 g/mol.
  • Preparation of these low molecular-weight polyacrylic acid polymers is described in U.S. Patent Nos. 3,904,685; 4,301,266; 2,798,053; and 5,093,472, each of which is incorporated by reference for its teachings relating to methods to produce these polymers.
  • Acrylic acid may be co-polymerized with one or more other monomers selected from acrylamide, 2-acrylamido-2- methylpropanesulfonic acid, ⁇ , ⁇ -dimethylacrylamide, N-isopropylacrylamide, methacrylic acid, and methacrylamide, to name a few.
  • the relative reactivities of the monomers affect the microstructure and thus the physical properties of the polymer.
  • Co-monomers may be derived from 3-HP, or otherwise provided, to produce copolymers. Ulmann's Encyclopedia of Industrial Chemistry,
  • Acrylic acid can in principle be copolymerized with almost any free-radically polymerizable monomers including styrene, butadiene, acrylonitrile, acrylic esters, maleic acid, maleic anhydride, vinyl chloride, acrylamide, itaconic acid, and so on. End-use applications typically dictate the copolymer composition, which influences properties. Acrylic acid also may have a number of optional substitutions on it, and after such substitutions be used as a monomer for polymerization, or co- polymerization reactions.
  • acrylic acid may be substituted by any substituent that does not interfere with the polymerization process, such as alkyl, alkoxy, aryl, heteroaryl, benzyl, vinyl, allyl, hydroxy, epoxy, amide, ethers, esters, ketones, maleimides, succinimides, sulfoxides, glycidyl and silyl (see U.S. Patent No. 7,678,869, incorporated by reference above, for further discussion).
  • substituent such as alkyl, alkoxy, aryl, heteroaryl, benzyl, vinyl, allyl, hydroxy, epoxy, amide, ethers, esters, ketones, maleimides, succinimides, sulfoxides, glycidyl and silyl.
  • Paints that comprise polymers and copolymers of acrylic acid and its esters are in wide use as industrial and consumer products. Aspects of the technology for making such paints can be found in U.S. Patent Nos. 3,687,885 and 3,891,591, incorporated by reference for its teachings of such paint manufacture.
  • acrylic acid and its esters may form homopolymers or copolymers among themselves or with other monomers, such as amides, methacrylates, acrylonitrile, vinyl, styrene and butadiene.
  • the weight percent of the vehicle portion may range from about nine to about 26 percent, but for other paints the weight percent may vary beyond this range.
  • Acrylic-based polymers are used for many coatings in addition to paints.
  • acrylic acid is used from 0.1-5.0%, along with styrene and butadiene, to enhance binding to the paper and modify rheology, freeze-thaw stability and shear stability.
  • U.S. Patent Nos. 3,875,101 and 3,872,037 are incorporated by reference for their teachings regarding such latexes.
  • Acrylate- based polymers also are used in many inks, particularly UV curable printing inks.
  • Sodium acrylate (the sodium salt of glacial acrylic acid) can be co-polymerized with acrylamide (which may be derived from acrylic acid via amidation chemistry) to make an anionic copolymer that is used as a flocculent in water treatment.
  • acrylamide which may be derived from acrylic acid via amidation chemistry
  • 3-HP may be converted to 3-HP-CoA, which then may be converted into polymerized 3-HP with an enzyme having polyhydroxyacid synthase activity (EC 2.3.1.-).
  • 1,3-propanediol can be made using polypeptides having oxidoreductase activity or reductase activity (e.g. , enzymes in the EC 1.1.1.- class of enzymes).
  • 1,3-propanediol from 3HP
  • a combination of (1) a polypeptide having aldehyde dehydrogenase activity (e.g., an enzyme from the 1.1.1.34 class) and (2) a polypeptide having alcohol dehydrogenase activity (e.g., an enzyme from the 1.1.1.32 class) can be used.
  • Polypeptides having lipase activity may be used to form esters. Enzymatic reactions such as these may be conducted in vitro, such as using cell-free extracts, or in vivo.
  • 3-HP may be converted to 3-HP-CoA, which then may be converted into polymerized 3-HP with an enzyme having polyhydroxyacid synthase activity (EC 2.3.1.-).
  • 1,3-propanediol can be made using polypeptides having oxidoreductase activity or reductase activity (e.g., enzymes in the EC 1.1.1.- class of enzymes).
  • 1,3-propanediol from 3HP
  • a combination of (1) a polypeptide having aldehyde dehydrogenase activity (e.g., an enzyme from the 1.1.1.34 class) and (2) a polypeptide having alcohol dehydrogenase activity (e.g., an enzyme from the 1.1.1.32 class) can be used.
  • Polypeptides having lipase activity may be used to form esters. Enzymatic reactions such as these may be conducted in vitro, such as using cell-free extracts, or in vivo.
  • various embodiments of the present invention include conversion steps to any such noted downstream products of microbially produced 3-HP, including but not limited to those chemicals described herein and in the incorporated references (the latter for jurisdictions allowing this).
  • one embodiment is making 3-HP molecules by the teachings herein and further converting the 3-HP molecules to polymerized-3-HP (poly-3-HP) or acrylic acid, and such as from acrylic acid then producing from the 3-HP molecules any one of polyacrylic acid (polymerized acrylic acid, in various forms), methyl acrylate, acrylamide, acrylonitrile, propiolactone, ethyl3-HP, malonic acid, 1,3 -propanediol, ethyl acrylate, n-butyl acrylate, hydroxypropyl acrylate, hydroxy ethyl acrylate, isobutyl acrylate, 2- ethylhexyl acrylate, and acrylic acid or an acrylic acid ester to
  • Stabilizing agents and/or inhibiting agents include, but are not limited to, e.g., phenolic compounds (e.g., dimethoxyphenol (DMP) or alkylated phenolic compounds such as di-tert-butyl phenol), quinones (e.g., t-butyl hydroquinone or the monomethyl ether of hydroquinone (MEHQ)), and/or metallic copper or copper salts (e.g., copper sulfate, copper chloride, or copper acetate).
  • DMP dimethoxyphenol
  • MEHQ monomethyl ether of hydroquinone
  • metallic copper or copper salts e.g., copper sulfate, copper chloride, or copper acetate.
  • Inhibitors and/or stabilizers can be used individually or in combinations.
  • the one or more downstream compounds is/are recovered at a molar yield of up to about 100 percent, or a molar yield in the range from about 70 percent to about 90 percent, or a molar yield in the range from about 80 percent to about 100 percent, or a molar yield in the range from about 90 percent to about 100 percent.
  • Such yields may be the result of single- pass (batch or continuous) or iterative separation and purification steps in a particular process.
  • the methods of making may include making 3-HP microbially and further making any of the following derived chemicals: polymerized-3-HP (poly-3-HP), acrylic acid (CAS No. 79-10- 7), polyacrylic acid, acrylamide (CAS No. 79-06-01), acrylonitrile, propiolactone, ethyl 3-HP, malonic acid, and 1,3— propanediol.
  • polymerized-3-HP poly-3-HP
  • acrylic acid CAS No. 79-10- 7
  • polyacrylic acid CAS No. 79-06-01
  • acrylonitrile propiolactone
  • ethyl 3-HP acrylamide
  • malonic acid 1,3— propanediol
  • 1,3— propanediol 1,3— propanediol.
  • Any of the various monomers may be further processed by methods of the present invention to yield another product of interest (e.g., a "further derived product").
  • An expanded listing of such monomers is acrylic acid, acrylamide, acrylonitrile, propiolactone, ethyl 3-HP, malonic acid, 1,3 -propanediol, hydroxypropyl acrylate, hydroxy ethyl acrylate, isobutyl acrylate, n-butyl acrylate, hydroxypropyl aery late, hydroxyethyl acrylate, isobutyl acrylate, ethyl acrylate, methyl acrylate, ethyl ethoxy propionate, ethyl -3- hydroxypropionate (ethyl-3-HP), 2-ethylhexyl acrylate and other acrylates (e.g., acrylic acid salts and esters).
  • acrylic acid salts and esters e.g., acrylic acid salts and esters.
  • a "further derived product” includes within its scope any such derived product and also includes more complex polymers and products of any such derived product.
  • acrylamide may be made from 3-HP made by the methods described herein, and thereafter may be converted chemically to any of a plurality of polyacrylamides, such as by methods known in the art.
