WO2013032032A1 - Anti-human xcr1 antibodies - Google Patents
Anti-human xcr1 antibodies Download PDFInfo
- Publication number
- WO2013032032A1 WO2013032032A1 PCT/JP2012/072667 JP2012072667W WO2013032032A1 WO 2013032032 A1 WO2013032032 A1 WO 2013032032A1 JP 2012072667 W JP2012072667 W JP 2012072667W WO 2013032032 A1 WO2013032032 A1 WO 2013032032A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- human
- antibody
- amino acid
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/14—Drugs for dermatological disorders for baldness or alopecia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
Definitions
- the present invention relates to an antibody that binds to human XCR1.
- Chemokine is a collective term for basic heparin- binding proteins that have effects on leukocyte chemotaxis and leukocyte activation. Based on a comparison of the primary structures of various chemokines, the chemokines are classified into CXC, CC, C, and CX3C subfamilies according to the positions of conserved cysteine residues.
- XCL1 also referred to as lymphotactin (Ltn) or lymphotactin a (Ltn-a)
- XCL2 also referred to as lymphotactin ⁇ (Ltn- ⁇ )
- XCR1 also referred to as GPR5, SCM- ⁇ , or ATAC
- G protein-coupled chemokine receptor which specifically binds to XCL1 and XCL2.
- XCR1 expression of XCR1 in various human tissues has been examined at the mRNA level. Expression of XCR1 is reportedly high in placenta, but low in spleen and thymus gland (NON PATENT
- XCR1 is mainly expressed in dendritic cells. In mice, XCR1 is highly expressed, particularly in CD8a+ dendritic cells (NON PATENT LITERATURE 2; and NON PATENT
- the CD8 + dendritic cells are normally present in secondary lymphoid tissues such as spleen and lymph nodes, and are known to perform "cross-presentation," which serves an important role in reactions against infection and immunological responses to tumor cells.
- XCR1 is also known to be highly expressed in human CD141+ dendritic cells, which are considered to be homologues of mouse CD8a+ dendritic cells (NON PATENT
- Antigen taken up from the outside of cells into antigen-presenting cells is usually degraded into peptide. presented on class II major histocompatibility antigen (MHC class II), and recognized by CD4+ T-cells.
- MHC class II major histocompatibility antigen
- MHC class I major histocompatibility antigen
- This antigen presentation process is referred to as "cross- presentation. " In this process , the antigen presented on MHC class I is recognized by the CD8+ T-cells , and then
- Non Patent Literature 5 cytotoxic T-cells
- the dendritic cells have particularly excellent antigen-presenting ability, and play a very important role in the activation of the T-cells. It has been suggested that because T-cells are involved in the
- Non Patent Literature 6 Non Patent Literature 6
- Non Patent Literature 7 Non Patent Literature 6
- Non Patent Literature 8 inhibiting XCL-induced migration of normal oral keratinocytes and oral cancer cells.
- Non Patent Literature NPL 1 Yoshida T, Imai T, Kakizaki M, Nishimura M, Takagi S, Yoshie O. "Identification of Single C motif- 1/lymphotactin receptor XCRl, " J. Biol. Chem. 273: 16551-16554 (1998)
- NPL 2 Crozat K, Guiton R, Contreras V, Feuillet V,
- Dutertre CA Ventre E, Vu Manh TP, Baranek T, Storset AK, Marvel J, Boudinot P, Hosmalin A, Schwartz-Cornil I, Dalod M "The XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8a+ dendritic cells," J Exp Med, 207: 1283-1292 (2010)
- NPL 3 Dorner BG, Dorner MB, Zhou X, Opitz C, Mora A, Giittler S, Hutloff A, Mages HW, Ranke K, Schaefer M, Jack RS, Henn V, Kroczek RA "Selective expression of the chemokine receptor XCRl on cross-presenting dendritic cells determines cooperation with CD8+ T-cells," Immunity, 31: 823-833 (2009)
- NPL 4 Bachem A, Guttler S, Hartung E, Ebstein F, Schaefer M, Tannert A, Salama A, Movassaghi K, Opitz C, Mages HW, Henn V, Kloetzel PM, Gurka S, Kroczek RA, "Superior antigen cross-presentation and XCRl expression define human CDllc + CD141 + cells as homologues of mouse CD8 + dendritic cells," J Exp Med, 207: 1273-1281 (2010)
- NPL 5 Kurts C, Robinson BW, Knolle PA, “Cross-priming in health and disease,” Nat Rev Immunol, 10: 403-414 (2010)
- NPL 6 Kurts C, Robinson BW, Knolle PA, “Cross-priming in health and disease,” Nat Rev Immunol, 10: 403-414 (2010)
- NPL 7 Waldner H, "The role of innate immune responses in autoimmune disease development," Autoimmun, Rev 8: 400-404 (2009)
- NPL 8 Khurram SA, Whawell SA, Bingle L, Murdoch C, McCabe BM, Farthing PM, "Functional expression of the chemokine receptor XCRl on oral epithelial cells," J Pathol, 221: 153-63 (2010)
- An object of the present invention is to provide a monoclonal antibody that selectively binds to human XCRl;
- a monoclonal antibody that selectively binds to human XCRl and inhibits cell migration; further preferably an antibody that is effective in the treatment or prevention of immune diseases, in particular, immune diseases of the skin, based on the above-described effect.
- the present inventors conducted intensive studies in an attempt to solve the above problem. As a result, they developed antibodies that bind to human XCRl, and found that such
- antibodies have an effect of inhibiting cell migration as well as a significant effect in the treatment or prevention of immune diseases, such as immune diseases of the skin, associated with migration of dendritic cells.
- antibodies are sometimes simply referred to as the "antibodies,” “antibodies of the present invention,” or “anti- human XCR1 antibodies . "
- the antibodies of the present invention bind to human XCR1.
- the antibodies of the present invention include an antibody that inhibits binding between human XCR1 and human XCL1. Such an antibody has potential as an active ingredient to be added to a human XCRl-human XCL1 binding inhibitor.
- the antibodies of the present invention also include an antibody that inhibits cell migration, particularly that of dendritic cells.
- an antibody has potential as an active ingredient to be added to a cell migration inhibitor,
- the antibodies of the present invention also include an antibody that specifically recognizes BDCA3 (also referred to as CD141)
- the composition has potential as a therapeutic agent for the treatment of immune diseases associated with cell migration, particularly dendritic cell migration.
- the pharmaceutical composition has potential as a therapeutic agent for the treatment of immune diseases of the skin such as delayed-type hypersensitivity, psoriasis, parapsoriasis, atopic dermatitis, contact dermatitis, dermatomyositis , polymyositis, inclusion body myositis,
- autoimmune blistering disease e.g., pemphigus, pemphigoid, or acquired epidermolysis bullosa
- pustulosis e.g., pustulosis, systemic scleroderma, herpes gestationis, linear IgA bullous dermatosis, alopecia areata, vitiligo vulgaris, skin diseases associated with
- collagenosis e.g., systemic lupus erythematosus, Sjogren
- GVHD graft-versus-host disease
- eczema urticaria
- the antibodies of the present invention also has potential as
- therapeutic agents for the treatment of immune diseases such as diabetes mellitus type 1, glomerulonephritis, autoimmune
- thyroiditis graft rejection, Crohn's disease, rheumatoid arthritis, inflammatory bowel disease, anterior uveitis,
- Fig. 1 shows the results of FACS analysis of the reactivity of mouse anti-human XCRl antibodies (2H6, 5G7, and 11H2) to human XCRl-EGFP-expressing B300.19 cells.
- FIG. 2 shows the analysis results of a chemotaxis assay of the neutralizing activity of the mouse anti- human XCRl antibodies (2H6, 5G7, and 11H2) on human lymphotactin- induced migration of human XCRl-EGFP-expressing B300.19 cells.
- FIG. 3 shows the results of FACS analysis of the reactivity of humanized anti-human XCRl antibodies (HK1L2 and HK5L5) to human XCRl-EGFP-expressing B300.19 cells, in parallel with the reactivity of their parent mouse anti-human XCRl antibody (5G7) and its chimeric antibody.
- Fig. 4 shows the results of FACS analysis of the reactivity of mouse anti-human XCRl antibody (5G7) and humanized anti-human XCRl antibodies (HK1L2 and HK5L5) to human BDCA3+ dendritic cells.
- FIG. 5 shows the analysis results of a chemotaxis assay of the neutralizing activity of the humanized anti-human XCRl antibodies (HK1L2 and HK5L5) on human
- lymphotactin-induced migration of human XCRl-EGFP-expressing B300.19 cells in parallel with the neutralizing activity of their parent mouse anti-human XCRl antibody (5G7) and its chimeric antibody.
- Fig. 6 shows the analysis results of a transendothelial migration assay of the neutralizing activity of the humanized anti-human XCRl antibodies (HK1L2 and HK5L5) and a chimeric antibody on human lymphotactin-induced migration of human BDCA3+ dendritic cells, in parallel with an isotype control antibody (human IgG2, ⁇ ).
- Fig. 7 shows the comparison of amino acid sequences of heavy chain CDRs 1 to 3 and light chain CDRs 1 to 3 of the antibodies of the present invention.
- the figure also shows the generalized amino acid sequences of heavy chain CDRs 1 to 3 and light chain CDRs 1 to 3.
- Fig. 8 shows a pharmacological effect of the mouse anti-human XCRl antibody (5G7) of the present invention on a mouse model of delayed-type contact dermatitis (DTH).
- Figs. 8A and 8B respectively show the results obtained by
- Fig. 9 shows binding specificity of the mouse anti-human XCRl antibody (5G7) of the present invention to various human chemokine receptors.
- the abscissa axis of the graph in the figure indicates the fluorescence intensity of
- PE phycoerythrin
- Fig. 10 shows amino acid sequences of human XCRl to which the antibodies of the present invention bind.
- Fig. 11 shows cytotoxity to human XCRl expressing cells, using the antibodies of present invention.
- Fig. 12 shows the analysis of the result of cytotoxic T lymphocyte assay of the mouse anti-human XCRl
- Fig. 13 shows reactivity of mouse anti-human XCRl antibodies (2H6, 5G7, and 11H2) of the present invention to the chimeric human/mouse XCRl-expressing cells.
- Fig. 14 shows the analysis of result of mapping of mouse anti-human XCRl antibodies (2H6, and 5G7)- binding sites on human XCRl extracellular domains by peptide ELISA.
- FIG. 15 shows the analysis of the result of mapping of anti-human XCRl polyclonal antibody-binding sites on human XCRl extracellular domains by using alanine mutants.
- FIG. 16 shows the analysis of the result of mapping of mouse anti-human XCRl antibody (2H6) -binding sites on human XCRl extracellular domains by using alanine mutants.
- FIG. 17 shows the analysis of the result of mapping of mouse anti-human XCRl antibody (5G7) -binding sites on human XCRl extracellular domains by using alanine mutants.
- Fig. 18 shows the analysis of the result of mapping of mouse anti-human XCRl antibody (11H2) -binding sites on human EXRl extracellular domains by using alanine mutants .
- Fig. 19 shows the analysis of the result of mapping of humanized anti-human XCRl antibody (HK1L2) -binding sites on human XCRl extracellular domains by using alanine mutants .
- Fig. 20 shows the analysis of the result of mapping of humanized anti-human XCRl antibody (HK5L5) -binding sites on human XCRl extracellular domains by using alanine mutants .
- Fig. 21 shows the analysis of the result of the competition among mouse anti-human XCRl antibodies (2H6, 5G7, and 11H2) for binding to human XCRl-expressing cells.
- Fig. 22 shows binding specificity of the mouse anti-human XCRl monoclonal antibody (5G7) and commercial goat anti-human XCRl polyclonal antibody to various human
- the abscissa axis of the graph in the figure indicates the fluorescence intensity of phycoerythrin (PE).
- Fig. 23 shows binding specificity of the mouse anti-human XCRl monoclonal antibody (5G7) and humanized anti-human XCRl monoclonal antibodies (HK1L2 and HK5L5) to various human chemokine receptors.
- the abscissa axis of the graph in the figure indicates the fluorescence intensity of
- PE phycoerythrin
- Fig. 24 shows a pharmacological effect of the mouse anti-human XCRl antibody (5G7) of the present invention on a mouse model of delayed-type contact dermatitis (DTH) induced by Mycobacterium butyricum.
- Fig. 25 shows a pharmacological effect of the mouse anti-human XCRl antibody (5G7) of the present invention on a mouse model of multiple sclerosis (MS) by experimental
- EAE autoimmune encephalomyelitis
- Fig. 26 shows the analysis of the result of the competitive ligand binding assay of mouse anti-human XCRl antibodies of the present invention.
- nucleic acid encompasses, for example, ribonucleotides, deoxyribonucleotides , and their modified forms.
- the nucleic acid may be either single- or double-stranded, and either polynucleotide or oligonucleotide.
