WO2013029027A1

WO2013029027A1 - Separation of productive biomass from non-productive biomass in bioreactors and methods thereof

Info

Publication number: WO2013029027A1
Application number: PCT/US2012/052394
Authority: WO
Inventors: Robert Paul Woods; Edwin Malkiel; Matt SPIEKER
Original assignee: Algenol Biofuels Inc.
Priority date: 2011-08-24
Filing date: 2012-08-24
Publication date: 2013-02-28

Abstract

The invention provides metabolically enhanced cells in a cell culture that express a characteristic that enables a separation of the metabolically enhanced cells from other cells that do not express the characteristic. The invention further provides systems and methods for culturing metabolically enhanced cells that express a characteristic, and methods for separating the metabolically enhanced cells from other cells that do not express the characteristic.

Description

TITLE

[00 1] Separation Of Productive Biomass From Noii-Productive Biomass In Bioreactors And Methods Thereof

CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S . Provisional Patent Application No. 61/575,644, filed on August 24, 2011 , which is incorporated herei by reference i its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] This invention was made in part with United States government support under The Department of Energy grant number DE EE0002867. The government has certain rights in this invention.

REFERENCE TO SEQUENCE LISTING

[0004] This application contains a sequence listing comprising 76 sequences, created on August 24, 2012, which is named "Separation_PCT_Sequences_ST25'\ and is 208 KB in size.

FIELD OF THE INVENTION

[0005] The field of the present invention relates to biotechnology and bioprocess engineering.

BACKGROUND OF THE INVEN ION

[0006] Biofuels and other products of interest may be produced through converting biomass or other feedstocks using chemical, biological or mechanical means. In a known strategy for the production of biodiesel. for example, the biomass consists of biological cells, which are cultured and subsequently converted to biodiesel using means such as mechanical pressing and solvent extraction. In a known strategy for the production of ethanol, the biomass consists of com, which is converted to ethanol through industrial fermentation, chemical processing a d distillation. Cellulose may also be converted to ethanol through celJiiioIysis processes or gasification processes, These strategies are constrained by the need to regenerate new batches of biomass in the form of new crops of algae, plants or trees to start new cycles of production.

[0007] An alternative strategy developed recently employs metabolicaliy enhanced cells of photosynfhetic orgamsms that inexpensively convert readily available carbon dioxide into inh'acellularly-produced substrates, such as pyruvate, which are then converted into desired products, such as biofuels and other chemicals of industrial value. Instead of converting biomass, the metabolicaliy enhanced cells utilize various biosynthetic pathways to make the products of interest.

[000S] Specifically, U.S. Patent No. 6,306,639 (Woods etal. for "Genetically Modified Cyanobacteria For The Production Of Ethanol, The Constructs And Method Thereof ) (the "'639 patent") and U.S. Patent No. 6,699,696 (Woods et at for "Genetically

Modified Cyanobacteria For The Production Of Ethanol, The Constructs And Method Thereof) (the "'696 patent") disclose genetically enhanced cyanobacteria which are capable of producing ethanol as a product of photosynthesis. Examples 1 through 5 of the '639 patent and the '696 patent teach the insertion of DNA fragments encoding the enzymes pyruvate decarboxlyase and alcohol dehydrogenase into the cyanobacteria and subsequently the in vivo production of those enzymes by the genetically enhanced cyanobacteria, which enzymes convert pyruvate to aceta!dehyde and acetaldehyde to ethanol, respectively. Example 5 of the '639 patent and the '696 patent further teaches the exposure of the genetically enhanced cyanobacteria to light and the production of ethanol by the genetically enhanced cyanobacteria-.

[0009] In ''Ethanol Synthesis fay Genetic Engineering in Cyanobacteria," Applied and Environmental Microbiology, February 1999, 65(2), pp. 523-528, Deng -and Coleman disclose the introduction of the genetic coding sequences of pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adh) from the bacterium Zymomonas mobilis into the eyanobacterium Syneehoeocc s sp. strain PCC 7942 in order to create a novel pathway for fixed carbon utilization wliich results in the synthesis of ethanol. As noted by Deng and Coleman, in some algae and cyanobacteria, ethanol is synthesized as one of the fermentation products under dark a d anaerobic conditions. However, the fermentation process is generally kept at a minimal level ; the level of fermentation is only sufficient for the survival of the organisms. Moreover, ethanol synthesis via fermentation is disfavored in the presence of light in such organisms. Deng and Coleman disclose a pathway for ethanol synthesis in Syneehoeoccus sp. strain PCC 7942 that functions during oxygenic photosynthesis and requires no special conditions, suc as an anaerobic environment.

[00010] The synthesis of a product of interest, such as ethanol, from metabolic-ally enhanced cells may dec line over time due to a variety of causes. For example, productivit}- is dependent upon the preseiice of genes in the metabolic-ally enhanced cells encoding enzymes for the production of the product of interest. Loss or deterioration of the genes relating to the production of the product of interest can result in loss of productivit}- . A culture of the metabolic-ally enhanced cells contained in, for example, a photobioreactor may gradually become less productive as metabolic-ally enhanced cells lose the genetic elements responsible for productivit and the fraction of non-productive cells present in the culture increases.

[00011] Non-productive cells that are alive compete with productive,

nietaboiically enhanced cells for consumption of nutrients in the culture, which are needed by the nietaboiically enhanced cells to grow and reproduce. Non-productive cells may also compete with productive cells for solar inadiance that is required to cany out photosynthesis, in the case of photoautotropliie production of the product of interest. In the presence of a selection pressure, such as antibiotics, the degradation of dead nonproductive cells also consumes nutrients and releases undesirable materials thai are not bioavailable into the culture.

[00012] To ameliorate lost productivity at the cellular level and competition for resour ces between nietaboiically enhanced cells and non-productive cells, a culture in a photobioreactor may be replaced with a culture containing a greater quantity of productive bioiiiass. However, batch replacement of a culture entails expense and loss of efficiency when the photobioreactor is not in operation, highlighting the desirability of preserving culture longevity in commercial processes used to make biofiiels.

[00013] A need exists to distinguish and separate in situ productive nietaboiically enhanced cells from non-productive cells in a cultur e on a global basis, where the masses of nietaboiically enhanced cells and non-productive cells behave in distinct ways but the differences exhibited by individual cells enable the separation of the masses of metabolic-ally enhanced cells and non-productive cells, if a cell in the culture continues to exhibit a specified characteristic, and the specific characteristic persists as long as the cell produces the target molecule, then overall .productivity of the- target molecule is ^'enhanced in the culture because non-productive cells may be separated en masse.

[00014] It is known in the art that endogenous or exogenous genetic material may induce cells to produce gas vesicles, which provide flotation in aqueous solutions.

Methods are also known for separating cells in an aqueous culture thai produce gas vesicles from cells in the aqueous culture that do not produce gas vesicles.

[00015] U.S. Patent No. 6,008,051 (DasSarma for "Recombinant Vector And Process For Cell Flotation") (the "'051 patent") discloses a recombinant vector capable of directing the synthesis of gas vesicles in a non-floating E. coli (and a mutant H.

halobhmt) cell, in addition to a method for directing synthesis of gas vesicles in non- floating E. coli cells, and for transforming non-floating E. coli cells to a floating phenofype. The '051 patent does not teach the. transformation of metabolic-ally enhanced cyanobacteria that produce a product of interest to a floating phenotype.

[00016] U.S. Patent Appln. Pub. No. 20090317886 (Hamilton for "Apparatus and Methods for Separating, Concentrating and Isolating Algae") (the "'886 publication") discloses an apparatus and method to separate strains of cyanobacteria using a

separation/concentration isolation tank, in which the tank wall is at least partly transparent or translucent so that sunlight penetrates the tank wall and into the tank interior. According to this reference, two strains of cyanobacteria, A. flos aquae and M aeruginosa _y present in an aqueous solution in the tank each have gas vacuoles and each rise vertically upwardly in the tank as the gas vacuoles fill, but vertically stratify in the tank by virtue of the different buoyancy responses of the two organisms when exposed to the same environmental conditions, resulting in physical separation between the bacterial strains. This reference further discloses that the desired portion of the aqueous solution may be removed from the tank for further concentration and purification.

[00017] Hamilton does not teach the transformation of metabolically enhanced non-floating cyano acteria that produce a product of interest to a floating pkenotype and furthermore does not teach the separation of such cells from other cells that do not produce a product of interest based on differentiation of non-zero positive settling rates between the metabolic-ally enhanced cells and the other cells. Additionally, the cyanobacteria taught by Hamilton are filamentous cells that are in the range of 20 microns long (Afios aquae) to 100 microns in diameter (M. aeruginosa) and do not experience electrostatic interaction or Brownian motion in aqueous cultures. Conversely, cyanobacteria of the genus S nechococcus, for example, vary in size from 0.8 to 1.5 microns and are subject to electrostatic interactions and fiocculation in aqueous cultures, [00018] In "Three Different But Related Gene Clusters Encoding Gas Vesicles hi Halophilic Archaea " J. Mol. Biol. 227:586-592 (1992), Englert etai. analyze the chromosomal region comprising the gene cluster involved in gas vesicle (Vac) synthesis in Hahferax mediterrami (mc-vac-region) and H lobacterium sahnarhmi (c-vac-region) and compare both of mem to the plasinid loca ted p-vac-region of H. salinarimn. This reference reports 14 gvp genes clustered in an approximately 9-kb DNA region termed the vac region. According to tins reference, the absolute requirement of gvpO for gas vesicle synthesis was demonstrated by transformation experiments. This reference does not teach the transformation of metabolically enhanced non-floating cyanobacteria that produce a product of interest to a floating phenorype. [0001 ] In "The Right ard Gas Vesicle Qperon in Halobaeteriuni Plasmid pNRClOO: Identification Of The gvpA And gvpC Gene Products By Use Of Antibody Probes And Genetic Analysis Of The Region Downstream Of gvpC," J Bacterioi. 1993 February 175(3): 684-692, Haiiaday et al identify a cluster of 13 genes involved in gas vesicle synthesis in Halobacterium halobium and used for restoring flotation in

Halohacierium halobium mutants. According to this reference, the results presented therein open the way toward further genetic analysis of gas vesicle gene functions and directed flotation of other microorganisms with potential biotechnological applications. This reference does not teach the transformation of metabolically enhanced non-floating cvanobacteria that produce a product of interest to a floating phenotype.

[00020] Ei "Gas Vesicle Genes Identified in Bacillus megateri n and Functional Expression in Escherichia coli " J. Bacterioi., May 1998; ISO: 2450 - 2458. Li et al. report the cloning and sequence analysis of a cluster of 15 putative gas vesicle genes (gvp) from Bacillus meg terium VT1 60 and their functional expression in Escherichia coti. According to the authors' knowledge, this is the first example of a functional gas vesicle gene cluster in nonaquatic bacteria and the first example of the interspecies transfer of genes resulting in the synthesis of a functional organelle. This reference does not teach tlie transformation of metabolically enhanced non- floating cvanobacteria that produce a product of interest to a floating phenotype.

[00021] A need exists to provide metabolically enhanced cvanobacteria that produce one or more products of interest through photosynthesis while also exhibiting distinctive features, such as gas vesicles that provide a change in buoyancy in an aqueous culture. A further need exists to provide methods of consistently separating, on a global basis, each metabolic-ally enhanced cyano acterial cell from other cells that do not produce the products of interest. The present invention enables the identification and extraction of non-productive cells through linking the persistent expression of a physical property, such as buoyancy, with productivity in metaboUcai!y enhanced cells. In accordance with the presen invention, if a cell loses the ability to produce the target molecule, it also loses the separation characteristic that is the result of the expression of a particular gene. Accordingly, the present invention provides for sustained productivity of a culture containing metabolicallv enhanced cells,

SUMMARY OF THE INVENTION

[00022] An object of this invention is the formation of an enhanced cyanobacterial cell, comprising a heterologous DNA sequence which facilitates the creation of a physical characteristic enabling a spatial separation of the enhanced cell in a culture medium comprising enhanced and non-enhanced cells.

[00023] Another object of this invention is a metabolicallv enhanced cell thai produces a product of interest comprising at least one heterologous DNA molecule, wherein the at least one heterologous DNA molecule comprises a first nucleotide sequence for the production of the produc t of interest and a second nucleotide sequence for enabling a spatial or physical separation of the metabolic-ally enhanced cells in a cell culture from other cells that do not produce the product of interest in the medium. The global separation of non-productive cells from productive cells is enabled by the persistent expression of a specified feature b each productive cell, while non-productive cells do not express the specified feature. Accordingly, non-productive cells are constantly screened for separation from productive cells. [00024] In some embodiments, the product of interest is eilianol, and th specified tea toe or characteristic that enables the spatial or physical separation, of productive cells from non-productive cells is buoyancy. The production of ethanol. is linked to the persistence of buoyancy, such that the loss from a cell of genetic material encoding the production of ethanol is necessarily accompanied by fee loss of genetic material feat provides for buoyancy of the cell.

[00025] In some embodiments, the specified feature or characteristic that enables the spatial or physical separation of productive cells from non-productive cells is fee production of chlorophyll or the execution of photosystem. I or photosysteni II. The production ofefhanol or other product of interest is linked to continuing ability of the ceil to conduct photosynthesis, such that the loss from a cell of genetic material encoding the production of product of interest is necessarily accompanied by fee loss of genetic material that encodes for photosynthesis. A cell that loses the ability to produce the product of interest also loses the ability to cany out photosynthesis and dies.

[00026] Compete separation is a preferred embodiment. Incomplete separation is within the scope of the invention and is a benefit to the overall target molecule product production. For example, removal of 50% of non-productive cells during each pass through a mechanical separator reduces the competition between non-productive and productive cells.

[00027] In some embodiments, the at least one heterologous D A molecule comprises a first nucleotide sequence encoding at least one polypeptide for the production of the product of interest and a second nucleotide sequence encoding a t least one polypeptide enabling a spatial or physical separation of (he meiabolicaHy enhanced cells in a cell culture from the other cells.

