WO2013034645A1

WO2013034645A1 - Methods and kits for predicting the risk of having a melanoma in a subject

Info

Publication number: WO2013034645A1
Application number: PCT/EP2012/067424
Authority: WO
Inventors: Nadem Soufir
Original assignee: INSERM (Institut National de la Santé et de la Recherche Médicale)
Priority date: 2011-09-06
Filing date: 2012-09-06
Publication date: 2013-03-14

Abstract

The present invention relates to in vitro methods and kits for predicting the risk of having melanoma in a subject. Thirty four genetic markers in 27 different genes were significantly associated with melanoma risk.

Description

METHODS AND KITS FOR PREDICTING THE RISK OF HAVING A MELANOMA

IN A SUBJECT

FIELD OF THE INVENTION:

The present invention relates to in vitro methods and kits for predicting the risk of having melanoma in a subject.

BACKGROUND OF THE INVENTION:

Melanoma is a serious form of skin cancer in humans. It arises from the pigment cells

(melanocytes), usually in the skin. Melanoma is currently increasing at the fastest rate of all cancers in the United States. Without even including melanoma in-situ, it is the seventh most common serious cancer in the United States. There are projected to be 60,000 new cases of melanoma in the United States in 2006, with 7,600 deaths due to melanoma. This means, on average, about one person per hour will die in the U.S. due to this disease. It is the most common cancer in women aged 25-29 years old, it is second in malignancies of adulthood in terms of life-years lost and currently the prognosis for melanoma once it is disseminated is dismal.

Melanoma is currently predicted by assessing risk factors. Risk factors for melanoma are a family history of melanoma, the presence of dysplastic nevi, patient history of melanoma, weakened immune system, many ordinary nevi, exposure levels to ultraviolet radiation, exposure to severe sunburns especially as a child or teenager, and fair skin. Nonetheless no single biomarker is sufficiently specific to provide adequate clinical utility for the predisposition for melanoma in an individual subject. Therefore, there is a need for identifying other factors that provide a more accurate prognosis of melanoma. Thus, the invention aims to provide a novel method for the prognosis of melanoma using a genetic factor.

SUMMARY OF THE INVENTION:

The present invention relates to a method of determining whether a subject is at risk of having or developing melanoma, comprising testing for said subject the genotype of at least one single nucleotide polymorphism selected from the group consisting of:

- rsl 1773094

- rsl99524 - rsl 042522

- rsl 1977660

- rs6453373

. rs4911414

- rs6120580

- rs4318084

- rsl 104737

- rsl2913832

- rs6440589

- rs739289

- rs2976045

- rs2237028

- rs6781 171

- rs7641320

- rs7643531

- rs2743993

- rsl7542017

- rs6710486

- rs6436310

- rs930140

- rs6899628

- rs6941583

- rs3741983

- rsl 805009

- rsl0876863

- rs3810908, and,

- rs2733832

, wherein:

- the presence of the allele (T) for rsl 1773094 - the presence of the allele (T) for rsl 99524

- the presence of the allele (G) for rsl 042522

- the presence of the allele (T) for rsl 1977660

- the presence of the allele (T) for rs6453373

- the presence of the allele (T) for rs4911414 - the presence of the allele (T) for rs6120580

- the presence of the allele (T) for rs4318084

the presence of the allele (C) for rsl 104737

- the presence of the allele (G) for rsl2913832

- the presence of the allele (G) for rs6440589

- the presence of the allele (C) for rs739289

- the presence of the allele (G) for rs2976045

- the presence of the allele (C) for rs2237028

the presence of the allele (T) for rs6781171

- the presence of the allele (G) for rs7641320

- the presence of the allele (G) for rs7643531

- the presence of the allele (G) for rs2743993

the presence of the allele (T) for rsl7542017

- the presence of the allele (G) for rs6710486

- the presence of the allele (G) for rs6436310

the presence of the allele (G) for rs930140

the presence of the allele (T) for rs6899628

- the presence of the allele (T) for rs6941583

- the presence of the allele (G) for rs3741983

- the presence of the allele (G) for rsl805009

the presence of the allele (G) for rsl 0876863

- the presence of the allele (T) for rs3810908

- the presence of the allele (T) for rs2733832

indicates an increased risk of having or being at risk of having or developing melanoma.

DETAILED DESCRIPTION OF THE INVENTION:

The inventors investigated the involvement of 338 candidate SNPs in genetic predisposition to melanoma by using a dedicated chip (Illumina technology) as part of a case- control study (1069 melanoma patients, 925 controls). These SNPs belong to 1 10 genes involved in pigmentation and most of these were predicted to be functional using bioinformatic algorithms. The genotyping was performed on a beadexpress station using Goldengate technology. Statistical association between melanoma risk and each marker was tested in genotypic, additive, dominant, recessive models by calculating the P value and the odds ratio (OR). Thirty four genetic markers in 27 different genes were significantly associated with melanoma risk (Table 1); 5 of them were already known as associated with melanoma : locus 20q (rs910873), OR : 1.65 [1.25-2.2] ; MC1R (rsl 1547464 OR : 1.92; 1.47 [2.5;-1.39] ; rsl805007 OR 1.89; [1.4-2.54]); SLC45A2 (rsl6891982;OR : 0.427 [0.32-0.57] , TYR (rsl 126809, OR 1.51 [1.09-2.10]. Most of these markers remain significant after adjustment on pigmentation characteristics, and several markers have been replicated in two Spanish cohorts of 1085 melanomas and 801 controls. These results may useful in the future in identifying individuals highly predisposed to melanoma.

