WO2013041577A1 - Procédés de diagnostic de la sclérose latérale amyotrophique et de la dégénérescence lobaire frontotemporale - Google Patents

Procédés de diagnostic de la sclérose latérale amyotrophique et de la dégénérescence lobaire frontotemporale Download PDF

Info

Publication number
WO2013041577A1
WO2013041577A1 PCT/EP2012/068456 EP2012068456W WO2013041577A1 WO 2013041577 A1 WO2013041577 A1 WO 2013041577A1 EP 2012068456 W EP2012068456 W EP 2012068456W WO 2013041577 A1 WO2013041577 A1 WO 2013041577A1
Authority
WO
WIPO (PCT)
Prior art keywords
als
ftld
repeat
patients
expansion
Prior art date
Application number
PCT/EP2012/068456
Other languages
English (en)
Inventor
Christine Van Broeckhoven
Marc Cruts
Original Assignee
Vib Vzw
Universiteit Antwerpen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vib Vzw, Universiteit Antwerpen filed Critical Vib Vzw
Publication of WO2013041577A1 publication Critical patent/WO2013041577A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to the field of diagnosis, more particularly to the diagnosis of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
  • the invention relates to the detection of mutations in the promoter region of the gene C90RF72, whereby said mutations cause a significant decrease in the expression of gene C90RF72.
  • the decrease in gene C90RF72 expression is related to the presence of amyotrophic lateral sclerosis (ALS) or frontotemporal lobar degeneration (FTLD) in a patient.
  • ALS amyotrophic lateral sclerosis
  • FTLD frontotemporal lobar degeneration
  • the identified mutations can be used in the diagnosis of ALS and/or FTLD, or in the construction of transgenic animals for studying ALS and/or FTLD.
  • ALS Amyotrophic lateral sclerosis
  • FTLD frontotemporal lobar degeneration
  • ALS patients show reduced control of voluntary muscle movement expressed in increased muscle weakness, disturbances of speech, swallowing or breathing, as a result of progressive upper and lower motor neuron degeneration in motor cortex, brainstem and spinal cord, and up to 50% of ALS patients shows mild disturbances in executive functions while a minority also develop overt FTLD (Lomen-Hoerth et al., 2003; Ringholz et al., 2005).
  • FTLD symptoms include behavioural, personality and language disturbances, and also cognitive dysfunctions, due to affected frontal and temporal cortical neurons in the brain.
  • FTLD patients may additionally present with typical clinical signs of ALS in a later stage of the disease (Neary et al., 1998).
  • TDP-43 TAR DNA-binding protein-43
  • FTLD-TDP TDP-43 positive FTLD
  • Five to 10% of ALS patients and up to 50% of FTLD patients has a positive familial history of disease with a Mendelian mode of inheritance indicating a significant contribution of genetic factors in disease aetiology.
  • GNN granulin
  • VCP valosin-containing protein
  • CHMP2B charged multivesicular body protein 2B
  • ALSFTD2 locus chromosome 9p13-p21
  • a GWAS in FTLD has implicated the same region (Van Deerlin et al., 2010). This finding was further confirmed in other FTLD and ALS-FTLD cohorts (Rollinson et al., 201 1 ). Together, these data demonstrate that ALS and FTLD share a major common genetic factor on chromosome 9p, most likely showing high mutation frequencies. Despite all attempts of several research groups, the genetic defect(s) underlying both genetic linkage and association to this region have not been identified yet.
  • This mutation can be used for the development of a diagnostic assay and kits for the detection of FTLD and/or ALS.
  • Figure 1 Schematic view of the repeat primer-based PCR detection assay on Chr 9
  • Figure 3 PCR amplification products of ALS patient with repeat expansion on Chr 9 are separated on an Applied Biosystems ABI 3730 and analyzed.
  • Figure 4 Schematic representation of the chromosome 9p21 ALS-FTLD locus.
  • Upper panel grey bars indicate the minimal candidate regions in all reported significantly linked ALS-FTLD families, defining a minimal interval of 3.7 Mb between D9S169 and D9S251 containing five protein coding genes, illustrated with grey lines.
  • Lower panel associated SNPs in ALS and FTLD GWAS are shown in red and LD blocks or finemapped regions of these GWAS are indicated with green lines. Three genes are located in the associated region.
  • Figure 5 the effect of the repeat expansion on gene expression was evaluated. qPCR analysis of random-primed and poly-A RNA of frontal cortex of two patients carrying the repeat expansion compared to frontal cortex RNA of control individuals demonstrated that in repeat expansion carriers, the C90RF72 transcript was about 50% reduced after normalization to 4 housekeeping genes.
  • FIG. 6 The DNA-sequence depicts the first 5460 base pairs of SEQ ID NO: 1 , in the figure the hexanucleotide repeat which is expanded in patients diagnosed for ALS, FTLD or ALS and FTLD or are susceptible for ALS, FTLD or ALS and FTLD corresponds to nucleotides 5299 to 5321 , i.e. 3 5 / 6 repeat units (depicted as bold underlined).
  • the first non-coding exon of the longer transcript NM_018325 is located from nucleotides 5362 to 5414 (depicted in UPPER CASE LETTERS).
  • the European EOD consortium was launched in August 201 1 to centralize and harmonize epidemiological, clinical, and biological data together with biomaterial of early-onset dementia patients throughout Europe to stimulate high-profile translational dementia research.
  • the European EOD consortium currently holds 40 partnering dementia research groups from 16 EU-countries.
  • the European EOD consortium is coordinated by Christine Van Broeckhoven, Neurodegenerative Brain Diseases group, Department of Molecular Genetics, VIB, Antwerp, Belgium.
  • the European EOD consortium member countries are indicated with an asterisk.
  • Figure 8 Genotyping assays to characterize the C9orf72 region and G 4 C 2 repeat
  • the C9orf72 G 4 C 2 repeat (dark grey box) is located upstream of the first exon, exon 1 a (white box), in the largest transcript and adjacent to a GC-rich low-complexity sequence (LCS; light grey box) with their nucleotide sequences shown above.
  • the primers with their corresponding PCR amplicons are shown for each of the PCR genotyping assays.
  • Figure 9 Distribution of normal repeat lengths in the Flanders-Belgian patients and control individuals. Histograms of G 4 C 2 repeat units sized ⁇ 60 repeats in Flanders-Belgian patients, excluding patients with mutations in known causal genes or with a pathological G 4 C 2 expansion, compared to control individuals.
  • Figure 10 Correlation of normal repeat lengths with rs2814707 alleles. Histograms of G 4 C 2 repeat units in 610 control individuals homozygous for the rs2814707 C-allele and 53 homozygous for the rs2814707 T-allele.
  • nucleic acid includes a combination of two or more nucleic acids, and the like.
  • amplification or “amplify” as used herein means one or more methods known in the art for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear.
  • a target nucleic acid may be either DNA or RNA.
  • PCR polymerase chain reaction
  • numerous other methods are known in the art for amplification of nucleic acids e.g., isothermal methods, rolling circle methods, etc). The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods. See, e.g. Saiki, "Amplification of Genomic DNA” in PCR Protocols, Innis et al, Eds., Academic Press, San Diego, CA 1990, pp.
  • allele and "allelic variant” are used interchangeably herein.
  • An allele is any one of a number of alternative forms or sequences of the same gene occupying a given locus or position on a chromosome. A single allele for each locus is inherited separately from each parent, resulting in two alleles for each gene. An individual having two copies of the same allele of a particular gene is homozygous at that locus, whereas an individual having two different alleles of a particular gene is heterozygous.
  • complement means the complementary sequence to a nucleic acid according to standard Watson/Crick base pairing rules.
  • a complement sequence can also be a sequence of RNA complementary to the DNA sequence or its complement sequence, and can also be a cDNA.
  • substantially complementary means that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences comprise a contiguous sequence of bases that do not hybridize to a target or marker sequence, positioned 3 ' or 5' to a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target or marker sequence.
  • diagnosis means determining a disease state or condition in a patient in such a way as to inform a health care provider as to the necessity or suitability of a treatment for the patient.
  • genomic DNA refers to some or the entire DNA from the nucleus of a cell. Genomic DNA may be intact or fragmented. In some embodiments, genomic DNA may include sequence from all or a portion of a single gene or from multiple genes, sequence from one or more chromosomes, or sequence from all chromosomes of a cell. In contrast, the term “total genomic nucleic acid” is used herein to refer to the full complement of DNA contained in the genome of a cell. As is well known, genomic nucleic acid includes gene coding regions, introns, 5' and 3' untranslated regions, 5' and 3' flanking DNA and structural segments such as telomeric and centromeric DNA, replication origins, and intergenic DNA. Genomic nucleic acid may be obtained from the nucleus of a cell, or recombinantly produced. Amplification techniques may also be used.
  • nucleic acid refers broadly to segments of a chromosome, segments or portions of DNA, cDNA, and/or RNA. Nucleic acid may be derived or obtained from an originally isolated nucleic acid sample from any source e.g. isolated from, purified from, amplified from, cloned from, or reverse transcribed from sample DNA or RNA.
  • oligonucleotide refers to a short polymer composed of deoxyribonucleotides, ribonucleotides or any combination thereof. Oligonucleotides are generally between about 10 and about 100 nucleotides in length. Oligonucleotides are preferably 15 to 70 nucleotides long, with 20 to 26 nucleotides being the most common. The single letter code for nucleotides is as described in the U.S. Patent Office Manual of Patent Examining Procedure, section 2422, table 1 . An oligonucleotide may be used as a primer or as a probe.
  • An oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity with a portion of the nucleic acid when the oligonucleotide and the nucleic acid are aligned.
  • An oligonucleotide that is specific for a nucleic acid is one that, under the appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and more preferably at least 98% sequence identity.
  • a "primer” for amplification is an oligonucleotide that specifically anneals to a target or marker nucleotide sequence.
  • the 3' nucleotide of the primer should be identical to the target or marker sequence at a corresponding nucleotide position for optimal primer extension by a polymerase.
  • a "forward primer” is a primer that anneals to the anti-sense strand of dsDNA.
  • a “reverse primer” anneals to the sense-strand of dsDNA.
  • promoter refers to a nucleic acid sequence sufficient to direct transcription of a gene. Also included in the invention are those promoter elements which are sufficient to render promoter dependent gene expression controllable for cell type specific, tissue specific or inducible by external signals or agents.
  • neuronal promoter refers to a promoter that results in a higher level of transcription of a gene in cells of neuronal lineage compared to the transcription level observed in cells of a non-neuronal lineage. Diagnostic Methods of the present invention
  • the present inventors identified that the presence of a hexanucleotide expansion (5'- GGCCCC-3') in SEQ ID NO: 1 , particularly in the promoter region of SEQ ID NO: 1 , more particularly in exon 1A, shows a strong association with ALS and/or FTLD disease risk.
  • a hexanucleotide expansion (5'- GGCCCC-3') in SEQ ID NO: 1 , particularly in the promoter region of SEQ ID NO: 1 , more particularly in exon 1A, shows a strong association with ALS and/or FTLD disease risk.
  • the nucleic acid segment of interest includes a hexanucleotide expansion (5'-GGCCCC-3') in the gene SEQ ID NO: 1 .
  • SEQ ID NO: 1 is the genomic sequence of ORF (open reading frame 72) present on human chromosome 9 (in short C90RF72). The complete nucleotide sequence of SEQ ID NO: 1 is depicted below. This information may be used to determine if an individual is suffering from or is susceptible to ALS and/or FTLD.
  • the wording 'ALS and/or FTLD' means that in one embodiment a patient having a hexanucleotide expansion in SEQ ID NO: 1 has ALS or is susceptible to ALS, in another embodiment a patient having said hexanucleotide expansion in SEQ ID NO: 1 has FTLD or is susceptible to FTLD.
  • a patient having said hexanucleotide expansion in SEQ ID NO: 1 has combined disease hallmarks of FTLD and ALS.
  • the information may also be used in genetic counseling to determine if the individual could have offspring with an increased risk of ALS and/or FTLD.
  • SEQ ID NO: 1 depicts the genomic sequence of C90RF72, preceded by 5000 bp upstream and followed by 2000 bp downstream regulatory sequence. In other words SEQ ID NO: 1 codes for the gene C90RF72.
  • C90RF72 is a gene with hitherto unknown function.
  • the sequence SEQ ID NO: 1 corresponds to the reverse complement of the region spanning nucleotides 27532544 to 27568842 in the human reference genome sequence version GRCh37; in GenBank the sequence is referred to as Accession NT_008413.
  • Figure 6 depicts the first 5460 base pairs of SEQ ID NO: 1
  • the hexanucleotide repeat which is expanded in patients corresponds to nucleotides 5299 to 5321 , i.e. 3 5 / 6 repeat units (depicted as bold underlined).
  • the first non-coding exon of the longer transcript NM_018325 is located from nucleotides 5362 to 5414 (depicted in UPPER CASE LETTERS).
  • the hexanucleotide repeat in SEQ ID NO: 1 is a repeat of the sequence 5'-GGGGCC-3'. Because SEQ ID NO: 1 is depicted in the complement with respect to the orientation of human chromosome 9 the diagnostic method can be described as a detection of a 5'-GGCCCC-3' repeat expansion wherein said repeat expansion is measured with respect to the orientation of the chromosome (human Chromosome 9). In the alternative the diagnostic method can be described as a detection of a 5'-GGGGCC-3' repeat expansion wherein said repeat expansion is measured with respect to the orientation of the C90RF72 gene on Chromosome 9 (in particular since the orientation of the C90RF72 gene on Chromosome 9 is reversed).