- protein refers to a compound in which two or more amino acids are linked by peptide bonds.
- the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous
- each monoclonal antibody is directed to a single determinant on the antigen.
- monoclonal antibodies are also advantageous in that they can be synthesized without contamination by other antibodies.
- the modifier "monoclonal” refers to a characteristic of an antibody obtained from a population of substantially homogeneous antibodies, and should not be interpreted to mean that antibodies must be produced by any specific method.
- a monoclonal antibody that should be used in accordance with the present invention can be prepared by the hybridoma method first described by Kohler G and Milstein C, "Continuous cultures of fused cells secreting antibody of predefined specificity," Nature, 256: 495-7 (1975), or by a recombinant DNA method (see U.S. Patent No. 4816567).
- monoclonal antibodies can be isolated from phage antibody library by using a technique, for example, described by Clackson T, Hoogenboom HR, Griffiths AD, and Winter G, "Making antibody fragments using phage display libraries," Nature, 352: 624-8 (1991); or Marks JD, Hoogenboom HR, and
- amino acid sequences or nucleotide sequences refers to the degree of identical amino acid sequences or nucleotide sequences between two or more comparable amino acid sequences or nucleotide sequences. Accordingly, when the identity between two amino acid sequences or nucleotide sequences is high, the identity or similarity of these sequences is high.
- the level of identity between amino acid sequences or nucleotide sequences is determined, for example, using FASTA, which is a sequence analysis tool, based on default parameters.
- BLASTN may be used when analyzing the nucleotide sequence, by setting, for example, the score to 100 and the word length to 12, as
- BLASTX may be used when analyzing the amino acid sequence, by setting, for example, the score to 50 and the word length to 3, as parameters.
- the antibodies of the present invention are isolated antibodies .
- the antibodies of the present invention bind to human XCR1.
- the amino acid sequence of human XCR1 is an amino acid sequence shown by NCBI Reference Sequence: NP_001019815.1 or
- NP_005274.1 In regard to these amino acid sequences, reference may be made to the NCBI websites (respectively,
- a specific antibody of a first embodiment of the present invention is an antibody comprising a heavy chain variable region comprising
- a heavy chain CDR 1 consisting of the amino acid sequence of SEQ ID NO: 53,
- CDR defined in relation to the antibodies of the present invention is an abbreviation for Complementarity
- CDRs are present in the variable region of immunoglobulin, and are deeply involved in the specific binding of an antibody to an antigen. Further, “light chain CDR” refers to a CDR that is present in the variable region of the light chains of immunoglobulin, and “heavy chain CDR” refers to a CDR that is present in the variable region of the heavy chains of immunoglobulin .
- variable region refers to a region that includes the above-described CDR 1 to CDR 3 (hereinafter simply referred to as "CDRs 1 to 3").
- CDRs 1 to 3 the order of arrangement of the CDRs 1 to 3 is not particularly limited, preferably, CDR 1, CDR 2, and CDR 3 are arranged in that order or in the opposite order from N-terminus to C-terminus in a sequential manner or via other amino acid sequences called framework regions (FRs ) .
- the "heavy chain variable region” is a region where the above-described heavy chain CDRs 1 to 3 are located, and
- the "light chain variable region” is a region where the above- described light chain CDRs 1 to 3 are located.
- the region other than the above- described CDRs 1 to 3 in the each variable region is called a framework region (FR) .
- FR framework region
- the region between the N- terminus and CDR 1 in each variable region is defined as FR 1
- the region between CDR 1 and CDR 2 is defined as FR 2
- the region between CDR 2 and CDR 3 is defined as FR 3
- the region between FR 3 is defined as FR 3
- the FRs also have a function as linker sequences for linking the CDRs 1 to 3 that are particularly important as the antigen recognition sequences.
- the FRs are the regions that contribute to the formation of the three-dimensional structure of the entire variable region.
- the heavy chain CDR 3 described in (i) and the heavy chain CDR 3 described in (o) comprise identical amino acid sequences .
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (A) -(C) above or
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (a) -(c) above;
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (D)-(F) above or
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (d)-(f) above.
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (m)-(o) above, and
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (a) -(c) above;
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (d)-(f) above.
- An antibody of a third embodiment of the present invention is an antibody comprising
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (A) -(C) above, and
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (D)-(F) above, or
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (a) -(c) above, and
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (d)-(f) above.
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (g)-(i) above, and
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (j)-(l) above;
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (m)-(o) above, and
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (p)-(r) above;
- a heavy chain variable region comprising the heavy chain CDRs 1 to 3 described in (a) -(c) above, and
- a light chain variable region comprising the light chain CDRs 1 to 3 described in (d)-(f) above.
- the molecular structures of the antibodies of the present invention are not limited to that of immunoglobulin insofar as the antibodies have the above-described heavy and light chain variable regions.
- specific structures include molecular structures of F(ab' ) 2 that does not comprise the Fc region; Fab formed by papain digestion of immunoglobulin and composed of CHI and CL domains as well as the heavy and light chain variable regions; Fv that does not comprise the immunoglobulin constant region; and scFv, which is a single-chain Fv antibody.
- the antibodies of the present invention may also be multivalent, in which the above molecular structures are combined.
- Such a multivalent antibody is formed by a technique of
- multivalent refers to the presence of multiple antigen-binding sites.
- the term is used in the same meaning as the presence of multiple sites that bind to human XCRl.
- the antibodies of the present invention may also have a human constant region in addition to the above-described heavy and light chain variable regions.
- the "constant region" of the heavy chains comprises domains called CHI, CH2, and CH3;
- Constant region of the light chains comprises a domain called CL.
- the heavy chain variable region is linked to at least one of the CHI, CH2, and CH3 domains, and that the light chain variable region is linked to CL. Further, the heavy chain variable region is
- CHI preferably directly linked to CHI.
- the constant region of the antibodies of the present invention is a constant region derived from human immunoglobulin, preferably, a constant region derived from human immunoglobulin IgG.
- the subtype of human immunoglobulin IgG is not particularly limited, and may be suitably selected, for example, according to whether to impart ADCC activity, CDC activity, and the like described below to the antibodies.
- ADCC activity is an abbreviation for Antibody-Dependent Cellular Cytotoxicity activity. It is an activity in which cells such as NK cells expressing receptors specific for the antibody Fc region bind to the antibodies and damage cells present in the vicinity of the antibodies.
- the subtype of IgG having a high ADCC and/or CDC activity is IgGl
- the subtype of IgG having a low ADCC and/or CDC activity is IgG2 or IgG4.
- Amino acid residues in the Fc region of the antibodies of the present invention may be mutated in order to induce a change in ADCC and/or CDC activity. Mutations to be introduced are not particularly limited, and known mutations may be
- mutations that increase CDC activity include S267E, H268F, S324T, S267E/H268F, S267E/S324T,
- H268F/S324T S267E/H268F/S324T (Moore GL, Chen H, Karki S, Lazar GA, "Engineered Fc variant antibodies with enhanced ability to recruit complement and mediate effector functions," MAbs, 2:181-9 (2010)) .
- V234A/G237A Cold MS, Anasetti C, Tso JY, "Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells," J Immunol, 159:3613-21 (1997)), H268Q/V309L/A330S/P331S (An Z.
- the numbering of the above-described amino acids to be mutated is in accordance with the Eu numbering (see Sequences of proteins of immunological interest, NIH Publication No. 91-3242).
- an antibody in which the heavy and light chain variable regions comprise amino acid sequences derived from non-human species and the constant region comprises amino acid sequences derived from human is defined as a "chimeric antibody.”
- a first embodiment of the chimeric antibody of the present invention is a chimeric antibody comprising a heavy chain consisting of the amino acid sequence of SEQ ID NO: 13 and a light chain of SEQ ID NO: 14.
- the amino acid sequence of SEQ ID NO: 13 comprises the heavy chain CDRs 1 to 3 of SEQ ID NOs: 17 to 19 among the heavy chain CDRs 1 to 3 described above in the heavy chain variable region.
- the amino acid sequence of SEQ ID NO: 14 comprises the light chain CDRs 1 to 3 of SEQ ID NOs: 20 to 22 among the light chain CDRs 1 to 3 described above in the light chain variable region.
- the chimeric antibody of the present invention is a chimeric antibody of the present invention.
- Such variants in the heavy and light chains are preferably obtained by introducing mutations into at least any one of FR 1 to FR 4 (hereinafter simply referred to as "FRs 1 to 4") of the variable region, or at least one site in the constant region of the respective amino acid sequences of SEQ ID NOs: 13 and 14.
- the specific number of mutations introduced into the heavy and light chains is not particularly limited. Mutations are usually introduced to obtain a variant having 85% or higher identity, preferably 90% or higher identity, more preferably 95% or higher identity, and most preferably 99% or higher identity with the amino acid sequence before mutation.
- mutation used herein includes substitution, deletion, insertion, and the like.
- conservative substitution refers to a substitution of an amino acid residue with another amino acid residue having a similar side chain.
- a substitution between amino acid residues with basic side chains such as lysine, arginine, and histidine corresponds to a conservative substitution.
- the following substitutions between the amino acid residues also correspond to conservative substitutions: substitutions between amino acid residues with acid side chains such as aspartic acid and glutamic acid; substitutions between amino acid residues with non-charged polar side chains such as glycine, asparagine,
- substitutions between amino acid residues with non-polar side chains such as alanine , valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan
- substitutions between amino acid residues with ⁇ -branched side chains such as threonine, valine, and isoleucine
- substitutions between amino acid residues with aromatic side chains such as tyrosine
- the antibody comprising the above-described CDRs 1 to 3 in the heavy and light chain variable regions, in which the FRs 1-4 comprise a human-derived amino acid sequence or a variant thereof, is defined as a "humanized antibody.”
- Such FRs comprising a human-derived amino acid sequence are not particularly limited, and may be determined based on a known technique.
- FRs include fully human framework regions or sub-regions, with FRs derived from human germline sequences being preferable. Reference may be suitably made to, for example, the NCBI website, which shows a list of currently known sequences of FRs as examples of fully human framework regions or sub-regions.
- Non-limiting examples of the sequences of the human heavy chain variable region include VH1-18, VHl-2, VH1-24, VH1-3, VH1-45, VHl-46, VH1-58, VH1-69, VHl-8, VH2-26, VH2-5, VH2-70, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33, VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, YH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59. VH4-61, VH5-51, VH6-1, and VH7-81.
- Non-limiting examples of the sequences of the human light chain variable region include VLl-11, VLl-13, VLl-16, VL1- 17, VL1-18, VL1-19, VL1-2, VL1-20, VL1-22, VL1-3, VL-4, VL1-5,
- Fully human FRs are selected from these functional germline genes. Each of these FRs is usually different because of the modification of a limited number of amino acids. These FRs may be used in a combination with the CDRs described in the present specification. Non-limiting additional examples of human FRs to be used in combination with the above-described CDRs include KOL, NEW , REI, EU, TUR, TEI , LAY, and POM. In regard to the examples of these human FRs , reference may be made to the following documents: Rabat, et al., "Sequences of Proteins of Immunological Interest , " US Department of Health and Human
- a first embodiment of the humanized antibody of the present invention is a humanized antibody comprising a heavy chain variable region comprising the amino acid sequence of either SEQ ID NO: 60 or SEQ ID NO: 64, and a light chain variable region of either SEQ ID NO: 68 or SEQ ID NO: 72.
- a more preferable embodiment is a humanized antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 60 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 68, or a humanized antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 64 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 72.
- the amino acid sequences of SEQ ID NO: 60 and SEQ ID NO: 64 comprise the heavy chain CDRs 1 to 3 of SEQ ID NOs: 17 to 19 among the above-described heavy chain CDRs 1 to 3 in the heavy chain variable region.
- the amino acid sequences of SEQ ID NO: 68 and SEQ ID NO: 72 comprise the light chain CDRs 1 to 3 of SEQ ID NOs: 20-22 among the above-described light chain CDRs 1 to 3 in the light chain variable region.
- the humanized antibody of the present invention comprises variants caused by mutations in the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 60 or 64 and/or the light chain variable region comprising the amino acid sequence of SEQ ID NO: 68 or 72, insofar as such mutation do not abolish the binding ability to human XCR1.
- Such variants in the heavy and light chain variable regions are preferably obtained by introducing mutations into the respective FRs 1 to 4.
- the specific number of mutations into the heavy and light chain variable regions is not particularly limited.
- Mutations are usually introduced to obtain a variant having 85% or higher identity, preferably 90% or higher identity, more preferably 95% or higher identity, and most preferably 99% or higher identity with the amino acid sequence before mutation.
- mutation used herein includes substitution, deletion, insertion, and the like. As is the case with the chimeric antibody described above, conservative substitution and the like may be employed as a specific method for introducing mutations .