Definitions:

Throughout the specification, several terms are employed and are defined in the following paragraphs.

"Risk" in the context of the present invention, relates to the probability that an event will occur over a specific time period, as in the conversion to melanoma, and can mean a subject's "absolute" risk or "relative" risk. Absolute risk can be measured with reference to either actual observation post-measurement for the relevant time cohort, or with reference to index values developed from statistically valid cohorts that have been followed for the relevant time period. Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed. Odds ratios, the proportion of positive events to negative events for a given test result, are also commonly used (odds are according to the formula p/(l-p) where p is the probability of event and (1- p) is the probability of no event) to no- conversion. Alternative continuous measures which may be assessed in the context of the present invention include time to melanoma conversion and therapeutic geographic atrophy form of melanoma conversion risk reduction ratios.

"Risk evaluation," or "evaluation of risk" in the context of the present invention encompasses making a prediction of the probability, odds, or likelihood that an event or disease state may occur, the rate of occurrence of the event or conversion from one disease state to another, i.e., from a normal condition to melanoma condition. Risk evaluation can also comprise prediction of future clinical parameters, traditional laboratory risk factor values, or other indices of melanoma, such as fair skin, a history of sunburn, excessive ultraviolet (UV) light exposure, living closer to the equator or at a higher elevation, a family history of melanoma, a weakened immune system... The methods of the present invention may be used to make continuous or categorical measurements of the risk of conversion to melanoma, thus diagnosing and defining the risk spectrum of a category of subjects defined as being at risk for melanoma. In the categorical scenario, the invention can be used to discriminate between normal and other subject cohorts at higher risk for melanoma.

A "sample" in the context of the present invention is a biological sample isolated from a subject and can include, by way of example and not limitation, bodily fluids and/or tissue extracts such as homogenates or solubilized tissue obtained from a subject. Tissue extracts are obtained routinely from tissue biopsy and autopsy material. Bodily fluids useful in the present invention include blood, urine, saliva or any other bodily secretion or derivative thereof. As used herein "blood" includes whole blood, plasma, serum, circulating epithelial cells, constituents, or any derivative of blood.

A "subject" in the context of the present invention can be a male or female. A subject can also be one who has not been previously diagnosed as having melanoma. For example, a subject can be one who exhibits one or more risk factors for melanoma, or a subject who does not exhibit melanoma risk factors, or a subject who is asymptomatic for melanoma. A subject can also be one who is at risk of developing melanoma. The term "Allele" has the meaning which is commonly known in the art, that is, an alternative form of a gene (one member of a pair) that is located at a specific position on a specific chromosome which, when translated result in functional or dysfunctional (including non- existent) gene products. The term "polymorphism" or "allelic variant" means a mutation in the normal sequence of a gene, Allelic variants can be found in the exons, introns, or the coding region of the gene, or in the sequences that control expression of the gene.

The term "Single nucleotide polymorphism" or "SNP" means a single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the human population. There are millions of SNPs in the human genome. Most commonly, these variations are found in the DNA between genes. When SNPs occur within a gene or in a regulatory region near a gene, they may play a more direct role in disease by affecting the gene's function. As used herein, the SNP that are concerned by the invention are described as follows (Table A): Gene rs ID dbSNP sequence

(5·->3')

AP3B1 rs6453373 CATATTTACTTAAAGCTCCACTCTTT[A/T]CATTCGGAACAA

TAAGCTGCCTAAT (SEQ ID NO: l)

ASIP rs49H414 tgtaagtctttgctgagaaattcatt[G/T]ttagtctaatatgatgcttttctct (SEQ ID

NO:2)

ASIP rs6120580 AAACCCAAAGACACAAAATAACTACA[C/T]GTACCGCCTCC

TAATTTATAACATG (SEQ ID NO:3)

DCT rs4318084 TGTGAGGGAAAATCTGTTCCAGACCT[C/T]ACTCCTACCTTC

TCGGGCCTTGCTG (SEQ ID NO:4)

EGFR rsl 1977660 CCAGCAACTTCCTTTCTAACTTCTCC[C/T]TTCACATATGCT

GGATACTCCAAGA (SEQ ID NO:5)

GNA1 rsl 104737 ACATCTTCCTCACTGTCCTATCTGCC[A/C]CGCCTGGCCCTG 1 AGCCTGACAGCAA (SEQ ID NO:6)

HERC rsl2913832 CGAGGCCAGTTTCATTTGAGCATTAA[A/G]TGTCAAGTTCT 2 GCACGCTATCATCA (SEQ ID N0:7)

HPS3 rs6440589 ATTGTGAATACGATCTCACCAGTGCA[A/G]CTGTACAAAGA

GATGGTACTCTTTT (SEQ ID NO: 8)

HPS4 rs739289 GT AC AGGGGT AGGT AGC AT AAAAG AC [ A/C] GCCGTTCTC AA

GAGGCAACCATGCG (SEQ ID NO:9)

HPS5 rs2976045 GTT AATGTT AGTGT AG AAGGTGG ACT [C/G] C AAG AACT AAA

GTGACAAGTTACTT (SEQ ID NO: 10)