  • the invention provides a method for diagnosing ALS or FTLD or the combined presence of ALS and FTLD or a method for diagnosing the susceptibility to ALS or FTLD or the combined presence of ALS and FTLD comprising detecting the presence of a hexanucleotide repeat expansion of 5'-GGGGCC-3' in SEQ ID NO: 1 in a sample comprising nucleic acids from a subject, and diagnosing the subject as having or being susceptible to ALS or FTLD or the combined presence of ALS and FTLD when said hexanucleotide repeat expansion is present in SEQ ID NO: 1.
  • the invention provides a method for diagnosing ALS or FTLD or the combined presence of ALS and FTLD or a method for diagnosing the susceptibility to ALS or FTLD or the combined presence of ALS and FTLD comprising detecting the presence of a hexanucleotide repeat expansion of 5'-GGGGCC-3' of more than 60 repeats in SEQ ID NO: 1 in a sample comprising nucleic acids from a subject, and diagnosing the subject as having or being susceptible to ALS or FTLD or the combined presence of ALS and FTLD when said hexanucleotide repeat expansion is present in SEQ ID NO: 1 .
  • the invention provides a method for diagnosing ALS or FTLD or the combined presence of ALS and FTLD or a method for diagnosing the susceptibility to ALS or FTLD or the combined presence of ALS and FTLD comprising detecting the presence of a hexanucleotide repeat expansion of 5'-GGGGCC-3' of more than 80 repeats in SEQ ID NO: 1 in a sample comprising nucleic acids from a subject, and diagnosing the subject as having or being susceptible to ALS or FTLD or the combined presence of ALS and FTLD when said hexanucleotide repeat expansion is present in SEQ ID NO: 1 .
  • the diagnostic method is based on a PCR method.
  • the diagnostic method is based on a repeat primer-based PCR detection assay.
  • the present invention also provides variant nucleic acids derived from C90RF72 associated with ALS and/or FTLD.
  • the detection of a hexanucleotide expansion (5'-GGGGCC-3') present in SEQ ID NO: 1 has a strong association with ALS and/or FTLD risk.
  • said hexanucleotide expansion is between 25 and 200 repeats.
  • said hexanucleotide expansion is between 25 and 50 repeats.
  • said hexanucleotide expansion is between 30 and 200 repeats.
  • said hexanucleotide expansion is between 30 and 50 repeats.
  • said hexanucleotide expansion is between 40 and 200 repeats. In yet another embodiment said hexanucleotide expansion is between 50 and 200 repeats. In yet another embodiment said hexanucleotide expansion is between 60 and 200 repeats. In yet another embodiment said hexanucleotide expansion is between 70 and 200 repeats. In yet another embodiment said hexanucleotide expansion is between 80 and 200 repeats. In yet another embodiment said hexanucleotide expansion is between 90 and 200 repeats. In yet another embodiment said hexanucleotide expansion is between 100 and 200 repeats. In yet another embodiment said hexanucleotide expansion is higher than 25 repeats.
  • said hexanucleotide expansion is higher than 30 repeats. In yet another embodiment said hexanucleotide expansion is higher than 35 repeats. In yet another embodiment said hexanucleotide expansion is higher than 40 repeats. In yet another embodiment said hexanucleotide expansion is between 80 and 140 repeats. In yet another embodiment said hexanucleotide expansion is between 30 and 80 repeats. In yet another embodiment said hexanucleotide expansion in SEQ ID NO: 1 is longer than 1000 base pairs. In yet another embodiment said hexanucleotide expansion is longer than 5000 base pairs. In yet another embodiment said hexanucleotide expansion is longer than 10.000 base pairs.
  • said hexanucleotide expansion is between 5000 and 10.000 base pairs.
  • the number of repeats reflects the onset of the disease of ALS and/or FTLD, id est the higher the number of hexanucleotide repeats are identified in SEQ ID NO: 1 the earlier the onset of ALS and/or FTLD can occur in a patient (i.e. the presence of a higher expansion of the hexanucleotide sequence results in a younger disease onset of ALS and/or FTLD).
  • nucleic acid molecules may be double- stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand.
  • reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule.
  • Probes and primers may be designed to hybridize to either strand and variant genotyping methods disclosed herein may generally target either strand.
  • identifying a variants position reference is generally made to the protein-encoding strand, only for the purpose of convenience.
  • variant peptides, polypeptides, or proteins of the present invention include peptides, polypeptides, proteins, or fragments thereof, that contain at least one nucleotide or amino acid residue that differs from the corresponding nucleotide or amino acid sequence of the art-known nucleotide/protein (the art-known protein may be interchangeably referred to as the "wild-type", "reference", or "normal” protein).
  • Such variant proteins can result from a codon change caused by a non-synonymous nucleotide substitution at a protein-coding SNP position (i.e., a missense mutation) disclosed by the present invention.
  • Variant proteins can also result from a nonsense mutation, i.e., a SNP that creates a premature stop codon, a SNP that generates a read-through mutation by abolishing a stop codon, or a SNP that otherwise alters the structure, function/activity, or expression of a protein, such as a SNP in a regulatory region (e.g., a promoter or enhancer) or a SNP that leads to alternative or defective splicing, such as a SNP in an intron or a SNP at an exon/intron boundary.
  • a nonsense mutation i.e., a SNP that creates a premature stop codon, a SNP that generates a read-through mutation by abolishing a stop codon, or a SNP that otherwise alters the structure, function/activity, or expression of a protein, such as a SNP in a regulatory region (e.g., a promoter or enhancer) or a SNP that leads to alternative or defective splic
  • the methods and compositions described herein may be used to detect mutations in the gene depicted in SEQ ID NO: 1 , more particularly in Exon 1A present in SEQ ID NO: 1 , more particularly in the promoter region of C90RF72 using a biological sample obtained from an individual.
  • Nucleic acid DNA or RNA
  • Examples include tissue samples or any cell- containing bodily fluid.
  • Biological samples may be obtained by standard procedures and may be used immediately or stored, under conditions appropriate for the type of biological sample, for later use.
  • test samples are well known to those of skill in the art and include, but are not limited to, aspirations, tissue sections, drawing of blood or other fluids, surgical or needle biopsies, and the like.
  • the test sample may be obtained from a patient.
  • the test sample may contain cells, tissues or fluid obtained from a patient suspected being afflicted with or a carrier for an allele associated with increased susceptibility to ALS and/or FTLD.
  • the test sample may be a cell-containing liquid or a tissue.
  • Samples may include, but are not limited to, amniotic fluid, cerebrospinal fluid, biopsies, blood, blood cells, bone marrow, fine needle biopsy samples, peritoneal fluid, amniotic fluid, plasma, pleural fluid, saliva, semen, serum, tissue or tissue homogenates, frozen or paraffin sections of tissue. Samples may also be processed, such as sectioning of tissues, fractionation, purification, or cellular organelle separation.
  • Fetal cells can be obtained through the pregnant female, or from a sample of an embryo. Fetal cells are present in amniotic fluid obtained by amniocentesis, chorionic villi aspirated by syringe, percutaneous umbilical blood, a fetal skin biopsy, a blastomere from a four-cell to eight-cell stage embryo (pre- implantation), or a trophectoderm sample from a blastocyst (pre -implantation or by uterine lavage).
  • the mutation detection can be carried out on the basis of free-floating DNA which is genomic DNA derived from the fetus and which is present in the blood of a pregnant female.
  • the sample may be collected or concentrated by centrifugation and the like.
  • the cells of the sample may be subjected to lysis, such as by treatments with enzymes, heat, surfactants, ultrasonication, or a combination thereof.
  • the lysis treatment is performed in order to obtain a sufficient amount of nucleic acid derived from the individual's cells to detect using polymerase chain reaction.
  • variants in the C90RF72 gene may be detected using an acellular bodily fluid.
  • Plasma and serum preparation are well known in the art. Either "fresh" blood plasma or serum, or frozen (stored) and subsequently thawed plasma or serum may be used. Frozen (stored) plasma or serum should optimally be maintained at storage conditions of -20 to -70°C until thawed and used. "Fresh” plasma or serum should be refrigerated or maintained on ice until used, with nucleic acid (e.g., RNA, DNA or total nucleic acid) extraction being performed as soon as possible. Exemplary methods are described below.
  • nucleic acid e.g., RNA, DNA or total nucleic acid
  • Blood can be drawn by standard methods into a collection tube, typically siliconized glass, either without anticoagulant for preparation of serum, or with EDTA, sodium citrate, heparin, or similar anticoagulants for preparation of plasma.
  • a collection tube typically siliconized glass
  • EDTA sodium citrate
  • heparin or similar anticoagulants for preparation of plasma.
  • plasma or serum is first fractionated from whole blood prior to being frozen. This reduces the burden of extraneous intracellular RNA released from lysis of frozen and thawed cells which might reduce the sensitivity of the amplification assay or interfere with the amplification assay through release of inhibitors to PCR such as porphyrins and hematin.
  • Frsh plasma or serum may be fractionated from whole blood by centrifugation, using gentle centrifugation at 300-800 times gravity for five to ten minutes, or fractionated by other standard methods. High centrifugation rates capable of fractionating out apoptotic bodies should be avoided. Since heparin may interfere with RT- PCR, use of heparinized blood may require pretreatment with heparanase, followed by removal of calcium prior to reverse transcription. Imai, H., et al., J. Virol. Methods 36:181 -184, (1992). Thus, EDTA is a suitable anticoagulant for blood specimens in which PCR amplification is planned.
  • the nucleic acid to be amplified may be from a biological sample such as a patient, cell culture, tissue sample, and the like.
  • the biological sample can be from a subject which includes any animal, preferably a mammal.
  • a preferred subject is a human, which may be a patient presenting to a medical provider for diagnosis or treatment of a disease.
  • the biological sample may be obtained from a stage of life such as a fetus, young adult, adult, and the like.
  • Subjects may be humans being tested for the existence of a hexanucleotide expansion in SEQ ID NO: 1.
  • the volume of plasma or serum used in the extraction may be varied dependent upon clinical intent, but volumes of 100 ⁇ to one milliliter of plasma or serum are usually sufficient.
  • Various methods of extraction are suitable for isolating the DNA or RNA. Suitable methods include phenol and chloroform extraction. See Maniatis et al, Molecular Cloning, A Laboratory Manual, 2d, Cold Spring Harbor Laboratory Press, page 16.54 (1989). Numerous commercial kits also yield suitable DNA and RNA including, but not limited to, QIAampTM mini blood kit, Agencourt GenfindTM, Roche Cobas® Roche MagNA Pure® or phenol: chloroform extraction using Eppendorf Phase Lock Gels®, and the NucliSens extraction kit (Biomerieux, Marcy I'Etoile, France).
  • mRNA may be extracted from patient blood/bone marrow samples using MagNA Pure LC mRNA HS kit and Mag NA Pure LC Instrument (Roche Diagnostics Corporation, Roche Applied Science, Indianapolis, IN). Nucleic acid extracted from tissues, cells, plasma or serum can be amplified using nucleic acid amplification techniques well known in the art. Many of these amplification methods can also be used to detect the presence of the hexanucleotide expansion (id est the mutations in C90RF72) simply by designing oligonucleotide primers or probes to interact with or hybridize to a particular target sequence in a specific manner.
  • these techniques can include the polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), nested PCR, ligase chain reaction.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase polymerase chain reaction
  • nested PCR ligase chain reaction.
  • Urdea M. S., et al, AIDS, 7 (suppl 2):S1 1 -S 14, (1993)
  • amplifiable RNA reporters Q-beta replication, transcription-based amplification, boomerang DNA amplification, strand displacement activation, cycling probe technology, isothermal nucleic acid sequence based amplification (NASBA).
  • NASBA isothermal nucleic acid sequence based amplification
  • long template PCR can be used for the detection of the hexanucleotide repeat of the invention.
  • sequencing e.g. Sanger sequencing or other
  • classical sequencing or bisulfite sequencing in which the template DNA is first chemically modified using bisulfite converting unmethylated C nucleotides into T, can be used to detect the hexanucleotide repeat of the invention.
  • the length of the amplification primers depends on several factors including the nucleotide sequence identity and the temperature at which these nucleic acids are hybridized or used during in vitro nucleic acid amplification.
  • the considerations necessary to determine a preferred length for an amplification primer of a particular sequence identity are well-known to a person of ordinary skill.
  • the length of a short nucleic acid or oligonucleotide can relate to its hybridization specificity or selectivity.
  • oligonucleotides specific for alternative alleles Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as “allele-specific probes", or “allele-specific primers”.