  • acrylonitrile may be made from 3-HP made by the methods described herein, and thereafter may be converted chemically to form (or be a component of) any of a plurality of plastics including but not limited to polyacrylonitrile, styrene-acrylonitrile, acrylonitrile butadiene styrene, acrylonitrile styrene acrylate, acrylonitrile butadiene, and adiponitrile.
  • a further derivedproduct of 1,3-propanediol is Polytrimethylene terephthalate, or PTT.
  • the present invention is contemplated to include use of modified microorganisms as described herein to produce 3-HP which is then converted ultimately to any derived chemical and further derived product, such as listed in Table 12.
  • Malonic acid may be made from 3 -HP via an oxidation reaction, and 1,3 -propanediol may be made from 3 -HP via a reduction reaction.
  • acrylic acid first converted from 3 -HP by dehydration, may be esterified with appropriate compounds to form a number of commercially important acrylate -based esters, including but not limited to methyl acrylate, ethyl acrylate, methyl acrylate, 2-ethylhexyl acrylate, butyl acrylate, and lauryl acrylate.
  • 3HP may be esterified to form an ester of 3HP and then dehydrated to form the acrylate ester.
  • 3-HP may be oligomerized or polymerized to form poly(3-hydroxypropionate) homopolymers, or copolymerized with one or more other monomers to form various co-polymers.
  • the second enzymatic function is a dehydrogenase, referred to herein as a 3 -HP dehydrogenase, able to convert the malonate semialdehyde produced in the first enzymatic reaction to 3-hydroxypropionate (3-HP).
  • 3-HP dehydrogenase a dehydrogenase
  • 3-HP dehydrogenase able to convert the malonate semialdehyde produced in the first enzymatic reaction to 3-hydroxypropionate
  • the plasmids for expressing the various truncated versions of the bifunctional malonyl CoA reductase of Chloroflexus aurantiacus were created as follows. Using pTRC-ptrc-mcr (1 -1220) SEQ ID NO: 096) as template, each mcr variant was amplified by PCR using the primers (IDT, Coralville, IA) described in Table 7.
  • Cell pellets were lysed using a mixture of Bugbuster, benzonase nuclease, and rLysozyme (all from Novagen). Once lysed, the lysate mixture was centrifuged at 14000 RPM in a standard table top centrifuge. The resulting supernatant was removed to another tube. The clarified supernatant was measured for protein concentration using a Biorad Total Protein determination kit (BioRad). For each measurement, 20 uL of lysate was added to a reaction buffer filled well of the 96-well plate used to perform the assay.
  • Biorad Total Protein determination kit BioRad
  • the assay was initiated by addition of malonyl CoA to a final concentration of 0.3 mM or ImM, which is well above the reported Km binding constant for these enzymes. Once the reaction time course was read and the slopes of each well were calculated, the specific activities were compared to a negative control to determine a background rate. All values reported are the average specific activities measured in triplicate.
  • YdfG is a dehydrogenase able to convert malonate semialdehyde to 3-HP at the expense of 1 NADPH molecule.
  • MCR( 177- 1220) truncate has about twice the activity of the full length bifunctional MCR in this coupled assay, MCR(177- 1220) has a higher specific activity.
  • Example 2 Determining the region of Chloroflexus aurantiacus that is responsible for 3-HP dehydrogenase activity.
  • Example 3 Engineering the malonyl CoA reductase domain of Chloroflexus aurantiacus for increased NADH utilization.
  • This putative phosphate binding loop was located between and including amino acids 604 to 609 in the full length bifunctional MCR sequence (SEQ ID NO:058).
  • a new search of the NCBI sequence database was performed to find protein sequences that had similar proximal amino acid sequences around the putative phosphate loop that included 10 to 20 amino acids before and after the putative phosphate binding loop region.
  • This search was performed with a sequence derived with three specifications as follows; First, the phosphate binding loop region in the search sequence was replaced with the sequence being 'XXXXX'.
  • Plasmids able to express the putative NADH-specific loop variants (variants 1 thru 4) (SEQ ID NO: 046-049) of the malonyl CoA reductase domain were assayed for function as described in the methods section and other examples. The results for these assays are shown in FIG. 10. As a positive control a cell lysate from cells expressing MCR(496-1220) was used as a control to compare NADH- specific activity and NADPH-specific activity of the variant malonyl CoA reductase domains.
  • the MCR(496-1220) control has an activity an NADH-specific activity of nearly 0.01 U/mg and an NADPH- specific activity of about 0.42 U/mg in this assay.
  • all variants (1 through 4) (SEQ ID NO:046- 049) showed a significant reduction of NADPH-specific activity as compared to control and showed increased NADH-specific activity over the control MCR(496-1220) NADH-specific activity.
  • the NADHspecific activity for variant 1 was 0.018 U/mg
  • variant 2 was 0.14 U/mg
  • variant 3 was 0.023 U/mg
  • variant 4 was 0.14 U/mg.
  • a coupled assay In order to confirm that reactions showing malonyl CoA reductase activities could perform a reaction able to convert malonyl CoA to malonate semialdehdye, a coupled assay was used.
  • the coupled assay uses lysates overexpressing MmsB, a dehydrogenase able to convert malonate semialdehyde to 3- hydroxypropionate.
  • the formation of 3- hydroxypropionate was assessed using gas chromatography— mass spectrometry (GC-MS).
  • the buffer conditions consisted of 1 mM malonyl CoA, 2 mM NADH or 2mM NADH, 5 mM dithiothreitol, 3 mM magnesium chloride, 100 mM Trizma-HCl pH7.6 buffer. Lysates for these assays were prepared from over expressed cultures. Cell line carrying plasmids able to over express mmsB or the malonyl CoA reductases were grown with antibiotic selection in LB media overnight as starter cultures.
  • GGATAGTCCCATGGCCGACATTGCGTTTCTGGGTC SEQ ID NO: 123
  • reverse primer GCTAATATGGATCCACCTCTTTAATCTAATCCTTACCGCGATACAG
  • the amplified gene was digested with Ncol and BamHI and subcloned into the pTRC(amp)-HisA (Invitrogen, Carslbad, CA) to make pTRC-mmsB (SEQ ID NO: 125).
  • the malonic semialdehyde reductase gene (SEQ ID NO: 126), ydfG, was amplified by PCR from the E coli genome using the forward primer, GGATAGTCCCATGGTCGTTTTAGTAACTGGAGCAAC (SEQ ID NO: 127), and reverse primer, GCTAATATGGATCCACCTCTTTAATTTACTGACGGTGGACATTCAG (SEQ ID NO: 128).
  • the amplified gene was digested with Ncol and BamHI and subcloned into the same restriction sites in the pTRC(amp)-HisA (Invitrogen, Carslbad, CA) to make pTRC-ydfG (SEQ ID NO: 129).
  • 3-HP is quantified using a 3HP standard curve at the beginning of the run and the data are analyzed using HP Chemstation.
  • the GC-MS system consists of a Hewlett Packard model 5890 GC and Hewlett Packard model 5972 MS.
  • the column is Supelco SPB- 1 (60m X 0.32mm X 0.25um film thickness).
  • the capillary coating is a non-polar methylsilicone.
  • the carrier gas is helium at a flow rate of lmL/min.
  • the 3-HP as derivatized is separated from other components in the ethyl acetate extract using either of two similar temperature regimes.
  • a first temperature gradient regime the column temperature starts with 40°C for 1 minute, then is raised at a rate of 10°C/minute to 235°C, and then is raised at a rate of 50°C/minute to 300°C.
  • a second temperature regime which was demonstrated to process samples more quickly, the column temperature starts with 70°C which is held for 1 min, followed by a ramp-up of 10 °C/minute to 235°C which is followed by a ramp-up of 50 " C/minute to 300°C. All values reported are the average specific activities measured in triplicate.
  • variants 1 through 4 showed better NADH-specific activities over controls and had confirmed 3-HP production as shown by GC-MS, the secondary site mutations were added as described above.
  • the plasmids were sequenced, and cell lines expressing each of these plasmids able to express the putative NADH-specific phosphate loop variants containing the secondary site mutations (variants 5 through 8 in Table 1) (SEQ ID NO: 050-053) of the malonyl CoA reductase domains were assayed for function as described above. The results for these assays are shown in FIG. 12.
  • Each variant had an NADPH-specific activity of less than 0.04 U/mg.
  • the NADH-specific activities for variant 9, variant 10, variant 11, and variant 12 are 0.67 U/mg, 0.5 U/mg, 0.70 U/mg, and 1.2 U/mg, respectively.