KIT rs2237028 CCTGGACCCTGAAACATCTCTCTCAG[A/C]TGTGAAAGAGC

ATTCCGGCACATTC (SEQ ID NO: l 1) MITF rs6781171 AAGGATTTTTTTTTCTTTTAGTGCCT[A/T]TGAGGAATTTCC

TAAATACTTTTGC (SEQ ID NO: 12)

MITF rs7641320 ATTATGAAATTAGATAACAACCAAAA[C/G]AAAAATGGAC

TGTAAGCTAAATTTA (SEQ ID NO: 13)

MITF rs7643531 TCGCTTGGAGTC ACCTCTTGGG AGTC [C/G] GGTCTCTGTGG

GGAAACTAGCCTCT (SEQ ID NO: 14)

MUTE rs2743993 aaggatgctgtttcaaattgGATCCC[A/G]AAAAGGAGGGAAAAGCTG D GGAAAAG (SEQ ID NO: 15)

MY05 rsl7542017 TACCTCTGTTTCACCCATTCTTTCTT[C/T]TGGTTATCAAAGT A AGACACTTTTCA (SEQ ID NO: 16)

PAX3 rs6710486 CCATATTTCAACATTTAAATTCCAAG[A/G]GCAAAGTTCAA

CAATATGCCGAGAT (SEQ ID NO: 17)

PAX3 rs6436310 CATATGGTTTGTGGGAAGATAGGAAG[A/G]GAGAAGGAAA

ATAGGAAAGGAAAAA (SEQ ID NO: 18)

PAX3 rs930140 CAAAGGGAAATGTTCTTTTATTCTGA[A/G]GATTGCACTCTT

GTTGACCCAAACA (SEQ ID NO: 19)

POLH rs6899628 GTGTGTGGGCCTTGGAGTCTAAGAGA[C/T]GTGGTTGCAAA

CTTAGCTCTGGTTA (SEQ ID NO:20)

POLH rs6941583 GTGGCTCCCTGGTACCGGTATGGGAT[A/T]TGCCAGAACAC

ATGGACTATCATTT (SEQ ID NO:21)

RPL24 rs3741983 ATTTTGCCCAAAAAAAGAAAAAAGAG[A/G]GAGAAAGAAA

AAAAAATTGATAGAC (SEQ ID NO:22)

RPS20 rsl805009 CCCTCATCATCTGCAATGCCATCATC[C/G]ACCCCCTCATCT

ACGCCTTYCACAG (SEQ ID NO:23) SILV rsl0876863 GGCTCATGATCCTCCCACCTGAGACT[C/G]CTAAGTAGCAG

GGACTACAACTGTA (SEQ ID NO: 24)

SLC31 rs3810908 ATGCTCACCTTGACCTCACCCTGTGG[C/T]TCGCCTAGACCC A2 AGGGTTGGCTGTG (SEQ ID NO:25)

TP53 rs 1042522 TCCCAGAATGCCAGAGGCTGCTCCCC[C/G]CGTGGCCCCTG

CACCAGCAGCTCCT (SEQ ID NO:26)

TYRP rs2733832 AATGCTGGTAAGACATTTTCATATGC[C/T]TTTTGCATGCTC 1 AGCTGGGCGGATT (SEQ ID NO:27)

VPS41 rsl 1773094 TGCTCATGGGAATGGCTGGGTGACTT[C/T]GGTAGCTGGCA

TGCTGTCAGTACTC (SEQ ID NO:28)

WNT3 rsl99524 GGCGCCCGCCTCCCCTCCTGGGCTGT[G/T]GGCCGAGTGCT

GCAAGAAGGAAGCC (SEQ ID NO:29)

Table A

The term "linkage disequilibrium" (LD) refers to a population association among alleles at two or more loci. It is a measure of co-segregation of alleles in a population. Linkage disequilibrium or allelic association is the preferential association of a particular allele or any other genetic marker with a specific allele, or genetic marker at a nearby chromosomal location more frequently than expected by chance for any particular allele frequency in the population.

A nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al, 1989).

The conditions of temperature and ionic strength determine the "stringency" of the hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions, corresponding to a Tm (melting temperature) of 55°C, can be used, e.g., 5x SSC, 0.1 % SDS, 0.25 % milk, and no formamide ; or 30 % formamide, 5x SSC, 0.5 % SDS). Moderate stringency hybridization conditions correspond to a higher Tm, e.g., 40 % formamide, with 5x or 6x SCC. High stringency hybridization conditions correspond to the highest Tm, e.g., 50 % formamide, 5x or 6x SCC. SCC is a 0.15 M NaCl, 0.015 M Na-citrate. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: R A:R A, DNA:R A, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al, 1989, 9.50-9.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al, 1989 11.7-11.8). A minimum length for a hybridizable nucleic acid is at least about 10 nucleotides, preferably at least about 15 nucleotides, and more preferably the length is at least about 20 nucleotides.

In a specific embodiment, the term "standard hybridization conditions" refers to a Tm of 55°C, and utilizes conditions as set forth above. In a preferred embodiment, the Tm is 60°C. In a more preferred embodiment, the Tm is 65 °C. In a specific embodiment, "high stringency" refers to hybridization and/or washing conditions at 68°C in 0.2 X SSC, at 42°C in 50 % formamide, 4 X SSC, or under conditions that afford levels of hybridization equivalent to those observed under either of these two conditions.