- Examples thereof include a humanized antibody comprising a heavy chain comprising the amino acid sequence of either SEQ ID NO: 59 or 63, and a light chain comprising the amino acid sequence of either SEQ ID NO: 67 or 71.
- a more preferable embodiment is a humanized antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 59 and a light chain comprising the amino acid
- sequence of SEQ ID NO: 67 or a humanized antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 63 and a light chain comprising the amino acid sequence of SEQ ID NO: 71.
- the amino acid sequence of SEQ ID NO: 67 comprises an amino acid sequence corresponding to the light chain variable region of SEQ ID NO: 68, and therefore comprises the light chain CDRs 1 to 3 of SEQ ID NO: 20-22 among the light chain CDRs 1 to 3 described above.
- the heavy and/or light chain described above comprises variants caused by mutations insofar as such mutations do not abolish the binding ability to human XCRl.
- Such variants in the heavy and light chains are preferably obtained by introducing mutations into the FRs 1 to 4 or the constant region.
- the specific number of mutations into the heavy and light chains is not particularly limited. Mutations are usually introduced to obtain a variant having 85% or higher identity, preferably 90% or higher identity, more preferably 95% or higher identity, and most preferably 99% or higher identity with the amino acid sequence before mutation.
- mutation used herein includes substitution, deletion, insertion, and the like. As is the case with the chimeric antibody described above, conservative substitution and the like may be employed as a specific method for introducing mutations .
- the antibodies of the present invention bind to human XCRl.
- the meaning of the term "bind” used herein encompasses, at least, binding through hydrophobic bonds and the like as seen in the case of an interaction between proteins. In other words, antibodies that bind to human XCRl at least by hydrophobic
- binding are sufficient as the antibodies of the present invention. Further, the antibodies of the present invention and human XCRl may or may not be dissociated after binding.
- the antibodies of the present invention preferably specifically bind to human XCRl.
- the term "specific binding” as used herein refers to specific binding to human XCRl, meaning that the antibodies preferentially bind to human XCRl when human XCRl is present concurrently with molecules other than human XCRl, in particular, molecules having a structure similar to that of human XCRl, such as a homologue of human XCRl or an orthologue of human XCRl.
- antibodies of the present invention specifically bind to human XCRl does not mean that the ability of binding to the above-described homologue or orthologue of human XCRl is excluded.
- the degree of binding of the antibodies of the present invention to human XCRl can be evaluated by a reaction rate constant such as a Kd, Koff, or Kon value.
- a Kd value is a value obtained by dividing a Koff value by a Kon value.
- reaction rate constant between the antibodies of the present invention and human XCRl is not particularly limited.
- the antibodies of the present invention bind to the extracellular domain of human XCRl. Specifically, the antibodies bind to one or more of amino acid regions 1 to 31, 90 to 103, 168 to 190, and 251 to 267, which corresponds to the extracellular domain region of the amino acid sequence (SEQ ID NO: 91; Fig. 10) of the above-described NCBI Reference Sequence: NP_001019815.1 or NP_005274.1.
- the antibodies bind to at least three amino acids
- Said "at least three amino acids” includes, for example, three or more amino acids, four or more amino acids, five or more amino acids, six or more amino acids, seven or more amino acids, eight or more amino acids, nine or more amino acids, ten or more amino acids, or eleven amino acids.
- epitope in the present invention is also referred to as an "antigenic determinant,” and includes
- linear epitope and “discontinuous epitope.”
- a “linear epitope” is an epitope that is recognized by antibodies by the primary structure of the amino acid sequence, rather than by its conformational structure.
- a “discontinuous epitope” is an epitope that is recognized by antibodies by the conformational structure of the amino acid sequence, based on the higher-order structure
- the epitope of the antibodies of the present invention can be determined by suitably modifying the methods described in the Examples of the present invention.
- the epitope can be determined by
- the epitope can be determined by preparing a mutant by introducing an
- the antibodies of the present invention bind to human XCRl
- the antibodies of the present invention also include an antibody that inhibits binding between human XCRl and human XCL1.
- Human XCL1 is also referred to as human lymphotactin (Ltn) or human lymphotactin a (Ltn- ).
- Such an inhibitory activity is sometimes referred to as "neutralizing activity” induced by the antibodies of the present invention.
- the antibodies of the present invention also include an antibody that inhibits binding not only between human XCRl and XCL1, but also between human XCRl and XCL2.
- preferred cells include cells associated with an immune system activated by the binding between human XCRl and human XCL1, with dendritic cells being particularly
- the antibodies have an effect of inhibiting binding between human XCRl and human XCL1 on BDCA3+ dendritic cells.
- Binding between human XCRl and human XCL1 is inhibited by the antibodies of the present invention.
- Non-limiting examples of forms of such inhibition include:
- the antibodies of the present invention bind to XCRl at a site to which human XCL1 originally should bind, causing a steric obstruction to binding to human XCL1, and resulting in the inhibition of binding between human XCRl and human XCL1.
- the antibodies of the present invention bind to human XCRl, causing a change in the three-dimensional structure of human XCRl, which consequently causes a change in the
- the inhibitory activity of the antibodies of the present invention against binding between human XCRl and human XCL1 is evaluated based on IC 50 or IC 90 values. These values can be obtained, for example, by performing a competitive inhibition experiment or the like of binding of human XCL1 to human XCRl, using cells those express human XCRl proteins in the presence of the antibodies of the present invention. A known method may be employed as a specific method of such a competitive inhibition experiment .
- the antibodies of the present invention include an antibody that has an effect of inhibiting cell migration.
- cell migration refers to the phenomenon in which cells actively migrate as a result of external stimuli given to the cells and stimulus-induced activation of the intracellular signal transduction mechanism. Effects produced by the active cell migration vary depending on the functions of the cells. For example, in the case of cell migration of dendritic cells, such cell migration is a phenomenon that serves as one of the cells.
- inhibitory activity against cell migration is sometimes referred to as “neutralizing activity.
- the antibodies of the present invention suitably inhibit binding between human XCRl and human XCL1 in dendritic cells, particularly BDCA3+ dendritic cells, the antibodies particularly preferably inhibit migration of dendritic cells, particularly BDCA3+ dendritic cells.
- Human XCRl is a seven-transmembrane G protein-coupled receptor.
- human XCL1 binds to human XCRl, the three- dimensional structure of human XCRl changes; and, as a result, a G protein coupled to the intracellular domain of human XCRl is released, and a signal is transduced into the cells.
- G proteins is prevented from release by the antibodies of the present invention inhibiting the binding between human XCRl and XCL1 in accordance with the above-described forms (1), (2) or the like. As a result, no signal is transduced, thereby inhibiting the phenomena of cell migration.
- the phenomena of cell migration may be inhibited as a result of a mechanism in which binding of the antibodies of the present invention to human XCRl strengthens the bond between human XCRl and G protein coupled to the
- an IC 50 value is usually about 0.36 nM or less, preferably about 0.27 nM or less, and more preferably about 0.16 nM or less.
- an IC 90 value is usually about 2.38 nM or less, preferably about 1.52 nM or less, and more preferably about 0.86 nM or less.
- the antibodies of the present invention include, as an embodiment, an antibody that has an effect of decreasing
- CTL cytotoxic T lymphocyte
- the antibodies of the present invention inhibiting the interaction between human XCR1 and human XCL1 in dendritic cells.
- the dendritic cells the above-described BDCA3+ dendritic cells are preferable.
- the antibodies of the present invention can be prepared by a method comprising the following three steps, although it is not limited thereto.
- Step 1 of introducing a vector into the host to transform the host, the vector comprising a nucleic acid
- Step 2 of culturing the transformed host obtained in step 1 and collecting a fraction containing antibodies that bind to human XCR1;
- the nucleic acid used in step 1 is a nucleic acid that encodes the antibodies of the present invention.
- the nucleotide sequence of the above nucleic acid can be determined using the in silico technique based on the amino acid sequence information of the antibodies of the present invention. At that time, it is preferable to determine the nucleotide sequence with reference to the codon frequency in the host employed in step 2.
- Specific examples of nucleotide sequences include the nucleotide sequence of SEQ ID NO: 3, 4, 7, 8, 11, 12, 15, 16, 61, 62, 65, 66, 69, 70, 73, or 74; or a variant thereof.
- the above variant is preferably generated by introducing mutations (deletion, substitution, insertion, or the like) in the FR or constant region of the antibodies.
- the specific number of mutations introduced into the variant is not particularly limited. Mutations are usually introduced to obtain a variant having 85% or higher identity, preferably 90% or higher identity, more preferably 95% or higher identity, and most preferably 99% or higher identity with the amino acid sequence before mutation.
- nucleic acid may comprise a
- secretion signal peptide refers to a peptide comprising an amino acid sequence that acts as a recognition sequence for introducing proteins or peptides produced in the host into a pathway for secretion of the proteins or peptides to the outside of the host.
- nucleotide sequences encoding a secretion signal peptide include:
- ATGAAGTTGCCTGTTAGGCTGTTGGTGCTGCTGTTCTGGTTTCCTGCTTCCAACACT SEQ ID NO: 76
- ATGGAATGGTCATGGGTCTTTCTGTTCTTTCTGAGTGT(I-ACAACCGGGGTGCATAGC SEQ ID NO: 77)
- the vector used in step 1 comprises at least one of the above nucleic acids.
- Such a vector may be one of the following vectors:
- the above vector may be a gene expression vector.
- gene expression vector is a vector having a function to cause expression of the nucleotide sequence of the above nucleic acid.
- the gene expression vector may contain a promoter sequence, enhancer sequence, repressor sequence, insulator sequence, and the like to control the expression of the nucleotide sequence. These sequences are not particularly limited insofar as they function in the above-described host.
- the host used in step 1 is not particularly limited insofar as the above gene is expressed.
- Examples thereof include insect cells, eukaryotic cells, and mammalian cells. Of these cells, HEK cells, CHO cells, NSO cells or SP2/0 cells, which are mammalian cells, are particularly preferable in terms of more efficient expression of the nucleotide sequence that encodes antibodies .
- a technique for introducing the above vector into the host in step 1 is not particularly limited. A known technique may be used.
- the vectors shown in (I) to (III) above may be
- a host with the above vector can be produced by such a technique.
- the vector may be maintained as is in the host, or in such a manner that the nucleic acid comprising the nucleotide sequence encoding antibodies in the vector is incorporated into the genome of the host.
- the prepared host may be maintained using a known technique, and can be stored for a long period of time, if necessary.
- Step 2 is a step of culturing the above-described host obtained in step 1 and collecting a fraction containing the antibodies of the present invention, which bind to human XCR1. Culturing the host maintaining the above-described vector allows the host to express the nucleotide sequence encoding the
- antibodies of the present invention based on the nucleic acid in the vector, resulting in the production of the antibodies of the present invention.
- the produced antibodies are stored in the host or in the medium used for culturing the host .
- a known method may be employed as a technique for collecting a fraction containing the antibodies of the present invention.
- the host is disrupted by physical or chemical means, and the solution obtained by disruption is subjected to solid-liquid separation treatment, thereby obtaining a liquid fraction.
- the obtained liquid fraction may be used as the fraction containing the antibodies of the present invention.
- the medium i.e., the culture solution of the host obtained in step 1
- the medium is subjected to solid-liquid separation treatment, thereby obtaining a liquid fraction.
- the obtained liquid fraction may be used as the fraction containing the antibodies of the present invention.
- the medium used for cultivation in step 2 is not particularly limited insofar as the medium allows the host to express the nucleotide sequence encoding the antibodies of the present invention, thereby producing the antibodies of the present invention.
- the conditions employed during cultivation of the host such as container, temperature, time, host concentration in the medium, and culture conditions
- the conditions used in a known method for producing antibodies may be employed.
- Step 3 is a step of isolating or purifying the antibodies of the present invention, which bind to human XCR1, from the fraction obtained in step 2.
- the method for isolating and purifying the antibodies of the present invention is not particularly limited. A generally used method for isolating or purifying protein is widely applicable.
- the antibodies of the present invention have an effect of inhibiting the phenomena of cell migration of dendritic cells associated with the immune system.
- the antibodies of the present invention in particular, the humanized antibody, have potential as an active ingredient of a pharmaceutical composition that is clinically applicable to human.
- XCR1 is highly expressed in CD141+ dendritic cells in the case of humans, and in CD8a+ dendritic cells in the case of mice. These dendritic cells activate T-cells using the above- described antigen presentation method called cross-presentation (Bachem A, Giittler S, Hartung E, Ebstein F, Schaefer M, Tannert A, Salama A, Movassaghi K, Opitz C, Mages HW, Henn V, Kloetzel PM, Gurka S, Kroczek RA, "Superior antigen cross-presentation and XCR1 expression define human CDllc + CD141 + cells as homologues of mouse CD8 + dendritic cells," J Exp Med, 207: 1273-1281 (2010)).