  • These results signify a 5.1 times, 3.8 time, 5.3 times, and a 9.2 times improvement in NADH specific activity over the MCR (1-554) truncate without an NADH-specific phosphate binding loop.
  • Example 4a Modifications for improved NADH utilization in several malonyl-coA reductases
  • Three of these sequences include the MCRs from C. auranticus (Ca MCR), O. trichoides (OTMCR) and C. aggregans (Caggregans MCR).
  • Ca MCR C. auranticus
  • OTMCR O. trichoides
  • C. aggregans C. aggregans
  • An alignment of these protein sequences can be obtained by comparing the published sequences.
  • other sequences may also be used as a starting sequence. Using the alignment it is reasonable to mutate the sequences in the homologous MCRs to mimic the changes made in other examples to the chlorflexus sequence which resulted in increased NADH utilization. See SEQ ID NO. 149, SEQ ID NO. 150, and SEQ ID NO. 151. These mutations are shown in Table 9a below.
  • Table 9a Mutations to homologous MCRs to increase NADH utilization.
  • the mutated sequence on the left is used to replace the original amino sequence in the middle or right column.
  • the position of mutation is indicated by the amino acids number referring to the original sequence.
  • GGLFGRRARLILEN 782-795 (PGLFLRRGRLILEN) (PGLFARRARLILEN)
  • Example 5 Switching the enzyme cofactor utilization from nicotinamide adenine dinucleotide and nicotinamide phosphate (NADPH) to adenine dinucleotide phosphate (NADH).
  • NADPH nicotinamide adenine dinucleotide and nicotinamide phosphate
  • NADH adenine dinucleotide phosphate
  • 3-HP is produced from malonyl-CoA by the sequential effects of a malonyl-CoA reductase and a 3-HP dehydrogenase activity. Production of 3-HP can thus be achieved in a microorganism comprising NADH-dependent malonyl-CoA reductase activity and a 3-HP dehydrogenase activity encoded by the ydfG gene of E.
  • coli which is an NADPH-specific dehydrogenase, or in a microorganism comprising NADH-dependent malonyl-CoA reductase activity and a 3-HP dehydrogenase activity encoded by the mmsB gene of Pseudomonas aeruginosa (SEQ ID NO: 092), which is a dehydrogenase with NADH substrate preference, or in a microorganism comprising NADHdependent malonyl-CoA reductase activity and 3-HP dehydrogenase activities encoded by the ydfG and mmsB gene products.
  • Production of 3-HP can also be achieved in a microorganism comprising NADH-dependent malonyl-CoA reductase activity and NADH-dependent 3-HP dehydrogenase activity, the latter encoded by variants of MCR with NADH- dependent 3-HP dehydrogenase activity.
  • a microorganism comprising NADH-dependent malonyl-CoA reductase activity and NADH-dependent 3-HP dehydrogenase activity, the latter encoded by variants of MCR with NADH- dependent 3-HP dehydrogenase activity.
  • Respective non-limiting examples of such combinations include variants 1-8(SEQ ID NOs:046-053) as to the former function and variants 9 -12 (SEQ ID NOs:054-057) as to the latter function.
  • Production of 3-HP from malonyl-CoA can in addition be achieved with a NADH-dependent malonyl-CoA reductase activity and an activity that converts malonyl semialdehyde to 3-HP using a biological reductant other than NADPH or NADH, such as the activity encoded by the rutE gene of E. coli or by the nemA gene of E. coli which are reductases that utilize a flavin derivative as the reductant and which further require the activity of a function such as the fre gene product encoding FMN reductase to regenerate the reductant. See, for example, Kim et al., 2010, J. Bacteriol. 192(16): 4089- 4102.
  • Expression of these genes can be driven by regulated promoters, such as the lac promoter or derivatives thereof, or by the T7 bacteriophage promoter, or by the arabinose promoter, or other DNA sequences known or found to drive expression in E. coli.
  • regulated promoters such as the lac promoter or derivatives thereof, or by the T7 bacteriophage promoter, or by the arabinose promoter, or other DNA sequences known or found to drive expression in E. coli.
  • Two malonyl-coA reductases were evaluated to produce malonate as well as one malonate semialdehyde dehydrogenase.
  • the malonyl-coA reductases used were the monofunctional malonyl- coA reductase from Solfolobus todakii ( StMCR) and the monofunctional MCR from chloroflexus auranticus comprising the 177-1220 amino acids of the full length bifunctional malonyl-coA reductase ( 177MCR).
  • StMCR Solfolobus todakii
  • the malonate semialdehyde dehydrogenase evaluated was that from gabD gene from E. coli which encodes for a succinate semialdehyde dehydrogenase.
  • Strains A-D are controls, while Strains E-J are strains modified according to the invention showing malonate production has been achieved via the expression of E. coli gabD from malonyl-coA via malonate semialdehyde produced from two independent malonyl-coA reductases.
  • Targeted mutagenesis at codons near to codon 241 may also be contemplated to obtain the desired fah./ mutants with altered properties.
  • Strains bearing the discussed fabl alleles can be used in combination with expression of NADH dependent 3-HP production pathways from malonyl-CoA using the enzymes variants described within the above examples. It has been shown that mutations in a microorganism's fatty acid synthase system can be used to increase the production of malonyl-CoA dependent products.
  • Example 8 Construction of Additional Strains for Evaluation.
  • the method replaces the target gene by a selectable marker via homologous recombination performed by the recombinase from X-phage.
  • the host organism expressing k-red recombinase is transformed with a linear DNA product coding for a selectable marker flanked by the terminal regions (generally— 50 bp, and alternatively up to about— 300 bp) homologous with the target gene or promoter sequence.
  • the marker is thereafter removed by another recombination step performed by a plasmid vector carrying the FLP -recombinase, or another recombinase, such as Cre.
  • deletions may be employed in various microbial strains in combinations such as but not limited to those shown in FIGs. 2A-G.
  • Part 2 Construction of E. coli_651 having a fabl mutation
  • JP1 1 11 The fad s mutation (Ser241— *Phe) in E. coli strain JP1 1 11 significantly increases the malonyl-CoA concentration when cells are grown at the nonpermissive temperature (37°C) and thus produces more 3-HP at this temperature.
  • JP1 1 11 is not an ideal strain for transitioning into pilot and commercial scale, since it is the product of NTG mutagenesis and thus may harbor unknown mutations, carries mutations in the stringency regulatory factors relA and spoT, and has enhanced conjugation propensity due to the presence of an Hfr factor.
  • the method involves replacement of the target gene (or, in this case, a promoter region) by a selectable marker via homologous recombination performed by the recombinase from X-phage.
  • the host organism expressing k-red recombinase is transformed with a linear DNA product coding for a selectable marker flanked by the terminal regions (generally— 50 bp, and alternatively up to about— 300 bp) homologous with the target gene or promoter sequence.
  • the marker can then be removed by another recombination step performed by a plasmid vector carrying the FLP -recombinase, or another recombinase, such as Cre.
  • Example 9 Preparing a Genetically Modified E. coli Host Cell Comprising an NADH dependent malonyl-CoAreductase (Mcr) and or NADH dependent 3-HP dehydrogenase in Combination with Other Genetic Modifications to Increase 3-HP Production Relative to a Control E. coli Cell (Prophetic).
  • Mcr malonyl-CoAreductase
  • NADH dependent 3-HP dehydrogenase in Combination with Other Genetic Modifications to Increase 3-HP Production Relative to a Control E. coli Cell (Prophetic).
  • Pseudomonas aeruginosa which further is codon-optimized for E. coli, alternatively, E. coli genes encoding, ydfG, rutE, nemA and fire may be overexpressed by standard methodology.