As used herein, an amplification primer is an oligonucleotide for amplification of a target sequence by extension of the oligonucleotide after hybridization to the target sequence or by ligation of multiple oligonucleotides which are adjacent when hybridized to the target sequence. At least a portion of the amplification primer hybridizes to the target. This portion is referred to as the target binding sequence and it determines the target-specificity of the primer. In addition to the target binding sequence, certain amplification methods require specialized non-target binding sequences in the amplification primer. These specialized sequences are necessary for the amplification reaction to proceed and typically serve to append the specialized sequence to the target. For example, the amplification primers used in Strand Displacement Amplification (SDA) include a restriction endonuclease recognition site 5' to the target binding sequence (US Patent No. 5,455,166 and US Patent No. 5,270,184). Nucleic Acid Based Amplification (NASBA), self-sustaining sequence replication (3SR) and transcription based amplification primers require an RNA polymerase promoter linked to the target binding sequence of the primer. Linking such specialized sequences to a target binding sequence for use in a selected amplification reaction is routine in the art. In contrast, amplification methods such as PCR which do not require specialized sequences at the ends of the target, generally employ amplification primers consisting of only target binding sequence.

As used herein, the terms "primer" and "probe" refer to the function of the oligonucleotide. A primer is typically extended by polymerase or ligation following hybridization to the target but a probe typically is not. A hybridized oligonucleotide may function as a probe if it is used to capture or detect a target sequence, and the same oligonucleotide may function as a primer when it is employed as a target binding sequence in an amplification primer. It will therefore be appreciated that any of the target binding sequences disclosed herein for amplification, detection or quantisation may be used either as hybridization probes or as target binding sequences in primers for detection or amplification, optionally linked to a specialized sequence required by the selected amplification reaction or to facilitate detection.

Diagnostic methods of the invention: The present invention relates to a method of determining whether a subject is at risk of having or developing melanoma, comprising testing for said subject the genotype of at least one single nucleotide polymorphism selected from the group consisting of:

- rsl 1773094

- rsl99524

- rsl042522

- rsl 1977660

- rs6453373

- rs4911414

- rs6120580 - rs4318084

- rsl 104737

- rsl2913832

- rs6440589

- rs739289

- rs2976045

- rs2237028

- rs6781 171

- rs7641320

- rs7643531

- rs2743993

- rsl7542017

- rs6710486

- rs6436310

- rs930140

- rs6899628

- rs6941583

- rs3741983

- rsl805009

- rsl0876863

- rs3810908, and,

- rs2733832

, wherein:

- the presence of the allele (T) for rsl 1773094 - the presence of the allele (T) for rsl99524

- the presence of the allele (G) for rsl042522

- the presence of the allele (T) for rsl 1977660

- the presence of the allele (T) for rs6453373

- the presence of the allele (T) for rs491 1414 - the presence of the allele (T) for rs6120580

- the presence of the allele (T) for rs4318084

- the presence of the allele (C) for rsl 104737

- the presence of the allele (G) for rsl2913832

- the presence of the allele (G) for rs6440589 the presence ofthe al lele (C) for rs739289

the presence ofthe al lele (G) for rs2976045

the presence ofthe al lele (C) for rs2237028

the presence ofthe al lele (T) for rs6781171

the presence ofthe al lele (G) for rs7641320

the presence ofthe al lele (G) for rs7643531

the presence ofthe al lele (G) for rs2743993

the presence ofthe al lele (T) for rs 17542017

the presence ofthe al lele (G) for rs6710486

the presence ofthe al lele (G) for rs6436310

the presence ofthe al lele (G) for rs930140

the presence ofthe al lele (T) for rs6899628

the presence ofthe al lele (T) for rs6941583

the presence ofthe al lele (G) for rs3741983

the presence ofthe al lele (G) for rsl 805009

the presence ofthe al lele (G) for rsl0876863

the presence ofthe al lele (T) for rs3810908

the presence ofthe al lele (T) for rs2733832

In one embodiment of the invention, the subject having or being at risk of having or developing melanoma may be a substantially healthy subject, which means that the subject has not been previously diagnosed or identified as having or suffering from melanoma.

In another embodiment, said subject may also be one that is asymptomatic for melanoma. As used herein, an "asymptomatic" subject refers to a subject that does not exhibit the traditional symptoms of melanoma.

In another embodiment of the invention, said subject may be one that is at risk of having or developing melanoma, as defined by clinical indicia such as for example fair skin, a history of sunburn, excessive ultraviolet (UV) light exposure, living closer to the equator or at a higher elevation, a family history of melanoma, a weakened immune system.

According to the invention the genotype of the single nucleotide polymorphism from a sample obtained from the subject. In another embodiment of the invention, the sample obtained from the subject comprises bodily fluids (such as blood, saliva or any other bodily secretion or derivative thereof), and/or tissue extracts such as homogenates or solubilized tissue obtained from the subject. In a preferred embodiment, the sample to be tested is blood.

According to the invention, the sample comprises nucleic acids, wherein nucleic acids may be genomic DNA, heterogenous nuclear RNA (hnRNA, also referred as incompletely processed single strand of ribonucleic acid) and/or cDNA. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,

21, 22, 23, 24, 25, 26, 27, 28, or 29 single nucleotide polymorphisms are tested in the sample obtained from the subject.