- cross-presentation Bachem A, Giittler S, Hartung E, Ebstein F, Schaefer M, Tannert A, Salama A, Movassaghi K, Opitz C, Mages HW, Henn V, Klo
- the source of production of XCL1, which is a ligand for human XCR1 comprises T-cells, in
- CD8+ T-cells the chemokine system in which XCLl-XCRl is involved controls dendritic cell-induced activation of CD8+ T- cells
- XCLl-XCRl the chemokine system in which XCLl-XCRl is involved controls dendritic cell-induced activation of CD8+ T- cells
- Crozat K Guiton R, Contreras V, Feuillet V, Dutertre CA, Ventre E, Vu Manh TP, Baranek T, Storset AK, Marvel J, Boudinot P, Hosmalin A, Schwartz-Cornil I, Dalod M
- the XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8a+ dendritic cells
- J Exp Med, 207: 1283- 1292 (2010) and Dorner BG, Dorner MB, Zhou X, Opitz C, Mora A, Guttler S, Hutloff A, Mages
- the antibodies of the present invention include, as an embodiment, an antibody that exhibits an effect of inhibiting binding between human XCLl and human XCRl in dendritic cells, in particular, BDCA3+ dendritic cells.
- the antibodies of the present invention has
- the antibodies have potential as therapeutic agents for the treatment of diseases associated with the control of the activation of CD8+ T-cells.
- the antibodies of the present invention include, as an embodiment, an antibody that exhibits an effect of decreasing CTL activity.
- CTL has a mechanism to
- the antibodies of the present invention have potential as a therapeutic agent for the treatment of
- Non-limiting examples of such diseases include diabetes mellitus type 1, psoriasis, glomerulonephritis, autoimmune hepatitis, multiple sclerosis, ankylosing spondylitis,
- macrophage inflammatory protein-lalpha is critical to the recruitment of CD8(+) T cells to the liver, lung, and spleen during graft-versus-host disease," Blood, 96: 2973-2980 (2000); Sugihara T, Sekine C, Nakae T, Kohyama K, Harigai M, Iwakura Y, Matsumoto Y, Miyasaka N, Kohsaka H, "A new murine model to define the clinical pathologic and therapeutic mediators of
- delayed-type hypersensitivity is a disease known as one of the immune diseases in which CD8+ T-cells that are activated by migration of the dendritic cells are involved.
- the fact that the antibodies of the present invention are effective in the treatment of delayed-type hypersensitivity provides evidence that the antibodies of the present invention have activity of inhibiting cell migration, in particular, dendritic cell migration, because the antibodies of the present invention affect CD8+ T-cells.
- atopic dermatitis and contact dermatitis are also known as immune diseases of the skin in which the DTH reaction is involved
- the antibodies of the present invention have potential as therapeutic agents for the treatment of immune diseases of the skin such as atopic dermatitis or contact dermatitis. It has been pointed out that the activation of CD8+ T- cells may also be involved in the DTH reaction (Mody CH, Pain III R, Jackson C, Chen G-H, Toews GB, "CD8 Cells play a critical role in delayed-type hypersensitivity to intact Cryptococcus
- psoriasis is an autoimmune skin disease affecting a large number of patients, in particular, in chronic psoriasis lesions- These cells are considered to be the main effector cells that cause psoriasis lesions (Gudjonsson JE, Johnston A,
- the antibodies of the present invention have potential as therapeutic agents for the treatment of immune diseases of the skin in which the activation of CD8+ T- cells is involved.
- non-limiting examples of immune diseases of the skin in which CD8+ T-cells are involved also include dermatomyositis , polymyositis, inclusion body myositis, psoriasis, parapsoriasis, autoimmune blistering
- GVHD graft-versus-host disease
- CD8+ T-cells play an important role in human multiple sclerosis and its mouse model (Friese MA, Fugger L, "Autoreactive CD8+ cells in multiple sclerosis: a new target for therapy?" Brain, 128: 1747-1763
- the antibodies of the present invention that control the activation of CD8+ T-cells has potential as therapeutic agents for the treatment of multiple sclerosis.
- Non-obese diabetic mice representing a model of human type 1 diabetes mellitus have shown that depletion of CD8+ T-cells results in inhibition of the onset of diabetes mellitus (Wang B, Gonzales A, Benoist C, Mathis D, "The role CD8+ T-cells in the initiation of insulin-dependent diabetes mellitus,” Eur J Immunol, 26: 1762-1769 (1996)). This suggests that CD8+ T-cells are also involved in the development of the pathology of diabetes mellitus type 1.
- the antibodies of the present invention that control the activation of CD8+ T-cells has potential as therapeutic agents for the treatment of human type 1 diabetes mellitus .
- the antibodies of the present invention which control the activation of CD8+ T-cells, have potential as therapeutic agents for the treatment of glomerulonephritis.
- Autoimmune Hepatitis Autoimmune Hepatitis
- HCV hepatitis C virus
- the antibodies of the present invention which control the activation of CD8+ T-cells, have potential as therapeutic agents for the treatment of autoimmune hepatitis.
- Thyroiditis Thyroiditis
- CD8+ CTLs are known to be involved in the development of experimental autoimmune thyroiditis (EAT) , which is a mouse model of human thyroiditis (for example, Hashimoto's disease). It has been reported that the mice in the model show lesions similar to human thyroiditis (antithyroglobulin antibodies are found in the peripheral blood, and the invasion of CD8+ T-cells and CD4+ T-cells into the thyroid gland is observed). As described above, it has been suggested that CD8+ T-cells are involved in the development of thyroiditis in human and mouse models (Brazillet M-P, Batteux F, Abehsira-Amar O, Nicoletti F, Charreire J,
- the antibodies of the present invention which control the activation of CD8+ T-cells, have potential as therapeutic agents for the treatment of human thyroiditis.
- 5G7 which is one of the antibodies of the present invention, exhibits a
- the antibodies of the present invention have potential as a therapeutic agent for the treatment of rheumatoid arthritis .
- CD8+ T-cells play an important role in the graft rejection after human organ transplantation. A graft is rejected by CD8+ T-cells in the host that recognizes MHC class I being expressed in the cells in the graft. Further, invasion of many CD8+ T-cells into the kidney has been reported in renal
- CD8+ T-cells also play a central role in the graft rejection after human organ transplantation (Bueno V, Pestana JOM, "The role of CD8+ T-cells during allograft
- the antibodies of the present invention which control the activation of CD8+ T-cells, have potential as therapeutic agents for the treatment of graft-versus-host disease.
- CD8+ T-cell lines showed cytotoxicity against their own cultured muscle cells. This indicates that muscle cell damage in the patients with the above-described myositis is caused by CD8+ T-cells with antigen-specific cytotoxicity
- the antibodies of the present invention which control the activation of CD8+ T- cells, have potential as therapeutic agents for the treatment of dermatomyositis, polymyositis, or inclusion body myositis.
- the antibodies of the present invention have potential as therapeutic agents for the treatment of Immune diseases, in particular, immune diseases of the skin, the present invention provides a pharmaceutical
- composition comprising the antibodies of the present invention.
- Such a pharmaceutical composition has potential as a therapeutic agent for the treatment of immune disease, for the purpose of treating immune diseases, in particular, immune diseases of the skin.
- treatment means attainment of desired pharmacological and/or physiological effects.
- the effects include an effect of partially or completely curing disease and/or adverse effects caused by the disease (pathologies and symptoms ) .
- the above effects also include an effect of inhibiting or delaying the progression of the disease and/or adverse effects caused by the disease (pathologies and symptoms); an effect of alleviating pathologies and symptoms (i.e., ameliorating the disease or symptoms, or causing reversal of the progression of symptoms) ; and an effect of preventing recurrence of the disease.
- the above effects also include an effect of partially or
- treatment also means “relief,” “prevention of recurrence,” and “prevention of
- a pharmaceutical composition comprising the antibodies of the present invention can be
- the above pharmaceutical composition is capable of providing, for example, an effect of partially or completely curing various symptoms of immune diseases; an effect of partially or completely inhibiting various symptoms of immune diseases (i.e., inhibiting or delaying the progression) ; an effect of alleviating various symptoms of immune diseases (i.e., ameliorating the disease or symptoms, or causing reversal of the progression of symptoms); or an effect of preventing recurrence of various symptoms of immune diseases .
- target diseases are as described above, with immune diseases of the skin being preferable.
- the content of the antibodies of the present invention in the above pharmaceutical composition is not particularly limited insofar as the pharmaceutical composition comprises an effective amount of the antibodies of the present invention.
- the content can be suitably determined, for example, in such a manner the antibodies of the present invention are contained in the pharmaceutical composition in an amount of 0.001 to 99.99 wt% relative to 100 wt% of the composition, by taking into account the type of the target immune disease, dosage form,
- an effective amount refers to an amount that allows the antibodies of the present invention to demonstrate an effect of inhibiting cell migration of dendritic cells, or an amount that allows the antibodies to demonstrate the above-described desired pharmacological and/or physiological effects ( treatment effect for immune diseases) .
- compositions may be added in combination with the antibodies of the present invention to the pharmaceutical composition.
- pharmaceutically acceptable carriers or additives used herein refers to optional carriers, diluents, excipients, suspending agents, lubricants, adjuvants, vehicles, delivery systems, emulsifiers, disintegrants , absorbents, preservatives,
- surfactants colorants, fragrances, or sweeteners.
- Known carriers or additives may be used.
- Non-limiting examples of dosage forms of the pharmaceutical composition include tablets, syrups, liniments, injections, and infusions, with injections or infusions being preferable. Such injections and infusions may be in aqueous, nonaqueous, or suspension form. Additionally, the pharmaceutical composition may have a dosage form that is prepared just before administration.
- the pharmaceutical composition of the present invention specifically, a therapeutic agent for an immune disease, has potential in methods of treating an immune disease, comprising a step of administering the composition to a human subject with an immune disease, in particular, an immune disease of the skin.
- the pharmaceutical composition also has
- an immune disease comprising administering the composition to a human subject who has not developed pathologies or symptoms of an immune disease, in particular, an immune disease of the skin, but who may possess a predisposition to the immune disease.
- the dosage amount and administration method of the pharmaceutical composition (therapeutic agent for immune
- diseases can be suitably determined within a range of 0.001 to 100 mg/kg/day, according to the type of immune disease, the human subject's sex, race, age, and general condition, the severity of the disease, and the like.
- the antibodies of the present invention may be administered at the above-described dosage once a day, or in divided dosage several times per day. Further, in the range that the antibodies have a treatment effect on the above-described diseases, the administration interval may be every day, every other day, every week, every other week, every 2 to 3 weeks, every month, or every 2 to 3 months.
- administration methods include oral, intramuscular, intravenous, intraarterial, intrathecal, intradermal, intraperitoneal,
- the antibodies of the present invention may have been conjugated to cytotoxic molecules. Because such antibodies bind to human XCRl protein that is expressed in a significant amount in dendritic cells associated with the immune system, the
- antibodies may be used as immunotoxins that target dendritic cells .
- cytotoxic molecules used herein refers to molecules that demonstrate effects, such as apoptosis and/or necrosis, which cause the death of cells.
- Examples of such molecules include saporin, ricin, Pseudomonas exotoxin, diphtheria toxin, and chemotherapeutic agents. Binding between the antibody and a toxic substance may be performed by a method used for the preparation of conventional immunotoxins.
- the antibodies of the present invention also include, as an embodiment, an antibody that binds to XCRl that is expressed in a significant amount in dendritic cells, the
- label refers to binding the antibodies to labeled molecules such as fluorescent molecules, luminescent molecules, chromogenic
- the binding pattern is not limited insofar as the bond is not dissociated in a detection step.
- a known method may be employed as a specific detection method. For example, a flow cytometry technique may be employed.
- antibodies of the present invention may also be suitably applicable in methods of isolating and/or
- removing dendritic cells after the detection of dendritic cells may also be employed for these methods.
- a known cell-sorting device may be suitably used in a combination with a flow cytometry technique.
- the present invention relates to the antibodies explained above, and widely encompasses the inventions of the embodiments described below.
- an antibody binding to human XCR1 wherein the antibody binds to linear or discontinuous epitopes which comprise at least three amino acids selected from the group consisting of the 8th, 11th, 12th, 13th, 14th. 16th, 17th, 22nd. 23rd, 176th, and 177th amino acids in the amino acid sequence of SEQ ID NO: 91.
- the antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (g) to (i) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (j) to (1) below;
- the antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (m) to (o) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (p) to (r) below; or
- the antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (a) to (c) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (d) to (f) below:
- the antibody according to above item 1 or 2 wherein the antibody comprises a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 60 or 64, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 68 or 72.
- the antibody according to any one of above items 1 to 8 comprising an Fc region, wherein the Fc region is mutated to induce a change in ADCC activity.
- a pharmaceutical composition comprising the antibody according to any one of above items 1 to 14 and a
- the pharmaceutical composition is a therapeutic agent for an immune disease.