[00028] In some embodiments, the metabolic-ally enhanced cell is an autotrophic cell, a photoautotrophic ceil, a photoheterotiOphic cell or a chemoautotrophic cell.

[00029] In some embodiments, the nietabolieally enhanced cell is a

cyanobactermm.

[00030] In some embodiments, the expression in the nietabolieally enhanced cells of the second nucleotide sequence enabling a spatial or physical separation of the nietabolieally enhanced cells in a cell culture from other cells confers buoyancy.

[00031] I some embodiments, the expressio in the nietabolieally enhanced cells of the second nucleotide sequence enabling a spatial or physical ^'separation of the nietabolieally enhanced cells in a cell culture from other cells is the production of a gas vesicle.

[00032] In some embodiments, the product of interest is a volatile organic compound.

[00033] In some embodiments, the product of niterest is an alcohol, an aldehyde, a ketone, an organic acid, an alkene, or an isoprenoid. The product of interest can be a pharmaceutical drag, a mitraceutical. a bioplastic, a monomer (such as acrylic acid), or a polymer.

[00034] In some embodiments, the nietabolieally enhanced cell further comprises at least one plasmid, wherein the at least one plasmid comprises the at least one heterologous DNA molecule. [00035] In some embodiments, tlie metabolically enhanced ceil further comprises at least one chromosome, wherein the at least one chromosome comprises the at least one heterologous DNA molecule.

[00036] In some embodiments, tlie metabolically enhanced cell is created fiom Chroococcales, G eobacteri , Nosiocal s, Oscillatoriaies, Pleuroeapsal s, Prochlorahs or Siigonemat les.

[00037] In some embodiments, the first nucleotide sequence encodes at least one polypeptide for an enzyme for the production of etlianoi selected from a group consisting of pyruvate decarboxylases and alcohol dehydrogenases: and the second nucleotide sequence enabling a spatial or physical separation of the metabolically enhanced cells in a cell cultur e from other cells encodes at least one polypeptide for the production of a gas vesicle.

[00038] In some embodiments, the metabolically enhanced cell further comprises a first promoter element, wherein the first promoter element regulates the first nucleotide sequence and the second nucleotide sequence.

[00039] In some embodiments, the metabolically enhanced cell further comprises at least first promoter element and a second promoter element, wherein at least one open reading frame of the first nucleotide sequence is regulated by the at least first promoter element and at least one open reading frame of the second nuc leotide sequence is regulated by the second promoter element.

[00040] In some embodiments, the metabolically enhanced cell further comprises a constitutive promoter element, wherein the first nucleotide sequence and the second nucleotide sequence are regulated by the constitutive promoter element. [00041 J In some embodiments, tlie metabolically enhanced ceil farther comprises at least a first promoter element, wherein the first micleotide sequence, and the second nucleotide sequence are independently regulated by the at least first promoter element.

[00042] In some embodiments, the metabolically enhanced cell farther comprises an inducible promoter element, wherein the first nucleotide sequence and the second nucleotide sequence are regulated by the inducible promoter element.

[00043] I some embodiments, the metabolically enhanced cell comprises at least one promoter element, wherein the promoter element for the first nucleotide sequence and the promoter element for the second nucleotide sequence are the same.

[00044] I some embodiments, the metabolically enhanced cell further comprises at least one promoter element, wherein the promoter element for the first nucleotide sequence and the promoter element for the second nucleotide sequence are different.

[00045] In some embodiments, the metabolically enhanced cell further comprises a first promoter element for the transcriptional control of the first nucleotide sequence encoding at least one polypeptide for the production of the product of interest and the second nucleotide sequence encoding at least one polypeptide enabling a spatial or physical separation of the metabolically enhanced cells in a cell culture from other cells, wherein the first nucleotide sequence encoding at least one polypeptide for the production of the product of interest is for etlianol production and is selected from the group consisting of adhA, pdc, adhl, adhH and adliE; the second nucleotide sequence encoding at least one polypeptide enabling a spatial or physical separation of the metabolically enhanced cells in a cell culture from other cells is for buoyancy or production of a gas vesicle and is selected from the group consisting of gvpA, gvpB, gvpC, gvpF, gvpG, gvpJ, gypK, gypL, gvpN, gypR, gvpS, gvpT and g pU; and the promoter element for the transcriptional control of the first gene and the second gene is selected from the group consisting of PrbcL, PnblA, Ppetl, PntcA, PisiA, PpetE, PggpS, PpshA2, PpsaA,. PsigB, PIrtA, PfatpG, Pnii-A PhspA, PcipBl, PhliB, Prbc, and PcrhC.

[00046] In some embodiments, the second nucleotide sequence encodes at least one polypeptide selected from the group consisting of SEQ ID NOs: 11-23.

[00047] I some embodiments, the at least one polypeptide sequence has more than 90% identity to any of the polypeptides selected from the group consisting of SEQ ID NOs: 11-23.

[00048] I some embodiments, the metabolically enhanced cell further comprises a first promoter element, wherein the first promoter element controls the transcription of bom the at least one gene encoding at least one polypeptide for the production of the product of hiterest and the at least one gene encoding at least one polypeptide enabling a spatial or physical separation of the metabolically enhanced cell in a cell culture from other cells.

[00049] In some embodiments, the metabolically enhanced cell further comprises at least one promoter element that controls the transcription of the at least one gene encoding at least one polypeptide for the production of the product of hiterest and at least one promoter element that controls the tr anscription of the second nucleotide sequence encoding at least one polypeptide enabling a spatial or physical separation of the metabolically entranced cells in a cell culture from other cells.

[00050] In some embodiments, the second nucleotide sequence encoding at least one polypeptide enabling a spatial or physical separation of the metabolically enhanced cells in a cell culture from other cells is isolated from .the microorganisms selected torn the group consisting of Arthronema, Lyngby , Baci his, Arthrospira, Pkmktothrix, Pseudoanab n ,. Qseillatorm, Nosioe, Octadecabacter, Halobacterium, H lof rdx, Spirnlina. Synechococcus and Dolichosperrnum .

[00051 ] In some embodiments, th second nucleotide sequence enabling a spatial or physical separa tion of the metabolicaily enhanced cells in a cell culture from other cells is isolated irom the microorganisms selected from the group consisting of

Arthronema, Lyngbya, Bacillus, Arthrospira, Planfoothrix, Fseudoanabaena-, Osd atorio, Nostoc, Octadecabacter, Halobacterium, Haloferax, Spirulina, Sy echococcas and Dolichospermum .

[00052] In some embodiments, the metabolicaily enhanced cell comprises at least one heterologous DNA molecule, wherein the at least one heterologous DNA molecule further comprises a third nucleotide sequence encoding a selectable marker.

[00053] Another object of this invention is a method for differentiating

metabolicaily enhanced cells that produce a product of interest from other cells that do not produce the product of interest, comprising cul ruling metabolicaily enhanced cells that comprise a first nucleotide sequence for the production of the product of interest and a second nucleotide sequence; wherein the other cells that do not produce the product of interest do not comprise the second nucleotide sequence, and expressing in the

metabolicaily enhanced cells, the second nucleotide sequence enabling a spatial or physica l separation of the metabolicaily enhanced cells in a cell culture from the other cells. [00054] In some embodiments, the meta olicaUy enhanced cells are autotrophic cells, photoautotrophic ceils, photoheterotrophic cells or diemoautotrophic cells.

[00055] In some embodiments, the metabolic-ally enhanced cells are eyanohacteria.

[00056] In some embodiments, expressing in the metabolicaUy enhanced cells, the second nucleotide sequence enabling a spatial or physical separation of the metabolieally enhanced cells in a cell culture from the other cells, confers buoyancy.

[00057] In some embodiments, expressing in the metabolicaUy enhanced cells, the second nucleotide sequence enabling a spatial or physical separation of the metabolicaUy enhanced cells in a cell culture from the other cells, confers production of a gas vesicle.

[00058] In some embodiments, the metabolicaUy enhanced cells are cultured in a medium contained in a bioreactor.

[00059] In some embodiments, the bioreactor is a photobioreactor.

[00060] In some embodiments, the metabolicaUy enhanced cells remain closer to the surfac e of the medium than the other cells that do not produce the product of interest.

[00061] In some embodiments, the metabolicaUy enhanced cells settle to the bottom of the bioreactor at a slower rate than the other cells that do not produce the product of interest.

[00062] I some embodiments, the metabolicaUy enhanced cells and the other cells that do not produce the product of interest stratify into bands, which may overlap.

[00063] In some embodiments, the other cells that do not produce the product of interest from the bioreactor are removed through a drain formed in the bottom of the bioreactor. [00064] In some embodiments, tlie other .cells thai do not produce the product of interest settle to the bottom of the bioreactor and are not removed or resuspended in the culture. Competition for light, nutrients and other resources that are consumed by productive cells in the bioreactor is reduced by allowing the non-productive cells to settle and remain on the bottom of the bioreactor.

[00065] In some embodiments, the medium is flowed over a baffle.

[00066] Another object of this invention is a system for separating metaboiieaily enhanced cells that produce a product of interest from cells that do not produce the product of interest comprising a bioreactor; a holding vessel; a baffle disposed in the holding vessel; flow connectors connecting the bioreactor with the holding vessel; a medium containing metabolic-ally entranced cells that produce a product of interest and produce gas vesicles and containing cells that do not produce the product of interest and do not produce gas vesicles; and a pump adapted to induce flow of the medium between the bioreactor and the holding vessel and over the baffle.

[00067] Another object of this invention is a system for separating metabolicaily enhanced cells that produce a product of interest from cells that do not produce the product of interest, which comprises a medium comprising metabolicaily enhanced cells that produce a product of interest and produce gas vesicles and cells that do not produce the product of interest and do not produce gas vesicles and a partial obstiiiction, wherein the medium flows over or through the partial obstruction.

[00068] Another object of this invention is a method of culhiring the metabolic ally enhanced cells comprising the method steps of transforming autotrophic cells with the heterologous D A molecule; transferring the transformed autotrophic cells to a culture medium, in a bioreactor; expressing the first nucleotide sequence in the autotrophic cells for the production of the product of i terest; expressing the second nucleotide sequence in the autotrophic cells for enabling a spatial or physical separation Of the metabolic-ally enhanced cells in a cell culture from other cells; and fraiisfening a portion of the autotrophic cells from the bioreactor to a holding vessel

[00069] Another object of this invention is a method of culruring the metabolic ally enhanced cells comprising the method steps of transforming autotrophic cells with the at least one heterologous DNA molecule; transferring the transformed autotrophic cells to a bioreactor; expressing me first nucleotide sequence in the autotrophic cells for the production of the product of interest; expressing the second nucleotide sequence in the autotrophic cells for enabling a spatial or physical separation of the metabolically enhanced cells in a cell culture from other cells; tiansfemng a portion of the autotrophic cells from the bioreactor to a holding vessel; and returning a portion of the liquid comprising autotrophic cells from the holding vessel to the bioreactor.

[00070] In some embodiments, the portion of the autotrophic cells is transferred to the holding vessel by transfeiring an upper portion of the medium, which is closer to the surface of the medium.

[00071] In some embodiments, the portion of the autotrophic cells is transferred to the holding vessel by ttansferring a base portion of the medium, which is closer to the bottom of the medium.

[00072] Another object of this invention is a method for producing a product of interest comprising culruring metabolically enhanced cells comprising a first nucleotide sequence for the production of a product of interest and a. second nucleotide sequence enabling a spatial or physical separation of the metaboiicaliy enhanced cells in a cell culture from other cells not harboring the first nucleotide sequence for the production of a product of interest, wherein the metaboiicaliy enhanced cells produce the product of interest while being cultured.

[00073] Another object of this invention is a method for separating metaboiicaliy enhanced cells from other cells comprising the steps of creating metaboiicaliy enhanced cells comprising a nucleotide sequence the expression of which alters the density of the metaboiicaliy enhanced cells relative to the density of wild type cells; allowing said cells to grow in a culture which comprises cells not so metaboiicaliy enhanced; and separating said metaboiicaliy enhanced cells from other cells on the basis of differences in settling rate.

[00074] In some embodiments, the method further comprises the steps of

determining a settling rate v(enliaiiced) of the metaboiicaliy enhanced cells: providing a holding vessel of approximately rectilinear geometry with settling area A ; selecting an overflow rate Q/A for the holding vessel such that Q/A is greater than v(enhanced), wherein Q is the flow of liquid through the holding vessel; causing the metaboiicaliy enhanced cells of settling rate less than Q/A to leave the holding vessel; and retaining cells of settling rate greater than Q/A within the holding vessel.

BRIEF DESCRIPTION OF THE DRAWINGS

[00075] These and other featur es, aspects and advantages of this invention will become better understood with regard to the following description, appended claims and accompanying drawings where: [00076] Figure 1 shows a schematic diagram of the design of an insert comprising gas vesicles operon and kanamycin resistance gene and the Location of insertion in plasmid RSFIOIQ.

[00077] Figure 2 shows a physical map of the 14.96 kb plasmid pSA499. wliich contains gas vesicle genes from Bacillus megafermm. The location of the gas vesicle genes, replication protein genes, and antibiotic resistance genes are indicated.

[00078] Figure 3 shows a physical map of the 16.87 kb plasmid pAB 1213, which contains gas vesicle genes from Bacillus megateri m. The location of the gas vesicle genes, replication protein genes, and antibiotic resistance genes are indicated.

[00079] Figure 4 shows a physical map of the 16.11 kb plasmid pAB 1214, which contains gas vesicle genes from Microcystis aeruginosa PCC 7806. The location of the gas vesicle genes, replication protein genes, and antibiotic resistance genes are indicated.

[00080] Figure 5 shows a physical map of the 17.87 kb plasmid pAB1215, which contains gas vesicle genes from Microcystis aeruginosa PCC 7806. The location of the gas vesicle genes, replication protein genes, and antibiotic resistance genes are indicated.