According to the invention, the determination of the said polymorphism may be determined by nucleic acid sequencing, PCR analysis or any genotyping method known in the art. Examples of such methods include, but are not limited to, chemical assays such as allele specific hybridization, primer extension, allele specific oligonucleotide ligation, sequencing, enzymatic cleavage, flap endonuclease discrimination; and detection methods such as fluorescence, chemiluminescence, and mass spectrometry.

For example, the presence or absence of said polymorphism may be detected in a

RNA or DNA sample, preferably after amplification. For instance, the isolated RNA may be subjected to couple reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that are specific for the polymorphism or that enable amplification of a region containing the polymorphism. According to a first alternative, conditions for primer annealing may be chosen to ensure specific reverse transcription (where appropriate) and amplification; so that the appearance of an amplification product be a diagnostic of the presence of the polymorphism according to the invention. Otherwise, RNA may be reverse-transcribed and amplified, or DNA may be amplified, after which a mutated site may be detected in the amplified sequence by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art. For instance, a cDNA obtained from RNA may be cloned and sequenced to genotype the polymorphism (or identify the allele).

Actually numerous strategies for genotype analysis are available (Antonarakis et al, 1989; Cooper et al, 1991; Grompe, 1993). Briefly, the nucleic acid molecule may be tested for the presence or absence of a restriction site. When a base polymorphism creates or abolishes the recognition site of a restriction enzyme, this allows a simple direct PCR genotype the polymorphism. Further strategies include, but are not limited to, direct sequencing, restriction fragment length polymorphism (RFLP) analysis; hybridization with allele-specific oligonucleotides (ASO) that are short synthetic probes which hybridize only to a perfectly matched sequence under suitably stringent hybridization conditions; allele-specific PCR; PCR using mutagenic primers; ligase-PCR, HOT cleavage; denaturing gradient gel electrophoresis (DGGE), temperature denaturing gradient gel electrophoresis (TGGE), single- stranded conformational polymorphism (SSCP) and denaturing high performance liquid chromatography (Kuklin et al., 1997). Direct sequencing may be accomplished by any method, including without limitation chemical sequencing, using the Maxam-Gilbert method ; by enzymatic sequencing, using the Sanger method ; mass spectrometry sequencing ; sequencing using a chip-based technology; and real-time quantitative PCR. Preferably, DNA from a subject is first subjected to amplification by polymerase chain reaction (PCR) using specific amplification primers. However several other methods are available, allowing DNA to be studied independently of PCR, such as the rolling circle amplification (RCA), the InvaderTMassay, or oligonucleotide ligation assay (OLA). OLA may be used for revealing base polymorphisms. According to this method, two oligonucleotides are constructed that hybridize to adjacent sequences in the target nucleic acid, with the join sited at the position of the polymorphism. DNA ligase will covalently join the two oligonucleotides only if they are perfectly hybridized to one of the allele.

Therefore, useful nucleic acid molecules, in particular oligonucleotide probes or primers, according to the present invention include those which specifically hybridize the one of the allele of the polymorphism.

Oligonucleotide probes or primers may contain at least 10, 15, 20 or 30 nucleotides.

Their length may be shorter than 400, 300, 200 or 100 nucleotides.

The present invention also relates to a method of determining whether a subject is at risk of having or developing melanoma, comprising testing for said subject the genotype of at least one single nucleotide polymorphism in linkage disequilibrium with a single nucleotide polymorphism selected from the group consisting of:

- rsl 1773094

- rsl99524

- rsl 042522 rs 11977660

rs6453373

rs49H414

rs6120580

rs4318084

rsl 104737

rsl2913832

rs6440589

rs739289

rs2976045

rs2237028

rs6781171

rs7641320

rs7643531

rs2743993

rsl7542017

rs6710486

rs6436310

rs930140

rs6899628

rs6941583

rs3741983

rsl805009

rsl0876863

rs3810908, and,

rs2733832

The term "linkage disequilibrium" (LD) refers to a population association among alleles at two or more loci. It is a measure of co-segregation of alleles in a population. Linkage disequilibrium or allelic association is the preferential association of a particular allele or any other genetic marker with a specific allele, or genetic marker at a nearby chromosomal location more frequently than expected by chance for any particular allele frequency in the population. Accordingly, two particular alleles at different loci on the same chromosome are said to be in LD if the presence of one of the alleles at one locus tends to predict the presence of the other allele at the other locus.