  • allele-specific probes or “allele-specific primers”.
  • the design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al, Nature, 324: 163-166 (1986);
  • a probe or primer may be designed to hybridize to a segment of target DNA such that the herein identified hexanucleotide repeat sequence aligns with either the 5' most end or the 3' most end of the probe or primer.
  • the amplification may include a labeled primer, thereby allowing detection of the amplification product of that primer.
  • the amplification may include a multiplicity of labeled primers; typically, such primers are distinguishably labeled, allowing the simultaneous detection of multiple amplification products.
  • the primer or probe is labeled with a fluorogenic reporter dye that emits a detectable signal.
  • a fluorogenic reporter dye is a fluorescent dye
  • any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the invention.
  • Such dyes include, but are not limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2, Cy3, Cy5, Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam, Tet, Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and Texas Red.
  • the detection reagent may be further labeled with a quencher dye such as Tamra, especially when the reagent is used as a self-quenching probe such as a TaqMan® (U.S. Pat. Nos. 5,210,015 and 5,538,848) or Molecular Beacon probe (U.S. Pat. Nos. 5,1 18,801 and 5,312,728), or other stemless or linear beacon probe (Livak et al, 1995, PCR Method Appl, 4:357-362; Tyagi et al, 1996, Nature Biotechnology, 14:303- 308; Nazarenko et al, 1997, Nucl. Acids Res., 25:2516-2521.
  • a quencher dye such as Tamra
  • a self-quenching probe such as a TaqMan® (U.S. Pat. Nos. 5,210,015 and 5,538,848) or Molecular Beacon probe (U.S. Pat. Nos. 5,1 18,801 and 5,31
  • the target sequence comprising the hexanucleotide repeat of the invention is amplified and the resulting amplicon is detected by electrophoresis.
  • the specific mutation or variant is detected by sequencing the amplified nucleic acid.
  • the target sequence is amplified using a labeled primer such that the resulting amplicon is detectably labeled.
  • the primer is fluorescently labeled.
  • detection of a variant nucleic acid, such as the hexanucleotide repeat of the invention is performed using the TaqMan® assay, which is also known as the 5' nuclease assay (see U.S. Pat. Nos.
  • the TaqMan® assay detects the accumulation of a specific amplified product during PCR.
  • the TaqMan® assay utilizes an oligonucleotide probe labeled with a fluorescent reporter dye and a quencher dye.
  • the reporter dye is excited by irradiation at an appropriate wavelength, it transfers energy to the quencher dye in the same probe via a process called fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • the excited reporter dye does not emit a signal.
  • the proximity of the quencher dye to the reporter dye in the intact probe maintains a reduced fluorescence for the reporter.
  • the reporter dye and quencher dye may be at the 5' most and the 3' most ends, respectively or vice versa.
  • the reporter dye may be at the 5 ' or 3' most end while the quencher dye is attached to an internal nucleotide, or vice versa.
  • both the reporter and the quencher may be attached to internal nucleotides at a distance from each other such that fluorescence of the reporter is reduced.
  • the 5' nuclease activity of DNA polymerase cleaves the probe, thereby separating the reporter dye and the quencher dye and resulting in increased fluorescence of the reporter. Accumulation of PCR product is detected directly by monitoring the increase in fluorescence of the reporter dye.
  • the DNA polymerase cleaves the probe between the reporter dye and the quencher dye only if the probe hybridizes to the target hexanucleotide repeat expansion containing template which is amplified during PCR, and the probe is designed to hybridize to the target hexanucleotide repeat expansion site only if the particular hexanucleotide repeat expansion allele is present.
  • TaqMan® primer and probe sequences can readily be determined using the variant and associated nucleic acid sequence information provided herein. A number of computer programs, such as Primer Express (Applied Biosystems, Foster City, Calif), can be used to rapidly obtain optimal primer/probe sets.
  • primers and probes for detecting the variants of the present invention are useful in diagnostic assays for ALS and/or FTLD can be readily incorporated into a kit format.
  • the present invention also includes modifications of the TaqMan® assay well known in the art such as the use of Molecular Beacon probes (U.S. Pat. Nos. 5,1 18,801 and 5,312,728) and other variant formats (U.S. Pat. Nos. 5,866,336 and 6,1 17,635).
  • Oligonucleotide probes can be designed which are between about 10 and about 100 nucleotides in length and hybridize to the amplified region. Oligonucleotides probes are preferably 12 to 70 nucleotides; more preferably 15-60 nucleotides in length; and most preferably 15-25 nucleotides in length. The probe may be labeled. Amplified fragments may be detected using standard gel electrophoresis methods. For example, in preferred embodiments, amplified fractions are separated on an agarose gel and stained with ethidium bromide by methods known in the art to detect amplified fragments.
  • Assay controls may be used in the assay for detecting carriers and individuals afflicted with or susceptible to a ALS, FTLD or to ALS and FTLD. Positive controls for normal or wild type C90RF72 gene may be used.
  • kits for diagnosing ALS, FTLD, or ALS and FTLD or prognosing patients for having an increased risk of ALS, FTLD, or ALS and FTLD the kit comprising a set of reagents for determining the presence or absence, or differential presence, of the hexanucleotide repeat expansion.
  • Protein detection Gene C90RF72 or SEQ ID NO: 1 codes for at least two different splice forms, a shorter and a longer isoform wherein the shorter isoform is essentially a fragment of the longer isoforms. These two splice forms are depicted in SEQ ID NO: 2 and SEQ ID No: 3.
  • the gene C90RF72 has 2 major, validated transcripts, but more transcripts may exist.
  • the validated transcripts have GenBank Accession Numbers NM_018325 (the longer transcript, 3233 nucleotides) and NM_145005 (the shorter transcript, 1879 nucleotides).
  • the encoded proteins have GenPept Accession Numbers NP_060795 (the longer protein isoform, 481 amino acids, depicted in SEQ ID NO: 2) and NP_659442 (the shorter protein isoform, 222 amino acids, depicted in SEQ ID NO: 3).
  • protein C90RF72 refers to SEQ ID NO: 2 and SEQ ID NO: 3.
  • a level of protein C90RF72 expression is reduced due to the presence of the identified mutation in the promoter region of gene C90RF72 that results in little or no expression of C90RF72 RNA and little or no presence of the C90RF72 protein.
  • the presence of the identified mutations in only one C90RF72 allele can result in a level of wild-type C90RF72 polypeptide that is intermediate between the level of wild-type C90RF72 polypeptide typically observed when both C90RF72 alleles are wild-type and the level typically observed when both alleles contain the mutation.
  • reduced level as used herein with respect to a level of C90RF72 expression is any level of C90RF72 expression that is less than a median level of wild-type C90RF72 polypeptide or C90RF72 RNA expression in a random population of humans (e.g. a random population of 10, 20, 30, 40, 50, 100, 500, 1000 or more humans) having homozygous wild- type C90RF72 alleles.
  • a "reduced level" of C90RF72 expression can be any level of wild-type C90RF72 polypeptide or C90RF72 RNA expression that is less than a median level of wild-type C90RF72 polypeptide or RNA expression, respectively, in a random population of humans (e.g.
  • a reduced level of C90RF72 expression can be a level of wild-type C90RF72 expression that is at least one (e.g. at least 1 .0, 1 .2, 1 .4, 1 .6, 1 .8, 2.0, or 2.2) standard deviation less than a mean level of wild- type C90RF72 expression in a random population of humans (e.g. having homozygous wild- type C90RF72 alleles and/or not having been diagnosed with ALS and/or FTLD).
  • a reduced level of C90RF72 expression can be a level of wild-type C90RF72 expression that is less than a median level of wild-type C90RF72 expression in a random population of humans (e.g., a random population of 10, 20, 30, 40, 50, 100, 500, 1000 or more humans) that are age-matched and/or who are race-matched.
  • Humans that are age-matched can be the same age or can be in the same age range (e.g., 15 to 35 years of age, 35 to 75 years of age, 75 to 100 years of age, 35 to 45 years of age, 60 to 80 years of age, 20 to 35 years of age, or 40 to 50 years of age).
  • a reduced level of C90RF72 expression can be a level of wild-type C90RF72 expression that is less than a median level of wild-type C90RF72 expression in a random population of humans (e.g. a random population of 10, 20, 30, 40, 50, 100, 500, 1000 or more humans) having homozygous wild-type C90RF72 alleles that are age-matched and/or who are race-matched.
  • a reduced level of C90RF72 expression can be little or no detectable wild-type C90RF72 expression.
  • C90RF72 expression levels from comparable samples are used when determining whether or not a particular C90RF72 expression level is a reduced level. For example, a mRNA level of C90RF72 expression in a skin biopsy from a human is compared to the median mRNA level of C90RF72 expression in skin biopsies from a random population of humans (e.g. having homozygous wild-type C90RF72 alleles and/or not having been diagnosed with ALS and/or FTLD). In addition, C90RF72 expression levels are compared to a median C90RF72 expression level measured using the same or a comparable method. Any appropriate method can be used to determine a C90RF72 expression level.
  • Northern blotting RT-PCR, or quantitative PCR can be used to determine a level of RNA molecules encoding a wild-type C90RF72 polypeptide.
  • mass spectrometry can be used to determine a level of a wild-type C90RF72 polypeptide.
  • a level of C90RF72 polypeptide can be detected using a method that relies on an anti- C90RF72 polypeptide antibody. It is envisaged here that an antibody against SEQ ID NO: 2 will also have a specificity for SEQ ID NO: 3 because SEQ ID NO: 3 can be considered as a fragment of SEQ I D NO: 2.
  • Antibody based assays can include using combinations of antibodies that bind to one or more sites of the amino-terminal, central, and carboxy-terminal portions of a C90RF72 polypeptide or a fragment thereof.
  • An anti-C90RF72 polypeptide antibody can be labeled for detection.
  • an anti-C90RF72 polypeptide antibody can be labeled with a radioactive molecule, a fluorescent molecule, or a bioluminescent molecule.
  • C90RF72 polypeptides can also be detected indirectly using a labeled antibody that binds to an anti- C90RF72 polypeptide antibody that binds to a C90RF72 polypeptide.
  • An antibody can be, without limitation, a polyclonal, monoclonal, human, humanized, chimeric, or single-chain antibody, or an antibody fragment having binding activity, such as a Fab fragment, F(ab') fragment, Fd fragment, fragment produced by a Fab expression library, fragment comprising a VL or VH domain, or epitope binding fragment of any of the above.
  • An antibody can be of any type (e.g., IgG, IgM, IgD, IgA or IgY), class (e.g., IgGI, lgG4, or lgA2), or subclass.
  • an antibody is derived from camels
  • an antibody derived from camels is a variable heavy chain also designated as a nanobody®.
  • an antibody can be from any animal including birds and mammals.
  • an antibody can be a human, rabbit, sheep, camelid or goat antibody.
  • An antibody can be naturally occurring, recombinant, or synthetic. Antibodies can be generated and purified using any suitable methods known in the art.
  • monoclonal antibodies can be prepared using hybridoma, recombinant, or phage display technology, or a combination of such techniques.
  • antibody fragments can be produced synthetically or recombinantly from a gene encoding the partial antibody sequence.
  • An anti-C90RF72 polypeptide antibody can bind to a C90RF72 polypeptide at an affinity of at least 10 4 rmol "1 (e.g., at least 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , or 10 12 mol "1 ).
  • An anti-C90RF72 polypeptide antibody provided herein can be prepared using any appropriate method.
  • any substantially pure C90RF72 polypeptide, or fragment thereof can be used as an immunogen to elicit an immune response in an animal such that specific antibodies are produced.
  • a human C90RF72 polypeptide or a fragment thereof can be used as an immunizing antigen.
  • the immunogen used to immunize an animal can be chemically synthesized or derived from translated cDNA.
  • the immunogen can be conjugated to a carrier polypeptide, if desired.
  • Commonly used carriers that are chemically coupled to an immunizing polypeptide include, without limitation, keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid.
  • polyclonal antibodies The preparation of polyclonal antibodies is well- known to those skilled in the art. See, e.g., Green et al, Production of Polyclonal Antisera, in IMMUNOCHEMICAL PROTOCOLS (Manson, ed.), pages 1 -5 (Humana Press 1992) and Coligan et al, Production of Polyclonal Antisera in Rabbits, Rats, Mice and Hamsters, in CURRENT PROTOCOLS IN IMMUNOLOGY, section 2.4.1 (1992).
  • monoclonal antibodies can be obtained by injecting mice with a composition comprising an antigen, verifying the presence of antibody production by analyzing a serum sample, removing the spleen to obtain B lymphocytes, fusing the B lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
  • Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein A Sepharose, size exclusion chromatography, and ion exchange chromatography.
  • hybridoma clones that produce antibodies to an antigen of interest have been selected, further selection can be performed for clones that produce antibodies having a particular specificity.
  • the methods for diagnosis herein described before can also be used for the detection of somatic mutations in patients which are suspected to suffer from ALS and/or FTLD.