  • Vectors comprising galP and a native or mutated ppc also may be introduced by methods known to those skilled in the art (see, e.g., Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third Edition 2001 (volumes 1-3), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., "Sambrook and Russell, 2001”), additionally recognizing that mutations may be made by a method using the XL1 -Red mutator strain, using appropriate materials following a manufacturer's instructions (Stratagene QuikChange Mutagenesis Kit, Stratagene, La Jolla, CA USA) and selected for or screened under standard protocols. Also, genetic modifications are made to reduce or eliminate the enzymatic activities of E.coli genes as desired. These genetic modifications are achieved by using the RED/ET homologous recombination method with kits supplied by Gene Bridges (Gene Bridges GmbH, Dresden, Germany, www.genebridges.com) according to manufacturer's instructions.
  • vectors comprising malonyl-CoA thioesterase variants as described above such as the ybgC gene from E. coli.
  • vectors comprising galP and a native or mutated ppc also may be introduced by methods known to those skilled in the art (see, e.g., Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Third Edition 2001 (volumes 1-3), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., “Sambrook and Russell, 2001 ").
  • strains may be genetically modified to have mutations in the strains fatty acid synthase system, such as the temperature sensitive fabl allele as described above.
  • genetic modifications are made to reduce or eliminate the enzymatic activities of E.coli genes as desired. These genetic modifications are achieved by using the RED/ET homologous recombination method with kits supplied by Gene Bridges (Gene Bridges GmbH, Dresden, Germany, www.genebridges.com) according to manufacturer's instructions.
  • Example 9c Genetic modification/introduction of Malonyl-CoA Reductase and malonate semialdehyde dehydrogenase for 3-HP production in Bacillus subtilis (Prophetic)
  • nucleic acid construct that comprises a sequence encoding for malonyl-CoA reductase and or malonate semialdehyde dehydrogenase activity in a bacillus cell
  • additional genetic modifications are made to decrease enoyl-CoA reductase activity and/or other fatty acid synthase activity.
  • Example 10 Evaluation of Strains for 3-HP Production (Prophetic).
  • Example 1 1 General example of genetic modification to a host cell (prophetic and non-specific).
  • nucleic acid primers are prepared. Each primer is designed to have a sufficient overlap section that hybridizes with such ends or adjacent regions. Such primers may include enzyme recognition sites for restriction digest of transposase insertion that could be used for subsequent vector incorporation or genomic insertion. These sites are typically designed to be outward of the hybridizing overlap sections. Numerous contract services are known that prepare primer sequences to order (e.g., Integrated DNA Technologies, Coralville, IA USA).
  • the segment of interest may be synthesized, such as by a commercial vendor, and prepared via PCR, rather than obtaining from a microorganism or other natural source of DNA.
  • coli EXPRESSION SYSTEM (Stratagene, La Jolla, CA), pSC-B StrataClone Vector (Stratagene, La Jolla, CA), pRANGER-BTB vectors (Lucigen, Middleton, WI), and TOPO vector (Invitrogen Corp, Carlsbad, CA, USA).
  • the vector then is introduced into any of a number of host cells.
  • E. cloni 100 (Lucigen, Middleton, WI)
  • E. cloni 10GF' (Lucigen
  • StrataClone Competent cells (Stratagene, La Jolla, CA), E. coli BL21, E. coli BW25113, and E. coli K12 MG1655.
  • Some of these vectors possess promoters, such as inducible promoters, adjacent the region into which the sequence of interest is inserted (such as into a multiple cloning site), while other vectors, such as pSMART vectors (Lucigen, Middleton, WI), are provided without promoters and with dephosporylated blunt ends.
  • promoters such as inducible promoters
  • pSMART vectors Lucigen, Middleton, WI
  • the plasmids containing the segment of interest can then be isolated by routine methods and are available for introduction into other microorganism host cells of interest.
  • Various methods of introduction are known in the art and can include vector introduction or genomic integration.
  • the DNA segment of interest may be separated from other plasmid DNA if the former will be introduced into a host cell of interest by means other than such plasmid.
  • Host cells into which the segment of interest is introduced may be evaluated for performance as to a particular enzymatic step, and/or tolerance or bio-production of a chemical compound of interest. Selections of better performing genetically modified host cells may be made, selecting for overall performance, tolerance, or production or accumulation of the chemical of interest.
  • this procedure may incorporate a nucleic acid sequence for a single gene (or other nucleic acid sequence segment of interest), or multiple genes (under control of separate promoters or a single promoter), and the procedure may be repeated to create the desired heterologous nucleic acid sequences in expression vectors, which are then supplied to a selected microorganism so as to have, for example, a desired complement of enzymatic conversion step functionality for any of the herein-disclosed metabolic pathways.
  • a nucleic acid sequence for a single gene or other nucleic acid sequence segment of interest
  • multiple genes under control of separate promoters or a single promoter
  • cscB, cscK, and cscA were designed and synthesized using the services of a commercial synthetic DNA provider (DNA 2.0, Menlo Park, CA). These genes may be isolated or synthesized as described above, incorporated on a plasmid, and transformed into a suitable host cell simultaneously with plasmids that may express NADH dependent malonyl-CoA reductase or NADH dependent 3-HP dehydrogenase genes as described in other examples. Transformants carrying both plasmids are grown and evaluated for 3-HP production in shake flasks using SM3 medium where glucose is replaced with an equal concentration of sucrose.
  • NADH dependent malonyl-CoA reductase or NADH dependent 3-HP dehydrogenase genes as described in other examples.
  • Transformants carrying both plasmids are grown and evaluated for 3-HP production in shake flasks using SM3 medium where glucose is replaced with an equal concentration of sucrose.
  • Example 13 Conversion of 3-HP to Specified Derived Chemicals and Products
  • 3-HP is obtained in a relatively pure state from a microbial bio-production event, and is converted to any one or more of propriolactone via a ring-forming internal esterification reaction (eliminating a water molecule), ethyl-3-HP via esterification with ethanol, malonic acid via an oxidation reaction, and 1,3-propanediol via a reduction reaction.
  • a ring-forming internal esterification reaction eliminating a water molecule
  • ethyl-3-HP via esterification with ethanol
  • malonic acid via an oxidation reaction
  • 1,3-propanediol via a reduction reaction.
  • Example 14 Genetic modification/introduction of Malonyl-CoA Reductase for 3-HP production in Bacillus subtilis (Prophetic).
  • MCR variants or combinations of MCR and 3-HP dehydrogenases in Bacillus subtilis is expression from a plasmid.
  • Shuttle vectors are known in the art that carry an inducible Pgrac IPTG-inducible promoter.
  • the genetic element containing these enzymes can be cloned under the control of this promoter using standard molecular biology techniques creating a plasmid containing MCR or 3-HP dehydrogenase variants.
  • a plasmid based MCR could then be transformed into different bacillus strains
  • nucleic acid construct that comprises a sequence encoding for malonyl-CoA reductase and or 3-HP dehydrogenase activity in a bacillus cell
  • additional genetic modifications are made to decrease enoyl-CoA reductase activity and/or other fatty acid synthase activity.
  • Example 15 Yeast aerobic pathway for 3HP production (Prophetic).
  • MCR variants or combinations of MCR and 3-HP dehydrogenases in yeast by expression from a plasmid.
  • the genetic elements containing these enzymes under the control of numerous promoters in numerous vectors are known in the art by use of standard methods.
  • a vector based MCR could then be transformed into different yeast strains.
  • nucleic acid construct that comprises a sequence encoding for malonyl-CoA reductase and or 3-HP dehydrogenase activity in a yeast cell
  • additional genetic modifications are made to decrease enoyl-CoA reductase activity and/or other fatty acid synthase activity.
  • Example 16 Yeast Strain construction.
  • Yeast strains are constructed using standard yeast transformation and selected for by