[00081] Figure 6 shows a physical map of the 12.56 kb plasmid pAB1252. The location of the gas vesicle genes, replication protein genes, and antibiotic resistance genes are indicated.

[00082] Figure 7 is a photograph showing differential settling of strains PCC 7942 and PCC 7942: pSA499.

[00083] Figure 8 is a panel of photographs of ^' Synechococc sp. PCC 7942 cells, either with or without the gas vesicle plasmid pSA499, after being allowed to settle o the laboratory benchtop for 1, 2, 4 and 7 days. [00084] Figure 9 is a panel of photographs of Symechocystis sp„ PCC 6803 cells, either/with or without the gas vesicle plasmid pSA499, after being allowed to settle on the laboratory beiichtop for 1, 2. 4_; and 7 days.

[00085] Figure ^"10 shows localization of cells of strains PCC 6803 and PCC 6803: pSA499 cells in a sucrose gradient corresponding to the buoyant density between the 10% and 30% sucrose layers.

[00086] Figure 11 shows a physical map of the plasmid p309, the source of ethanologenic genes. The location of the PpetJ promoter, the PDC gene, tlie ADH gene, antibiotic resistance genes, and various restriction sites are indicated.

[00087] Figure 12 shows a schema tic drawing of a photobioreactor and a holding tank.

[00088] Figure 13 show^rs a schematic drawing of a holding tank.

[00089] Figure 14 shows a schematic chawing of close-up of a baffle system with upper and lower baffles.

[00090] Figure 15 shows a schematic drawing of close-up of a baffle system without upper baffle.

[000 1] Figure 16 is a photograph showing suspended ABCC1507 culture after mixing (A) and buoyant ABCC1507 cells collected at the surface after keeping unmixed for 20 hours.

[00092] Figure 17 show^rs a schematic view of an exemplary embodiment in which aqueous culture contained in a bioreactor is mixed from the surface of the culture to the maximum depth of the culture. [00093] Figure 18 shows a schematic view of an exemplary -embodiment in which aqueous culture contained in a bioreactor is mixed from the surface of the culture to a depth that is less than the total depth of the culture.

[00094] Figure 1 shows a schematic view of an exemplary embodiment in which trailing vortices mix an aqueous culture contained in a bioreactor from the surface of the culture to the maximum depth of the culture.

[00095] Figure 20 shows a schematic view of an. exemplary embodiment in which trailing vortices mix an aqueous culture contained in a bioreactor from the siiriace of the culture to a depth that is less than the total depth of the culture,

[00096] Figure 21 shows a schematic view of an exemplary embodiment in which a bioreactor comprises a vertically displaced quiescent settling volume.

[00097] Figure 22 shows a schematic view of an exemplary embodiment in which a bioreactor comprises a horizontally displaced quiescent settling volume.

[00098] Figure 23 shows plots of settling area ratios thai are needed to maintain population fractions of nonproductive faster settling cells that comprise 10% and 20% of the total cell population, respectively.

[00099] Figure 24 is a panel of photographs of Syneckococcus sp. PCC 7942 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid pAB1213 or with gas vesicle plasmid pAB1215, after being allowed to settle on the laboratory benchtop for 2, 4 and 7 days.

[000100] Figure 25 is a panel of photographs of Synechocoecus sp. PCC 7942 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499 or with gas vesicle plasmid pAB1214, after being allowed to settle on the laboratory benchtop for 2, 3, 6 and 8 days.

[000101] Figure 26 is a panel of photographs of Synechococeus sp. PCC 7942 cells, with no gas vesicle plasmid, with gas vesicle plasmid pS A499, with gas vesicle plasmid pAB1213, with gas vesicle plasmid pAB1214 or with gas vesicle plasmid pABl 215, after being allowed to settle o the laboratory henchtop for 1 , 2, 6 and 8 days.

[000102] Figure 27 is a photograph of Synechococeus sp. PCC 7942 cells, with no gas vesicle plasmid or with gas vesicle plasmid pSA499, in a Percoll gradient

[000103] Figure 28 is a panel of photographs of Synechocystis sp. PCC 6803 cells, with no gas vesicle piasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid pAB1213 or with gas vesicle plasmid pAB1214, after being allowed to settle on the laboratory bench top for 1, 2, 4 and 7 days.

[000104] Figure 29 is a panel of photographs of Syn chocystis sp. PCC 6803 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid pAB12I3 or with gas vesicle plasmid pAB1214, after being allowed to settle on the laboratory benchtop for 1, 2, 4 and 7 days.

[000105] Figure 30 is a panel of photographs of Sy nechocystis sp. PCC 6803 cells, with no gas vesicle piasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid pAB1214 or with gas vesicle piasmid pAB1215, after being allowed to settle on the laboratory benchtop for 2, 4 and 7 days.

[000106] Figure 31 is a panel of photographs οϊ Synechocystis sp. PCC 6803 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid

77 pAB1213 to which Z11SO₄ was added or with gas vesicle plasmid pAB 1214, after being: allowed to settle on the iaboratoiy benchtop for 1 , 2, 4 and 7 days.

[000107] Figure 32 is a panel of photographs of Synechoeystis sp. PCC 6803 cells, wit no gas vesicle plasmid, with gas vesicle, plasmid pSA499 or with gas vesicle plasmid pAB1215 to which Z11SO₄ was added, after being allowed to settle on the Iaboratoiy benchtop for 2, 3, 6 and 8 days.

[000108] Figure 33 is a photograph of Synechoeystis sp. PCC: 6803 cells, with no gas vesicle plasmid or with gas vesicle plasmid pSA499₅ in a Percoll gradient

[000109] Figure 34 is a panel of photographs of Sytiechococcm sp. PCC 7002 cells, with no gas vesicle plasmid or with gas vesicle plasmid pSA499, after being allowed to settle 011 the Iaboratoiy benchtop for 1. 2, 4 and 7 days.

[000110] Figure 35 is a panel of photographs of Sytiechococcm sp. PCC 7002 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499 or with gas vesicle plasmid pAB1213, after being allowed to settle on the laboratory benchtop for 2, 4 and 7 days.

[000111] Figure 36 is a panel of photographs of Syneehocoectis sp. PCC 7002 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid pAB1213, with gas vesicle plasmid pABI214, with gas vesicle plasmid pAB 1215 or plasmid TK96, after being allowed to settle on the Iaboratoiy benchtop for 1 , 2, 6 and 8 days.

[000112] Figure 37 is a panel of photographs of Syneehocoectis sp. PCC 7002 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499, with gas vesicle plasmid pAB1213, with gas vesicle plasmid pAB1214, with gas vesicle plasmid pAB1215 or plasmid TK96, after being allowed to settle on the laboratory bencbtop for 1₅ 2, 6 and 8 days.

[000113] Figure 37 is a panel of photographs of Symechococcus sp. PCC 7002 cells, with no gas vesicle plasniid, with gas vesicle plasniid pS A499, with gas vesicle plasniid pAB^'1213, with gas vesicle plasmid pAB1214 or with gas vesicle plasniid pAB^'1215 after being allowed to settle on the laboratory henchtop for 1 , 2, 5 and 8 days.

[000114] Figure 38 is a photograph of Synechococcus sp. PCC 7002 cells, with no gas vesicle plasmid or with gas vesicle plasniid pSA499, in a Percoll gradient.

[000115] Figure 39 is a panel of photographs of Syneckocystis sp. PCC 6803 cells and Synechococcus sp. PCC 7942 cells, with no gas vesicle plasniid or with gas vesicle plasmid pAB1252, after being allowed to settle on the laboratory benchiop for 1, 2, 5 and

8 days.

[000116] Figure 40 is a panel of photographs of Synechococcus sp. PCC 7942 cells, with no gas vesicle plasmid, with gas vesicle plasmid pSA499 or with gas vesicle plasniid pABl 252, after being allowed to settle on the laboratory benchtop for 1, 2, 3 and 5 days.

DETAILED DESCRIPTION OF THE INVENTION

[000117] This invention is directed, in part, to the transfer and replication of gas vesicle genes from a non-planktonic soil microorganism to planktoiiic photoauti phic cyanobacteria that are inetabolieally enhanced to produce a product of interest.

Planfctomc organisms include, but are not limited to, nanoplankton (2-20 μιη diameter) or picoplankton (0.2-2 μιη diameter). [000118] This invention is further directed to the transfer of functionality conferred by gas vesicle gene from a non-planktomc soil microorganism to plankto ic

photoautrophic cyanobacteria that are metaboiically enhanced to produce a product of interest.

[00011 ] In some embodiments, the cyanobacteria are Synechoeystis and

Syneehococc s. In some embodiments, the gas vesicle genes are derived from Bacillus megaterrum. In some embodiments, the gas vesicle genes are derived from Microcystis aeruginosa PCC 7806. In some embodiments, the transfer of ga s vesicle genes from Bacillus megateriitm or Microcystis aeruginosa PCC 7806 to Synechoeystis and

Syneehococcus induces buoyancy of the cy anobacteria in an aqueous culture.

[000120] Achieving buoyancy in Synechoeystis and Syneehococcus through the exogenous addition of gas vesicle genes derived from Bacillus megaterium is unexpected in light of evolutionary divergence between Bacillus megateriitm gvp genes and the cyanobacterial order Chroococcales, which includes Synechoeystis and Syneehococcus, and fiirther in light of low identity between gas vesicle genes found in other

cyanobacteria (order Chroococcales) and gas vesicle genes found in Bacillus megaterium.

[000121] In some embodiments, the product of interest is etfianol. In some

embodiments, pyruvate decarboxylase and alcohol dehydrogenase genes are inserted and expressed in Synechoeystis and Syneehococcus and enable the metaboiically enhanced Synechoeystis and Syneehococcus to produce ethanol. In some embodiments, the pyruvate decarboxylase gene is derived from Zyniamonas mobilis, and the alcohol dehydrogenase gene is derived fiom Synechoeystis. In some embodiments, pyruvate decarboxylase derived from Clostridium acetobutylicum and alcohol dehydrogenase derived from Clostridium b ijerinckn are inserted and expressed in Synechocystis and Synechoeoccus and enable the metabolicaliy enhanced Synechocystis and Synechoeoccus to produce eihanoi. hi some embodiments, homologous gas vesicle genes derived from other cyanobacteria may be transferred to Synechocystis and Synechococcm for the purpose of inducing buoyancy. In a preferred embodiment, homologous genes from the cyanobacterial order Chrooeoccales, such as from Microcystis aeruginosa PCC 7806, are transferred to Synechocystis and Synechoeoccus that are metabolicaliy enhanced to produce a product of interest.

[000122] This invention is further directed to systems and methods for separating metabolicaliy enhanced cells that contain ga vesicle genes and produce a product of interest from other cells that do not contain gas vesicle genes and do not produce a product of interest. According to the present invention, as shown in FIGS. 12, 13, 14 and 15, in an aqueous culture 113 containing metabolicaliy enhanced cells and other cells, the metabolicaliy enhanced cells exhibit a slower settling rate than the other cells, causing the flux of metabolicaliy enhanced cells from higher depths to lower depths in the aqueous culture 113 to be lower than the flux of the other cells from higher depths to lower depths in the aqueous culture 113.

[000123] In some embodiments, an aqueous culture 1 13 containing metabolicaliy enhanced cells and other cells is flowed over or through a baffle 102 or other partial obstruction. According to the present invention, the baffle 102 or partial obstruction differentially retains a larger proportion of the other cells than the metabolicaliy enhanced cells that express production of the target molecule and express the nucleotide sequence enabling spatial or physical separation, since the concentration of the other cells at lower depths in the aqueous culture 113 is higher than the concentration of the metabolically ^'enhanced cells.

[000124] In some embodiments, metabolically enhanced cells are separated from other cells in a holding vessel 101 and are returned to a pBotobioreaetor 112, while the other cells are retained and concentrated in th holding vessel 101 and removed. In some embodiments, the other ceils are retained in a quiescent settling volume V_s in the photobioreaetor 112 and removed, where the quiescent settling volume V_s may be, for example, a vertically displaced portion of the aqueous culture 113 in the photobioreaetor 112 that is bounded by the bottom and sides of the photobioreae tor 112 and extends to a uniform depth from the bottom of the photobioreaetor 112 that is below the smface of the aqueous culture 113 , or a horizontally displaced portion of the aqueous culture 113 that ext ends from the surface to the bottom of the aqueous culture 113 and covers less than the full surface area of the aqueous culture 113.

[000125] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which thi invention belongs. As used herein, the following terms have the meanings ascribed to mem unless specified otherwise.

[000126] The term "about" is used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical value/range, it modifies that value/range by extending the boundaries above and below the numerical value(s) set forth, hi general, the term "about" is used herein to modify a numerical value(s) above and below the stated value(s) by a variance of 20%. [000127] As used herein, the term "metaboiicaily enhanced" is intended to refer to any change in the endogenous genome of a wild type cyanobactertal cell or to the addition of endogenous and non-endogenous, exogenous genetic code to a wild type cyanobacterial cell, such as, for example, the introduction of a heterologous gene. More specifically, such changes are made by the hand of man through the use of recombinant DNA technology or mutagenesis. The changes can involve protein coding sequences or non-protein coding sequences in the genome, including such regulatory sequences as non-coding RNA, antisense RNA, promoters or enhancers. Aspects of mis invention utilize techniques and methods common to the fields of molecular biology, microbiology and cell culture. Useful laboratory references for these ty es of methodologies are readily available to those skilled in the art. See, for example, "Molecular Cloning: A Laboratory Manual" (Third Edition), Sanibrook, J., et al. (2001) Cold Spring Harbor Laboratory Press; "Current Protocols in Microbiology" (2007) Edited by Coico, R, et al., John Wiley and Sons, Inc.; "The Molecular Biology of Cyanobacteria" (1994) Donald Bryant (Ed.), Springer Netherlands; "Handbook Of Microalgal Culture: Biotechnology And Applied Phycology" (2003) Richmond, A.; (ed.), Blackwell Publishing; and "The Cyanobacteria, Molecular Biology, Genomics and Evolution", Edited by Antonia Herrero and Enrique Flores, Caister Academic Press, Norfolk. UK, 2008.