- autoimmune blistering disease pemphigus, pemphigoid, or acquired epidermolysis bullosa
- pustulosis herpes gestationis
- linear IgA bullous dermatosis alopecia areata
- vitiligo vulgaris skin disease associated with collagenosis (systemic lupus
- composition according to above item 17 wherein the immune disease of the skin is psoriasis, atopic dermatitis, contact dermatitis, dermatomyositis, polymyositis, or inclusion body myositis.
- composition according to above item 17-19 wherein the immune disease of the skin is atopic dermatitis or contact dermatitis.
- composition according to above item 16 wherein the immune disease is thyroiditis, rheumatoid
- nucleic acid comprising a nucleotide sequence encoding the antibody according to any one of above items 1 to 14.
- Item 23 A method of treating an immune disease comprising administering an effective amount of the antibody according to any one of above items 1 to 14 or the pharmaceutical composition according to above item 15 to a human affected by an immune disease.
- the immune disease of the skin is psoriasis, parapsoriasis, atopic dermatitis, contact dermatitis, dermatomyositis , polymyositis, inclusion body myositis, autoimmune blistering disease (pemphigus, pemphigoid, or acquired epidermolysis bullosa), pustulosis, herpes gestationis, linear IgA bullous dermatosis, alopecia areata, vitiligo vulgaris, skin disease associated with
- collagenosis systemic lupus erythematosus, Sj6gren syndrome, or mixed connective tissue disease
- Addison's disease skin disease associated with graft-versus-host disease (GVHD) , eczema, or urticaria.
- GVHD graft-versus-host disease
- the immune disease of the skin is psoriasis, atopic dermatitis, contact dermatitis , dermatomyositis , polymyositis, or inclusion body myositis.
- An antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (g) to (i) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (j) to (1) below;
- an antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (m) to (o) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (p) to (r) below; or
- an antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (a) to (c) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (d) to (f) below:
- the antibody according to above item 1-A comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 60 or 64, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 68 or 72.
- the antibody according to above item 1-A or 2-A comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 60, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 68.
- the antibody according to above item 1-A or 2-A comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 64, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 72.
- Item 5-A The antibody according to any one of above items 1-A 4-A, comprising a human constant region.
- 5-A comprising a heavy chain comprising an amino acid sequence of SEQ ID NO: 59, and a light chain comprising an amino acid sequence of SEQ ID NO: 67.
- the antibody according to any one of above items 1-A to 5-A comprising a heavy chain comprising an amino acid sequence of SEQ ID NO: 63, and a light chain comprising an amino acid sequence of SEQ ID NO: 71.
- the antibody according to any one of above items 1-A to 7-A comprising an Fc region, wherein the Fc region is mutated to induce a change in ADCC activity.
- the antibody according to any one of above items 1-A to 9-A, wherein the antibody inhibits interaction between human XCRl and human XCL1.
- Item 12-A A pharmaceutical composition comprising the antibody according to any one of above items 1-A to 11-A and a
- the immune disease is an immune disease of the skin.
- autoimmune blistering disease pemphigus, pemphigoid, or acquired epidermolysis bullosa
- pustulosis herpes gestationis
- linear IgA bullous dermatosis alopecia areata
- vitiligo vulgaris skin disease associated with collagenosis (systemic lupus
- erythematosus erythematosus, Sjogren syndrome, or mixed connective tissue disease
- skin disease associated with Addison's disease skin disease associated with graft-versus-host disease (GVHD) , eczema, or urticaria.
- GVHD graft-versus-host disease
- composition according to above iteml4-A wherein the immune disease of the skin is psoriasis, atopic dermatitis, contact dermatitis, dermatomyositis,
- polymyositis polymyositis, or inclusion body myositis.
- composition according to above item 14-A wherein the immune disease of the skin is atopic dermatitis or contact dermatitis.
- a nucleic acid comprising a nucleotide sequence encoding the antibody according to any one of above items 1-A to 11-A.
- An immune disease treatment method comprising a step of administering an effective amount of the antibody according to any one of above items 1-A to 11-A to a human affected by an immune disease.
- the present invention further encompasses the embodiments described below.
- An antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (g) to (i) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (j) to (1) below;
- an antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (m) to (o) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (p) to (r) below; or
- an antibody comprising a heavy chain variable region comprising heavy chain CDRs 1 to 3 described in (a) to (c) below and a light chain variable region comprising light chain CDRs 1 to 3 described in (d) to (f) below:
- the antibody according to above item 1-B comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 60 or 64, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 68 or 72.
- the antibody according to above item 1-B or 2-B comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 60, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 68.
- the antibody according to above item 1-B or 2-B comprising a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 64, and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 72.
- the antibody according to any one of above items 1-B to 5-B comprising a heavy chain comprising an amino acid sequence of SEQ ID NO: 63, and a light chain comprising an amino acid sequence of SEQ ID NO: 71.
- a pharmaceutical composition comprising the antibody according to any one of above items 1-B to 12-B and a
- composition according to above item 13-B, wherein the pharmaceutical composition is a therapeutic agent for an immune disease.
- composition according to above item 14-B wherein the immune disease is an immune disease of the skin.
- composition according to above item 15-B wherein the immune disease of the skin is psoriasis. parapsoriasis, atopic dermatitis, contact dermatitis, dermatomyositis . polymyositis, inclusion body myositis,
- autoimmune blistering disease pemphigus, pemphigoid, or acquired epidermolysis bullosa
- pustulosis herpes gestationis
- linear IgA bullous dermatosis alopecia areata
- vitiligo vulgaris skin disease associated with collagenosis (systemic lupus
- erythematosus erythematosus, Sj5gren syndrome, or mixed connective tissue disease
- skin disease associated with Addison's disease skin disease associated with graft-versus-host disease (GVHD), eczema, or urticaria.
- GVHD graft-versus-host disease
- composition according to above iteml5-B wherein the immune disease of the skin is psoriasis, atopic dermatitis, contact dermatitis, dermatomyositis,
- polymyositis polymyositis, or inclusion body myositis.
- composition according to above item 15-B wherein the immune disease of the skin is atopic dermatitis or contact dermatitis.
- a nucleic acid comprising a nucleotide sequence encoding the antibody according to any one of above items 1-B to 12-B.
- a method of treating an immune disease comprising administering an effective amount of the antibody according to any one of above items 1-B to 12-B or the pharmaceutical
- composition according to above item 13-B to a human affected by an immune disease.
- Item 21-B The method according to above item 20-B, wherein the immune disease is an immune disease of the skin.
- the immune disease of the skin is psoriasis, parapsoriasis, atopic dermatitis, contact dermatitis, dermatomyositis , polymyositis, inclusion body myositis, autoimmune blistering disease (pemphigus, pemphigoid, or acquired epidermolysis bullosa), pustulosis, herpes gestationis, linear IgA bullous dermatosis, alopecia areata, vitiligo vulgaris, skin disease associated with
- collagenosis systemic lupus erythematosus, Sjogren syndrome, or mixed connective tissue disease
- Addison's disease skin disease associated with Addison's disease
- GVHD graft-versus-host disease
- eczema urticaria
- the immune disease of the skin is psoriasis, atopic dermatitis, contact dermatitis, dermatomyositis, polymyositis, or inclusion body myositis.
- membrane fraction of human XCR1-expressing B300.19 cells was immunized to XCR1 knockout mice.
- the membrane fraction was prepared as the following procedure: first, human XCR1-expressing B300.19 cells, being suspended in a Ho buffer (0.25 M Sucrose, 10 mM Hepes (pH 7.4), 1 mM EGTA, 0.5 mM MgCl 2 , lx Complete mini EDTA- free (Roche Applied Science)), were disrupted (800 psi, for 30 minutes on ice) by a nitrogen gas cell disruption vessel (Parr Instrument Company) and then centrifuged (2,000 g, 10 minutes). The supernatant was collected and re-centrifuged (100,000 g, 30 minutes). The pellet was suspended in a 50 mM Hepes (pH 7.4) buffer, and designated as a membrane fraction.
- mice Five or six additional injections were then administered every other week. Three or four days after the final immunization, the mice were sacrificed, and the peripheral lymph-node cells were fused with P3U1 myeloma cells at a 2:1 or 5:1 ratio in the presence of GenomeONE-CF (Ishihara Sangyo Kaisha, Ltd.). The fused cells were then cultured in 96-well plastic plates .
- CHO cells and human XCRl-EGFP-expressing CHO cells were mixed at a 1:1 ratio, and suspended in a FACS buffer (1 mM EDTA, 1% FBS-containing PBS " (Sigma)). The cells were incubated for 20 minutes on ice with culture supernatants from each hybridoma. The cells were washed with the FACS buffer three times, and then incubated for 20 minutes on ice with PE-labeled anti-mouse IgG polyclonal antibody (Jackson, #715-116-151, diluted at 1:100 in the FACS buffer) . The cells were washed with the FACS buffer three times, and then suspended in the FACS buffer. The
- fluorescence intensity was measured using a FACSCanto II Cell analyzer (BD Bioscience). As results, supernatants collected from three wells showed high reactivity to human XCRl-EGFP-expressing CHO cells. A standard limiting dilution method was used to obtain clones from these three positive wells (2H6, 5G7, and 11H2). The reactivity of each clone was confirmed by the FACS analysis described above.
- an in vitro chemotaxis assay was performed to evaluate the neutralizing activity of these three clones on human lymphotactin-induced migration of human XCR1- expressing BaF3 cells or B300.19 cells.
- the chemotaxis assay was performed in 24-well transwell culture supports (pore 3 ⁇ m,
- human XCRl-expressing B300.19 cells (2 x 10 5 cells) were suspended in a mixture of 25 L of a chemotaxis buffer (RPMIl 640 (Invitrogen) containing 0.5% BSA, 0.5% FBS, and 20 mM HEPES (pH 7.4), and 50 ⁇ 2-mercaptoethanol) and 50 ⁇ of each culture supernatant, and incubated at room temperature for 30 minutes.
- RPMIl 640 Invitrogen
- BSA 0.5% BSA
- FBS 0.5% FBS
- 20 mM HEPES pH 7.4
- recombinant human lymphotactin (Genzyme, #2695) dissolved in chemotaxis buffer at a concentration of 1 ⁇ gmL was added to the lower wells at 150 ⁇ /well, and the incubated cells were added to the upper wells. After 4 hours of incubation in a 5% CX3 ⁇ 4 incubator at 37° C, the transwells were centrifuged at 1,350 rpm for 5 minutes, and migrated cells were collected in the lower wells. 30 ⁇ . of each sample was applied to the FACSCanto II cell analyzer to count the number of the cells.
- the reactivity of the purified antibodies to human XCRl was evaluated by FACS analysis.
- Parent B300.19 cells and human XCRl-EGFP-expressing B300.19 cells were mixed at a 1:1 ratio and suspended in a FACS buffer (1% FBS-containing PBS " (Sigma)). The cells were blocked for 10 minutes on ice with the FACS buffer containing 100 g/mL of human immunoglobulin.
- the cells were then incubated for 20 minutes on ice with the purified antibodies (2H6, 5G7, and 11H2) at various concentrations from 0 to 10 g/mL or with mouse isotype control antibody, IgG2a (eBioscience, #14- 4724-82) or IgG2b (eBioscience, #14-4732-82), at a concentration of 10 ⁇ g ItlL.
- the cells were washed with the FACS buffer three times, and then incubated for 20 minutes on ice with PE-labeled anti-mouse IgG polyclonal antibody (Jackson, #715-116-151,
- the cells were washed with the FACS buffer three times, and then suspended in the FACS buffer. The fluorescence intensity was measured by a FACSCanto II cell analyzer.
- the neutralizing activity of purified antibodies from these clones was evaluated by in vitro chemotaxis assay.
- the chemotaxis assay was performed using 96-well transwell culture plates (Multiscreen, pore 5 ⁇ , Millipore, #MAMIC 5S10).
- Human XCR1- expressing B300.19 cells (2 x 10 5 cells) were suspended in a 75 ⁇ of chemotaxis buffer (RPMI 1640 medium (Invitrogen) containing 0.5% BSA, 0.5% FBS, 20 mM HEPES (pH 7.4), and 50 ⁇ 2-niercaptoethanol) containing each of the purified antibodies (2H6, 5G7, and 11H2) at various concentrations from 0 to 10 ⁇ g mL; and incubated at room temperature for 30 minutes.
- RPMI 1640 medium Invitrogen
- BSA 0.5% BSA
- FBS 0.5% FBS
- 20 mM HEPES pH 7.4
- 2-niercaptoethanol 50 ⁇ 2-niercaptoethanol
- recombinant human lymphotactin (R&D, #695-LT/CF) was dissolved in the chemotaxis buffer at a final concentration of 1 g/mL, in which the purified antibodies were dissolved at various concentrations from 0 to 10 g/mL.