  • E. coli-Rhodococcus shuttle vectors are available for expression in R. erythropolis, including, but not limited to, pRhBR17 and pDA71 (Kostichka et al., Appl. Microbiol. Biotechnol. 62:61- 68(2003)). Additionally, a series of promoters are available for heterologous gene expression in R.
  • erythropolis see for example Nakashima et al., Appl. Environ. Microbiol. 70:5557-5568 (2004), and Tao et al., Appl. Microbiol. Biotechnol. 2005, DOI 10.1007/s00253-005-0064).
  • Targeted gene disruption of chromosomal genes in R. erythropolis may be created using the method described by Tao et al., supra, and Brans et al. (Appl. Environ. Microbiol. 66: 2029-2036 (2000)). These published resources are incorporated by reference for their respective indicated teachings and compositions.
  • nucleic acid sequences required for providing an increase in 3-HP production are cloned initially in pDA71 or pRhBR71 and transformed into E. coli.
  • the vectors are then transformed into R. erythropolis by electroporation, as described by Kostichka et al., supra.
  • the recombinants are grown in synthetic medium containing glucose and the 3-HP bio-production is followed using methods known in the art and/or described herein.
  • the plasmids constructed for expression in B. subtilis are transformed into B. licheniformis to produce a recombinant microorganism that then demonstrates improved 3-HP Bio-production.
  • Plasmids are constructed as described herein for expression in B. subtilis and used to transform Paenibacillus macerans by protoplast transformation to produce a recombinant microorganism that demonstrates improved 3-HP Bio-production.
  • the poly(hydroxybutyrate) pathway in Alcaligenes has been described in detail, a variety of genetic techniques to modify the Alcaligenes eutrophus genome is known, and those tools can be applied for engineering a recombinant microorganism that produces 3-HP and/or polymers thereof.
  • these nucleic acid sequences are inserted into pUCP18 and this ligated DNA are electr op orated into electrocompetent Pseudomonas putida KT2440 cells to generate recombinant P. putida microorganisms that exhibit increased 3-HP Bio-production, comprised at least in part of introduced nucleic acid sequences.
  • the Lactobacillus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Bacillus subtilis and Streptococcus are used for Lactobacillus.
  • suitable vectors include pAM.beta. l and derivatives thereof (Renault et al., Gene 183 :175- 182 (1996); and O'Sullivan et al., Gene 137:227-231 (1993)); pMBBl and pHW800, a derivative of pMBBl (Wyckoff et al. Appl. Environ.
  • Microbiol 62:1481-1486 (1996)); pMGl, a conjugative plasmid (Tanimoto et al., J. Bacteriol. 184:5800-5804 (2002)); pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol. 63:4581-4584 (1997)); pAM401 (Fujimoto et al., Appl. Environ. Microbiol. 67:1262-1267 (2001)); and pAT392 (Arthur et al., Antimicrob. Agents Chemother. 38:18991903 (1994)).
  • the Enterococcus genus belongs to the Lactobacillales family and many plasmids and vectors used in the transformation of Lactobacillus, Bacillus subtilis, and Streptococcus are used for
  • Non- limiting examples of suitable vectors include pAM.beta. l and derivatives thereof (Renault et al., Gene 183:175-182 (1996); and O'Sullivan et al., Gene 137:227-231 (1993)); pMBBl and pHW800, a derivative of pMBBl (Wyckoff et al. Appl. Environ. Microbiol. 62:1481-1486 (1996));
  • pMGl a conjugative plasmid (Tanimoto et al., J. Bacteriol. 184:5800-5804 (2002)); pNZ9520
  • 3-HP bio-production comparison may be incorporated thereto: Using analytical methods for 3-HP such as are described in Subsection III of Common Methods Section, 3-HP is obtained in a measurable quantity at the conclusion of a respective bio-production event conducted with the respective recombinant microorganism (see types of bio- production events, incorporated by reference into each respective General Prophetic Example). That measurable quantity is substantially greater than a quantity of 3-HP produced in a control bio-production event using a suitable respective control microorganism lacking the functional 3-HP pathway so provided in the respective General Prophetic Example.
  • Bacterial species which may be utilized as needed, are as follows:
  • Acinetobacter calcoaceticus (DSMZ # 1139) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, IL, USA). Serial dilutions of the resuspended A. calcoaceticus culture are made into BHI and are allowed to grow for aerobically for 48 hours at 37°C at 250 rpm until saturated. Bacillus subtilis is a gift from the Gill lab (University of Colorado at Boulder) and is obtained as an actively growing culture. Serial dilutions of the actively growing B.
  • subtilis culture are made into Luria Broth (RPI Corp, Mt. Prospect, IL, USA) and are allowed to grow for aerobically for 24 hours at 37°C at 250 rpm until saturated.
  • Chlorobium limicola (DSMZ# 245) is obtained from the German Collection of Microorganisms and Cell Cultures
  • Clostridium acetobutylicum (DSMZ # 792) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Clostridium acetobutylicum medium (#411) as described per DSMZ instructions. C. acetobutylicum is grown anaerobically at 37°C at 250 rpm until saturated.
  • Clostridium aminobutyricum (DSMZ # 2634) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Clostridium aminobutyricum medium (#286) as described per DSMZ instructions. C. aminobutyricum is grown anaerobically at 37°C at 250 rpm until saturated.
  • Cupriavidus metallidurans (DMSZ # 2839) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, IL, USA). Serial dilutions of the resuspended C. metallidurans culture are made into BHI and are allowed to grow for aerobically for 48 hours at 30°C at 250 rpm until saturated.
  • BHI Brain Heart Infusion
  • Desulfovibrio fructosovorans (DSMZ # 3604) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Desulfovibrio fructosovorans medium (#63) as described per DSMZ instructions. D. fructosovorans is grown anaerobically at 37°C at 250 rpm until saturated.
  • Escherichia coli Crooks (DSMZ#1576) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Brain Heart Infusion (BHI) Broth (RPI Corp, Mt. Prospect, IL, USA). Serial dilutions of the resuspended E. coli Crook culture are made into BHI and are allowed to grow for aerobically for 48 hours at 37°C at 250 rpm until saturated.
  • BHI Brain Heart Infusion
  • Escherichia coli K12 is a gift from the Gill lab (University of Colorado at Boulder) and is obtained as an actively growing culture. Serial dilutions of the actively growing E. coli K12 culture are made into Luria Broth (RPI Corp, Mt. Prospect, IL, USA) and are allowed to grow for aerobically for 24 hours at 37°C at 250 rpm until saturated.
  • Halobacterium salinarum (DSMZ# 1576) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Halobacterium medium (#97) as described per DSMZ instructions. H. salinarum is grown aerobically at 37°C at 250 rpm until saturated.
  • Lactobacillus delbrueckii (#4335) is obtained from WYEAST USA (Odell, OR, USA) as an actively growing culture. Serial dilutions of the actively growing L. delbrueckii culture are made into Brain Heart Infusion (BHI) broth (RPI Corp, Mt. Prospect, IL, USA) and are allowed to grow for aerobically for 24 hours at 30°C at 250 rpm until saturated.
  • Metallosphaera sedula (DSMZ #5348) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as an actively growing culture. Serial dilutions of M. sedula culture are made into Metallosphaera medium (#485) as described per DSMZ instructions. M. sedula is grown aerobically at 65°C at 250 rpm until saturated.
  • Propionibacterium freudenreichii subsp. shermanii (DSMZ# 4902) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in PYG-medium (#104) as described per DSMZ instructions. P. freudenreichii subsp. shermanii is grown anaerobically at 30°C at 250 rpm until saturated.
  • Pseudomonas putida is a gift from the Gill lab (University of Colorado at Boulder) and is obtained as an actively growing culture. Serial dilutions of the actively growing P. putida culture are made into Luria Broth (RPI Corp, Mt. Prospect, IL, USA) and are allowed to grow for aerobically for 24 hours at 37°C at 250 rpm until saturated. Streptococcus mutans (DSMZ# 6178) is obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) as a vacuum dried culture. Cultures are then resuspended in Luria Broth (RPI Corp, Mt. Prospect, IL, USA). S. mutans is grown aerobically at 37°C at 250 rpm until saturated.