[000128] As used herein, the term "gene" is intended to mean a nucleic acid fragment that is capable of being expressed as a specific protein, optionally including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence. [000129] As used herein, the term "nucleic acid" is intended to mean nucleic acid molecules, such-as-polyaucleotides which include an open reading frame encoding a polypeptide, and can farther include non-coding regulatory^" sequences of genes, such as promoters and enhancers as well as non-coding R As. In addition, the terms are intended to include one or more genes that are part of a func tional operon. In addition, the terms are intended to include a specific gene for a selected purpose. The gene can be endogenous to the host cell or can be recombinantly introduced into the host cell.

[000130] In one aspect the invention also provides nucleic acids that are at least 60%, 70%, 80% 90%, 95%, 99%, or 99.5% identical to the nucleic acids disclosed herein.

[000131] The percentage of identity of two nucleic acid sequences or two ammo acid sequences can be determined using the algorithm of Thompson et al. (CLUSTALW, 1994 Nucleic Acid Research 22: 4673-4, 680). A nucleotide sequence or an amino acid sequence can also be used as a so-called "query sequence^"' to perform a search against public nucleic acid or protein sequence databases in order, for example, to identify further unknown homologous promoters, which can also be used in embodiments of tins invention. In addition, any nucleic acid sequences or protein sequences disclosed in this patent application can also be used as a "query sequence" in order to identify yet unknown sequences in public databases, which can encode for example new enzymes, which could be useful in this invention. Such searches can be performed using the

algorithm of Karlin and Altschul (1999 Proceedings of the National Academy of Sciences U.S.A. 87: 2,264 to 2,268), modified as in Karlin and Altschul (1993 Proceedings of the National Academy of Sciences U.S.A. 90: 5,873 to 5,877). Such an algorithm is incorporated in the NBLAST and XBLAST programs of Altschul et al. (1999 Journal of Molecular Biology 215: 403 to 410). Suitable parameters for these database searches with these programs are, for example, a score of 100 and a word length of 12 for BLAST micleotide searches as performed with the NBLAST program. BLAST protein searches are performed with the XBLAST program with a score of 50 and a word length of 3. Where gaps exist between two sequences, gapped BLAST is utilized as described in Altschul et al. (1997 Nucleic Acid Research, 25: 3,389 to 3,402).

[000132] As used herein, the term "kilobase" is intended to mean 1000 bases of nucleotide sequences. A kilobase is a unit to define the length of a DNA sequence.

[000133] As used herein, the term "polypeptide" is intended to mean a polymer of amino acid linked cova!ently by peptide bonds. Typically, one end of the polypeptide has a tree amino group (N-termmal) and the other end has a free carboxyl group (C- terminal).

[000134] As used herein, the term "DNA" is intended to mean deoxyribonucleic acid.

[000135] As used herein, the term "R A" is intended to mean ribonucleic acid.

[000136] As used herein, the terni "heterologous DNA molecule" is intended to mean the first nucleotide sequence, encoding at least one polypeptide for the production of the product of interest, and the second nucleotide sequence, encoding at least one polypeptide enabling a spatial or physical separation of the metabolically enhanced cells in a cell culture from other cells that do not produce the product of interest. The first nucleotide sequence and the second nucleotide sequence in this invention are co-located on a piasrmd or on a chromosome of the metabolically enhanced cell In some embodiments the first nucleotide sequence and the second nucleotide sequence of the heterologous inolecole may be first located on a plasmid and subsequently integrated into a chromosome of the metabolicaliy enhanced cells.

[000137] As used herein, the term "replicon" is intended to mean a D A molecule or RNA molecule, or a region of such a molecule, which replicates from a single origin of replication and therefore constitutes a replication unit. For most prokaiyotic

chromosomes, the replicon is the entire chromosome. Plasmids are usually replicated as single replieans, but plasmids may cany more than one origin of replication, especially in the case of shuttle vectors that are designed to replicate in more than one organism.

[000138] As used herein, the term ''organelle^"' is intended to mean a specialized subunit within a cell that has a specific function, and is usually separately enclosed within a membrane. Several types of organelles, such as mitochondria, chloroplasts. nucleus and lysosomes, are found in eukaryotic cells. Prokaryotic cells typically do not contain organelles, but gas vesicles are present in some prokaryotes.

[000139] A used herein, the term "gas vesicle" is intended to mean a spindle- shaped structure found in some planktonic bacteria that provides buoyancy to those cells by decreasing their overall cell density. Gas vesicles are made up of a protein coat that is impermeable to solvents such as water but permeable to most gases. Bacteria can increase or decrease their overall cell density by adjusting the number of gas vesicles in the cell and thereby move up or down within a water column to maintain their position in an environment optimal for growth.

[000140] As used herein, the terni "autotrophic" is intended to mean an organism that is capable of utilizing light or inorganic chemicals as a source of energy. [000141] As used herein, the term "photoautotrophic" is intended to mean an organism that is capable of using the energy from sunlight to convert carbon dioxide and water into organic materials to be utilized in cellular functions such a biosynthesis and respiration

[000142] As used herein, th term "operon" is intended to mean a functional unit of genomic DNA containing one or more genes under the control of a single regulatory signal or promoter. The genes in an operon are transcribed together into an mKNA strand. The genes in an operon are either expressed together or not at all. Several genes must be both co-transcribed and co-regulated to define an operon.

[000143] As used herein, the term "genome" is intended to mean the entirety of a cyanobacterium's hereditary information excluding any recombinant extrachromosomal plasmid, which is introduced into the metabolically enhanced cyanobacterium via recombinant DNA technology. The term "genome" therefore is intended to mean the chromosomal genome as well as extrachromosomal piasmids, which are normally present in the wild type cyanobacterimn. For example, cyanobaeteria such as Synecococcus can include at least up to 6 extrachromosonial plasmids in their wild type form.

[000144] As used herein, the term "promoter" is intended to mean a DNA sequence capable of controlling the expression of RNA from a nucleotide sequence comprising an ope reading frame ("ORF"). in general, an ORF is located 3' downstream to a promoter sequence. A promoter may be derived hi its entirety from a native gene, o be composed of different elements derived from different promoters found in nature, or comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may regulate the expression of a gene in different cell types, strains or at

"5^■* different stages of developmen or in response to specific or non-specific en vironmental or physiological conditions. Promoters which cause expression of RNA from

nucleotide sequence most of the times are commonly referred to as "constitutive

promoters." It is further recognized that since in most cases the exact boundaries of regulatory sequences ha ve not been completely defined, DNA fragments of different lengths may have identical promoter activity if the complete promoter is present on the DNA fragment.

[000145] As used herein, the term "open reading frame" ("ORF") is intended to mean a DNA sequence that contains a start codon and the coding sequence for the amino acids of a polypeptide. It does not contain a stop codon in the given reading frame until after the complete coding sequence.

[000146] As used herein, the term "expression" is intended to mean the transcription of RNA derived from the nucleotide sequence of the invention. Alternatively, the term "expression^"' may refer to translation ofmRNA into a polypeptide or to the process of transcription and translation.

[000147] As used herein, the term "transformation" is intended to mean the transfer of a nucleic acid fragment into a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" or "recombinant" or "transformed" organisms.

[000148] Exemplary methods suitable for transformation of cyanobacteria include, as nominating examples, natural DNA uptake (Chung, et al. (1998) FEMS Microbiol. Lett. 164: 353-361; Frigaard, et al. (2004) Methods Mol. Biol. 274: 325-40; Zang, et al. (2007) J. Microbiol. 45: 2 1-245), conjugation, transduction, glass bead transformation (Kindle, ei al. (1 89) J. Cell Biol. 109: 2589-601; Feng, et al. (2009) Mol. Biol. Rep. 36; 1433-9: U.S. Pat. No. 5,661,017). silicon carbide whisker transformation (Dunahay, et al. (1997) Methods Mol. Biol. (1997) 62 503-9), biohsties (Dawson, et al. (1997) CHIT. Microbiol 35: 356-62; Kallmann, et al (1997) Proc. Nail. Acad, USA 94: 7469-7474; Jakobiak, et al. (2004) Protisf 155:381-93; Tan, et al. (2005) J. Microbiol 43: 361-365; Steinbrenner, et al. (2006) Appl Environ. Microbiol. 72: 7477-7484; Kroth (2007)

Memods Mol. Biol. 390: 257-267; U.S. Pat. No. 5,661 ,017) eleetroporation ( jaeralff, et al (1994) Photosynth. Res. 41 : 277-283; Iwai, et al. (2004) Plant Cell Physiol. 45: 171-5; Ravindran, et al. (2006) J. Microbiol. Methods 66: 174-6; Sun, et al. (2006) Gene 377 140-149; Wang, et al. (2007) Appl. Microbiol. Biotechnol. 76: 651-657; Chaurasia, et al. (2008) J. Microbiol. Methods 73: 133-141 ; Ludwig, et al. (2008) Appl. Microbiol.

Biotechnol. 78: 729-35), laser-mediated transformation, or incubation with DNA in the presence of or after pre-treatinent with any of poly(aniidoamine) dendrirners (Pasupathy, et al. (2008) Biotechnol. J. 3: 1078-82), polyethylene glycol (Ohnuma, ei al. (2008) Plant Cell Physiol. 49: 117-120), cationic lipids (Muradawa, et al. (2008) J. Biosci. Bioeng. 105: 77-80), dextraii, calcium phosphate, or calcium chloride (Mendez- Alvarez, et al. (1 94) J. Bacterid. 176; 7395-7397), optionally after treatment of the cells with cell wall- degrading enzymes (Perrone, et al. (1998) Mol. Biol. Cell 9: 3351-3365); and biolistic methods (see, for example, Rarnesh, et al. (2004) Methods Mol. Biol. 274: 355-307; Doestch, et al. (2001) Curr. Genet. 39: 49-60; all of which are incorporated herein by reference in their entireties).

[000149] As used herein, the terms "plasmid" and "vector" are intended to mean an extra chromosomal element often carrying genes, which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome

integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or R A, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique coiisiniction that is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell .

[000150] As used herein, the term "codon-optiniized," when describing genes or coding regions of nucleotide sequence for transformation of various hosts, is intended to mean the alteration of codons in the gene or coding regions of the nucleotide sequence to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the nucleotide sequence.

[000151] As used herein, the teini "nucleotide sequence" is intended to mean a polymeric RNA or DNA that is single- or double-stranded, optionally comprising synthetic, non-natural or altered nucleotide bases. An isolated nucleotide sequence in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

[000152] As used herein, the term "spatial or physical separation" is intended to include vertical separation in an aqueous culture between metabolically enhanced cells containing gas vesicle gene sequences and other cells that do not contain gas vesicle gene sequences. Spatial separation includes separations other than vertical. According to the present invention, vertical separation results from expression of the gas vesic le gene sequences in the metabolically enhanced cells, which causes increased buoyancy of the metabolicaliy enhanced cells in comparison to the other cells that do not contain gas vesicle gene sequences, and cells that do not produce the product of interest will not exhibit buoyancy.

[000153] In accordance with, the present invention, a majority of metabolicaliy enhanced cells containing gas. vesicle gene sequences tend to exhibit vertical separation from a majority of other cells that do not contain gas vesicle gene sequences, wherein a majority of metabolicaliy enhanced cells containing gas vesicle gene sequences remain closer to the surface of the aqueous culture for a longer period of time. In accordance with the present invention, the maximum depth of the total population of metabolicaliy enhanced cells containing gas vesicle gene sequences, a measured from the surface of the aqueous culture, may overlap with the minimum depth of the total population of other cells that do not contain gas vesicle gene sequences, as measured from the surface of the aqueous culture.

[000154] As used herein, the term "buoyancy" is intended to mean the net upward force exerted on a cell contained in an aqueous culture. A metabolicaliy enhanced cell containing gas vesicle gene sequences can experience a different force in an aqueous culture relative to another cell that does not contain gas vesicle gene sequences, such that the metabolicaliy enhanced cell containing gas vesicle gene sequence exhibits a different settling rate and settles out of the aqueous culture at a different rate compared to the other cell that does not contain gas vesicle gene sequences. A population of metabolicaliy enhanced cell containing gas vesicle gene sequences can experience flotation or sinking en masse compared to a population of other cells that do not contain gas vesicle gene sequences. [000155] As used herein, the term "bioreactor" is intended to mean any

manufactured or engineered device or system mat supports a biologically active environment.

[000156] As used herein, the term "photobioreactor" is intended to mean a bioreactor which incorporates, some type of light source to provide photonic enersy input into the reactor.

[000157] As used herein, the term "baffle" is intended to mea a flow-directing vane or panel in a vessel.

[000158] As used herein, the tern "holding vessel" is intended to mean a container such as a tank that is used to for the sedimentation of biological cells.

[000159] The EC numbers cited throughout this patent application are enzyme commission numbers, which are part of a numerical classification scheme for enzymes based on the chemical reactions which are catalyzed by the enzymes.

[000160] Although other expressions may be used, denominations of genes herein are typically presented hi a three letter lower case name followed by a capitalized letter if more than one related gene exists, for example gvpA or gvpC. The respective protein encoded by that gene is denominated by the same name with the first letter capitalized, such as GvpA or GvpC.

[000161] Denominations for promoter sequences, which control the transcription of a certain gene in their natural environment, are typically given by a capitalized letter "P" followed by the gene name according to the above described nomenclature, such as, for example "PpetJ" for the promoter controlling the transcription of the pet! gene. [000162] Denominations for enzyme names cm be given in a three letter code indicating the origin of the enzyme, followed by the above mentioned three letter code for the enzyme itself, such as SynAdh (Zn2÷ dependent Alcohol dehydrogenase from Synechocystis), ZymPdc (pyruvate decarboxylase from Z tnomon s mobifis).