- the mixture of lymphotactin and purified antibodies were added to the lower wells at 150 L/well, and incubated at room temperature for 30 minutes. 30 minutes later, the incubated cells were added to the upper wells, and incubated in a 5% CO 2 incubator at 37° C for 4 hours. Subsequently, 30 pL of each sample was applied to the FACSCanto II cell analyzer to count the number of the cells.
- a polynucleotide comprising a gene sequence encoding the heavy and light chains of the clones (2H6, 5G7, and 11H2) were amplified by 5' -RACE (5' -rapid amplification of cDNA ends) method.
- the total RNA was prepared from the hybridoma of these three clones using TRIZOL (Invitrogen) and treated with DNase
- Double-stranded cDNA was prepared from the total RNA, using a cDNA synthesis kit (TAKARA) . 5' adaptor obtained by annealing ad29S; ACATCACTCCGT (SEQ ID NO: 81) and as29AS; ACGGAGTGATGTCCGTCGACGTATCTCTGCGTTGATACTTCAGCGTAGCT (SEQ ID NO: 82) was added to the cDNA. The obtained cDNA was amplified using
- CTCAAGTTTTTTGTCCACCGTGGTGC SEQ ID NO: 85
- CTCAATTTTCTTGTCCACCTTGGTGC SEQ ID NO: 86, or
- GATGGATACAGTTGGTGCAGC SEQ ID NO: 89, or
- CAGATCCTCAGCCTCCACTCTGCT SEQ ID NO: 90
- the amplified cDNA was inserted into pCR2.1 vector (Invitrogen).
- the gene sequences were analyzed using ABI3130XL. Tables 2-1 to 4-2 show amino acid sequences encoded by the gene sequences identified by the analysis .
- 5G7 which demonstrated the highest neutralizing activity among 2H6, 5G7, and 11H2, was used to produce a chimeric antibody and humanized antibodies.
- the chimeric antibody was prepared by combining, by overlapping extension PCR, the gene sequence of the 5G7 heavy chain variable region and the gene sequence of the human IgG2 constant region into which V234A/G237A mutation was inserted for heavy chain and the sequence of the 5G7 light chain variable region and the gene sequence of human IgK constant region, and by inserting the resulting sequence into expression vectors (pEE6.4 or pEE12.4).
- Tables 5 and 6 respectively show amino acid sequences and nucleotide sequences of the specific chimeric antibody.
- the antibody was humanized by grafting the complementary determining region of mouse antibody 5G7 into the human antibody variable region.
- the complementary determining region was determined according to the Rabat numbering system and a method for identifying the complementary determining region (for example, Rabat et al., (1991) Sequences of Proteins of
- the "X" in the table may be any of the following:
- alanine (Ala: A), arginine (Arg: R) , asparagine (Asn: N) , aspartic acid (Asp: D) , cysteine (Cys: C) , glutamine (Gin: Q) , glutamic acid (Glu: E) , glycine (Gly: G) , histidine (His: H) , isoleucine (lie: I), leucine (Leu: L), lysine (Lys: K) ,
- methionine (Met: M) , phenylalanine (Phe: F) , proline (Pro: P), serine (Ser: S), threonine (Thr: T) , tryptophan (Trp: W) , tyrosine (Tyr: Y) , and valine (Val: V).
- the FRs of a human antibody with high identity to the FR of 5G7 were selected as the FRs of the humanized antibodies. Subsequently, the amino acids in the FRs, which interact with the CDRs of 5G7, were predicted using the 3D model of the resulting antibody, and grafted with the CDRs.
- the human IgG2 constant region into which V234A/G237A mutation was inserted was used as the constant region.
- HK1 and HK5 were designed as the humanized antibody heavy chains, and L2 and L5 were designed as the humanized antibody light chains. Tables 11-1 to 14-2 show amino acid sequences and nucleotide sequences of the specific humanized antibodies .
- AGAAGTTTAAAGG (3AGGGTGACAATTACTCGGGACACTTCCGCAAG CACCGCCTACATGGAGCTGTCCAGCCTGAGGAGTGAAGATACCGCT GTGTACTATTGTGCACGATGGGGATCCGTGGTCGGAGACTGGTAT
- CAGIAGTCCCCGCK TGCTGATCTATAAGGTGTCTCACAGATTCAGTG variable region
- Gene sequences of these humanized antibodies were entirely synthesized by GenScript USA Inc., and inserted into expression vectors (pEE6.4 or pEE12.4 purchased from Lonza) .
- expression vectors pEE6.4 or pEE12.4 purchased from Lonza
- the expression vectors were transfected into HEK293E cells (Invitrogen) using Lipofectamine 2000 according to the instructions for Lipofectamine 2000 (Invitrogen).
- the supernatants were collected and purified using Protein A (GE Healthcare). The neutralizing activity was evaluated using these purified humanized antibodies.
- Humanized antibodies having neutralizing activity against human lymphotactin-induced migration of human XCR1- expressing cells were identified by performing in vitro chemotaxis assays using human XCR1-expressing B300.19 cells.
- the chemotaxis assay was performed as described above using 96-well transwell culture plates (Multiscreen, pore 5 m, Millipore, # AMIC 5S10 or Corning #3387 or #3388).
- the amount of the recombinant human lymphotactin and purified antibodies to be added to the lower wells is 235 ⁇ per well.
- humanized antibodies having neutralizing activity two types of the following antibodies, HK1L2 and HK5L5, were evaluated in further detail.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Dermatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Physical Education & Sports Medicine (AREA)
- Neurology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Rheumatology (AREA)
- Endocrinology (AREA)
- Emergency Medicine (AREA)
- Hematology (AREA)
- Pain & Pain Management (AREA)
- Biomedical Technology (AREA)
- Obesity (AREA)
- Neurosurgery (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112014004352A BR112014004352A2 (pt) | 2011-09-01 | 2012-08-30 | anticorpos anti-xcr1 humano |
| MX2014002078A MX346560B (es) | 2011-09-01 | 2012-08-30 | Anticuerpos anti-xcr1 humano. |
| CN201280041366.2A CN103764680B (zh) | 2011-09-01 | 2012-08-30 | 抗人xcr1抗体 |
| HK14112359.4A HK1199038A1 (en) | 2011-09-01 | 2012-08-30 | Anti-human xcr1 antibodies |
| EP12761822.1A EP2751140B1 (en) | 2011-09-01 | 2012-08-30 | Anti-human xcr1 antibodies |
| KR1020147004507A KR101767717B1 (ko) | 2011-09-01 | 2012-08-30 | 항-인간 xcr1 항체 |
| JP2014509528A JP5989096B2 (ja) | 2011-09-01 | 2012-08-30 | 抗ヒトxcr1抗体 |
| NZ621320A NZ621320B2 (en) | 2011-09-01 | 2012-08-30 | Anti-human xcr1 antibodies |
| US14/240,090 US9371389B2 (en) | 2011-09-01 | 2012-08-30 | Anti-human XCR1 antibodies |
| PH1/2014/500384A PH12014500384A1 (en) | 2011-09-01 | 2012-08-30 | Anti-human xcr1 antibodies |
| IN1466CHN2014 IN2014CN01466A (https=) | 2011-09-01 | 2012-08-30 | |
| CA2846370A CA2846370C (en) | 2011-09-01 | 2012-08-30 | Anti-human xcr1 antibodies |
| AU2012302596A AU2012302596B2 (en) | 2011-09-01 | 2012-08-30 | Anti-human XCR1 antibodies |
| RU2014106832A RU2619180C2 (ru) | 2011-09-01 | 2012-08-30 | Антитела к xcr1 человека |
| ES12761822T ES2684173T3 (es) | 2011-09-01 | 2012-08-30 | Anticuerpos anti-XCR1 humano |
| IL231075A IL231075A (en) | 2011-09-01 | 2014-02-20 | Antibodies against human xcr1 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161530194P | 2011-09-01 | 2011-09-01 | |
| US61/530,194 | 2011-09-01 | ||
| US201261659637P | 2012-06-14 | 2012-06-14 | |
| US61/659,637 | 2012-06-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013032032A1 true WO2013032032A1 (en) | 2013-03-07 |
Family
ID=46881120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2012/072667 Ceased WO2013032032A1 (en) | 2011-09-01 | 2012-08-30 | Anti-human xcr1 antibodies |
Country Status (19)
| Country | Link |
|---|---|
| US (1) | US9371389B2 (https=) |
| EP (1) | EP2751140B1 (https=) |
| JP (1) | JP5989096B2 (https=) |
| KR (1) | KR101767717B1 (https=) |
| CN (1) | CN103764680B (https=) |
| AR (1) | AR087749A1 (https=) |
| AU (1) | AU2012302596B2 (https=) |
| BR (1) | BR112014004352A2 (https=) |
| CA (1) | CA2846370C (https=) |
| ES (1) | ES2684173T3 (https=) |
| HK (1) | HK1199038A1 (https=) |
| IL (1) | IL231075A (https=) |
| IN (1) | IN2014CN01466A (https=) |
| MX (1) | MX346560B (https=) |
| MY (1) | MY166152A (https=) |
| PH (1) | PH12014500384A1 (https=) |
| RU (1) | RU2619180C2 (https=) |
| TW (1) | TWI563004B (https=) |
| WO (1) | WO2013032032A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017021539A3 (en) * | 2015-08-05 | 2017-03-16 | Acticor Biotech | Novel anti-human gpvi antibodies and uses thereof |
| US10071170B2 (en) | 2013-06-24 | 2018-09-11 | Ablbio | Antibody-drug conjugate having improved stability and use thereof |
| WO2020136060A1 (en) | 2018-12-28 | 2020-07-02 | F. Hoffmann-La Roche Ag | A peptide-mhc-i-antibody fusion protein for therapeutic use in a patient with amplified immune response |
| EP3743448A4 (en) * | 2018-01-26 | 2021-11-03 | Orionis Biosciences, Inc. | XCR1 BINDING AGENTS AND USES THEREOF |
| US11692033B2 (en) | 2017-02-03 | 2023-07-04 | Acticor Biotech | Inhibition of platelet aggregation using anti-human GPVI antibodies |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018146074A1 (en) | 2017-02-07 | 2018-08-16 | Vib Vzw | Immune-cell targeted bispecific chimeric proteins and uses thereof |
| CN107312092B (zh) * | 2017-05-04 | 2020-12-11 | 华南农业大学 | 一种斜带石斑鱼ccr12的多克隆抗体制备方法及其应用 |
| US20210130776A1 (en) * | 2017-09-29 | 2021-05-06 | The Broad Institute, Inc. | Methods and compositions for modulating suppression of lymphocyte activity |
| US12410225B2 (en) | 2018-11-08 | 2025-09-09 | Orionis Biosciences, Inc | Modulation of dendritic cell lineages |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| WO2002059608A2 (en) * | 2000-11-29 | 2002-08-01 | Lifespan Biosciences, Inc. | Compositions and methods related to chemokine (c motif) xc receptor 1 (ccxcr1) |
| WO2009065561A2 (en) * | 2007-11-20 | 2009-05-28 | Bundesrepublik Deutschland Letztvertreten Durch Das Robert Koch-Institut | System for delivery into a xcr1 positive cell and uses thereof |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5786210A (en) | 1994-02-08 | 1998-07-28 | Schering Corporation | Mammalian thymokine genes |
| AU2001250412A1 (en) * | 2000-03-31 | 2001-10-08 | Ipf Pharmaceuticals Gmbh | Diagnostic and medicament for analysing the cell surface proteome of tumour and inflammatory cells and for treating tumorous and inflammatory diseases, preferably using specific chemokine receptor analysis and the chemokine receptor-ligand interaction |
| US20050136033A9 (en) | 2002-08-13 | 2005-06-23 | Matthias Mack | Method of treating allergen induced airway disease |