Linked variants are readily identified by determining the degree of linkage disequilibrium (LD) between the allele genotyped for one SNP and a candidate linked allele at a polymorphic site located in the chromosomal region where said SNP is locatrd or elsewhere on the chromosome. The candidate linked variant may be an allele of a polymorphism that is currently known. Other candidate linked variants may be readily identified by the skilled artisan using any technique well-known in the art for discovering polymorphisms. One of the most frequently used measures of linkage disequilibrium is r, which is calculated using the formula described by Devlin et al. (Genomics, 29(2):311-22 (1995)). "r" is the measure of how well an allele X at a first locus predicts the occurrence of an allele Y at a second locus on the same chromosome. The measure only reaches 1.0 when the prediction is perfect (e.g. X if and only if Y). In some embodiments, the method of the invention is performed by a laboratory that will generate a test report. The test report will thus indicates whether the risk allele is present or absent for the genotypes, and preferably indicates whether the patient is heterozygous or homozygous for the risk allele. Accordingly, if the patient is homozygous for the risk allele, then the test report further indicates that the patient is positive for a genetic marker associated with a high risk of having or developing melanoma. If the patient is heterozygous for the risk allele, then the test report further indicates that the patient is positive for a genetic marker associated with a risk of having or developing melanoma. In some embodiments, the test result will include a probability score for achieving a beneficial response to the treatment, which is derived from running a model that include the risk factor determined for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 single nucleotide polymorphisms of the invention that are tested. For calculating the score, the risk factor determined for a single nucleotide polymorphism of the invention may be pondered by a coefficient depending on what is the contribution of said single nucleotide polymorphism in the determination of the risk in comparison with another single nucleotide polymorphism. Typically, the method for calculating the score is based on statistical studies performed on various cohorts of patients. The score may also include other various patient parameters (e.g., age, gender, weight, race, test results for other genetic risk factors or other typical risk factors such as fair skin, history of sunburn, excessive ultraviolet (UV) light exposure, living closer to the equator or at a higher elevation, family history of melanoma, or weakened immune system. The weight given to each parameter is based on its contribution relative to the other parameters in explaining the inter-individual variability of having melanoma in the relevant disease population. In some embodiments, the test report may be thus generated by a computer program for establishing such a score.

This probability score may be used as a guide in selecting a therapy or treatment regimen for the subject. Accordingly; when the subject is considered at risk according to the method of the invention, one or more melanoma treatments or prophylactic regimens may be prescribed to said subject. Subjects genotyped as having one or more of the alleles described herein that are associated with increased risk of melanoma often are prescribed a prophylactic regimen designed to minimize the occurrence of melanoma. An example of a prophylactic regimen often prescribed is directed towards minimizing ultraviolet (UV) light exposure. Such a regimen may include, for example, prescription of a lotion applied to the skin that minimizes UV penetration and/or counseling individuals of other practices for reducing UV exposure, such as by wearing protective clothing and minimizing sun exposure. In certain embodiments, a treatment regimen is specifically prescribed and/or administered to individuals who will most benefit from it based upon their risk of developing melanoma assessed by the method of the invention. The treatment sometimes is preventative (e.g., is prescribed or administered to reduce the probability that a melanoma arises or progresses), sometimes is therapeutic, and sometimes delays, alleviates or halts the progression of a melanoma. Any known preventative or therapeutic treatment for alleviating or preventing the occurrence of a melanoma can be prescribed and/or administered. For example, the treatment sometimes is or includes a drug that reduces melanoma, including, for example, cisplatin, carmustine (BCNU), vinblastine, vincristine, and bleomycin. In another example, the melanoma treatment is surgery. Surgery to remove (excise) a melanoma is the standard treatment for this disease. It is necessary to remove not only the tumor but also some normal tissue around it in order to minimize the chance that any cancer will be left in the area. It is common for lymph nodes near the tumor to be removed during surgery because cancer can spread through the lymphatic system. Surgery is generally not effective in controlling melanoma that is known to have spread to other parts of the body. In such cases, doctors may use other methods of treatment, such as chemotherapy, biological therapy, radiation therapy, or a combination of these methods.

Kits of the invention: A further object of the invention is a kit for performing the methods of the invention, comprising at least one primer and/or at least one probe for amplification of a sequence comprising the polymorphisms of the invention and instructions for use.

In some embodiments, the kit comprise primers and/or probes for amplification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 sequences comprising the polymorphisms of the invention and instructions.

In some embodiments, the kit comprise primers and/or probes for amplification of at least one region comprising a sequence selected from the group consisting of SEQ ID NO: l, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29.

In one embodiment of the invention, the primer or probe may be labelled with a suitable marker. In another embodiment of the invention, the primer or probe may be coated on an array.

The kit can include clinical data such as phenotype of the macula and questionnaire of the patient.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

EXAMPLE 1: IDENTIFICATION OF NEW GENETIC BIOMARKERS INVOLVED IN GENETIC PREDISPOSITION TO CUTANEOUS MELANOMA

Introduction:

Cutaneous Melanoma, the most common and lethal form of skin cancer, is a complex disease that arises through multiple etiological pathways with incidence continuing to increase in fair-skinned populations worldwide. In addition to UV radiation exposure that has been identified as the principal environmental cause genetic factors also play a major role in melanoma risk. In particular, variation in several pigmentation genes has been significantly associated with melanoma susceptibility. Of these, the gene encoding the melanocortin 1 receptor (MC IR), the receptor for a-melanocyte stimulating hormone (a-MSH), has been studied most extensively. The other genes include SLC45A2 (MATP) ASIP, TYR, TYRPl, EDNRB, as well as two SNPs at locus 20q 8. Yet, more than one hundred genes have been implicated in pigmentation in mammals. Pigmentation is a multistep process that plays a crucial role in numerous physiological processes notably protecting against skin cancer. Multiple steps are involved including, differentiation and migration of melanocytes, melanosome biogenesis and synthesis, and migration along melanosomal dendrites, and melanin synthesis. Results

1) A total of 34 different genetic markers belonging to 24 different genes were found to be associated to melanoma risk:

Melanosomal Genes : VPS41, AP3B1, MUTED, HPS3, HPS4, HPS5, MY05A - Genes involved in melanocyte differentiation: WNT3, PAX3, MITF, KIT

Genes involved in melanin biosynthesis: SLC31A2, HERC2, ASIP, DCT, TYRPl, GNA11, TP53, EGFR, SILV

Genes involved in DNA repair: POLH

Genes known to be associated with melanoma risk and used as controls MCIR, SLC45A2, 20Q, TYR.