[000163] One of ordinary skill in th art will understand that microorganisms suitable for use in accordance with the present invention may be selected from bacteria, yeast and filamentous fungi capable of using carbohydrates and sugars to produce ethanol or other products of interest. In some embodiments, microorganisms suitable for use in accordance with the present invention are pIiototrop c or heterotrophic. A phototrophic microorganism suitable for use in accordance with the present invention may be an obligate photoautotroph dependent on inorganic sources of carbon or a photoautotroph wifh an ability to shift to opportiuiisiic photoheterotrophy when organic somces of carbon are present to metabolize.

[000164] In some embodiments, filamentary cvanobacteria are suitable for use in accordance with the present invention. One of ordinary skill in the art will appreciate thai cyanobacteria are known to be among the smallest organisms that fix CO? in ^'the presence of light. Because of their photosynthetic efficiencies, these organisms are being

investigated for their potential to produce a variety of biofrtels and industrial chemicals. The cyanohacterial genera of this invention include without limitation Sy chococcus, Synechocystis, Anabaena, Nostoc, Cyanobacterium, Chroococcidiopsis, Chlorogloeopsis, Arthronema, Cyanothece, Aphanothece and Lynghya. Additional exemplary

cyanobacteria thai can be transformed with the nucleic acids described herein include, but are not limited to, Acmyochloris, therrnosynechococcus, Chamaesiphon, Chraocaccus, Cyaiiobacterium, Cyanobiu , Dactylococcopsis, Gloeobact r, Gloeocapsa, G eofhece. Microcystis, Prochlorococcus, Prock ron, Cyanocystis, Dermocarpett , Myxosarcina. Pleurocapsa, Staniefia, Xenococcus, Art^'hraspi , Borz , Crinalium, Geitlerinenm, Halospirukna, Leptoiyngbya, Linmothrix, Microcoleus, Cyanodictyon, Aphanocapsa, Oscillatoria, Planktoihrix, Prochhrathrix, Pseudcmabaena, Spirukna, Starria, Symploca, Triehodesmhtm, Tychonema. Anab enopsis, Aphanizomenon, Galothrix, Cyanospira, Cylindrospemiopsw, CyUndrospermmn, Nodularia, Ch rogloeopsis, Fischerelia,

Geideria, Nos^'tochopsis, fyengarielia, Stigoftema, Rivulario, Scytonema, Tolypothrix, Phormidmm, Adria ma, and the like.

[000165] In a preferred embodiment, the cyanobacterimn is transformable to add nucleic acids for the production of a product of interest, such as ethanol, and the production of gas vesicles.

[000166] In a preferred embodiment, the cyanobacterhmi is capable of being metabolic-ally enhanced for the purpose of producing biomass, biofuels such as efhanol, industrial chemicals, bioplastics, nutraceuticals, monomers, polymers, alcohols,

aldehydes, diol, ketones, isoprenoids, organic acids and pharmaceutical drags of interest.

[000167] In some embodiments, the microorganism is a unicellular or a filamentous photoautotroph using light energy and atmospheric C<¼ to produce biomass and the product of interest. In some embodiments, the unicellular or filamentous photoautotroph is a cyanobacterium.

[000168] One of ordinary skill in the art will recognize that prokaryotic organisms such as cyanobacteria typically do not contain organelles, with the exception of gas vesicles found in some planktonic bacteria. Gas vesicles are low-density, gas-filled subcellular structures comprising a protehiaceous membrane. Gas vesicles are found in some species of aquatic aaojQ hotoautotrophic bacteria, cyaiiobacteria and lialopliilic archaea and some other microorganisms.

[000169] Typically, the cyanobacteria genera Sytiechocystis and Sytteehaeocc s are not known to cany genes known to be involved in gas vesicle formation. Some cyanobacteria of the taxonomic order C roococcales, such as, for example. Microcystis, have been reported to form gas vesicles. Smarda and Roussomoustakaki, however, reported in "Archiv fur Hydrobiologie," Supplement (2000). Vol. 134. pp. 53-65, that electron microscopy of two coccoid halobiotic cyanobacteria of the order Chroococcales revealed that these bacteria do not form gas vesicles, although some evidence of small irregular fragments of gas vesicle wall with typical fine striatum was noted in Cyanoih ce. halobia and Aphanothece. cf. krimibemii.

[000170] n halobacteria. GvpA protein is a major constituent of the gas vesicle membrane. Gas vesicles are formed by most of the strains of Ectotkiorhodospiro

haloalk hphila, a haiopmlic, alkahphilie purple suphur bacterium (Gorlenko, Vladimir M.; Bryantseva, Irina A.; Rabold, Sandra; Tourova, Tatjana P.; Rubtsova, Dariya;

Sinirnova. Ekaterina; Thiel, Vera: Imlioff, Johannes F.; bitemational Journal of

Systematic and Evolutionary Microbiology (2009), 59(4), 658-664). The presence of gas vesicles allows the positioning of the organism at a depth favorable for growth.

[000171] in the case of halophilic archaea, 14 gvp genes cluster in an approximately 9-kb DNA region termed the vac region, as reported by Englert et al, 992. J Mol. Biol. 227: 586-592. More than one vac region may be present in a single organism. A vac region may be present on a piasniid or on a chromosome. Within a vac region, the gvp genes may be subclustered under the control of one or more promoters.

[000172] Surprisingly, gas vesicles have been found in certain nonplanktonie soil microorganisms, such as Bacillus megaiertum, Homologs of gas vesicles genes have been found among other bacteria from non-planktonic habitats as well For example, the availability of genome sequences reveals gas vesicle gene clusters in members of the Actinoniyceie genera Str ptontyces, Frankia and Rhodococcus.

[000173] One of ordinary skill in the art will recognize that the gas vesicle genes of Baciilm megatermm appear to be highly divergent from those of other species. For example, a search for gvp proteins homologous to Bacillus megatermm gas vesicle proteins yielded BlastP hits with > 95% identity to nr database entries

(www.ncbi.nlm.iiih.gov) only among strains of Bacillus megaiertum and did not include sequences from other organisms. Furthermore, BlastP hits higher than 75% identity were encountered only against the members of Bacillus genera itself. Any homologous hits against sequences from other organisms were less than 75% identity, and most had <50% identity. Therefore, for the assembly of gas vesicle organelle, a person of ordinary skill in the art would not expect that a gas vesicle cluster obtained from Bacillus megaiertum may be substituted for gas vesicle cluster in cyanobacterial organisms.

[000174] Consistently, a search for homologs of Bacillus megaterium gvp ORFs in Cyanobase Qittp://genome.kazusa.or.jp/cyanobase) did not yield any hits for homologous genes or proteins for any strain of Synechocystis. Homologous gvpA, gvpG, gvpJ, gvpN, gvpW were found in a Synechococcus sp. JA-3-3Ab and Synechococcus sp. JA-2-3Ba (2- 13). Homologs of gvp genes were not found in Synechocystis sp. PCC6803 or S nechocQccus sp. strains PCC7942, PCC7002 or any other strains in genera

Sy chocystis and Synecht>coccus.

[000175] An example of functional gas vesicle gene cluster in nonaquatie bacteria and inter-species transfer of genes between Bacillus megaterium and E. coli is provided by Li and Cannon (1998, Journal of Bacteriology , 180 (9): 2450-2458). A fragment isolated &om Bacillus megateriwn comprising gvpB, gvpR, gvpN, gvpF, gvpG, gvpL, gvpS, gvp , gvpJ, gvpT and gvpU was found sufficient for the synthesis of a functional gas vesicle organelle in E. coli. Bacillus megateriwn and Escherichia coli are both heterotrophic eubacteria.

[000176] As shown in FIGS. 12, 13, 14, and 15. in some embodiments, the present invention comprises a separation system 114 comprising a photobioreactor 112, a holding vessel 101, one or more baffles 102 disposed within the holding vessel 101, flow

connectors 108 between the photobioreac tor 112 and the holding vessel 101, and a pump 109 that induces flow circulating between the photobioreactor 112 and the holding vessel 101.

[000177] In some embodiments, the photobioreactor is adapted to contain an aqueous culture of cyanobacteria 113. In some embodiments, the volume of aqueous culture 113 contained in the photobioreactor 112 is 1 ,000 liters, hi some embodiments, the volume of aqueous culture 113 contained in the photobioreactor 112 is 4,500 liters. In some embodiments, the width of the photobioreactor 112 is approximately 1.5 meters. In some embodiments, the length of the photobioreact or 112 is from approximately 3 meters to approximately 15.2 meters. In some embodiments, the depth of the aqueous culture of cyanobacteria 113 in the photobioreactor 112 is approximately 20 cm. [000178] In some embodiments, the aqueous culture 113 contains approximately 1x10^s cyanobacteria per milliliter. In some embodimenis, the total number of

cyanobacteria contained in the -aqueous culture 1.13 remains roughly constant, because productive cyanobacteria reproduce in numbers sufficient to replace non-productive cyanobacteria that are separated and discarded.

[GOG 179] hi some embodiments, the total volume of aqueous culture 113 contained in the photobioreactor 112 and the holding vessel 101 remains roughly constant, because sufficient water, media, nutrients, culture and/or inoculum is added to replace wafer, media, nutrients, culture and/or inoculum that is discarded with non-productive

cyanobacteria. In some embodiments, the total depth of aqueous culture 1 13 contained in the photobioreactor 112 and the holding vessel 1 1 remains roughly constant, because sufficient water, media, nutrients, culture and or inoculum is added to replace water, media, nutrients, culture and or inoculum that is discarded with non-productive

cyanobacteria.

[000180] In some embodiments, the holding vessel 101 is a tank or other enclosed container. In some embodiments, the dimensions of the holding vessel I are similar to the dimensions of the photobioreact or 112. In some embodiments, the shape of the holding vessel 101 is oblong. In some embodiments, the holding vessel 1 is positioned adjacent to the photobioreactor 112. One of ordinary skill in the art will understand that the holding vessel 101 may have any dimensions and shape suitable for use in separating buoyant from non-buoyant aqueous bioniass.

[000181] In some embodiments, a flow connector 108 permits flow of the aqueous culture of cyanobacteria 113 from the photobioreactor 112 to the holding vessel 101. In some embodiments, a flow connector 108 permits flow of me aqueous culture of cyanobacteria 1 13 from the holding vessel 101 to the photobioreactor 1 12. In some embodiments, the flow connectors provide flow distributed across the width of the photobioreactor 112 and the holding vessel 101. hi some embodiments, one-way valves permit circulation of the aqueous culture of cyanobacteria 113 through the

photobioreactor 112 and the holding vessel 101 i only one direction of flow.

[000182] In some embodiments, the flow connector 108 connects to the

photobioreactor 112 near the bottom of the photobioreactor 112 and to the holding vessel 101 near the bottom of the holding vessel 101. In some embodiments, the flow connector 111 connects to the photobioreactor 112 near the surface of the aqueous culture 113 in the photobioreactor 112 and to the holding vessel 101 near the surface of the aqueous culture 113 in the holding vessel 101.

[000183] In some embodiments, one or more baffles 102 are attached to the bottom inner surface of the holding vessel 101. In some embodiments, a series of up to twelve baffles 102 are attached to the bottom inner surface of the holding vessel 101. In some embodiments, the baffles 102 are approximately 0.3 cm thick and are as wide as the inner width of the holding vessel 101. In some embodiments, the height of the baffles 2 is 85% of the depth of the aqueous culture 113 contained in the holding vessel 1 1.

[000184] A shown in FIGS. 13 and 14, in some embodiments, conesponding substantially vertical baffles 102 are attached to the top inner surface of the holding vessel 101, such that gaps exist between the closest edges of the bottoni inner surface and top inner surface baffles 102. [000 85] In some embodiments, one or more drains 105 are incorporated in tlie bottom surface of the holding vessel 101 to facilitate extraction of non-productive bioinass that is deposited on the bottom surface of the holding vessel 101. In some embodiments, tlie dram 105 is iocated upstream from tlie leading surface of a baffle 102. relative to the direction of flow of tlie aqueous culture 113. In some embodiments, the dr ain 105 is closed during normal operation of the photobioreacior 112 and is opened intermittently when the holding vessel 101 is being cleaned of cyanobaeteria deposited on the floor of the holding vessel 101.

[000186] hi some embodiments, tlie baffles 102 are substantially vertical. In some embodiments, the baffles 102 are angled from vertical.

[000187] In some embodiments, the pump 109 is a centrifugal pump.

[000188] In some embodiments, steady-state, continuous flow is maintained between the photobioreacior 112 and the holding vessel 101 at a constant, preselected rate during operation of the photobioreacior 112. In some embodiments, flow between the photobioreacior 112 and the holding vessel 101 is initiated and terminated

periodically for a predetermined length of time dining operation of the photobioreacior 112.

[000189] In some embodiments, flow is induced such that a volume of the aqueous culture 113 that contains a higher concentration of non-productive cyanobaeteria than productive cyanobaeteria is transferred from the photobioreactor 112 to the holding vessel 101.

[000190] In some embodiments, the aqueous culture 113 contained in the photobioreactor 112 is mixed from the surface of the cultur e 113 to a depth that is less than the total depth of the culture 113. In accordance with the present invention, nonproductive cells settle to the bottom of the photobioreactor 112 and may, or may not, be removed, while productive cells havin greater buoyancy are preferentially retained near the surface of the culture 1 i 3 by mixing.

[000191] In some embodiments, the aqueous culture 113 contained in the photobioreactor 112 is mixed along a portion of the length of the photobioreactor 112. In accordance with the present invention, the unmixed portion of the aqueous culture 113 acts as a quiescent zone. Non-productive cells preferentially migrate to the quiescent zone and settle to the bottom of the photobioreac tor 1 2, where they may be removed.