  • Such mutations (which are generally known as non-familial or non-hereditary or de novo mutations) can occur because of the expansion of the 5'-GGCCCC-3' repeat present in SEQ ID NO: 1 in several cells including neuronal cells.
  • cerebrospinal fluid (CSF) is used to identify the hexanucleotide expansion repeat of the invention. Identification can be based on DNA based methods, protein based detection or mRNA based detection of the lower expression of C90RF72 or the presence of the hexanucleotide repeat expansion in C90RF72.
  • kits that can be used to perform a method provided herein (e.g. to determine whether or not the promoter of the C90RF72 gene comprises the mutation of the invention).
  • kits can include nucleic acid molecules (e.g., primer pairs or probes), antibodies (e.g., anti-C90RF72 polypeptide antibodies), secondary antibodies, control nucleic acid molecules (e.g. C90RF72 nucleic acids that do or do not contain a mutation), control polypeptides (e.g. wild type or mutant C90RF72 polypeptides), DNA aptamers, microarrays, ELISA plates, or data analysis software optionally together with any other appropriate reagent, tool, or instruction for performing the methods described herein.
  • nucleic acid molecules e.g., primer pairs or probes
  • antibodies e.g., anti-C90RF72 polypeptide antibodies
  • secondary antibodies e.g., control nucleic acid molecules (e.g. C90RF72 nucleic acids that do or do not contain a mutation),
  • Appropriate informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein and/or the use of the reagents for the methods described herein.
  • the informational material can relate to performing a genetic analysis on a human and subsequently diagnosing the human as being at risk (or not) for ALS, FTLD or ALS and FTLD, and/or delivering a prognosis of the human relating to survival time, likelihood of responding to therapy, or quality of life.
  • the informational material of a kit can be contact information, e.g., a physical address, email address, website, or telephone number, where a user of the kit can obtain substantive information about performing a genetic analysis and interpreting the results, particularly as they apply to a human's likelihood of developing dementia and a subsequent prognosis.
  • the informational material of the kits can be in any form.
  • the informational material, e.g. instructions can be provided in printed matter, e.g. a printed text, drawing, and/or photograph, e.g., a label or printed sheet.
  • Informational material can be provided in other formats, such as Braille, computer readable material, video recording, or audio recording.
  • the kit can include one or more containers for the reagents for performing a genetic analysis, such as reagents for performing PCR, FISH, CGH, or any other method described herein.
  • the kit can contain separate containers, dividers, or compartments for the reagents and informational material.
  • a container can be labeled for use for the diagnosis and/or prognosis of a human relating to the development and treatment of dementia.
  • This document also provides methods and materials to assist medical or research professionals in determining whether or not a mammal has a hexanucleotide repeat expansion in the C90RF72 nucleic acid.
  • Medical professionals can be, for example, doctors, nurses, medical laboratory technologists, and pharmacists.
  • Research professionals can be, for example, principle investigators, research technicians, postdoctoral trainees, and graduate students.
  • a professional can be assisted by (1 ) determining the presence or absence of a mutation (id est the hexanucleotide repeat expansion of the invention) in a C90RF72 nucleic acid in a sample, and (2) communicating information about the presence or absence of that mutation to that professional. Any appropriate method can be used to communicate information to another person (e.g., a professional).
  • information can be given directly or indirectly to a professional.
  • any type of communication can be used to communicate the information.
  • mail, e-mail, telephone, and face-to-face interactions can be used.
  • the information also can be communicated to a professional by making that information electronically available to the professional.
  • the information can be communicated to a professional by placing the information on a computer database such that the professional can access the information.
  • the information can be communicated to a hospital, clinic, or research facility serving as an agent for the professional.
  • Still another aspect of the invention is the use of a mutation according to the invention in the construction of a non-human transgenic animal. Indeed, introduction of a mutation according to the invention in a model organism such as a mouse would lead to an reduction of SEQ ID NO: 2 and SEQ ID NO: 3 production and development of an ALS disease like phenotype or in the development of an FTLD disease like phenotype or the development of a combined ALS disease like and FTLD disease like phenotype. Methods to make mutant SEQ ID NO: 1 based transgenic animals have been described, amongst others, in GB2380196 and in WO9640895. Such model organism could be used for screening compounds and testing medication useful for treatment of ALS and/or FTLD.
  • a knock-out transgenic animal can be constructed having a loss of C90RF72.
  • a knock-out animal is made being hemizygous for a loss of function of C9QRF72. Examples
  • Table 1 Genetic, clinical and pathological characteristics of ALS-FTLD families linked or associated with chromosome 9p21 (ND: not determined; 1 summed LODscore in 6 small families, not linked separately)
  • the minimal candidate region was previously defined by D9S169 (Luty et al., 2008) and D9S1805 (Valdmanis et al., 2007) spanning 7 Mb and was recently reduced to 3.6 Mb between D9S169 (Luty et al., 2008) and D9S251 by Boxer and colleagues (2010) (figure 4). 2. Identification of a hexanucleotide repeat expansion in C9QRF72
  • the most 5' part of the low-complexity region was composed of 3 5/6 units of hexanucleotide repeat sequence GGGGCC. Therefore, the possibility of a hexanucleotide repeat expansion as the cause of chromosome 9p-linked ALS/FTD was explored using a repeat primer-based PCR detection assay.
  • the repeat was expanded from less than 30 repeat units in more than 800 control individuals of the Flanders region in Belgium to more than 80 repeat units, being the upper detection limit of the assay. The size range of the repeat did not show overlap between patients and controls.
  • CORF72 is highly conserved in vertebrates. In worms (e.g. c. elegans), the corresponding gene exists of the C-terminal half only, while it is completely absent in insects (e.g. drosophila). It is an orphan gene with unknown function. Based on functions of genes with similar expression patterns in human and mouse, a function in protein ubiquitination for proteasomal degradation and/or a function in RNA processing are predicted.
  • Table 2 The frequency of the repeat expansion in familial patients was 44% in ALS, 71 % in ALS/FTLD and 10% in FTLD patients
  • a fluorescently labeled forward primer F is used in combination with repeat-anchor primer R1 .
  • the R1 primer anneals at random positions in the repeat sequence of the genomic template.
  • these fragments are further amplified using forward primer F in combination with anchor primer R2.
  • Amplification products are separated on an Applied Biosystems ABI 3730 and analyzed. For each repeat unit present in the genomic template DNA, a differently sized PCR amplification fragment is observed. Expanded repeats are characterized by a high number of different fragments. See Figure 1 .
  • R1 5'-CGTACGCATCCCAGTTTGAGAGGGGCCGGGGCCGGGGCCGGGGC-3'
  • R2 5'-CGTACGCATCCCAGTTTGAGA-3'
  • EOD European Early- Onset Dementia
  • Table 3 The European EOD consortium brings together epidemiological, clinical and biological data with biomaterials of EOD patients throughout Europe to stimulate high-profile translational dementia research.
  • clinical presentation showed indications of FTLD or ALS together with symptomatology of other neurodegenerative brain diseases such as Alzheimer or Parkinson disease.
  • Table 3 European cohort - Patients per country overall and per clinical subgroup
  • G 4 C 2 repeat lengths were determined by repeat-primed PCR (forward RP-PCR, figure 8) followed by fluorescent fragment length analysis. This assay is able to discriminate between the presence (minimal 60 repeat units) and absence (maximal 25 repeat units) of a pathological G 4 C 2 expansion.
  • a pathological G 4 C 2 expansion was observed in 8.81 % (87/988) of the European cohort (Table 5).
  • All pathological G 4 C 2 expansion carriers in the European cohort carried at least one T-allele of the single-nucleotide-polymorphism (SNP) rs2814707, the top SNP in the ALS genome-wide association studies and tagging the chromosome 9p21 risk haplotype (Laaksovirta et al (2010); Van Es MA et al (2009)).
  • SNP single-nucleotide-polymorphism
  • the C9orf72 G 4 C 2 repeat is contiguous with a GC-rich, low complexity sequence (LCS), located upstream of exon 1 a of the longest C9orf72 isoform ( Figure 8).
  • LCS GC-rich, low complexity sequence
  • Figure 8 We successfully sequenced the GC-rich LCS in 432 patients of the Flanders- Belgian cohort and in 752 matched control individuals by repeat-primed PCR sequencing (RP- PCR for sequencing, figure 8).
  • FTLD-ALS 1 del CGGGCCCGCCCCGACCACGCCCC 27563504-27563526
  • nucleotide sequence ACCAC is most frequently deleted in the LCS adjacent to the G4C2 repeat in C9or ⁇ 72 (indicated in bold) ⁇ 2> genomic location is based on NCBIbuild37 - hg19
  • the LCS adjacent to the G 4 C 2 repeat is comprised in the PCR fragments produced by the forward RP-PCR assay that we used to identify pathological G 4 C 2 expansion carriers (Figure 8).
  • a reverse RP-PCR assay on the sense strand that eliminates the LCS from the PCR amplicon (reverse RP-PCR, Figure 8). This RP-PCR assay confirmed the presence of the pathological G 4 C 2 expansion in patients of the Flanders-Belgian as well as the European cohort.
  • STR-PCR reverse RP-PCR assay
  • Figure 8 a STR genotyping assay optimized for high GC-content, to size the normal alleles in non-carriers and the wild-type allele in carriers of a G 4 C 2 expansion mutation.
  • OR odds ratio
  • 95% CI 95% confidence interval. ORs were calculated for all patients, and after exclusion of patients and control individuals carrying two C9orf72 intermediate repeat alleles. Patients with a known mutation in an FTLD or ALS gene (including pathological C9orf72 G 4 C 2 expansion carriers) were excluded from all association analyses, p-values were calculated using logistic regression analysis and were corrected for age and gender.
  • the European cohort was collected after an initial call for participation in a Pan-European study of the frequency across Europe of the C9orf72 G 4 C 2 expansion mutation from within the European Early-Onset Dementia (EOD) consortium (Table 3).
  • EOD European Early-Onset Dementia
  • Table 3 describes the number of patients per country and per clinical subgroup contributed by European EOD consortium members to the European cohort.
  • the 1060 patients also included 26 patients from Wallonia, the French speaking part of Belgium, and 13 patients from different European countries that were referred for clinical genetic testing of causal genes to the Diagnostic Service Facility in our Department of Molecular Genetics, DMG DSF). Patients had been diagnosed according to established clinical diagnostic criteria i.e.
  • Flanders-Belgian FTLD patients were recruited through the Belgian Neurology (BELNEU) Consortium, a collaboration with neurologists affiliated to 9 different specialized memory clinics and neurology departments in Belgium. Index patients were evaluated using a standard clinical diagnostic protocol, including detailed recording of clinical and family history, neurological examination, neuropsychological testing, biochemical analyses and neuroimaging.
  • the ALS patients were recruited through the neuromuscular reference centers of the Antwerp University Hospital and the University Hospitals Leuven Gasthuisberg. Additional patients were included who had initially been referred to the DMG DSF for clinical genetic testing.
  • forward RP-PCR reverse repeat-primed PCR
  • reverse RP-PCR reverse repeat-primed PCR assay
  • F1 locus-specific fluorescently labeled reverse primer
  • F2 5'-CGTACGCATCCCAGTTTGAGA-3'
  • F2 5'-CGTACGCATCCCAGTTTGAGA-3'
  • KAPA HiFi HotStart DNA Polymerase with dNTPs kit Karl Biosystems
  • KAPA HiFi GC buffer 1 M betaine
  • 50ng genomic DNA 50ng genomic DNA
  • PCR cycling profile was as follows: denaturation at 95°C for 5 minutes, 33 cycles at 98°C for 20 seconds, 59°C for 15 seconds, and 72°C for 1 minute; and a final extension at 72°C for 5 minutes.
  • PCR products were size separated and analyzed on an ABI 3730 automated sequencer (Applied Biosystems) with GENESCAN LIZ600 as a size standard (Applied Biosystems) and genotypes were assigned using an in- house developed Tracl genotyping software (http://www.vibgeneticservicefacility.be).
  • Primers were designed for all 1 1 exons and exon-intron boundaries and 5'UTR of both major isoforms of C9orf72 using Primer 3 (Rosen S. et al (2000)). Standard PCRs on 20ng genomic DNA amplified exons and exon-intron boundaries with optimized conditions. PCR amplicons were purified using ExoSAP-IT ® (USB Corporation, Cleveland, Ohio), sequenced in both directions using BigDye ® Terminator Cycle Sequencing kit v3.1 (Applied Biosystems) and analyzed on an ABI3730xl DNA Analyzer (Applied Biosystems). Sequences were analyzed using NovoSNP software (Weckx S et al (2005). Exons containing rare mutations were also PCR sequenced in genomic DNA of 400 control individuals using the same primers and conditions as for the mutation analysis.
  • DQ dosage quotient
  • TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis.
  • Chromosome 9p-linked families with frontotemporal dementia associated with motor neuron disease are associated with motor neuron disease. Neurology, 72, 19, 1669-1676
  • Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis. Nat Genet, 41 , 10, 1083-1087