  • strains may also be used as starting strains in the Examples: DF40 Hfr(P02A), garBlO, fhuA22, ompF627(T2R), fadL701(T2R), relAl, pitAlO, spoTl, rrnB-2, pgi-2, mcrBl, creC510, BW25113 F-, A(araD-araB)567, AlacZ4787(::rrnB-3), &lambda , rph-1, A(rhaD- rhaB)568, hsdR514, JP111 Hfr(POl), galE45(GalS), &lambda Jab 1392 (ts), relAl, spoTJ, thi-1.
  • Bacterial growth culture media and associated materials and conditions are as follows:
  • Fed-batch medium contained (per liter): 10 g tryptone, 5 g yeast extract, 1.5 g NaCl, 2 g Na 2 HP0 4 .7 H 2 0, 1 g KH 2 P0 4 , and glucose as indicated
  • AM2 medium contained (per liter): 2.87 g K 2 HP0 4 , 1.50g KH 2 P0 4 , 3.13g (NH 4 ) 2 S0 4 , 0.15 g KC1, 1.5 mM MgS0 4 , 0.1M K + MOPS pH 7.2, 30 g glucose, and 1 ml trace Mineral Stock prepared as described in Martinez et al. Biotechnol Lett 29:397-404 (2007)
  • Components per liter 700 mL DI water, 100 mL 10X SM3 Salts, 2 ml 1M MgS0 4 , 1 ml 1000X Trace Mineral Stock, 60 mL 500 g/L glucose, 100 mL 0.1 M MOPS (pH 7.4), 0.1 mL of 1 M CaCl 2 , Q.S. with DI water to 1000 mL, and 0.2 urn filter sterilize.
  • MOPS 1M MOPS:209.3 g MOPS
  • dissolve in 700 ml water To make 1M MOPS:209.3 g MOPS, dissolve in 700 ml water. Take 70-ml portions and adjust to desired pH with 50% KOH, adjust to 100 mL final volume, and 0.2 jtm filter sterilize.
  • glucose stock solution 900 mL DI water, 500 g glucose, and Q.S. to 1000 mL.
  • M9 minimal media was made by combining 5X M9 salts, 1M MgS0 4 , 20% glucose, 1M CaCl 2 and sterile deionized water.
  • the 5X M9 salts are made by dissolving the following salts in deionized water to a final volume of 1L: 64g Na 2 HP0 4 7H 2 0, 15g KH 2 P0 4 ,2.5g NaCl, 5.0g NH 4 C1.
  • the salt solution was divided into 200mL aliquots and sterilized by autoclaving for 15minutes at 15psi on the liquid cycle.
  • a IM solution of MgS0 and 1M CaCl 2 were made separately, then sterilized by autoclaving.
  • the glucose was filter sterilized by passing it thought a 0.22jtm filter. All of the components are combined as follows to make 1L of M9: 750mL sterile water, 200mL 5X M9 salts, 2mL of 1M MgS0 4 , 20mL 20% glucose, O. lmL CaCl 2 , Q.S. to a final volume of 1L.
  • Molecular biology grade agarose (RPI Corp, Mt. Prospect, IL, USA) is added to lx TAE to make a 1% Agarose in TAE.
  • 50x TAE add the following to 900ml distilled H 2 0 : 242g Tris base (RPI Corp, Mt. Prospect, IL, USA), 57.1ml Glacial Acetic Acid (Sigma- Aldrich, St. Louis, MO, USA), 18.6 g EDTA (Fisher Scientific, Pittsburgh, PA USA), and adjust volume to IL with additional distilled water.
  • To obtain lx TAE add 20mL of 50x TAE to 980mL of distilled water.
  • agarose-TAE solution is then heated until boiling occurred and the agarose is fully dissolved.
  • the solution is allowed to cool to 50°C before lOmg/mL ethidium bromide (Acros Organics, Morris Plains, NJ, USA) is added at a concentration of 5ul per lOOmL of 1% agarose solution.
  • ethidium bromide is added, the solution is briefly mixed and poured into a gel casting tray with the appropriate number of combs (Idea Scientific Co., Minneapolis, MN, USA) per sample analysis. DNA samples are then mixed accordingly with 5X TAE loading buffer.
  • 5X TAE loading buffer consists of 5X TAE(diluted from 50X TAE as described herein), 20% glycerol (Acros Organics, Morris Plains, NJ, USA), 0.125% Bromophenol Blue (Alfa Aesar, Ward Hill, MA, USA), and adjust volume to 50mL with distilled water. Loaded gels are then run in gel rigs (Idea Scientific Co., Minneapolis, MN, USA) filled with IX TAE at a constant voltage of 125 volts for 25-30 minutes. At this point, the gels are removed from the gel boxes with voltage and visualized under a UV transilluminator (FOTODYNE Inc., Hartland, WI, USA).
  • the DNA isolated through gel extraction is then extracted using the QIAquick Gel Extraction Kit following manufacturer' s instructions (Qiagen (Valencia CA USA)). Similar methods are known to those skilled in the art.
  • the thus-extracted DNA then may be ligated into pSMART (Lucigen Corp, Middleton, WI, USA), StrataClone (Stratagene, La Jolla, CA, USA) or pCR2.1-TOPO TA (Invitrogen Corp, Carlsbad, CA, USA) according to manufacturer' s instructions. These methods are described in the next subsection of Common Methods.
  • Gel extracted DNA is blunted using PCRTerminator (Lucigen Corp, Middleton, WI, USA) according to manufacturer' s instructions. Then 50Ong of DNA is added to 2.5 uL 4x CloneSmart vector premix, lul CloneSmart DNA ligase (Lucigen Corp, Middleton, WI, USA) and distilled water is added for a total volume of lOul. The reaction is then allowed to sit at room temperature for 30 minutes and then heat inactivated at 70°C for 15 minutes and then placed on ice. E. cloni 10G Chemically Competent cells (Lucigen Corp, Middleton, WI, USA) are thawed for 20 minutes on ice.
  • Gel extracted DNA is blunted using PCRTerminator (Lucigen Corp, Middleton, WI, USA) according to manufacturer' s instructions. Then 2ul of DNA is added to 3ul StrataClone Blunt Cloning buffer and 1 ul StrataClone Blunt vector mix amp/kan (Stratagene, La Jolla, CA, USA) for a total of 6ul . Mix the reaction by gently pipeting up at down and incubate the reaction at room temperature for 30 minutes then place onto ice. Thaw a tube of StrataClone chemically competent cells (Stratagene, La Jolla, CA, USA) on ice for 20 minutes.
  • Chemically competent transformation protocols are carried out according to the manufacturer's instructions or according to the literature contained in Molecular Cloning (Sambrook and Russell, 2001). Generally, plasmid DNA or ligation products are chilled on ice for 5 to 30 min. in solution with chemically competent cells. Chemically competent cells are a widely used product in the field of biotechnology and are available from multiple vendors, such as those indicated in this Subsection.
  • cells Following the chilling period cells generally are heat-shocked for 30 seconds at 42°C without shaking, re- chilled and combined with 250 microliters of rich media, such as S.O.C. Cells are then incubated at 37°C while shaking at 250 rpm for 1 hour. Finally, the cells are screened for successful transformations by plating on media containing the appropriate antibiotics.
  • selected cells may be transformed by electroporation methods such as are known to those skilled in the art.
  • E. coli host strain for plasmid transformation is determined by considering factors such as plasmid stability, plasmid compatibility, plasmid screening methods and protein expression. Strain backgrounds can be changed by simply purifying plasmid DNA as described herein and transforming the plasmid into a desired or otherwise appropriate E. coli host strain such as determined by experimental necessities, such as any commonly used cloning strain (e.g., DH5a, Topi OF', E. cloni 10G, etc.).
  • any commonly used cloning strain e.g., DH5a, Topi OF', E. cloni 10G, etc.
  • Plasmid DNA was prepared using the commercial miniprep kit from Qiagen (Valencia, CA USA) according to manufacturer' s instructions.
  • Subsection Ma. 3 -HP Preparation A 3-HP stock solution was prepared as follows. A vial of 0-propriolactone (Sigma- Aldrich, St. Louis, MO, USA) was opened under a fume hood and the entire bottle contents was transferred to a new container sequentially using a 25-mL glass pipette. The vial was rinsed with 50 mL of HPLC grade water and this rinse was poured into the new container. Two additional rinses were performed and added to the new container. Additional HPLC grade water was added to the new container to reach a ratio of 50 mL water per 5 mL 0-propriolactone. The new container was capped tightly and allowed to remain in the fume hood at room temperature for 72 hours.
  • 0-propriolactone Sigma- Aldrich, St. Louis, MO, USA
  • the column resin is a sulfonated polystyrene divinyl benzene with a particle size of lOum and column dimensions are 300 x 7.8 mm.
  • the mobile phase consisted of sulfuric acid (Fisher Scientific, Pittsburgh, PA USA) diluted with deionized (18 MSkm) water to a concentration of 0.02 N and vacuum filtered through a 0.2 ⁇ nylon filter. The flow rate of the mobile phase is 0.6 mL/min.
  • the UV detector is operated at a wavelength of 210 nm and the column is heated to 60 °C.
  • the same equipment and method as described herein is used for 3-HP analyses for relevant prophetic examples.