[000192] In some embodiments, the spatial or physical separation conferred to the metabolic-ally enhanced cells is enhanced phoiotaxis. hi accordance with the present invention, metabolicaliy enhanced cells expressing phototaxis migrate toward the surface of the aqueous culture 113.

[000193] The present invention is fiirfher described by the folio whig non- limiting examples. However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

EXAMPLE 1

Rates of settling of w . ild type organisms

[000194] The fresh water algal culture medium BG-1 50X stock solution (Sigma; St. Louis, MO) was diluted with water to IX BG-11 culture medium. When marine culture medium was needed, 35g/L Instant Ocean® ( Spectrum Brands, Madison, WT) was added to the BG-1 1 medium to make "MBG-11." The BG-11 and MBG-11 media preparations were supplemented with 10 niM HEPES ^'buffer (Fisher Scieiitiiic; Pittsburgh. PA).

[000195] 35 ml cultures of individual strains in liquid BG-11 or MBG-1 1 medium were dispensed in 50 nil vented tubes. The cultures were mixed by timiing the tubes upside down five times. The homogeneously suspended cultures were left undisturbed in order for the cyanobacterial cultures to settle. The depth of medium that had cleai ed of green color of cyanobacteria by settling was measured for individual at various time points (t) after mixing. The rate of settling or settling rate (Vs) was calculated as

centimeters per hour. Time taken for settling by 6 cm depth was used to calculate the time needed for the culture to settle per cm (T/cm) or to the bottom in a column of 20 cm depth (Tpbr). The results are shown below in Table 1 .

[0001 6] Table 1 : Settling rates of wild type cultures

[0001 7] It should be noted thai there are strain- to- strain variations in terms of settling rates. Therefore the settling rate of one cyanobacterial strain comprising gas vesicles may be different than another cyanobacterial strain comprising the same gas vesicle genes.

[000198] The strain-specific differences hi settling rates may be used for differentiating and separating cells in a photobioreactor in mixed cultures or co-cultures wherein wild type cells are used for biomass production or production of other products such as chlorophyll, earotenoids and other cyanobacterial derived products.

[0001 9] hi some embodiments, any cyanobacterial mixtures may be chosen for separation on the basis of strain-specific settling rates or ability to stratify into layers or bands.

[000200] hi some embodiments, the differences in settling rates may be applied to any mixed cultures of photoautoh^'ophic, photoheterotrophic, chemoautoh^'ophic or hete otrophic organisms .

EXAMPLE 2

Construction of piasmids pSA479. i>S A480. pSA481. pSA483 and pSA499 harboring

gas vesicle genes

[000201] A fragment described hi SEQ ID NO: 1 was designed comprising: 1) sites for restriction enzymes Pmel and BsrGI, 2) a Plac promoter (bases 33 to 154), 3) sites for restriction enzymes Sail, XhoL and PspOML 4) gvp genes: the last 1 6 bases of gvpQ ORT complete gvpB, gvpR, gvpN, gvpF, gvpG, and the first 65 bases of gvpL ORT 5) Xnial site. In the present example, the source of the gvp genes is Bacillus meg terium (GenBank: AF053765.1). The nucleotide sequence (SEQ ID NO: 1) was custom synthesized, digested with Xmal and .Sphl and cloned into pUC57 vector digested with Xmal and Sphl ^'restriction enzymes. Plasmid pUC57 is an E. coli cloning vector

(GenBank: YI4S37. i , SEQ ID NO: 6} based on pMB i . The resulting plasimd was named pSA479.

[000202] The fragment described i SEQ ID NO: 2 was designed comprising: 1) the last 765 bases of gvpL ORE, gvpS, gvpK, gvpl, gvpT, and gvpU ORFs. A Pmll site, a Spel site, an EcoRV site; and an Xmal site were added to the end for subeloning. The sequence was synthesized by Genscript (Piscataway, NJ) and cloned into SpM-Xmal pUC57 vector. The resulting plasmid was named pSA480.

[000203] Plasmids pSA479 and pSA480 were digested with restriction enzyme Notl and Xmal. The 3050-bp fragment from pSA480 comprising 765 bases of gvpL ORF, gvpS, gvpK, gvpJ, gvpT, and gvpU ORFs was ligated into pSA479 using Quick Ligation Kit from New England Biolabs (Ipswich, MA). The resulting plasmid was transformed into E. coli XLIO-Gold Uitracompeteni Cells from Agilent Technologies (Santa Clara, CA). Other well-known E. coli strains that may be used include, but are not limited to, XL-1 Gold, Top 10, DH5ct, DH10B and HB 101.

[000204] Transformants were selected on LB-agar plates containing 100 ^ig/ml eaibenicillm from Teknova (Hollister, CA). The resulting plasmid was named pSA481.

[000205] Plasmid pSA481 was linearized with Pmll. The linearized plasmid was ligated with a blunt-ended fragment comprising a kanamycin resistance gene (bases 21 S 1-2993) from Drive, (Qiagen, Valencia, CA) according to standard protocols and procedures (Samhrook, J. et al, 2000 "Molecular Cloning: A Laboratory Manual"). The resulting plasmid was iraiisionned into XLIO-Gold Uftracompetent Cells and selected on an LB-agar plate containing 50 g/ml kanamycin. The resulting plasmid was named pSA483.

[000206] The plasmid RSFIOIO (GenBank: M28829.1) replicon may be used tor expressing gas vesicle genes in cyanobacteria. RSFIOIO (FIG. 1) is an IncQ/P4 broad- hosr-range conjagative plasmid. It contains the origin of vegetative DNA replication (oriV) and the genes encoding three replication proieins, repA, repB and repC {Baring and Seherzinger, 1989). These elements allow RSFIOIO to replicate in over 30 species of gram-negative bacteria (Frey and Bagdasarian, 1989). Furthermore, RSFIOIO replicon based shuttle vectors can replicate in cyanobacteria, particularly in the members of genera Syneehoeoccus. S neckocystis and Prochlorococcus. Many RSFIOIO derived plasmids are available as broad host range vectors. For example, the plasmid pSL1211 is described in Arch. Microbiol., 173: 412-417. The plasmid pSAl 211 comprises RSFIOIO replicon. a gentamycin marker and Pfrc promoter for expression of genes. Additionally, broad -host range plasmids other tha RSFIOIO may also be used for replication in cyanobacteria, such as pDUl or RP-4 based plasmids for filamentous cyanobacteria.

[000207] Primers were designed to amplify the gvp genes arid the kaiiaiirycin resistance gene from pSA4S3. The 5' end of primer 483 Plac RSFOL (SEQ ID NO; 3) was designed containing 30-bp homology to the RSFIOI sequence in the region at the restriction site for EcoRL The 5' end of primer 483 KanR RSFOL (SEQ ID NO; 4) contained a 30-bp homology to the RSFIOIO sequence in the region at the restriction site for Sapl. A fragment comprising gas vesicles operon and kanamycin resistance gene was amplified from pSA483 as template, the primer pair SEQ ID NO: 3 and SEQ ID NO: 4 respectively and Phusion High-Fidelity DNA Polymerase. RSFIOIO was digested with restriction enzymes EcoBl and Sap The PCR product (7244 bp) and the digested piasniid (7771 bp) were gel-purified.

[000208] The PCR product and the digested plasmid fragment were treated with T4 DNA polymerase for 45 -minutes to generate complementary 3' overhangs- about 30 bp long. The exomiclease activity was halted by the addition of dCTP. The reactions were mixed together in ligation buffer along with 20 ng RecA protein and incubated at 37°C for 30 minutes. This annealing reaction was used to transform XL- 10 Gold cells.

Transformants were selected on LB-agar plates containing 40 pg/ml kaiianiycin and 40 pg oil streptomycin. Other commonly used antibiotics are tetracycline, gentamycin, spectioomycm, ampicillin. neomycin and erythromycin. The resulting piasniid was named pSA499 (SEQ ID NO: 5, as shown m FIG. 2).

[000209] One of ordinary skill in the art will appreciate that plasmids native to the bacterial strain of interest may be used for gene expression. For example, shuttle or integrative vectors for Synechococciis sp. strain PCC70O2 may be based on replicons such as pAQl, pAQ3, pAQ4, pAQ5, pAQ6 and pAQ7.

[000210] In some embodiments, sequence and ligation independent cloning method was used (Li M. Z. and Elledge, S.J., 2007 "Nature Methods," vol. 4, pp. 251-256).

[000211] Vectors, markers and reagents useful for transforming E. coli are common and commercially available from a variety of sources, such as New England Bioiabs, Inc. (Ipswich, MA, USA) and Life Technologies, Inc. (Carlsbad, CA, LISA).

[000212] Custom synthesis of nucleotide sequences is standard and may be

contracted out to, for example, GenScript USA, Inc. (Piseataway, NJ, USA). [000213] In some embodiments, the nucleotide sequence of the ORF is codon optimized for the specific^■strain which will be metabolic-ally enhanced.

EXAMPLE 3

Transfer of gas vesicle genes to cyanobacteria

[000214] The plasmid pSA4 9 was introduced into Syneckocysiis sp. PCC 6803 and Syneehoeocc s elongates strain PCC 7942 by tri-parental conjugation. XLIO-Gold E. colt containing plasmid pSA499 (XLIO-Gold: pSA499) and an E. coli strain TOP10 containing a helper plasmid (pRL443) were inoculated in 3 ml LB media containing 50 pg oil fcanamycin o 100 μ§ ηι! carbenicillm, respectively, and grown overnight. The next morning, each culture was diluted into 10 ml of fresh LB plus antibiotic and grown to an ODeoo of about 0.6. Cyanobacterial culture was grown to mid- to late-exponential phase, to an OD₇₃₀ of about 0.7. E. coli cultures and 13 ml of cyanobacterial culture were cenfiifuged and re- suspended in 300 μΐ LB or BG-11 three times. The cell numbers were estimated, and equal numbers of cells (-10*) from the three cultures were mixed in less than 900 μΐ.

[000215] The mixture was spun down and re-suspended in BG-1 Ϊ containing 5% LB. About 100 μΐ was pipetted onto a sterile filter on a recovery plate (BG-11 agar plate containing 5% LB). The mixture appeared a very pale green on the filter. The plate was incubated for 2 days at 28°C, after which the filter was moved to a BG-! 1 plate

containing 10 μ^ηιΐ kanamycin. The cyanobacteria typically cleared after 2 to 4 days; colonies typically formed after 5 to 7 days. Colonies were re-streaked on BG-11 plates containing 10 ^^'ηιΐ kanamycin until they were clear of E. coli. [000216] The cyanobacterial strains Symchocysfts PCC 6803 and Synechacoccus PCC 7942 transformed with pSA499 were named PCC 6803: pSA499 and PCC 7942: pSA499 respectively.

[000217] The presence of the gas vesicle ca ssette in the transformed Synechocystis sp. PCC 6803 cells was confirmed by PGR. Samples of KNA were purified, from cultures of wild type Synechocysris sp. PCC 6803 and PCC 6803 harboring the plasmid pSA499 using a phenolxhlorofomi extraction. In order to prepare cDNA, reverse transcriptase PGR was performed on the RNA samples using Superscript VILQ cDNA Synthesis kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. Primers for amplifying gvpB (SEQ ID NO: 73 and SEQ ID NO: 74) or gvpT (SEQ ID NO: 75 and SEQ ID NO: 76) were able to amplify products of the appropriate sizes from cDNA from PCC 6803-pSA499 but not from cDNA from wild type Synechocystis sp. PCC 6803 cells.

EXAMPLE 4

Effect of gas vesicle genes on settling rate of Synechoeoccus

[000218] The strains PCC7942 and PCC7942; pSA499 were grown in BG-11 medium according to standard methods described earlier. The density of BG-11 medium at room temperature of approximately 22° C was measured and calculated a 0.9.969 g/cnr +/- 0.0016 g/cm^* using a 25 mi volumetric flask and an analytical balance.

[000219] The settling rates of cyanobacteria with and without gvp genes were compared (FIG. 7). 5 ml of each culture was pipetted into a 14-ml Falcon culture tube and left on the benehtop (dim light, room temperature) until cells began to settle. To get an idea of the lower bound for the settling rate, the time required for a volume to be cleared of species was determined. After 3 days, a difference in buoyancy between the strains PCC 7942 and PCC 7942: p5A499 became isible. Wild type PCC 7942 cells settled into the lowest 2 oil of the 5 ml culture volume, while transformed PCC 7942: pSA499 cells occupied all bu the top 1 ml of the 5 ml volume.

[000220] The elapsed time was measured for the slowest-settling cells in each culture to settle to the bottom and for the solutions to become clear, such that the settling rates were determined only for the slowest-settling cells. A settling rate of approximately 3 cm ÷ 3 days, or approximately 1 cm day, for the slowest-settling cells in a culture of wild type strain PCC 7942, in the absence of mixing, was inferred based on the tube dimensions. As opposed to wild type PCC 7942, under the same conditions a settling rate for the slowest settling cells in a culture of PCC 7942: pSA499 was approximately 1 cm ÷ 3 days, or approximately 1/3 cm/day in a Falcon tube.

[000221] Methods to obtain an average settling rate and a distribution of settling rates are described, for example, in the paper by P. Bienfang, E. Laws, and W. Johnson, J. Exp. Mar. Biol. Ecol., (1977), 36:283-300. Although the above-noted rates of 1 cm/day and 1/3 cm day will be used in examples below for illustrative purposes, it is anticipated that repeated testing of additional culture samples would show that average settling rates for all cells of one strain in a sample will be higher than these lower bound values of settling rates of the slowest-settling cells in the culture that are interred from clearing times. It is further anticipated that the settling rate of the slowest-settling cells in the culture would not be equal to the settling rate of the fastest-settling cells in the culture. Furthermore, once distributions are taken into account, it is possible that there may be overlap in settling rate ranges between wild type and modified species, such thai, for example, the range of settling rates hi a culture of PCC 7942 ma at least partially overlap the range of settling rates in a culture of PCC 7942: pSA499, with die settling rate for the fastest-settling cells of PCC 7942: pSA499 greater than the settling rate for the slowest-settling cells of PCC 7942. The separa tion approaches outlined below may be enhanced by recycling or staged separations.