Abstract

L'invention concerne la détection de mutations dans la région de promoteur du gène C9ORF72, en particulier une expansion hexanucléotidique, lesdites mutations provoquant une diminution significative de l'expression du gène C9ORF72. La diminution de l'expression du gène C9ORF72 est associée à la présence de sclérose latérale amyotrophique (SLA) ou de dégénérescence lobaire frontotemporale (DLFT), et les mutations peuvent être utilisées dans le diagnostic de la SLA et/ou de la DLFT, ou dans la construction d'animaux transgéniques pour étudier la SLA et/ou la DLFT.
PCT/EP2012/068456 2011-09-20 2012-09-19 Procédés de diagnostic de la sclérose latérale amyotrophique et de la dégénérescence lobaire frontotemporale WO2013041577A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161626063P 2011-09-20 2011-09-20
US61/626,063 2011-09-20
US201261638353P 2012-04-25 2012-04-25
US61/638,353 2012-04-25

Publications (1)

Publication Number Publication Date
WO2013041577A1 true WO2013041577A1 (fr) 2013-03-28

Family

ID=46924420

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/068456 WO2013041577A1 (fr) 2011-09-20 2012-09-19 Procédés de diagnostic de la sclérose latérale amyotrophique et de la dégénérescence lobaire frontotemporale

Country Status (1)

Country Link
WO (1) WO2013041577A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014114922A1 (fr) * 2013-01-23 2014-07-31 Medical Research Council Méthodes d'estimation de la taille d'expansions de répétitions polynucléotidiques associées à une maladie dans des gènes
WO2015001113A1 (fr) * 2013-07-05 2015-01-08 Vib Vzw Procédés pour le diagnostic de maladies neurodégénératives cérébrales
WO2016038220A1 (fr) * 2014-09-12 2016-03-17 Illumina Cambridge Limited Détection d'expansions de répétitions à l'aide de données de séquençage de lecture courte
WO2016060919A1 (fr) * 2014-10-14 2016-04-21 The Board Of Regents Of The University Of Texas System Inhibition sélective d'allèle de l'expression de foci c9orf72 mutants par des arn duplexes ciblant la répétition étendue d'hexanucléotide
US9448232B2 (en) 2013-01-24 2016-09-20 Mayo Foundation For Medical Education And Research Methods and materials for detecting C9ORF72 hexanucleotide repeat expansion positive frontotemporal lobar degeneration or C9ORF72 hexanucleotide repeat expansion positive amyotrophic lateral sclerosis
WO2016196185A1 (fr) * 2015-05-29 2016-12-08 Regeneron Pharmaceuticals, Inc. Animaux non-humains comprenant une perturbation dans un locus c9orf72
KR20190057104A (ko) * 2016-09-30 2019-05-27 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 헥사뉴클레오티드 반복 확장을 갖는 비인간 동물
EP3469093A4 (fr) * 2016-06-10 2019-12-25 Saunders, Ann M. Procédés de détection de variants structurels dans une maladie neurodégénérative
US20200239883A1 (en) * 2013-10-14 2020-07-30 Ionis Pharmaceuticals, Inc. Compositions for Modulating Expression of C9ORF72 Antisense Transcript
WO2022082199A1 (fr) * 2020-10-16 2022-04-21 Pluripotent Diagnostics Corp. Procédé de détection de la sclérose latérale amyotrophique
US11690362B2 (en) 2018-12-20 2023-07-04 Regeneran Pharmaceuticals, Inc. Nuclease-mediated repeat expansion

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118801A (en) 1988-09-30 1992-06-02 The Public Health Research Institute Nucleic acid process containing improved molecular switch
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
WO1996040895A1 (fr) 1995-06-07 1996-12-19 Athena Neurosciences, Inc. Procede d'identification de therapies de la maladie d'alzheimer a l'aide de modeles animaux transgeniques
US5866336A (en) 1996-07-16 1999-02-02 Oncor, Inc. Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
US6117635A (en) 1996-07-16 2000-09-12 Intergen Company Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
GB2380196A (en) 2001-08-21 2003-04-02 Smithkline Beecham Plc Transgenic animals with mutant human amyloid precursor protein sequences
WO2008095261A1 (fr) * 2007-02-08 2008-08-14 Powmri Limited Procédé permettant de diagnostiquer une maladie neurodégénérative

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118801A (en) 1988-09-30 1992-06-02 The Public Health Research Institute Nucleic acid process containing improved molecular switch
US5312728A (en) 1988-09-30 1994-05-17 Public Health Research Institute Of The City Of New York, Inc. Assays and kits incorporating nucleic acid probes containing improved molecular switch
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
WO1996040895A1 (fr) 1995-06-07 1996-12-19 Athena Neurosciences, Inc. Procede d'identification de therapies de la maladie d'alzheimer a l'aide de modeles animaux transgeniques
US5866336A (en) 1996-07-16 1999-02-02 Oncor, Inc. Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
US6117635A (en) 1996-07-16 2000-09-12 Intergen Company Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
GB2380196A (en) 2001-08-21 2003-04-02 Smithkline Beecham Plc Transgenic animals with mutant human amyloid precursor protein sequences
WO2008095261A1 (fr) * 2007-02-08 2008-08-14 Powmri Limited Procédé permettant de diagnostiquer une maladie neurodégénérative

Non-Patent Citations (91)