  • a representative calibration curve using this HPLC method with a 3-HP standard (TCI America, Portland, OR) is provided in FIG. 15.
  • 3-HP is quantified using a 3HP standard curve at the beginning of the run and the data are analyzed using HP Chemstation.
  • the GC-MS system consists of a Hewlett Packard model 5890 GC and Hewlett Packard model 5972 MS.
  • the column is Supelco SPB-1 (60m X 0.32mm X 0.25um film thickness).
  • the capillary coating is a non-polar methylsilicone.
  • the carrier gas is helium at a flow rate of lmL/min.
  • the 3 -HP as derivatized is separated from other components in the ethyl acetate extract using either of two similar temperature regimes.
  • a first temperature gradient regime the column temperature starts with 40°C for 1 minute, then is raised at a rate of 10°C/minute to 235°C, and then is raised at a rate of 50°C/minute to 300°C.
  • a second temperature regime which was demonstrated to process samples more quickly, the column temperature starts with 70°C which is held for 1 mM, followed by a ramp-up of 10 °C/minute to 235°C which is followed by a ramp-up of 50 C/minute to 300°C.
  • a representative calibration curve is provided in FIG. 16.
  • a bioassay for detection of 3-HP also was used in various examples. This determination of 3-HP concentration was carried out based on the activity of the E. coli 3-HP dehydrogenase encoded by the ydfG gene (the YDFG protein). Reactions of 200-u.1 were carried out in 96-well microtiter plates, and contained 100 mM Tris-HCl, pH 8.8, 2.5 mM MgCl 2 , 2.625 mM NADP + , 3 lig purified YDFG and 20 ul culture supernatant. Culture supernatants were prepared by centrifugation in a microfuge (14,000 rpm, 5 min) to remove cells.
  • a standard curve of 3-HP (containing from 0.025 to 2 g/1) was used in parallel reactions to quantitate the amount of 3-HP in culture supernatants. Uninoculated medium was used as the reagent blank. Where necessary, the culture supernatant was diluted in medium to obtain a solution with 3-HP concentrations within that of the standard curve.
  • a spectrophotometric assay was developed in order to biochemically measure malonyl CoA reductase activity of both full length and truncated version of malonyl CoA reductase. Activities were determined with either NADPH, NADH, or a mixture of NADPH and NADH as a cofactor and malonyl CoA as a substrate. Assays were performed as 200 microliter reactions in a 96-well plate format using a Molecular Dynamics SpectraMax 384 microplate reader with SoftmaxPro software (Molecular Dynamics, Sunnyvale CA) to quantitate the rate of change in the 340 nm absorbance. All assays were conducted at 37°C, and the instrument was allowed to mix the plate for 1 second prior to each measurement.
  • the progress of each reaction was monitored for 30 minutes during which measurements were made every 20 seconds.
  • the reaction conditions at the time of reaction consisted of 5 mM dithiothreitol, 3 mM magnesium chloride, 100 mM Trizma-HCl pH7.6 buffer. Unless otherwise noted, all chemicals were purchased from Sigma- Aldrich (St. Louis, MO).
  • the nicotinamide adenine dinucleotide (NADH) and nicotinamide adenine dinucleotide phosphate (NADPH) cofactors were added at lmM NADH, lmM NADPH, or a combination or 0.5 mM NADH (EMD Bioscience) and 0.5 mM NADPH (EMD
  • a spectrophotometric coupled assay was developed in order to biochemically measure the 3-HP dehydrogenase domain of malonyl CoA reductase to determine the specific activities of either the full length enzyme or truncated version thereof.
  • This coupled assay allows for measurement of the dehydrogenase specific activity by providing malonate semialdehyde to the dehydrogenase.
  • the malonate semialdehyde is produced using a purified beta-alanine aminotransaminase (BAAT). This enzyme is able to convert alpha-ketoglutarate and beta-alanine into glutamine and malonate semialdehyde.
  • This malonate semialdehyde is they used as substrate for the dehydrogenase reaction that is monitor by recoding the decrease in 340 nm NADPH/NADH-specific signal with the spectrophotometer.
  • Purified protein for this assay was provided by overexpressing the Saccharomyces kluyveri with a c-terminal SxHistidine purification tag. A plasmid encoding this codon optimized gene was synthesized using the services of Genscript, Inc. The sequence of the overexpressed protein is provided as SEQ ID NO:148.
  • a starter culture of the cell line carrying the BAAT overexpression plasmid was grown overnight in LB media with antibiotic selection.
  • the cells were mechanically lysed using a Mini-Beadb eater (Biospec Products, Bartelsville, OK).
  • the cell lysate was clarified by centrifugation and 10000 G for 15 minutes.
  • the his-tagged BAAT protein was then purified from the clarified cell lysate by mixing the lysate as a batch-purification with 3mL of Ni- NTA resin (Qiagen) at 4 degrees Celsius for 1 hour.
  • the protein bound resin was then placed in an empty chromatography column (Biorad), and washed with a buffer consisting of 50 mM Tris pH 8.0, 500 mM sodium chloride, and 20 mM imidazole for 50 column volumes.
  • the pure BBAT protein was eluted from the column using a buffer consisting of 50 mM Tris pH 8.0, 500 mM sodium chloride, 250 mM imidazole, and 0.1 mM pyridoxal 5' phosphate. Fractions were pooled and stored at -80 Celsius until the time of use.
  • Activities were determined with either NADPH, NADH, or a mixture of NADPH and NADH as a cofactor. Assays were performed as 200 microliter reactions in a 96-well plate format using a Molecular Dynamics SpectraMax 384 microplate reader with SoftmaxPro software (Molecular Dynamics, Sunnyvale CA) to quantitate the rate of change in the 340 nm absorbance. All assays were conducted at 37°C, and the instrument was allowed to mix the plate for 1 second prior to each measurement. The progress of each reaction was monitored for 30 minutes during which measurements were made every 20 seconds.
  • the reaction conditions at the time of reaction consisted of 0.1 mM pyridoxal 5' phosphate, 10 mM alpha- ketoglutarate, 25 mM beta-alanine, 1 mM magnesium chloride, 50 mM Trizma-HCl pH8.0 buffer, and 0.006 mg of purified BAAT. Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich (St. Louis, MO). The nicotinamide adenine dinucleotide and nicotinamide (NADH) adenine dinucleotide phosphate (NADPH) cofactors were added at lmM NADH, lmM NADPH.
  • Reactions were initiated by the addition of 20 uL of diluted, clarified whole cell lysates of cells expressing the dehydrogenase being assessed to a reaction buffer filled well of the 96-well plate used to perform the assay . Once the reaction time course was read and the slopes of each well were calculated, the specific activities were compared to a negative control to determine a background rate. All values reported are the average specific activities measured in triplicate.
  • the clarified supernatant was measure for protein concentration using a Biorad Total Protein determination kit (BioRad). For each dehydrogenase tested, a cell line containing the expression plasmid was grown as 50 mL cultures in LB with antibiotic selection. Expression cultures were started from overnight cultures grown overnight in LB at 30 degrees Celsius.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne la production microbienne de malonate semi-aldéhyde, de 3-hydroxypropionate et de produits dérivés de ceux-ci, comprenant l'utilisation d'une combinaison de domaines malonyl CoA réductase et de domaines 3-HP déshydrogénase avec des spécificités de cofacteur modifiées pour NADH et NADPH. Des modes de réalisation de la présente invention comprennent également des procédés de modification génétique de ces protéines, les microorganismes génétiquement modifiés étant utilisés pour la production avec ces enzymes modifiées, des procédés de fabrication de tels organismes et des procédés de fabrication des composés, des composés aval et des produits aval.
PCT/US2012/056159 2011-09-19 2012-09-19 Compositions et procédés concernant l'utilisation directe de nadh pour produire de l'acide 3-hydroxypropionique, produits chimiques dérivés et autres produits dérivés WO2013043758A2 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201161536539P 2011-09-19 2011-09-19
US201161536464P 2011-09-19 2011-09-19
US201161536558P 2011-09-19 2011-09-19
US61/536,558 2011-09-19
US61/536,464 2011-09-19
US61/536,539 2011-09-19