SNPs MODEL OR ICInf ICSup Pvalue

20q (rs910873) Add 1,65 1,25 2,2 5,22E-04

AP3B1 (rs6453373) Add 0,694 0,532 0,906 0,00715

ASIP (rs4911414) Add 1,25 1,08 1,45 0,0033

ASIP (rs6120580) Add 0,783 0,633 0,968 0,0236

DCT (rs4318084) Dom 0,777 0,64 0,943 0,0105

EGFR (rs 11977660) Add 0,828 0,724 0,947 0,00574

GNA11 (rsl 104737) Add 1,18 1,03 1,35 0,0186

HERC2(rsl2913832) Dom 1,35 1,04 1,74 0,0228

HPS3(rs6440589) Rec 1,33 1,03 1,72 0,0264

HPS4(rs739289) Add 1,27 1,02 1,58 0,0327

HPS5(rs2976045) Add 1,17 1,01 1,36 0,0349 KIT(rs2237028) Rec 0,766 0,593 0,988 0,0397

MClR(rsl 1547464) Add 1,92 1 ,47 2,5 1.39E-06

MClR(rsl805007) Add 1,89 1 ,4 2,54 2,76E-05

MITF(rs6781171) Add 0,825 0,717 0,949 0,00702

MITF(rs7641320) Rec 0,712 0,518 0,979 0,0367

MITF(rs7643531) Rec 0,775 0,617 0,974 0,0287

MUTED(rs2743993) Rec 0,694 0,531 0,907 0,00759

myo5A(rsl7542017) Dom 0,811 0,672 0,978 0,0284

PAX3(rs6436310) Dom 0,774 0,628 0,955 0,0168

PAX3(rs6710486) Rec 1,56 1 ,15 2, 1 0,00393

PAX3(rs930140) Dom 0,783 0,629 0,976 0,0297

POLH(rs6899628) Add 0,645 0,439 0,947 0,0254

POLH(rs6941583) Add 0,63 0,423 0,939 0,0233

RPL24(rs3741983) Rec 0,549 0,315 0,956 0,034

RPS20(rs 1805009) Add 1,68 1 ,12 2,52 0,0128

SILV(rsl0876863) Dom 1,29 1 ,05 1,58 0,0145

SLC31A2(rs3810908) Rec 2, 18 1 ,22 3,9 0,00863

SLC45A2 (rsl6891982) Add 0,427 0,32 0,569 6,57E-09

TP53(rsl042522) Add 0,807 0,678 0,96 0,0157

TYR (rs1126809) recessive 1.51 1.09 2.10 0.015

TYRP1 (rs2733832) Dom 0,794 0,654 0,963 0,019

VPS41(rsl 1773094) Dom 0,746 0,611 0,91 0,00384

WNT3(rsl99524) Add 0,813 0,697 0,95 0,00897

Table B Association of SNPS with melanoma risk

Several genetic markers were replicated in a Spanish cohort of cases and controls: MCIR, SLC45A2, WNT3, VPS41, 20q, TP53, HERC2.

2) Several SNPs were associated with pigmentation characteristics:

- Skin type: The most significant genes associated with skin type are listed in Table 1

SNP gene OR ICIrif ICSup P value rs 12913832 HERC2 0,66 0,58 0,76 1.1 0E-08 rs1126809 TYR 1 ,5 1 ,29 1 ,74 9,32E-08 rs1 6891982 SLC45A2 0,29 0,21 0,41 5.33E-13 rs910873 20Q 1 ,68 1 ,28 2,2 0,00016 rs1805007 MC1R 2,55 1 ,88 3,45 1.23E-09 rs11547464 MC1R 2,68 2,06 3,5 3.44E-13 Table 1. Association between skin type and pigmentation SNPs

-Hair color. The most significant genes associated with hair color are listed in Table 2

SNP gene OR ICInf ICSup P value

rs9516418 DCT 0,778 0,67 0,89 0,0002

rsl2913832 HERC2 0,30 0,26 0,35 l,00E-50

rsl2821256 KTLG 1,81 1,38 2,37 l,36E-05

rsl805009 MC1R 2,16 1,40 3,33 0,00042

rsl6891982 SLC45A2 0,37 0,28 0,49 2,48E-12

rsl2896399 SLC24A4 1,32 1,16 1,52 3,84E-05

rs 11547464 MC1R 1,99 1,53 2,60 2,66E-07

Table 2 Association between hair color and pigmentation SNPs. The association between DCT variant rs9516418 and pigmentation is novel

3) Predictive model

A Predictive model was built including the most significant melanoma and clinical risk factors. This model include 5 genes and 3 clinical parameters (Table 3):