* Cited by examiner, † Cited by third party
Title
"Animal Cell Culture", 1986
"Current Protocols in Molecular Biology", vol. I-III, 1997
"DNA Cloning: A Practical Approach", vol. I, 1985, GLOVER
"Gene Transfer Vectors for Mammalian Cells", 1987, COLD SPRING HARBOR LABORATORY
"Immobilized Cells and Enzymes", 1986, IRL PRESS
"methods in Enzymol.", vol. 154, 155
"Mutation Detection A Practical Approach", 1998, OXFORD UNIVERSITY PRESS
"Nucleic Acid Hybridization", 1985
"Oligonucleotide Synthesis", 1984
"Transcription and Translation", 1984
ABRAVAYA, K. ET AL., NUCLEIC ACIDS RESEARCH, vol. 23, 1995, pages 675 - 682
ALANE RENTON ET AL: "A Hexanucleotide Repeat Expansion inIs the Cause of Chromosome 9p21-Linked ALS-FTD", NEURON, CELL PRESS, US, vol. 72, no. 2, 21 September 2011 (2011-09-21), pages 257 - 268, XP028322561, ISSN: 0896-6273, [retrieved on 20110917], DOI: 10.1016/J.NEURON.2011.09.010 *
ARAI, T.; HASEGAWA, M.; AKIYAMA, H.; IKEDA, K.; NONAKA, T.; MORI, H.; MANN, D.; TSUCHIYA, K.; YOSHIDA, M.; HASHIZUME, Y.: "TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis", BIOCHEM BIOPHYS RES COMMUN, vol. 351, no. 3, 2006, pages 602 - 611, XP024925727, DOI: doi:10.1016/j.bbrc.2006.10.093
BAKER, M.; MACKENZIE, I.R.; PICKERING-BROWN, S.M.; GASS, J.; RADEMAKERS, R.; LINDHOLM, C.; SNOWDEN, J.; ADAMSON, J.; SADOVNICK, A.: "Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17", NATURE, vol. 442, no. 7105, 2006, pages 916 - 919, XP008101482, DOI: doi:10.1038/NATURE05016
BARNES ET AL.: "METHODS IN MOLECULAR BIOLOGY", vol. 10, 1992, HUMANA PRESS, article "Purification of Immunoglobulin G (IgG", pages: 79 - 104
BOXER, A.L.; MACKENZIE, I.R.; BOEVE, B.F.; BAKER, M.; SEELEY, W.W.; CROOK, R.; FELDMAN, H.; HSIUNG, G.Y.; RUTHERFORD, N.; LALUZ, V: "Clinical, neuroimaging and neuropathological features of a new chromosome 9p-linked FTD-ALS family", J NEUROL NEUROSURG PSYCHIATRY, 2010
BROOKS, B.R.; MILLER, R.G.; SWASH, M.; MUNSAT, T.L.: "EI Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis", AMYOTROPH LATERAL SCLER OTHER MOTOR NEURON DISORD, vol. 1, no. 5, 2000, pages 293 - 299
CHEAH B.C.: "Neurophysiological biomarkers in Amyotrophic Lateral Sclerosis", PHD THESIS, August 2011 (2011-08-01), XP007921297, Retrieved from the Internet <URL:unsworks.unsw.edu.au> [retrieved on 20121119] *
COLIGAN ET AL.: "CURRENT PROTOCOLS IN IMMUNOLOGY", 1992, article "Production of Polyclonal Antisera in Rabbits, Rats, Mice and Hamsters"
COLIGAN ET AL.: "CURRENT PROTOCOLS IN IMMUNOLOGY", 1994, WILEY INTERSCIENCE
COOPER, G.M.; ZERR, T.; KIDD, J.M.; EICHLER, E.E.; NICKERSON, D.A.: "Systematic assessment of copy number variant detection via genome-wide SNP genotyping", NAT GENET, vol. 40, no. 10, 2008, pages 1199 - 1203
CRUTS, M.; GIJSELINCK, I.; VAN DER ZEE, J.; ENGELBORGHS, S.; WILS, H.; PIRICI, D.; RADEMAKERS, R.; VANDENBERGHE, R.; DERMAUT, B.;: "Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21", NATURE, vol. 442, no. 7105, 2006, pages 920 - 924, XP008101481, DOI: doi:10.1038/NATURE05017
DRMANAC, R.; SPARKS, A.B.; CALLOW, M.J.; HALPERN, A.L.; BURNS, N.L.; KERMANI, B.G.; CARNEVALI, P.; NAZARENKO, I.; NILSEN, G.B.; YE: "Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays", SCIENCE, vol. 327, no. 5961, 2010, pages 78 - 81, XP055049204, DOI: doi:10.1126/science.1181498
GIJSELINCK, I.; ENGELBORGHS, S.; MAES, G.; CUIJT, I.; PEETERS, K.; MATTHEIJSSENS, M.; JORIS, G.; CRAS, P.; MARTIN, J.J.; DE DEYN,: "Identification of 2 Loci at chromosomes 9 and 14 in a multiplex family with frontotemporal lobar degeneration and amyotrophic lateral sclerosis", ARCH NEUROL, vol. 67, no. 5, 2010, pages 606 - 616
GITCHO, M.A.; BALOH, R.H.; CHAKRAVERTY, S.; MAYO, K.; NORTON, J.B.; LEVITCH, D.; HATANPAA, K.J.; WHITE, C.L.; BIGIO, E.H.; CASELLI: "TDP-43 A315T mutation in familial motor neuron disease", ANN NEUROL, vol. 63, no. 4, 2008, pages 535 - 538
GREEN ET AL.: "IMMUNOCHEMICAL PROTOCOLS", 1992, HUMANA PRESS, article "Production of Polyclonal Antisera", pages: 1 - 5
GREENWAY, M.J.; ANDERSEN, P.M.; RUSS, C.; ENNIS, S.; CASHMAN, S.; DONAGHY, C.; PATTERSON, V.; SWINGLER, R.; KIERAN, D.; PREHN, J.: "ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis", NAT GENET, vol. 38, no. 4, 2006, pages 411 - 413, XP008153956, DOI: doi:10.1038/ng1742
HAFNER ET AL., BIOTECHNIQUES, vol. 30, no. 4, 2001, pages 852 - 6,858,860
HARLOW ET AL.: "ANTIBODIES: A LABORATORY MANUAL", 1988, COLD SPRING HARBOR PUB., pages: 726
HUTTON, M.; LENDON, C.L.; RIZZU, P.; BAKER, M.; FROELICH, S.; HOULDEN, H.; PICKERING-BROWN, S.; CHAKRAVERTY, S.; ISAACS, A.; GROVE: "Association of missense and 5'- splice-site mutations in tau with the inherited dementia FTDP-17", NATURE, vol. 393, no. 6686, 1998, pages 702 - 705
ILSE GIJSELINCK ET AL: "A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort with disorders of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis spectrum: a gene identification study", THE LANCET NEUROLOGY, vol. 11, no. 1, 8 December 2011 (2011-12-08), pages 54 - 65, XP055044218, ISSN: 1474-4422, DOI: 10.1016/S1474-4422(11)70261-7 *
IMAI, H. ET AL., J. VIROL. METHODS, vol. 36, 1992, pages 181 - 184
JOHNSON, J.O.; MANDRIOLI, J.; BENATAR, M.; ABRAMZON, Y.; VAN DEERLIN, V.M.; TROJANOWSKI, J.Q.; GIBBS, J.R.; BRUNETTI, M.; GRONKA,: "Exome sequencing reveals VCP mutations as a cause of familial ALS", NEURON, vol. 68, no. 5, 2010, pages 857 - 864
KABASHI, E.; VALDMANIS, P.N.; DION, P.; SPIEGELMAN, D.; MCCONKEY, B.J.; VANDE, V.C.; BOUCHARD, J.P.; LACOMBLEZ, L.; POCHIGAEVA, K.: "TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis", NAT GENET, vol. 40, no. 5, 2008, pages 572 - 574
KIEVITS, T. ET AL., J VIROLOGICAL METHODS, vol. 35, 1991, pages 273 - 286
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495
KOVACS, G.G.; MURRELL, J.R.; HORVATH, S.; HARASZTI, L.; MAJTENYI, K.; MOLNAR, M.J.; BUDKA, H.; GHETTI, B.; SPINA, S.: "TARDBP variation associated with frontotemporal dementia, supranuclear gaze palsy, and chorea", MOV DISORD, vol. 24, no. 12, 2009, pages 1843 - 1847
KRUEGER, K.A.; TSUJI, S.; FUKUDA, Y.; TAKAHASHI, Y.; GOTO, J.; MITSUI, J.; ISHIURA, H.; DALTON, J.C.; MILLER, M.B.; DAY, J.W.: "SNP haplotype mapping in a small ALS family", PLOS ONE, vol. 4, no. 5, 2009, pages E5687
KUMPS C. ET AL.: "Multiplex Amplicon Quantification (MAQ), a fast and efficient method for the simultaneous detection of copy number alterations in neuroblastoma", BMC GENOMICS, vol. 11, 2010, pages 298, XP021072618, DOI: doi:10.1186/1471-2164-11-298
KWIATKOWSKI, T.J., JR.; BOSCO, D.A.; LECLERC, A.L.; TAMRAZIAN, E.; VANDERBURG, C.R.; RUSS, C.; DAVIS, A.; GILCHRIST, J.; KASARSKIS: "Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis", SCIENCE, vol. 323, no. 5918, 2009, pages 1205 - 1208, XP008153947, DOI: doi:10.1126/science.1166066
LAAKSOVIRTA H ET AL: "Chromosome 9p21 in amyotrophic lateral sclerosis in Finland: a genome-wide association study", LANCET NEUROLOGY, LANCET PUBLISHING GROUP, LONDON, GB, vol. 9, no. 10, 1 October 2010 (2010-10-01), pages 978 - 985, XP027599044, ISSN: 1474-4422, [retrieved on 20101001], DOI: 10.1016/S1474-4422(10)70184-8 *
LAAKSOVIRTA, H.; PEURALINNA, T.; SCHYMICK, J.C.; SCHOLZ, S.W.; LAI, S.L.; MYLLYKANGAS, L.; SULKAVA, R.; JANSSON, L.; HERNANDEZ, D.: "Chromosome 9p21 in amyotrophic lateral sclerosis in Finland: a genome-wide association study", LANCET NEUROL, vol. 9, no. 10, 2010, pages 978 - 985, XP027599044, DOI: doi:10.1016/S1474-4422(10)70184-8
LE BER, I.; CAMUZAT, A.; BERGER, E.; HANNEQUIN, D.; LAQUERRIERE, A.; GOLFIER, V.; SEILHEAN, D.; VIENNET, G.; COURATIER, P.; VERPIL: "Chromosome 9p-linked families with frontotemporal dementia associated with motor neuron disease", NEUROLOGY, vol. 72, no. 19, 2009, pages 1669 - 1676
LILLO, P.; HODGES, J.R.: "Frontotemporal dementia and motor neurone disease: overlapping clinic-pathological disorders", J CLIN NEUROSCI, vol. 16, no. 9, 2009, pages 1131 - 1135, XP026347988
LIVAK ET AL., PCR METHOD APPL, vol. 4, 1995, pages 357 - 362
LOMEN-HOERTH, C.; MURPHY, J.; LANGMORE, S.; KRAMER, J.H.; OLNEY, R.K.; MILLER, B.: "Are amyotrophic lateral sclerosis patients cognitively normal?", NEUROLOGY, vol. 60, no. 7, 2003, pages 1094 - 1097
LUTY, A.A.; KWOK, J.B.; DOBSON-STONE, C.; LOY, C.T.; COUPLAND, K.G.; KARLSTROM, H.; SOBOW, T.; TCHORZEWSKA, J.; MARUSZAK, A.; BARC: "Sigma nonopioid intracellular receptor 1 mutations cause frontotemporal lobar degeneration-motor neuron disease", ANN NEUROL, vol. 68, no. 5, 2010, pages 639 - 649
LUTY, A.A.; KWOK, J.B.; THOMPSON, E.M.; BLUMBERGS, P.; BROOKS, W.S.; LOY, C.T.; DOBSON-STONE, C.; PANEGYRES, P.K.; HECKER, J.; NIC: "Pedigree with frontotemporal lobar degeneration--motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome 9", BMC NEUROL, vol. 8, 2008, pages 32, XP021042819, DOI: doi:10.1186/1471-2377-8-32
MACKENZIE IR; NEUMANN M; BIGIO EH; CAIRNS NJ; ALAFUZOFF , KRIL J; KOVACS GG; GHETTI B; HALLIDAY G; HOLM IE; INCE PG: "Nomenclature and nosology for neuropathologic subtypes of frontotemporal lobar degeneration: an update", ACTA NEUROPATHOL, vol. 119, 2010, pages 1 - 4, XP019780689
MANIATIS ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, pages: 16.54
MARIELY DEJESUS-HERNANDEZ ET AL: "Expanded GGGGCC Hexanucleotide Repeat in Noncoding Region ofCauses Chromosome 9p-Linked FTD and ALS", NEURON, CELL PRESS, US, vol. 72, no. 2, 21 September 2011 (2011-09-21), pages 245 - 256, XP028322560, ISSN: 0896-6273, [retrieved on 20110917], DOI: 10.1016/J.NEURON.2011.09.011 *
MICHAEL A VAN ES ET AL: "Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis", NATURE GENETICS, vol. 41, no. 10, 1 October 2009 (2009-10-01), pages 1083 - 1087, XP055044719, ISSN: 1061-4036, DOI: 10.1038/ng.442 *
MOMENI, P.; SCHYMICK, J.; JAIN, S.; COOKSON, M.R.; CAIRNS, N.J.; GREGGIO, E.; GREENWAY, M.J.; BERGER, S.; PICKERING-BROWN, S.; CHI: "Analysis of FT74 as a candidate gene for chromosome 9p-linked ALS-FTD", BMC NEUROL, vol. 6, 2006, pages 44, XP021022989, DOI: doi:10.1186/1471-2377-6-44
MORITA, M.; AI CHALABI, A.; ANDERSEN, P.M.; HOSLER, B.; SAPP, P.; ENGLUND, E.; MITCHELL, J.E.; HABGOOD, J.J.; DE BELLEROCHE, J.; X: "A locus on chromosome 9p confers susceptibility to ALS and frontotemporal dementia", NEUROLOGY, vol. 66, no. 6, 2006, pages 839 - 844, XP008116435, DOI: doi:10.1212/01.wnl.0000200048.53766.b4
NAZARENKO ET AL., NUCL. ACIDS RES., vol. 25, 1997, pages 2516 - 2521
NEARY, D.; SNOWDEN, J.S.; GUSTAFSON, L.; PASSANT, U.; STUSS, D.; BLACK, S.; FREEDMAN, M.; KERTESZ, A.; ROBERT, P.H.; ALBERT, M.: "Frontotemporal lobar degeneration: a consensus on clinical diagnostic criteria", NEUROLOGY, vol. 51, no. 6, 1998, pages 1546 - 1554, XP009145335
NEUMANN, M.; SAMPATHU, D.M.; KWONG, L.K.; TRUAX, A.C.; MICSENYI, M.C.; CHOU, T.T.; BRUCE, J.; SCHUCK, T.; GROSSMAN, M.; CLARK, C.M: "Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis", SCIENCE, vol. 314, no. 5796, 2006, pages 130 - 133, XP002534603, DOI: doi:10.1126/SCIENCE.1134108
PEARSON, J.P.; WILLIAMS, N.M.; MAJOUNIE, E.; WAITE, A.; STOTT, J.; NEWSWAY, V.; MURRAY, A.; HERNANDEZ, D.; GUERREIRO, R.; SINGLETO: "Familial frontotemporal dementia with amyotrophic lateral sclerosis and a shared haplotype on chromosome 9p", J NEUROL, vol. 258, no. 4, 2011, pages 647 - 655, XP019890940, DOI: doi:10.1007/s00415-010-5815-x
PERBAL: "Meth. Enzymol.", 1984, ACADEMIC PRESS, INC., article "A Practical Guide to Molecular Cloning"
RAVASI, T.; SUZUKI, H.; CANNISTRACI, C.V.; KATAYAMA, S.; BAJIC, V.B.; TAN, K.; AKALIN, A.; SCHMEIER, S.; KANAMORI-KATAYAMA, M.; BE: "An atlas of combinatorial transcriptional regulation in mouse and man", CELL, vol. 140, no. 5, 2010, pages 744 - 752
RINGHOLZ, G.M.; APPEL, S.H.; BRADSHAW, M.; COOKE, N.A.; MOSNIK, D.M.; SCHULZ, P.E.: "Prevalence and patterns of cognitive impairment in sporadic ALS", NEUROLOGY, vol. 65, no. 4, 2005, pages 586 - 590
ROACH, J.C.; GLUSMAN, G.; SMIT, A.F.; HUFF, C.D.; HUBLEY, R.; SHANNON, P.T.; ROWEN, L.; PANT, K.P.; GOODMAN, N.; BAMSHAD, M.: "Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing", SCIENCE, 2010
ROLLINSON, S.; MEAD, S.; SNOWDEN, J.; RICHARDSON, A.; ROHRER, J.; HALLIWELL, N.; USHER, S.; NEARY, D.; MANN, D.; HARDY, J.: "Frontotemporal lobar degeneration genome wide association study replication confirms a risk locus shared with amyotrophic lateral sclerosis", NEUROBIOL AGING, vol. 32, no. 4, 2011, pages 758 - 7, XP028158073, DOI: doi:10.1016/j.neurobiolaging.2010.12.005
ROSEN S; SKALETSKY H: "prmer3 on the WWW for general users and for biologist programmers", METHODS MOL BIOL., vol. 132, 2000, pages 365 - 386, XP002949676
ROSEN, D.R.; SIDDIQUE, T.; PATTERSON, D.; FIGLEWICZ, D.A.; SAPP, P.; HENTATI, A.; DONALDSON, D.; GOTO, J.; O'REGAN, J.P.; DENG, H.: "Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis", NATURE, vol. 362, no. 6415, 1993, pages 59 - 62, XP008153951, DOI: doi:10.1038/362059a0
ROSSO, S.M.; DONKER, K.L.; BAKS, T.; JOOSSE, M.; DE, K.; PIJNENBURG, Y.; DE JONG, D.; DOOIJES, D.; KAMPHORST, W.; RAVID, R.: "Frontotemporal dementia in The Netherlands: patient characteristics and prevalence estimates from a population-based study", BRAIN, vol. 126, 2003, pages 2016 - 2022
ROWLAND, L.P.; SHNEIDER, N.A.: "Amyotrophic lateral sclerosis", N ENGL J MED, vol. 344, no. 22, 2001, pages 1688 - 1700
SAIKI ET AL., NATURE, vol. 324, 1986, pages 163 - 166
SAIKI ET AL.: "PCR Protocols", 1990, ACADEMIC PRESS, article "Amplification of Genomic DNA", pages: 13 - 20
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMPATHU, D.M.; NEUMANN, M.; KWONG, L.K.; CHOU, T.T.; MICSENYI, M.; TRUAX, A.; BRUCE, J.; GROSSMAN, M.; TROJANOWSKI, J.Q.; LEE, V.: "Pathological heterogeneity of frontotemporal lobar degeneration with ubiquitin-positive inclusions delineated by ubiquitin immunohistochemistry and novel monoclonal antibodies", AM J PATHOL, vol. 169, no. 4, 2006, pages 1343 - 1352
SARA ROLLINSON ET AL: "Frontotemporal lobar degeneration genome wide association study replication confirms a risk locus shared with amyotrophic lateral sclerosis", NEUROBIOLOGY OF AGING, TARRYTOWN, NY, US, vol. 32, no. 4, 9 December 2010 (2010-12-09), pages 758.e1 - 758.e7, XP028158073, ISSN: 0197-4580, [retrieved on 20101215], DOI: 10.1016/J.NEUROBIOLAGING.2010.12.005 *
SELA, N.; MERSCH, B.; GAL-MARK, N.; LEV-MAOR, G.; HOTZ-WAGENBLATT, A.; AST, G.: "Comparative analysis of transposed element insertion within human and mouse genomes reveals Alu's unique role in shaping the human transcriptome", GENOME BIOL, vol. 8, no. 6, 2007, pages R127, XP021031257, DOI: doi:10.1186/gb-2007-8-6-r127
SHATUNOV, A.; MOK, K.; NEWHOUSE, S.; WEALE, M.E.; SMITH, B.; VANCE, C.; JOHNSON, L.; VELDINK, J.H.; VAN ES, M.A.; VAN DEN BERG, L.: "Chromosome 9p21 in sporadic amyotrophic lateral sclerosis in the UK and seven other countries: a genome-wide association study", LANCET NEUROL, vol. 9, no. 10, 2010, pages 986 - 994
SKIBINSKI, G.; PARKINSON, N.J.; BROWN, J.M.; CHAKRABARTI, L.; LLOYD, S.L.; HUMMERICH, H.; NIELSEN, J.E.; HODGES, J.R.; SPILLANTINI: "Mutations in the endosomal ESCRTIII-complex subunit CHMP2B in frontotemporal dementia", NAT GENET, vol. 37, no. 8, 2005, pages 806 - 808
SREEDHARAN, J.; BLAIR, I.P.; TRIPATHI, V.B.; HU, X.; VANCE, C.; ROGELJ, B.; ACKERLEY, S.; DURNALL, J.C.; WILLIAMS, K.L.; BURATTI,: "TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis", SCIENCE, vol. 319, no. 5870, 2008, pages 1668 - 1672, XP008153967, DOI: doi:10.1126/science.1154584
TYAGI ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 303 - 308
URDEA, M. S. ET AL., AIDS, vol. 7, no. 2, 1993, pages S11 - S 14
VALDMANIS, P.N.; DUPRE, N.; BOUCHARD, J.P.; CAMU, W.; SALACHAS, F.; MEININGER, V.; STRONG, M.; ROULEAU, G.A.: "Three families with amyotrophic lateral sclerosis and frontotemporal dementia with evidence of linkage to chromosome 9p", ARCH NEUROL, vol. 64, no. 2, 2007, pages 240 - 245
VAN DEERLIN, V.M.; LEVERENZ, J.B.; BEKRIS, L.M.; BIRD, T.D.; YUAN, W.; ELMAN, L.B.; CLAY, D.; WOOD, E.M.; CHEN-PLOTKIN, A.S.; MART: "TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis", LANCET NEUROL, vol. 7, no. 5, 2008, pages 409 - 416, XP022609986, DOI: doi:10.1016/S1474-4422(08)70071-1
VAN DEERLIN, V.M.; SLEIMAN, P.M.; MARTINEZ-LAGE, M.; CHEN-PLOTKIN, A.; WANG, L.S.; GRAFF-RADFORD, N.R.; DICKSON, D.W.; RADEMAKERS,: "Common variants at 7p21 are associated with frontotemporal lobar degeneration with TDP-43 inclusions", NAT GENET, vol. 42, no. 3, 2010, pages 234 - 239
VAN ES, M.A.; VELDINK, J.H.; SARIS, C.G.; BLAUW, H.M.; VAN VUGHT, P.W.; BIRVE, A.; LEMMENS, R.; SCHELHAAS, H.J.; GROEN, E.J.; HUIS: "Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis", NAT GENET, vol. 41, no. 10, 2009, pages 1083 - 1087, XP055044719, DOI: doi:10.1038/ng.442
VAN LANGENHOVE, T.; VAN DER ZEE, J.; SLEEGERS, K.; ENGELBORGHS, S.; VANDENBERGHE, R.; GIJSELINCK, I.; VAN DEN BROECK, M.; MATTHEIJ: "Genetic contribution of FUS to frontotemporal lobar degeneration", NEUROLOGY, vol. 74, no. 5, 2010, pages 366 - 371
VANCE, C.; AI CHALABI, A.; RUDDY, D.; SMITH, B.N.; HU, X.; SREEDHARAN, J.; SIDDIQUE, T.; SCHELHAAS, H.J.; KUSTERS, B.; TROOST, D.: "Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3", BRAIN, vol. 129, 2006, pages 868 - 876, XP009100597, DOI: doi:10.1093/brain/awl030
VANCE, C.; ROGELJ, B.; HORTOBAGYI, T.; DE VOS, K.J.; NISHIMURA, A.L.; SREEDHARAN, J.; HU, X.; SMITH, B.; RUDDY, D.; WRIGHT, P.: "Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6", SCIENCE, vol. 323, no. 5918, 2009, pages 1208 - 1211, XP008153960, DOI: doi:10.1126/science.1165942
WATTS, G.D.; WYMER, J.; KOVACH, M.J.; MEHTA, S.G.; MUMM, S.; DARVISH, D.; PESTRONK, A.; WHYTE, M.P.; KIMONIS, V.E.: "Inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia is caused by mutant valosin-containing protein", NAT GENET, vol. 36, no. 4, 2004, pages 377 - 381
WECKX S ET AL.: "novoSNP, a novel computational tool for sequence variation discovery", GENOME RES., vol. 15, 2005, pages 436 - 442
WHARAM ET AL., NUCLEIC ACIDS RES., vol. 29, no. 11, 2001, pages E54 - E54
YAN J; SLIFER S; SIDDIQUE N; CHEN W; YONG S; ERDONG L; HAINES JL; PERICAK-VANCE M; SIDDIQUE T., FINE-MAPPING AND CANDIDATE GENE SEQUENCING OF THE CHROMOSOME 9P LOCUS OF ALS/FTD, 2008
YOKOSEKI, A.; SHIGA, A.; TAN, C.F.; TAGAWA, A.; KANEKO, H.; KOYAMA, A.; EGUCHI, H.; TSUJINO, A.; IKEUCHI, T.; KAKITA, A.: "TDP-43 mutation in familial amyotrophic lateral sclerosis", ANN NEUROL, vol. 63, no. 4, 2008, pages 538 - 542, XP055257495, DOI: doi:10.1002/ana.21392
ZHONG ET AL., BIOTECHNIQUES, vol. 30, no. 4, 2001, pages 852 - 6,858,860