Publications (2)

Publication Number Publication Date
WO2013043758A2 true WO2013043758A2 (fr) 2013-03-28
WO2013043758A3 WO2013043758A3 (fr) 2013-06-13

Family

ID=47915086

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/056159 WO2013043758A2 (fr) 2011-09-19 2012-09-19 Compositions et procédés concernant l'utilisation directe de nadh pour produire de l'acide 3-hydroxypropionique, produits chimiques dérivés et autres produits dérivés

Country Status (1)

Country Link
WO (1) WO2013043758A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8728788B1 (en) 2011-09-30 2014-05-20 Novozymes A/S Dehydrogenase variants and polynucleotides encoding same
EP2855690A4 (fr) * 2012-05-30 2016-02-17 Lanzatech New Zealand Ltd Micro-organismes recombinants et leurs utilisations
US9365875B2 (en) 2012-11-30 2016-06-14 Novozymes, Inc. 3-hydroxypropionic acid production by recombinant yeasts
WO2020128618A3 (fr) * 2018-12-18 2020-08-06 Braskem S.A. Voie de co-production de dérivés de 3-hp et d'acétyl-coa à partir de semi-aldéhyde de malonate
WO2022250697A1 (fr) * 2021-05-28 2022-12-01 Cargill, Incorporated Procédé de fermentation pour la production d'acide malonique
US11788092B2 (en) 2021-02-08 2023-10-17 Lanzatech, Inc. Recombinant microorganisms and uses therefor

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7638316B2 (en) * 2000-11-20 2009-12-29 Cargill, Incorporated 3-hydroxypropionic acid and other organic compounds
US20110125118A1 (en) * 2009-11-20 2011-05-26 Opx Biotechnologies, Inc. Production of an Organic Acid and/or Related Chemicals
US20120244588A1 (en) * 2011-03-24 2012-09-27 Samsung Electronics Co., Ltd. Method of producing 3-hydroxypropionic acid using malonic semialdehyde reducing pathway

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7638316B2 (en) * 2000-11-20 2009-12-29 Cargill, Incorporated 3-hydroxypropionic acid and other organic compounds
US20110125118A1 (en) * 2009-11-20 2011-05-26 Opx Biotechnologies, Inc. Production of an Organic Acid and/or Related Chemicals
US20120244588A1 (en) * 2011-03-24 2012-09-27 Samsung Electronics Co., Ltd. Method of producing 3-hydroxypropionic acid using malonic semialdehyde reducing pathway

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8728788B1 (en) 2011-09-30 2014-05-20 Novozymes A/S Dehydrogenase variants and polynucleotides encoding same
US9163220B2 (en) 2011-09-30 2015-10-20 Novozymes A/S Dehydrogenase variants and polynucleotides encoding same
US9404091B2 (en) 2011-09-30 2016-08-02 Novozymes, Inc. Dehydrogenase variants and polynucleotides encoding same
EP2855690A4 (fr) * 2012-05-30 2016-02-17 Lanzatech New Zealand Ltd Micro-organismes recombinants et leurs utilisations
US9365875B2 (en) 2012-11-30 2016-06-14 Novozymes, Inc. 3-hydroxypropionic acid production by recombinant yeasts
WO2020128618A3 (fr) * 2018-12-18 2020-08-06 Braskem S.A. Voie de co-production de dérivés de 3-hp et d'acétyl-coa à partir de semi-aldéhyde de malonate
US11377671B2 (en) 2018-12-18 2022-07-05 Braskem S.A. Co-production pathway for 3-HPA and acetyl-CoA derivatives from malonate semialdehyde
US11788092B2 (en) 2021-02-08 2023-10-17 Lanzatech, Inc. Recombinant microorganisms and uses therefor
WO2022250697A1 (fr) * 2021-05-28 2022-12-01 Cargill, Incorporated Procédé de fermentation pour la production d'acide malonique

Also Published As

Publication number Publication date
WO2013043758A3 (fr) 2013-06-13

Similar Documents

Publication Publication Date Title
US8809027B1 (en) Genetically modified organisms for increased microbial production of 3-hydroxypropionic acid involving an oxaloacetate alpha-decarboxylase
EP2689020B1 (fr) Production microbienne de produits chimiques, et compositions, procédés et systèmes associés
JP6271494B2 (ja) ３−ヒドロキシプロピオン酸および他の生成物を生成するための方法
US20110125118A1 (en) Production of an Organic Acid and/or Related Chemicals
AU2011210852B2 (en) Microorganism production of high-value chemical products, and related compositions, methods and systems
US20180312887A1 (en) Microbial production of chemical products and related compositions, methods and systems
WO2013043758A2 (fr) Compositions et procédés concernant l'utilisation directe de nadh pour produire de l'acide 3-hydroxypropionique, produits chimiques dérivés et autres produits dérivés
EP2904104B1 (fr) Microorganismes recombinés pour la production d'acides organiques
EP2501819A2 (fr) Production d'un acide organique, et/ou produits chimiques connexes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12834524

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 12834524

Country of ref document: EP

Kind code of ref document: A2