MODEL OR ICInf ICSup P value

WNT3 add 1 ,54380908 1 ,096508122 2,173578498 0,0129

EGFR add 1 ,61403039 1 ,197032575 2,176293405 0,00169

POLH rec 1 ,892199513 1 ,197405 2,990148694 0,0063

MATP add 2,194302259 1 ,550430986 3,105563837 9,22E-06

MC1R add 3,123500602 1 ,679620447 5,808607551 3,20E-04 skin type XXX 1 ,987442876 1 ,584891585 2,492239357 2,71 E-09 eye color XXX 1 ,444729283 1 ,154724001 1 ,807568477 0,00129 nevus count XXX 1 ,366382447 1 ,058666575 1 ,763540133 0,0165

Table 3 4) Replication studies and meta-analyses

The most significant SNPs associated to melanoma risk (MCIR, MATP/SLC45A2, 20q, EGFR, VPS41, TP53, AP3B1, OCA2) were tested in a Spanish cohort of cases and controls (1085 melanomas and 801 controls, Table 4). The association of eight SNPs with melanoma remained significant (Table 4)

SNP model Odd ratio IC IC sup P value

inf

VPS41(rsl 1773094) Dom 0,767 0,635 0,928 0,00624

WNT3(rsl99524) Add 0,797 0,69 0,921 0,00209

20Q(rs910873) Add 1,74 1,27 2,4 6,35E-04

P53(rsl042522) Rec 0,651 0,427 0,993 0,0465

D294H(rsl805009) Add 2,21 1,44 3,38 2,59E-04

R160W(rsl805008) Add 2,53 1,3 4,92 0,00646

HERC2(rsl2913832) Add 1,15 1,01 1,31 0,0404

SLC45A2(rsl6891982) Add 0,475 0,38 0,594 6,32E-11

Table 4 Replication study on Spanish melanoma cases and controls

A meta-analysis was conducted in French and Spanish melanoma patients and controls. Ten SNPs remained significantly associated with melanoma risk, four of which are novel, whereas the others (MCIR, SLC45A2, 20q) have been previously associated to melanoma (Table 5).

SNPs MODEL OR ICInf ICSup P value

VPS41(RS11773094) Add 0.894 0.813 0.982 0.0197

EGFR(RS11977660) Add 0.863 0.788 0.946 0.00157

WNT3(RS199524) Add 0.821 0.741 0.909 1.57e-04

AP3B1(RS6453373) Add 0.815 0.685 0.969 0.0206

20Q(RS910873) Add 1.73 1.42 2.12 8.97e-08

TP53(RS 1042522) Rec 0.629 0.466 0.848 0.00241

MC1R(RS1805009) Add 2.04 1.53 2.71 1.18e-06 MC1R(RS1805007) Dom 1.89 1.41 2.52 1.91e-05

SLC45A2(RS 16891982) Add 0.433 0.366 0.513 3.23e-22

Table 5 Meta-analysis conducted on French and Spanish patients and controls (2154 melanoma patients and 1726 controls)

Conclusion:

In this large association study, we confirmed the role of several genetic variants (MC1R, SLC45A2, 20q, TYR, TYRP1, ASIP) and identified several new biomarkers involved in melanoma risk, the association with melanoma persisting after adjustment on pigmentation characteristics. Some of these markers (WNT3, VPS41 , TP53, EGFR) were either replicated in a Spanish cohort of cases and controls or showed a persistent association in the meta-analysis. These findings may have important consequences in defining high-risk melanoma subgroups that could be benefit of a clinically survey.

REFERENCES

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

Claims

CLAIMS:

1. The present invention relates to a method of determining whether a subject is at risk of having or developing melanoma, comprising testing for said subject the genotype of at least one single nucleotide polymorphism selected from the group consisting of:

rsl 1773094 rsl99524 rsl 042522 rsl 1977660 rs6453373 rs4911414 rs6120580 rs4318084 rsl 104737 rsl2913832 rs6440589 rs739289 rs2976045 rs2237028 rs6781171 rs7641320 rs7643531 rs2743993 rsl 7542017 rs6710486 rs6436310 rs930140 rs6899628 rs6941583 rs3741983 rsl 805009 rsl0876863 rs3810908, rs2733832 and single nucleotide polymorphisms in linkage disequilibrium with said single nucleotide polymorphisms

, wherein: the presence of the allele (T) for rs 1 1773094 the presence of the allele (T) for rsl 99524 the presence of the allele (G) for rsl042522 the presence of the allele (T) for rsl 1977660 the presence of the allele (T) for rs6453373 the presence of the allele (T) for rs491 1414 the presence of the allele (T) for rs6120580 the presence of the allele (T) for rs4318084 the presence of the allele (C) for rsl 104737 the presence of the allele (G) for rsl2913832 the presence of the allele (G) for rs6440589 the presence of the allele (C) for rs739289 the presence of the allele (G) for rs2976045 the presence of the allele (C) for rs2237028 the presence of the allele (T) for rs6781171 the presence of the allele (G) for rs7641320 the presence of the allele (G) for rs7643531 the presence of the allele (G) for rs2743993 the presence of the allele (T) for rsl7542017 the presence of the allele (G) for rs6710486 the presence of the allele (G) for rs6436310 the presence of the allele (G) for rs930140 the presence of the allele (T) for rs6899628 the presence of the allele (T) for rs6941583 the presence of the allele (G) for rs3741983 the presence of the allele (G) for rsl 805009 the presence of the allele (G) for rsl0876863 the presence of the allele (T) for rs3810908 the presence of the allele (T) for rs2733832 indicates an increased risk of having or being at risk of having or developing melanoma.