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014114922A1 (fr) * 2013-01-23 2014-07-31 Medical Research Council Méthodes d'estimation de la taille d'expansions de répétitions polynucléotidiques associées à une maladie dans des gènes
US9448232B2 (en) 2013-01-24 2016-09-20 Mayo Foundation For Medical Education And Research Methods and materials for detecting C9ORF72 hexanucleotide repeat expansion positive frontotemporal lobar degeneration or C9ORF72 hexanucleotide repeat expansion positive amyotrophic lateral sclerosis
WO2015001113A1 (fr) * 2013-07-05 2015-01-08 Vib Vzw Procédés pour le diagnostic de maladies neurodégénératives cérébrales
US20200239883A1 (en) * 2013-10-14 2020-07-30 Ionis Pharmaceuticals, Inc. Compositions for Modulating Expression of C9ORF72 Antisense Transcript
US11193128B2 (en) * 2013-10-14 2021-12-07 Ionis Pharmaceuticals, Inc. Compositions for modulating expression of C9ORF72 antisense transcript
US11162096B2 (en) 2013-10-14 2021-11-02 Ionis Pharmaceuticals, Inc Methods for modulating expression of C9ORF72 antisense transcript
CN113362891A (zh) * 2014-09-12 2021-09-07 伊鲁米纳剑桥有限公司 用短读测序数据检测重复扩增
US10699801B2 (en) 2014-09-12 2020-06-30 Illumina Cambridge Limited Detecting repeat expansions with short read sequencing data
WO2016038220A1 (fr) * 2014-09-12 2016-03-17 Illumina Cambridge Limited Détection d'expansions de répétitions à l'aide de données de séquençage de lecture courte
EP4092680A1 (fr) * 2014-09-12 2022-11-23 Illumina Cambridge Limited Détection d'expansions de répétitions à l'aide de données de séquençage de lecture courte
CN107077537A (zh) * 2014-09-12 2017-08-18 伊鲁米纳剑桥有限公司 用短读测序数据检测重复扩增
WO2016060919A1 (fr) * 2014-10-14 2016-04-21 The Board Of Regents Of The University Of Texas System Inhibition sélective d'allèle de l'expression de foci c9orf72 mutants par des arn duplexes ciblant la répétition étendue d'hexanucléotide
US11840690B2 (en) 2014-10-14 2023-12-12 The Board Of Regents Of The University Of Texas System Allele selective inhibition of mutant C9orf72 foci expression by duplex RNAs targeting the expanded hexanucleotide repeat
US10538762B2 (en) 2014-10-14 2020-01-21 The Board Of Regents Of The University Of Texas System Allele selective inhibition of mutant C9orf72 foci expression by duplex RNAS targeting the expanded hexanucleotide repeat
RU2725737C2 (ru) * 2015-05-29 2020-07-03 Регенерон Фармасьютикалс, Инк. Животные, отличные от человека, с нарушением в локусе c9orf72
WO2016196185A1 (fr) * 2015-05-29 2016-12-08 Regeneron Pharmaceuticals, Inc. Animaux non-humains comprenant une perturbation dans un locus c9orf72
US11547101B2 (en) 2015-05-29 2023-01-10 Regeneron Pharmaceuticals, Inc. Non-human animals having a disruption in a C9ORF72 locus
EP3689139A1 (fr) * 2015-05-29 2020-08-05 Regeneron Pharmaceuticals, Inc. Animaux non-humains comprenant une perturbation dans un locus c9orf72
AU2021201827B2 (en) * 2015-05-29 2023-11-09 Regeneron Pharmaceuticals, Inc. Non-human animals having a disruption in a c9orf72 locus
KR102190661B1 (ko) 2015-05-29 2020-12-14 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 파괴를 갖는 비-인간 동물
KR20200140934A (ko) * 2015-05-29 2020-12-16 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 파괴를 갖는 비-인간 동물
KR20180012323A (ko) * 2015-05-29 2018-02-05 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 파괴를 갖는 비-인간 동물
US10285388B2 (en) 2015-05-29 2019-05-14 Regeneron Pharmaceuticals, Inc. Non-human animals having a disruption in a C9ORF72 locus
CN107920498A (zh) * 2015-05-29 2018-04-17 瑞泽恩制药公司 具有c9orf72基因座破坏的非人类动物
US11001893B2 (en) 2016-06-10 2021-05-11 Zinfandel Pharmaceuticals, Inc. Methods for detecting structural variants in neurodegenerative disease
EP3469093A4 (fr) * 2016-06-10 2019-12-25 Saunders, Ann M. Procédés de détection de variants structurels dans une maladie neurodégénérative
KR20210109649A (ko) * 2016-09-30 2021-09-06 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 헥사뉴클레오티드 반복 확장을 갖는 비인간 동물
KR102294755B1 (ko) 2016-09-30 2021-08-31 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 헥사뉴클레오티드 반복 확장을 갖는 비인간 동물
CN109862785B (zh) * 2016-09-30 2022-09-06 瑞泽恩制药公司 C9orf72基因座中具有六核苷酸重复扩增的非人类动物
US10781453B2 (en) 2016-09-30 2020-09-22 Regeneron Pharmaceuticals, Inc. Non-human animals having a hexanucleotide repeat expansion in a C9ORF72 locus
KR102527979B1 (ko) 2016-09-30 2023-04-28 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 헥사뉴클레오티드 반복 확장을 갖는 비인간 동물
CN109862785A (zh) * 2016-09-30 2019-06-07 瑞泽恩制药公司 C9orf72基因座中具有六核苷酸重复扩增的非人类动物
KR20190057104A (ko) * 2016-09-30 2019-05-27 리제너론 파마슈티칼스 인코포레이티드 C9orf72 유전자좌에서 헥사뉴클레오티드 반복 확장을 갖는 비인간 동물
US11690362B2 (en) 2018-12-20 2023-07-04 Regeneran Pharmaceuticals, Inc. Nuclease-mediated repeat expansion
WO2022082199A1 (fr) * 2020-10-16 2022-04-21 Pluripotent Diagnostics Corp. Procédé de détection de la sclérose latérale amyotrophique