| WO2004072646A1 (en) * | 2003-02-13 | 2004-08-26 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with g protein-coupled receptor 5 (gpr5) |
| EP1698902A1 (en) * | 2005-03-01 | 2006-09-06 | DKFZ Deutsches Krebsforschungszentrum | Use of XCR1 for diagnosing or monitoring of immune tolerance |
| CN101293924A (zh) | 2007-04-24 | 2008-10-29 | 上海国健生物技术研究院 | 骨桥蛋白的功能表位、与其特异性结合的单克隆抗体及其在制备抗肿瘤转移药物中的用途 |
| KR20110128876A (ko) * | 2009-02-16 | 2011-11-30 | 바이오렉스 쎄라퓨틱스, 인코포레이티드 | 인간화된 항-cd20 항체 및 이용 방법 |
-
2012
- 2012-08-30 JP JP2014509528A patent/JP5989096B2/ja not_active Expired - Fee Related
- 2012-08-30 TW TW101131633A patent/TWI563004B/zh not_active IP Right Cessation
- 2012-08-30 AU AU2012302596A patent/AU2012302596B2/en not_active Ceased
- 2012-08-30 AR ARP120103217A patent/AR087749A1/es unknown
- 2012-08-30 MY MYPI2014700412A patent/MY166152A/en unknown
- 2012-08-30 ES ES12761822T patent/ES2684173T3/es active Active
- 2012-08-30 IN IN1466CHN2014 patent/IN2014CN01466A/en unknown
- 2012-08-30 CA CA2846370A patent/CA2846370C/en not_active Expired - Fee Related
- 2012-08-30 HK HK14112359.4A patent/HK1199038A1/xx unknown
- 2012-08-30 PH PH1/2014/500384A patent/PH12014500384A1/en unknown
- 2012-08-30 BR BR112014004352A patent/BR112014004352A2/pt not_active Application Discontinuation
- 2012-08-30 CN CN201280041366.2A patent/CN103764680B/zh not_active Expired - Fee Related
- 2012-08-30 WO PCT/JP2012/072667 patent/WO2013032032A1/en not_active Ceased
- 2012-08-30 MX MX2014002078A patent/MX346560B/es active IP Right Grant
- 2012-08-30 RU RU2014106832A patent/RU2619180C2/ru not_active IP Right Cessation
- 2012-08-30 US US14/240,090 patent/US9371389B2/en not_active Expired - Fee Related
- 2012-08-30 KR KR1020147004507A patent/KR101767717B1/ko not_active Expired - Fee Related
- 2012-08-30 EP EP12761822.1A patent/EP2751140B1/en not_active Not-in-force
-
2014
- 2014-02-20 IL IL231075A patent/IL231075A/en active IP Right Grant
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| WO2002059608A2 (en) * | 2000-11-29 | 2002-08-01 | Lifespan Biosciences, Inc. | Compositions and methods related to chemokine (c motif) xc receptor 1 (ccxcr1) |
| WO2009065561A2 (en) * | 2007-11-20 | 2009-05-28 | Bundesrepublik Deutschland Letztvertreten Durch Das Robert Koch-Institut | System for delivery into a xcr1 positive cell and uses thereof |
Non-Patent Citations (63)
| Title |
|---|
| A. BACHEM ET AL: "Superior antigen cross-presentation and XCR1 expression define human CD11c+CD141+ cells as homologues of mouse CD8+ dendritic cells", JOURNAL OF EXPERIMENTAL MEDICINE, vol. 207, no. 6, 17 May 2010 (2010-05-17), pages 1273 - 1281, XP055027957, ISSN: 0022-1007, DOI: 10.1084/jem.20100348 * |
| ACTOR, J.K.; AMPEL, N.M.; HYPERSENSITIVITY: T LYMPHOCYTE- MEDIATED (TYPE IV: "In: Encyclopedia of Life Sciences (ELS", December 2009, JOHN WILEY & SONS, LTD |
| ALTSCHUL SF; GISH W; MILLER W; MYERS EW; LIPMAN DJ: "Basic local alignment search tool", J MOL BIOL, vol. 215, 1990, pages 403 - 10 |
| AN Z; FORREST G; MOORE R; CUKAN M; HAYTKO P; HUANG L. VITELLI S; ZHAO JZ; LU P; HUA J; GIBSON CR: "IgG2m4, an engineered antibody isotype with reduced Fc function", MABS, vol. 1, 2009, pages 572 - 9, XP002665505, DOI: doi:10.4161/mabs.1.6.10185 |
| ASUKA H; OKAZAKI Y; KAWAKAMI Y; HIRAKATA M; INOKO H; IKEDA Y; KUWANA M: "Autoreactive CD8+ cytotoxic T lymphocytes to major histocompatibility complex class I chain-related gene A in patients with Behçet's disease", ARTHRITIS RHEUM, vol. 50, 2004, pages 3658 - 3662 |
| AUSUBEL. F M ET AL.: "Current Protocols in Molecular Biology", JOHN WILEY & SONS |
| BACHEM A; GÜTTLER S; HARTUNG E; EBSTEIN F; SCHAEFER M; TANNERT A; SALAMA A; MOVASSAGHI K; OPITZ C; MAGES HW: "Superior antigen cross-presentation and XCR1 expression define human CD11c+CD141+ cells as homologues of mouse CD8+ dendritic cells", J EXP MED, vol. 207, 2010, pages 1273 - 1281, XP055027957, DOI: doi:10.1084/jem.20100348 |
| BACHEM A; GÜTTLER S; HARTUNG E; EBSTEIN F; SCHAEFER M; TANNERT A; SALAMA A; MOVASSAGHI K; OPITZ C; MAGES HW: "Superior antigen cross-presentation and XCR1 expression define human CD11c+CD141+ cells as homologues of mouse CDB+ dendritic cells", J EXP MED, vol. 207, 2010, pages 1273 - 1281, XP055027957, DOI: doi:10.1084/jem.20100348 |
| BACHEM ANNABELL ET AL: "Expression of XCR1 Characterizes the Batf3-Dependent Lineage of Dendritic Cells Capable of Antigen Cross-Presentation.", FRONTIERS IN IMMUNOLOGY, vol. 3, 214, 18 July 2012 (2012-07-18), pages 1 - 12, XP002686944, ISSN: 1664-3224 * |
| BLASCHKE S; BRANDT P; WESSELS JT; MÜLLER GA: "Expression and function of the C-class chemokine lymphotactin (XCL1) in Wegener's granulomatosis", J RHEUMATOL, vol. 36, 2009, pages 2491 - 2500 |
| BRAZIL-LET M-P; BATTEUX F; ABEHSIRA-AMAR O; NIOOLETTI F; CHARREIRE J: "Induction of experimental autoimnune thyroiditis by heat- denatured porcine thyroglobulin: a Tel-mediated disease", BUR J INMUNOL, vol. 29, 1999, pages 1342 - 1352 |
| BUENO V; PESTANA JCM: "The role of CD8+ T-cells during allograft rejection", BRAZ J MED BIOL RES, vol. 35, 2002, pages 1247 - 1258 |
| CLACKSON T; HOOGENBOOM HR; GRIFFITHS AD; WINTER G: "Making antibody fragments using phage display libraries", NATURE, vol. 352, 1991, pages 624 - 8, XP002101159, DOI: doi:10.1038/352624a0 |
| COLE MS; ANASETTI C; TSO JY: "Human IgG2 variants of chimeric anti-CD3 are nonmitogenic to T cells", J IMMUNOL, vol. 159, 1997, pages 3613 - 21, XP002226664 |
| COUZI L.; MERVILLE P; DEMINIERE C; MOREAU J-F; COMBE C; PELLEGRIN J-L; VIALLARD J-F; BLANCO P.: "Predominance of CD8+ T lymphocytes among periglomerular infiltrating cells and link to the prognosis of class III and class IV lupus nephritis", ARTHRITIS RHEUM, vol. 56, 2007, pages 2362 - 2370 |
| CROZAT K; GUITON R; CONTRERAS V; FEUILLET V.; DUTERTRE CA; VENTRE E; VU MANH TP; BARANEK T; STORSET AK; MARVEL J: "The XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8a+ dendritic cells", J EXP MED, vol. 207, no. 1, 2010, pages 1283 - 1292 |
| CROZAT K; GUITON R; CONTRERAS V; FEUILLET V; DUTERTRE CA; VENTRE E; VU MANH TP; BARANEK T; STOREET AK; MARVEL J: "The XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8?+ dendritic cells", J EXP MED, vol. 207, 2010, pages 1283 - 1292 |
| DALAKAS MC: "Review: An update on inflammatory and autoimmune myopathies", NEUROPATHOL APPL NEUROBIOL, vol. 37, 2011, pages 226 - 242 |
| DORNER BG; DORNER MB; ZHOU X; OPITZ C; MORA A; GÜTTLER S; HUTLOFF A; MAGES HW; RANKE K; SCHAEFER M: "Selective expression of the chemokine receptor XCR1 on cross-presenting dendritic cells determines cooperation with CD8+ T-cells", IMMUNITY, vol. 31, 2009, pages 823 - 833, XP002676612, DOI: doi:10.1016/j.immuni.2009.08.027 |
| FABRIZI G; ROMANO A; VULTAGGIO P; BELLEGRANDI S; PAGANELLI R; VENUTI A.: "Heterogeneity of atopic dermatitis defined by the immune response to inhalant and food allergy", EUR J DERMATOL, vol. 9, 1999, pages 380 - 384 |
| FONACIER LS; DRESKIN SC; LEUNG DYM: "Allergic skin diseases", J ALLERGY CLIN IMMUNOL, vol. 125, 2010, pages 138 - 149 |
| FRIESE MA; FUGGER L: "Autoreactive CD8+ cells in multiple sclerosis: a new target for therapy?", BRAIN, vol. 128, 2005, pages 1747 - 1763 |
| GUDJONSSON JE; JOHNSTON A; SIGMUNDSDOTTIR H; VALDIMARSSON H: "Immunopathogenic mechanisms in psoriasis", CLIN EXP IMMUNOL, vol. 135, 2004, pages 1 - 8 |
| HEYMANN F; MEYER-SCHWESINGER C; HAMILTON-WILLIAMS EE; HANMERICH L; PANZER W; KADEN S; QUAGGIN SE; FLOEGE J; GRÖNE H-J; KURTS C: "Kidney dendritic cell activation is required for progression of renal disease on a mouse model of glomerular injury", J CLIN INVEST, vol. 119, 2009, pages 1286 - 1297 |
| HOHLFELD R; ENGEL AG: "Coculture with autologous myotubes of cytotoxic T cells isolated from muscle in inflammatory myopathies", ANN NEUROL, vol. 29, 1991, pages 498 - 507 |
| JOURNAL EUR. J. IMMUNOL., vol. 35, 2005, pages 76 - 85 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1983, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NIH |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest: US Department of Health and Human Services", 1991, NIH |
| KAMMER AR; VAN DER BURG SH; GRABSCHEID B; HUNZIKER IP; KWAPPENBERG KMC; REICHEN J; MELIEF CJM; CERNY A: "Molecular mimicity of human cytochrome P450 by hepatitis C virus at the level of cytotoxic T cell recognition", J EXP MED, vol. 190, 1999, pages 169 - 175 |
| KARLIN S; ALTSCHUL SF: "Applications and statistics for multiple high-scoring segments in molecular sequences", PROC NATL ACAD SCI USA, vol. 90, 1993, pages 5873 - 7, XP001030852, DOI: doi:10.1073/pnas.90.12.5873 |
| KARLIN S; ALTSCHUL SF: "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes", PROC NATL ACAD SCI USA, vol. 871, 1990, pages 2264 - 2268, XP001030853, DOI: doi:10.1073/pnas.87.6.2264 |
| KEHREN J. DESVIGNES C; KRASTEVA M; DUCLUZEAU MT; ASSOSSOU O; HORAND F.; HAHNE M.; KAGI D; KAISERLIAN D.; NICOLAS JF.: "Cytotoxicity is mandatory for CD8(+) T cell-mediated contact hypersensitivity", J EXP. MED., vol. 189, 1999, pages 779 - 786 |
| KHURRAM SA; NHAWELL SA; BINGLE L; MURDOCH C; MCCABE BM; FARTHING PM: "Functional expression of the chemokine receptor XCR1 on oral epithelial cells", J PATHOL, vol. 221, 2010, pages 153 - 63, XP002686943, DOI: doi:10.1002/path.2695 |
| KHURRAM SA; WHAWELL SA; BINGLE L; MURDOCH C; MCCABE BM; FARTHING PM: "Functional expression of the chemokine receptor XCR1 on oral epithelial cells", J PATHOL, vol. 221, 2010, pages 153 - 63, XP002686943, DOI: doi:10.1002/path.2695 |
| KHURRAM SYED A ET AL: "Functional expression of the chemokine receptor XCR1 on oral epithelial cells", JOURNAL OF PATHOLOGY, vol. 221, no. 2, June 2010 (2010-06-01), pages 153 - 163, XP002686943, ISSN: 0022-3417 * |
| KÖHLER G; MILSTEIN C: "Continuous cultures of fused cells secreting antibody of predefined specificity", MATURE, vol. 256T, 1975, pages 495 - 7, XP002024548 |
| KONTERMAN; DÜBEL: "Antibody Engineering", SPRINGER |
| KURTS C; ROBINSON BW; KNOLLE PA: "Cross-priming in health and disease", HAT REV IMMUNOL, vol. 10, 2010, pages 403 - 414 |
| KURTS C; ROBINSON BW; KNOLLE PA: "Cross-priming in health and disease", NAT REV IMMUNOL, vol. 10, 2010, pages 403 - 414 |