[000222] The settling rates determined hi the present example are based on a single observation at a single timepoint for each culture. Settling observations were not made at multiple timepoints. Additionally, the experiment was not repeated for multiple culture samples under the same conditions. The elapsed time was not measured for any cells other than the slowest-settling cells in eac culture to settle to the bottom, and the settling rates were not determined for any cells other than the slowest-settling cells.

EXAMPLE 5

Construction of plasmid pAB1213: ziaR-PziaA-Bac-gvp

[000223] A plasmid similar to pSA499 but with a ziaR-PziaA6803 promoter driving the gas vesicle cassette was cloned and named pAB 1213. To prepare pAB 1213, plasmid pSA499 was digested with Prnel and Xhol and used as the vector. The spectinomycin resistance cassette SpR and the ziaR-PziaA promoter were PCR-amplified from pAB420 using primers SpR309F 499R/ADHr agR 499F and recoinbined into the vector with GENE ART® Seamless Cloning and Assembly Kit, thus resulting in plasmid pAB1213. The primer sequences used are: SpR309F 499R;

cttccagatgtatgctcttctctagggtttC TCTAGAAGAACAGCAAGGC (SEQ ID NO: 55); and ADHfragR 499F: cacatcgctaggtaccgggccccccctcgaCACCGACGCTGTAGGTAACG (SEQ ID NO: 56). This plasmid (FIG. 3, SEQ ID NO: 57) was successfully transformed into strains PCC 6803, PCC: 7942, and PCC 7002.

EXAMPLE 6

Construction of plasmid PAB1214

[000224] The gas vesicle cassette from Microcystis aeruginosa strain PCC 7806 was cloned into RSFlOlO-based plasmid pAB4I5 such that it was driven by a PrbcL-6803 promoter (pAB1214). Plasmid pAB415, having a spectinomycin resistance gene and a PrbcL promoter from Synechocystis sp. PCC 6803, was digested with EcoRI and Xliol and used as the vector. The Microcystis gas vesicle cassette, consisting of OR 's gvpAlA2A3CNJXKFGVW, was PCR-amplified from Microcystis aeruginosa strain PCC 7806 cells using primers Mgvp pre F rbcL6803R MgvpR 423F. The PCR product was recombined into the vector with GENEART® Seamless Cloning and Assembly Kit, thus resulting in plasmid pAB1214. The primer sequences used are: Mgvp pre F rbcL6803R: tttatggaggactgacctagatgatgAATTcctccatgacttcagcaccg (SEQ ID NO: 58); and MgvpR 423F:

CTAGAGCATGCAGATCTAGCGGCCGCTCGAC.'CTGCAGGttaagtaaagtgatagggggga g (SEQ ID NO: 59). This plasmid (FIG 4, SEQ ID NO: 60) was successfully

transformed into strains PCC 6803, PCC 7942, and PCC 7002.

EXAMPLE 7

Construction of plasmid pAB1215

[000225] The gas vesicle cassette from Microcystis aeruginosa strain PCC 7806 was cloned into an RSFlOlO-based plasmid, pAB420, such that it was driven by a ziaR- PziaA6803 promoter (pAB1215). Plasmid pAB420, having a gentamicin resistance gene. a spectinomycin resistance gene, and a ziaR-PziaA promoter, was digested with EcoRI and Psti and used as the vector. The Microcystis gas vesicle cassette, consisting of ORF's gvpA 1 A2 A3C JXKFGVW, was PCR-amplified from Microcystis aeruginosa strain PCC 7806 cells using primers Mgvp pre F ziaA6S03R^'MgvpR 309F. The PCR product was recombined into the vector with GENEART® Seamless Cloning and Assembly Kit, thus resulting in plasmid pABl 215. The primer sequences used are: Mgvp pre F ziaA6803R: ttctttaaatcacgttggccgccatgAATTcctccatgacttcagcaccg (SEQ ID NO: (VI): and MgvpR 309F:

TTTGCTTCCAGATGTATGCTCTTCTGCTCCCCTGCAGGttaagtaaagtgataggggggag (SEQ ID NO: 62). This plasmid (FIG. 5, SEQ ID NO: 63) was successfully transformed into strains PCC 6803, PCC 7942, and PCC 7002.

EXAMPLE 8

Effect of various gas vesicle gene cassettes (nlasmid t>SA499, pAB12i3, pAB1214. pAB1215) on settling rate of Synechococcus PCC 7942 - comparison of 7-8 day old caitures

[000226] Experiments were performed with Synechococcus PCC 7942 cells comprising pSA499, which comprised a gas vesicle cassette from Bacillus megoterium driven by a P ac promoter; pAB1213, which comprised a gas vesicle cassette from Bacillus megatermm driven by a ziaR-PziaAs_S03 promoter; pABI214, which comprised a gas vesicle cassette from Microcystis aeruginosa strain PCC 7806 driven by a PrbcLeso3 promoter; or AB1215₅ which comprised a gas vesicle cassette from Microcystis aeruginosa stem PCC 7806 driven by a ziaR-PziaAesos promoter. The transformed Synechococcus PCC 7942 cells were allowed to settle on the laboratory benchtop at room temperature, with a light/dark cycle corresponding to ambient light in the laboratory, approximately 12 hours light 12 hours dark. The cell separation differences (settling differences) were then determined by visual inspection (see Table 2. below).

[000227] hi one experiment, cultures of PCC 7942 and PCC 7942-pSA499 were spun down and resuspended in fresh BG-11 medium to an O.D.750—1.0 and volume of 10 ml using 15 ml polypropylene conical tubes. FIG. 8 shows settling at days 1, 2, 4 and 7.

[000228] In another experiment, cultures of PCC 7942, PCC 7942-pSA499, PCC 7942-pABI 213, and PCC 7942-pAB1215 were diluted to an O.D.₇₅₀ -1.0 and volume of 10 ml. FIG. 24 shows settling at days 2, 4 and 7.

[000229] In another experiment, cultures of PCC 7942, PCC 7942-pSA499, and PCC 7942-pAB1214 were either diluted to an O.D.750 -1.0 and volume of 10 nil (dil) or centrifuged and resuspended to an O.D.₇₅₀ -1.0 and volume of 10 ml (wash). FIG. 25 shows settling at days 2, 3, 6 and 8.

[000230] Cultures of PCC 7942, PCC 7942-pSA499, PCC; 7942-pAB 1213, PCC 7942-pAB1214, and PCC 7942-pAB1215 were centrifnged and resuspended to an O.D, 750 -1.0 and volume of 10 ml. FIG. 26 shows settling at days 1, 2, 6 and 8.

[000231] Table 2. Synechococcus sp. PCC7942 transformed with various gas vesicle gene-containing plasniids

PCC 7942 pAB1214 4, 10 PrbeL6803 M. Similar Dilution aeruginos

PCC 7942 pAB1214 4, 10 PrbcL6803 M. Faster Wash aeruginosa

PCC 7942 PAB1214 4, 10 Pr cL6803 M Similar Wash aeruginosa

PCC 7942 pAB1215 . , <>. / ziaR- M. Faster Dilution

PziaA6S03 aeruginosa

PCC 7942 pAB1215 6, 7 ziaR- M. Similar Wash

PziaA6803 aeruginosa

PCC 7942 pSA499 Plac B. Faster Dilution mevaierinm

PCC 7942 pSA499 Plac B. Faster Dilution megaterium

PCC 7942 pSA499 Plac B. Slower Wash megaterium

PCC 7942 pSA499 Plac B. Similar Wash megaterium

EXAMPLE 9

Effect of gas vesicle genes on settling rate of Synechococeus PCC 7942, as measured by eentrifugation through a Percoli gradient

[000232] A Percoli gradient was used to examine differences in cell density and cell separation. Percoli is a silica colloid which forms a continuous density gradient when centrifuged at 10,000 x rcf for 30 minutes. To generate a Percoli gradient for freshwater cyanobacterial strains, 7 ml Percoli 1 ml 10X BG-11, and 2 ml water were mixed in a 15 -ml Falcon centrifuge tube, which was then centrifuged for 30 minutes at 10,000 x rcf. [000233] Cultures of PCC 7942 and PCC 7942-pSA499 were diluted to O.D.750 of 1.0 and allowed to grow for 1-2 days. The cultures were again diluted to an O.D.750 of 1.0 in 10 ml in a 15-ml Falcon centrifuge tube. The cultures were centrifuged at 2500 x rcf for 10 minutes, the supernatant was discarded, and the cells were resuspended in 2 ml of fresh BG-11. 1 ml of the resuspension wa s care&lly applied to the top of the Perco!l gradient and the tubes were centrifuged at 400 x rcf for 10 minutes.

[000234] FIG. 26 shows settling of the Percolf gradient ^'with Syneckococcus PCC 7942 and PCC7942-pSA499 cells.

EXAMPLE 10

Effect of gas vesicle genes on settling rate of Synechocvstis

[000235] Experiments were performed with Sym chocystis sp. PCC 6803 cells comprising pSA499_? which comprised a gas vesicle cassette from Bacillus megatertum driven by a Plae promoter; pAB1213, which comprised a gas vesicle cassette from

Bacill meg teriimi driven by a ziaR-PziaAegos promoter; pAB1214, .which comprised a gas vesicle cassette from Microcystis, aeruginosa strain PCC 7806 driven by a PrbcLgsce promoter; or pAB1215, which comprised a gas vesicle cassette from Microcystis

aeruginosa strain PCC 7806 driven by a ziaR-PziaA promoter. The transformed Synechocvstis sp. PCC 6803 cells were allowed to settle on the laboratory benchtop at room temperature, with a light/dark cycle corresponding to ambient light in the

laboratoiy, approximately 12 hours light/12 hours dark. The cell separation differences (settling differences) were then determined by visual inspection (see Table 3, below).

[000236] In one experiment, a recordable difference of settling on the bench between PCC 6803 and PCC 6803: pSA499 after 3-7 days was not initially observed. After 3 days, neither culture exhibited settling or clumping of cells. The medium was not clear at the top of either culture. After 7 days, clumping was observed in bot cultures. [000237] In another experiment, cultures of PCC 6803 and PCC 6803-pSA499 were spun down and resuspended i fresh BG-11 medium to an O.D._?50 -1.0 and volume of 10 ml. FIG. shows settling at days 1, 2, 4 and 7.

[000238] in another experiment, cultures of PCC 6803 , PCC 6803 -pS A499, PCC 6803-pAB12B_s and PCC 6803-pAB 1214 were diluted to an O.D.₇₅₀ -1.5 and volume of 10 ml. FIG. 28 shows settling at days 1, 2, 4 and 7.

[000239] In another experiment, cultures of PCC 6803, PCC 6803-pSA499 PCC 6803-pAB1213, PCC 6S03-pAB12I4 and PCC 6803-pAB12I 5 were centrifuged and resuspended to an O.D.750 - 1.0 and volume of 10 ml. FIG. 29 shows settling at days 1, 2, 6 and 8.

[000240] In another experiment, cultures of PCC 6803, PCC 6803-pSA499, PCC 6S03-pAB1214, and PCC 6803-pAB1215 were diluted to an O.D.₇₅₀ - 1.0 and volume of 10 ml. FIG. 30 shows settling at days 2, 4 and 7.

[000241 ] In another experiment, cultures of PCC 6803, PCC 6803-pSA499, PCC 6803-pAB1213, and PCC 6803-pAB1214 were diluted to an O.D.750 -2.0 and volume of 10 ml. Z11SO₄ was added to select cultures to a final concentration of 10 μΜ. FIG. 31 shows settling at days 1, 2, 5 and 12.

[000242] In another experiment, cultures of PCC 6803, PCC 6803-pSA499, and PCC 6803-pABl 215 were diluted to an .D.750 ~1 -0 and volume of 10 nil. Z11SO₄ was added to select cultures to a final concentration of 10 uM. FIG. 32 shows settling at days 2, 3, 6 and 8.