Similar Documents

Publication Publication Date Title
WO2013041577A1 (fr) Procédés de diagnostic de la sclérose latérale amyotrophique et de la dégénérescence lobaire frontotemporale
Gijselinck et al. A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort with disorders of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis spectrum: a gene identification study
DeJesus-Hernandez et al. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS
US9486541B2 (en) Detecting and treating dementia
US11447826B2 (en) Cystic fibrosis transmembrane conductance regulator gene mutations
Mengel-From et al. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old
US20140255936A1 (en) Detecting frontotemporal dementia and amyotrophic lateral sclerosis
Downs et al. Late‐onset progressive retinal atrophy in the G ordon and I rish S etter breeds is associated with a frameshift mutation in C2orf71
Mougou‐Zerelli et al. CC2D2A mutations in Meckel and Joubert syndromes indicate a genotype–phenotype correlation
US20070141577A1 (en) Method
US20150292016A1 (en) Novel markers for mental disorders
Ramírez-Lorca et al. GAB2 gene does not modify the risk of Alzheimer’s disease in Spanish APOE 4 carriers
Kouremenos et al. Genes and genetic variations involved in the development of hypertension: focusing on a Greek patient cohort
US20050287556A1 (en) Use of HLA-G genotyping in immune-mediated conditions
US10260098B2 (en) FIG4 gene mutations in neurodegeneration
EP2687223B1 (fr) Detection et traitement de la démence
JP4546397B2 (ja) 腎臓疾患または素因を診断する方法
US20140288011A1 (en) Genetic association
US6869768B2 (en) Association between the acid phosphatase (ACP1) gene and Alzheimer&#39;s disease
EP1664336A2 (fr) Procede pour detecter l&#39;autisme et des troubles analogues
WO2016090001A1 (fr) Mutation intronique profonde avérée dans la maladie des corps polyglucosanes de l&#39;adulte et ses utilisations
Nespeca Retinal Disorders: advanced methods for the genetic diagnosis and genotype-phenotype correlations
Gijselinck et al. A major genetic factor at chromosome 9p implicated in amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD)
US20110151456A1 (en) Test method for type-2 diabetes using gene polymorphism
Россоха et al. The relationship between genes related folate metabolism and blood coagulation parameters in Ukrainian couples with reproductive disorders

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12762574

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12762574

Country of ref document: EP

Kind code of ref document: A1