| KURTS C; ROBINSON BW; KNOLLS PA: "Cross-priming in health and disease", NAT REV IMMUNOL, vol. 10, 2010, pages 403 - 414 |
| LAZAR GA; DANG W; KARKI S; VAFA O; PENG JS; HYUN L; CHAN C; CHUNG HS; EIVAZI A; YODER SC: "Engineered antibody Fc variants with enhanced effector function", PROC NATL ACAD SCI USA, vol. 103, 2006, pages 4005 - 10 |
| LEI YU ET AL: "XCL1 and XCR1 in the immune system.", MICROBES AND INFECTION / INSTITUT PASTEUR MAR 2012, vol. 14, no. 3, October 2011 (2011-10-01), pages 262 - 267, XP002686945, ISSN: 1769-714X * |
| MARKS JD; HOOGENBOOM HR; BONNERT TP; MCCAFFERTY J; GRIFFITHS AD; WINTER G: "By-passing immunization: Human antibodies from V-gene libraries displayed on phage", J MOL BIOL, vol. 222, 1991, pages 581 - 97, XP024010124, DOI: doi:10.1016/0022-2836(91)90498-U |
| MIDDEL P; THELEN P; BLASCHKE S; POLZIEN F; REICH K; BLASCHKE V; WREDE A.; HUMMEL KM; GUNAWAN B; RADZUN HJ: "Expression of the T-cell chemoattractant chemokine lymphotactin in Crohn's disease", AM J PATHOL., vol. 159, 2001, pages 1751 - 1761, XP002335820 |
| MIHARA, K. ET AL., IMMUNOLOGY LETTERS, vol. 84, 2002, pages 223 - 229 |
| MODY CH; PAIN III R; JACKSON C; CHEN G-H; TOEWS GB: "CD8 Cells play a critical role in delayed-type hypersensitivity to intact Cryptococous neoformans", J IMMUNOL, vol. 152, 1994, pages 3970 - 3979 |
| MOHAN K ET AL., EUR. J. IMMUNOL., vol. 35, 2005, pages 1702 - 1711 |
| MOORE GL.; CHEN H; KARKI S; LAZAR GA: "Engineered Fc variant antibodies with enhanced ability to recruit complement and mediate effector functions", MABS, vol. 2, 2010, pages 181 - 9, XP009143498, DOI: doi:10.4161/mabs.2.2.11158 |
| MUROI E; OGAWA F; SHIMIZU K; KOMURA K; HASEGAWA M; FUJIMOTO M; SATO S: "Elevation of serum lymphotactin levels in patients with systemic sclerosis", J RHEUMATOL., vol. 35, 2008, pages 834 - 838 |
| SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| SERODY JS; BURKETT SE; PANOSKALTSIS-MORTARI A; NG-CASHIN J; MCMAHON E; MATSUSHIMA GK; LIRA SA; COOK DN; BLAZAR BR: "T-lymphocyte production of macrophage inflammatory protein-lalpha is critical to the recruitment of CD8(+) T cells to the liver, lung, and spleen during graft-versus-host disease", BLOOD, vol. 96, 2000, pages 2973 - 2980, XP055026050 |
| SHIELDS R L ET AL: "High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgG1 variants with improved binding to the Fc gamma R", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 9, 2 March 2001 (2001-03-02), AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, pages 6591 - 6604, XP002495886, ISSN: 0021-9258, [retrieved on 20001128], DOI: 10.1074/JBC.M009483200 * |
| SHIELDS RL; NAMENUK AK; HONG K.; MENG YG; RAE J; BRIGGS J; XIE D; LAI J; STADLEN A; LI B: "High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgGl variants with improved binding to the Fc gamma R.", J BIOL CHEM, vol. 276, 2001, pages 6591 - 604, XP002638208, DOI: doi:10.1074/JBC.M009483200 |
| SUGIHARA T; SEKINE C.; NAKAE T; KOHYAMA K; HARIGAI M; IWAKURA Y; MATSUMOTO Y; MIYASAKA N; KOHSAKA H: "A new murine model to define the critical pathologic and therapeutic mediators of polymyositis", ARTHRITIS RHEUM, vol. 56, 2007, pages 1304 - 1314, XP055160849, DOI: doi:10.1002/art.22521 |
| SUGIHARA T; SEKINE C; NAKAE T; KOHYAMA K; HARIGAI M; IWAKURA Y; MATSUMOTO Y; MIYASAKA N.; KOHSAKA H: "A new murine model to define the clinical pathologic and therapeutic mediators of polymyositis", ARTHRITIS & RHEUMATISM., vol. 56, 2007, pages 1304 - 1314, XP055160849, DOI: doi:10.1002/art.22521 |
| TORRENCE AE; BRABB T; VINEY JL; BIELEFELDT-OHMANN H; TREUTING P; SEAMONS A.; DRIVDAHL R; ZENG W; MAGGIO-PRICE L: "Serum biomarkers in a mouse model of bacterial- induced inflammatory bowel disease", INFLAMM BOWEL DIS, vol. 14, 2008, pages 480 - 490, XP055077187, DOI: doi:10.1002/ibd.20347 |
| WALDNER H: "The role of innate immune responses in autoimmune disease development", AUTOIMMUN, vol. 8, 2009, pages 400 - 404, XP026004235, DOI: doi:10.1016/j.autrev.2008.12.019 |
| WANG B; GONZALES A; BENOIST C; MATHIS D: "The role CD8+ T-cells in the initiation of insulin-dependent diabetes mellitus", BUR J IMMUNOL, vol. 26, 1996, pages 1762 - 1769 |
| WANG CR; LIU MF; HUANG YH; CHEN HC: "Up- regulation of XCR1 expression in rheumatoid joints", RHEUMATOLOGY, vol. 43, 2004, pages 569 - 573, XP008049761, DOI: doi:10.1093/rheumatology/keh147 |
| WU TT; KABAT EA: "An analysis of the sequences of the variable regions of Bence Jones proteins and myeloma light chains and their implications for antibody complementarity", J EXP MED, vol. 132, 1970, pages 211 - 50 |
| YEH PT; LIN FA; LIN CP; YANG CM; CHEN MS; YANG CH: "Expressions of lymphotactin and its receptor, XCR, in Lewis rats with experimental autoimmune anterior uveitis", GRAEFES ARCH CLIN EXP OPHTHALMOL., vol. 248, 2010, pages 1737 - 1747, XP019858791, DOI: doi:10.1007/s00417-010-1435-5 |
| YOSHIDA T; IMAI T; KAKIZAKI M; NISHIMURA M.; TAKAGI S; YOSHIE O.: "Identification of Single C motif-1/lymphotactin receptor XCR1", J. BIOL. CHEM., vol. 273, 1998, pages 16551 - 16554, XP002279609, DOI: doi:10.1074/jbc.273.26.16551 |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2670748C2 (ru) * | 2013-06-24 | 2018-10-25 | Аблбио | Конъюгаты антител с лекарственными агентами, обладающие улучшенной стабильностью, и их применение |
| RU2670748C9 (ru) * | 2013-06-24 | 2018-12-13 | Аблбио | Конъюгаты антител с лекарственными агентами, обладающие улучшенной стабильностью, и их применение |
| US10071170B2 (en) | 2013-06-24 | 2018-09-11 | Ablbio | Antibody-drug conjugate having improved stability and use thereof |
| US10842870B2 (en) | 2015-08-05 | 2020-11-24 | Acticor Biotech | Anti-human GPVI antibodies and uses thereof |
| KR20180068952A (ko) * | 2015-08-05 | 2018-06-22 | 액티코어 바이오테크 | 신규한 항-인간 gpvi 항체 및 이의 용도 |
| WO2017021539A3 (en) * | 2015-08-05 | 2017-03-16 | Acticor Biotech | Novel anti-human gpvi antibodies and uses thereof |
| EP4091628A1 (en) * | 2015-08-05 | 2022-11-23 | Acticor Biotech | Novel anti-human gpvi antibodies and uses thereof |
| IL257323B1 (en) * | 2015-08-05 | 2023-09-01 | Acticor Biotech | New antibodies against human gpvi and their uses |
| IL257323B2 (en) * | 2015-08-05 | 2024-01-01 | Acticor Biotech | Novel anti-human gpvi antibodies and uses thereof |
| KR102751174B1 (ko) | 2015-08-05 | 2025-01-07 | 액티코어 바이오테크 | 신규한 항-인간 gpvi 항체 및 이의 용도 |
| US11692033B2 (en) | 2017-02-03 | 2023-07-04 | Acticor Biotech | Inhibition of platelet aggregation using anti-human GPVI antibodies |
| EP3743448A4 (en) * | 2018-01-26 | 2021-11-03 | Orionis Biosciences, Inc. | XCR1 BINDING AGENTS AND USES THEREOF |
| WO2020136060A1 (en) | 2018-12-28 | 2020-07-02 | F. Hoffmann-La Roche Ag | A peptide-mhc-i-antibody fusion protein for therapeutic use in a patient with amplified immune response |
Also Published As
| Publication number | Publication date |
|---|---|
| ES2684173T3 (es) | 2018-10-01 |
| IN2014CN01466A (https=) | 2015-05-08 |
| PH12014500384A1 (en) | 2014-04-14 |
| IL231075A (en) | 2017-08-31 |
| HK1199038A1 (en) | 2015-06-19 |
| RU2619180C2 (ru) | 2017-05-12 |
| JP5989096B2 (ja) | 2016-09-07 |
| AR087749A1 (es) | 2014-04-16 |
| EP2751140A1 (en) | 2014-07-09 |
| US20140193421A1 (en) | 2014-07-10 |
| EP2751140B1 (en) | 2018-05-30 |
| NZ621320A (en) | 2015-11-27 |
| IL231075A0 (en) | 2014-03-31 |
| KR101767717B1 (ko) | 2017-08-11 |
| TW201311725A (zh) | 2013-03-16 |
| AU2012302596B2 (en) | 2016-12-01 |
| MX346560B (es) | 2017-03-24 |
| MY166152A (en) | 2018-06-06 |
| US9371389B2 (en) | 2016-06-21 |
| BR112014004352A2 (pt) | 2017-03-21 |
| AU2012302596A1 (en) | 2014-03-06 |
| CA2846370A1 (en) | 2013-03-07 |
| JP2014527396A (ja) | 2014-10-16 |
| CN103764680B (zh) | 2016-11-23 |
| MX2014002078A (es) | 2014-05-30 |
| KR20140054108A (ko) | 2014-05-08 |
| CA2846370C (en) | 2019-04-23 |
| TWI563004B (en) | 2016-12-21 |
| RU2014106832A (ru) | 2015-08-27 |
| CN103764680A (zh) | 2014-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2846370C (en) | Anti-human xcr1 antibodies | |
| CA2993423C (en) | Il-8-binding antibodies and uses thereof | |
| AU2012233313C1 (en) | Method for altering plasma retention and immunogenicity of antigen-binding molecule | |
| AU2024219504A1 (en) | BINDING MOLECULES SPECIFIC FOR FCyGAMMA RIIA AND USES THEREOF | |
| CN112969714B (zh) | 抗cd40抗体、其抗原结合片段及其医药用途 | |
| US20170342169A1 (en) | Bispecific binding proteins | |
| CN110573527A (zh) | 抗ox40抗体及其用途 | |
| KR20120134138A (ko) | 인간 csf-1r에 대한 항체 및 이의 용도 | |
| KR20120138801A (ko) | 인간 csf-1r에 대한 항체 및 이의 용도 | |
| EA031047B1 (ru) | Антагонисты st2l и способы их применения | |
| JP2012521216A (ja) | Lightに対するヒト化抗体およびその使用 | |
| AU2015332338A1 (en) | Antibodies that bind to CCR6 and their uses | |
| US20260062487A1 (en) | Multi-specific antibodies and methods of use | |
| JP2024542618A (ja) | 抗trem2抗体による線維症治療法 | |
| AU2021223063A1 (en) | Anti-IL-2 antibody, and antigen-binding fragment thereof and medical use thereof | |
| EP4644422A1 (en) | Anti-nkg2a antibody and use thereof | |
| WO2013091903A1 (en) | Anti-crac channel antibodies | |
| TWI858383B (zh) | 一種cdc平臺抗體 | |
| NZ621320B2 (en) | Anti-human xcr1 antibodies | |
| EP4585618A1 (en) | Anti-ilt4 antibody and pharmaceutical use thereof | |
| JP2026513553A (ja) | 抗bdca2抗体 | |
| EP4725965A1 (en) | Anti-bdca2 antibody | |
| WO2026008055A1 (zh) | 抗kit抗体及其医药用途 | |
| CA3022479C (en) | Binding molecules specific for fc.gamma.riia and uses thereof | |
| WO2024135794A1 (ja) | 抗ヒトcx3cr1抗体 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12761822 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 231075 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 20147004507 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14240090 Country of ref document: US Ref document number: MX/A/2014/002078 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2846370 Country of ref document: CA Ref document number: 2014106832 Country of ref document: RU Kind code of ref document: A Ref document number: 2014509528 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2012302596 Country of ref document: AU Date of ref document: 20120830 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014004352 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014004352 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140225 |