[000243] Table 3. Synechocystis sp. PCC 6803 transformed with various gas vesicle gene-containing plasmids Settling

rate

relative

to wild Wash or

Strain Piasmid Cl nefs) Promoter HoBiolog type Dilution

Synechocystis pAB1213 6 ziaR- B. Slower Dilution PCC 6803 PziaA6803 megaterium

Synechocystis pAB1213 6 ziaR- B. Slower Dilution

PCC 6803 PziaA6803 megaterium

Synec-hocystis pAB1213 6 ziaR- B. Similar Wash

PCC 6803 PziaA6S03 megaterium

Synechocystis pAB1213 20 ziaR- 3. Faster Dilution

PCC 6803 PziaA6803 megateriwn

Synechocystis pAB1213 20 ziaR- B. Faster Wash

PCC 6803 PziaA6803 megaterium

Synechocystis pAB1213 23 ziaR- B. Faster Dilution

PCC 6803 PziaA6803 megateriwn

Synechocystis pAB1213 3, 20 ziaR- 3. Similar Dilution

PCC 6803 PziaA6803 megateriwn

Synechocystis pAB1214 9 PrbcL6803 M, Similar Dilution

PCC 6803 aeruginosa

Synechocystis pAB1214 g PrbcL6803 M. Similar Wash

PCC 6803 aeruginosa

Synechocystis pAB1214 10 PtbcL6803 M. Slower Dilution

PCC 6803 aeruginosa

Synec-hocystis pAB1214 10 PrbcL6803 M. Similar Dilution

PCC 6803 aeruginosa

Synechocystis pAB1214 10 PrbcL6803 M. Similar Dilution

PCC 6803 aeruginosa

Synechocystis pAB1214 10 PrbcL6803 M. Faster Wash

PCC 6803 aeruginosa

Synec-hocystis pAB1215 7 ziaR- M. Similar Dilution

PCC 6803 PziaA6803 aeruginosa

Synechocystis pAB1215 2,10 ziaR- M. Similar Dilution

PCC 6803 PziaA6803 aeruginosa

Synechocystis pAB1215 10 ziaR- M, Faster Wash

PCC 6803 PziaA6803 aeruginosa

Synechocystis pAB1215 77 ziaR- M. Faster Dilution

PCC 6803 PziaA6803 aeruginosa

Synechocystis pAB1215 22 ziaR- M. Faster Wash

PCC 6803 PziaA6803 aeruginosa

Synec-hocystis pAB1215 13, 22 ziaR- M, Similar Dilution

PCC 6803 PziaA6S03 aeruginosa

Synechocystis pSA499 Plac B. Slower Dilution

PCC 6803 megaterium Synechocystis pSA499 Plac 3. Slower Dilution

PCC 6803 megaterium

Synechocystis pSA499 Plac B. Slower Dilution

PCC 6803 megaterium

Syneehocystis pSA499 Plac B. Similar Dilution

PCC 6803 megaterium

Synecliocysiis pSA499 Plac 3. Slower Wash PCC 6803 megaterium

Synechocystis pSA499 Plac B. Slower Wash PCC 6803 megaterium

EXAMPLE 11

Effect of gas vesicte genes on settling rate of Synechocystis FCC 6803. as measured by centrifugation through a Percoli gradient and m a sucrose gradient

[000244] A Percoli gradient was used to examine differences in cell density and cell separation. Percoli is a silica colloid which forms a continuous density gradient when centrifuged at 10,000 x rcf for 30 minutes. To generate a Percoli gradient for freshwater cyanobacterial strains, 7 ml Percoli 1 ml 10X BG-11, and 2 ml water were mixed in a 15 -ml Falcon centrifuge tube, which was then centrifuged for 30 minutes at 10,000 x rcf. [000245] Cultures of PCC 6803 and PCC 6803-pSA499 were diluted to O.D.750 of 1.0 and allowed to grow for 1-2 days. The cultures were again diluted to an O.D.750 of 1.0 in 10 ml in a 15-ml Falcon centrifuge tube. The cultures were centrifuged at 2500 x rcf for 10 minutes, the supernatant was discarded, and the cells were resuspended in 2 ml of fresh BG-11. 1 ml of the resuspension was carefully applied to the top of the Percoli gradient and the tubes were centrifuged at 400 x rcf for 10 minutes. [000246] FIG. 33 shows settling of the Percoli gradient with Synechocystis sp. PCC 6803 and PCC6803-pSA499 cells. [000247] In another experiment a sucrose density gradient was prepared consisting of 3 layers: 3 ml of 10% sucrose on top of 3 ml of 20% sucrose on top of 3 nil of 30% sucrose. Salt was not present in the sucrose gradient, and the PCC 6803 and PCC 6803: pSA499 cells were grown in BG-11 medium, which does not contain salt. This

experiment, was conducted at room temperature of approximately 22° C. The PCC 6803 and PCC 6803: pSA499 cells were grown at 28° C prior to being added to the sucrose gradient.

[000248] The sucrose gradient was in a 14-ml culture tube. 1 ml of dense

cyanobacteria culture was layered on top of the gradient, and the tabes were centrimged at 1200 rcf for 10 mm. The wild type PCC 6803 cells settled into the 30% (1.127 g/cnr) sucrose traction after centiifugation, but PCC 6803; pSA499 settled into the 20% (1.081 g/cnr^*) sucrose traction, as shown in FIG. 10. The cultare comprising pSA499 had approximately 4% lower specific density than the wild type strain.

EXAMPLE 12

Predicted settling rates of Synechocystis without and with gas vesicles

[000249] In a prophetic example, predicted settling rates are calculated for PCC 6S03 and PCC 6803: pSA499, which are generally spherical in shape, using the following equation for Stokes flow:

[000251] where v_s is the settling velocity, p_p is cell density, p_j s fluid density, g is gravitational acceleration, R is the radius of the cell and u is the dynamic viscosity of the fluid. This equation for Stokes flow predicts She settling velocity of small spheres in dilute suspensions in a fluid, either air or water. [000252] In the present example, it is assumed that the cells of PCC 6803 and PCC 6803: pSA499 are falling in the viscous fluid by their own weight due to gravity, such that, a terminal velocity, or- settling velocity, is reached when the Motional force exerted on the cells by the viscous fluid combined with the buoyant force exactly balance the gravitational force. It is noted that cells of PCC 6803 and PCC 6803: pSA499 bear negative charges on their surfaces, such that electrostatic interactions would influence movement of the cells. However, such interactions are ignored in the present example.

[000253] In Example 11 , PCC 6803 : pSA499 cells settled into a 20% sucrose fraction. The density of the PCC 6803: pSA499 cells would be 1.081 g/enr\ According to UNESCO, 1987 International Oceanographic tables, UNESCO Technical Papers in Marine Science, no. 40, UNESCO, Paris, the density of the fluid, seawater at 20° C and 35 practical salinity units, is 1.02475 g cm*. It is assumed in the present example that the density of a culture of PCC 6803: pSA499 cells is the same in fresh water and salt water. The difference between cell density p_p of the PCC 6803: pSA499 cells and fluid density pfis 1.081 g/cm* - 1.02475 g/cm³ = 0.05625 g/cnr. Assuming cell radius R is 2.5 pm and fluid dynamic viscosity// is 1.08* 10^"3 N s/nr, the predicted settling rate of the PCC 6803: pSA499 cells would be 7.1 x 10" m s, or approximately 6 cm day.

[000254] In Example 5, PCC 6803 cells settled into a 30% sucrose fraction. The density of the PCC 6803 cells would be 1.127 g/cm³. According to UNESCO, 1987 International Oceanographic tables, UNESCO Technical Papers in Marine Science, no. 40, UNESCO, Paris, the density of the fluid, seawater at 20° C and 35 practical salinity units, is 1.02475 g/cm³. It is assumed in the present example that the density of a culture of PCC 6803 cells is the same in fresh water and salt water. The difference between cell density p of the PCC 6803 cells and fluid density p/ is 1.127 g/cni³ - 1.02475 g e * =

0.10225 g cai³. Assuming cell radius R is 2,5 μπι and fluid dynamic viscosity ./ is

1.08x10^""* N-s/iif, the predicted settling rate -of the PCC 6803 cells would be L x lO^"6 in/s, or approxiiiiately 1 1 em/ da .

EXAMPLE 13.

Effect of gas vesicle genes on settling rate of Svaechococcas PCC 7002

[000255] I s one experiment, cultures of PCC 7002 and PCC 7002-pSA499 were spun down and resuspended in fresh MBG-i 1 medium to an O.D.₇₅₀ ~-l.G and volume of 10 ml. The results are shown below in Table 4. FIG. 34 shows settling at days l_f 2, 4 and 7.

[000256] In another experiment, cultures of PCC 7002, PCC 7002-pSA49 , and

PCC 7002-pAB1213 were diluted to an Q.D.₇₅₀ -1.0 and volume of 10 ml, ZnS0₄ was added to select cultures to a final concentration of 10 μΜ. FIG. 35 shows settling at days 2, 4 and 7.

[000257] In another experiment, cultures of PCC 7002, PCC 7002-pSA499, PCC 7002-pAB1213, PCC 7002-pABI2I4 and PCC 7002-pAB1215-T 96 were centrifuged and resuspended to an O.D. ₇₅₀ ~^'l .0 and volume of 10 ml. FIG. 36 shows settling at days

1 , 2, 6 and 8.

[000258] hi another experiment, cultures of PCC 7002, PCC 7002-pSA499, PCC 7002-pAB1213, PCC 7002-pAB1214 and PCC 7002-pAB1215 were centrifuged and resuspended to an O.D. 750 -1.0 and volume of 10 ml. FIG. 37 shows settling at days 1, 2, 5 and 8. [000259] Table 4. Synechococcus sp. PCC 7002 transformed with various gas vesicle gene-containing plasmids

[000260] A Percoll gradient wa used to examine differences in cell density and cell separation. Percoll is a silica colloid which ionns a continuous density gradient when eentrifuged at 10,000 x rcf for 30 minutes. To generate a Percoll gradient for freshwater cyanobacterial strains, 7 ml Percoll, 1 ml 10X BG-11, and 2 ml water were mixed in a 1 -ml Falcon centrifuge tube, which was then eentrifuged for 30 minutes at 10,000 x rcf. [000261] Cultures of PCC 7002 and PCC 7002-pS A499 were diluted to O.D.750 of 1.0 and allowed to grow for 1-2 days. The cultures were again diluted to an O.D.750 of 1.0 i 10 nil in a 15-ml Falcon centrifuge tube. The cultures were centrifiiged at 2500 x ref for ^"10 minutes, the supernatant ^'was discarded, and the cells were resuspended in 2 nil of fresh BG- 11. I nil of the resuspension was carefully applied to the top of the Pereoll gradient and the tubes were cenirifuged at 400 x rcf for 10 minutes.

[000262] FIG. 38 shows settling of the Pereoll gradient with Synechococc s sp. PCC 7002 and PCC6803-pSA499 cells.

EXAMPLE 14

Construction of Plasmid pAB1252

[000263] The gas vesicle cassette from Microcystis aeruginosa contains intergenic regions that could adversely affect gene expression, such as interna! promoters and internal terminators. In an attempt to determine whether the removal of these intergenic regions would increase the effectiveness of the transformed constructs, a synthesized version of the Microcystis aeruginosa gas vesicle cassette was obtained in two fragments of approximately 3 kfo each ( Genscript USA Inc., Piscataway, NJ, USA), in which much of the intergenic regions were removed. The modified cassette was subcloned into an RSFlOlO-hased plasmid such thai the cassette was driven by a Pr/j>cL7002 promoter, yielding plasmid pAB1252. A physical map of plasmid pAB1252 is shown in FIG. 6.

[000264] The two synthesized pieces of the Microcystis aeruginosa strain PCC 7806 gas vesicle cassette were PCR-amphfied from the constructs from Genscript using primers 1201F/1201 R and 1202F 1202R, respectively. The two pieces were used to amplify each other in an overlapping PCR reaction, yielding a PCR product containing both pieces assembled together. The large PGR product was then inserted into a TOPO blunt, cloning vector from Iiwitrogeii (Carlsbad, CA, USA) according to the

manufacturer's iiisfraetions,

[000265] The Microcystis aeruginosa strain PCC 7S06 synthetic gas vesicle cassette was PCR-amplified from fee TOPO construct using primers PrbcL70G2F SpRR gvpWR RSF3F. The RSFIOIO backbone and spectinomycin resistance cassette SpR were PCR- amplified from pAB 1213 using primers pS A62 R3F/SpRR PrbcL7002F. The two PGR products were reeombined together with GENEART® Seamless Cloning and Assembly Kit.

[000266] The primer sequences that were used to prepare this construct were;

1201F; giaGACATTCGATCTGCAGGTAC (SEQ ID NO: 64); 1201R:

ataaagcttggcattggctagggaggtagg (SEQ ID NO: 65); 1202F:

cagggttatccctacctccctagccaatgc (SEQ ID NO: 66); 1202R:

aaacCTAGCGGCCGCTCGAttaag (SEQ ID NO: 67); PrbcL7002F SpRR:

TCGCGGCGCGGCTTAACTCAAGCTCTAGAGgacCGAGCGGGATTTTATGGC (SEQ ID NO; 68); gvpWR RSF3F:

actgtatgtaaacacagtattgcaaggacgttaagtaaagtgataggggggag (SEQ ID NO: 69): pSA62 R3F: cgtccttgcaatactgtg (SEQ ID NO: 70); and SpRR PrbcL70O2F:

CCTAAAAAAGCCATAAAATCCCGCTCGgtcCTCTAGAGCTTGAGTTAAGCCG (SEQ ID NO: 71). The resulting plasmid, pAB1252 (SEQ ID NO: 72) is shown in FIG. 6.

This plasmid was then transformed into PCC 6803 and PCC 7942 as discussed below. EXAMPLE 15

Settling mp risons with pAB1252

[000267] In one experiment, cultures ofPCC 6803, PCC 6803-pAB 1252, PCC 7942, and PCC 7942-pAB1252 were centrifuged and resiispended to an O.D. ₇₅₀ - 1-0 and volume of 10 ml. FIG. 39 shows settling at days 1, 2. 5 and 8.

[000268] hi another experiment, cultures of PCC 7942, PCC 7942-pSA49 , and PCC 7942-pAB1252 were centrifuged and resnspended to an O.D. ₇₅₀ -0.5 and volume of 10 ml. FIG. 40 shows settling at days 1, 2, 3 and 5.

EXAMPLE 16

Construction of Plasniids pAB1298 an rAB1299

[000269] In a prophetic example, one method of coupling the production of a product of interest to the spatial separation of the cells from non-producing cells in a culture is provided. In this example, the gas vesicle cassette is divided into two separate plasmids, and genes encoding a product of interest (such as ethanol producing genes

ADH and PDC) are added to one of the plasmids. When both plasmids are successfully transformed into a cyanobacteiial cell, the product of interest is produced and the gas vesicles genes are expressed. The resulting cell has a spatial separation from cells in the culture that do not contain the product genes, hi this way, the product-producing cells can be separated from cells that no longer contai the product-producing genes, such as revertants or cells that have lost the inserted plasmid containing the product-producing genes.

[000270] To construct tins plasmid system, the gas vesicle cassette from pSA499 is divided onto two plasniids: pAB1298, a plasmid based on a plasmid endogenous to the host cell, such as pUGl or pUG2 in Synechocystis sp. PCC 6803, and which contains the QRF's gvpFGLSKJTU driven by a cyanobacterial. promoter; and pABI299, a RSFIOIO- based plas nid with, a cyanobacterial promoter driving PDC-ADH audi gvpBR .

EXAMPLE 17

Transformation of Synechocystis with Piasmids pAB1298 and pAB1299

[000271] hi a prophetic example, Synechocystis PCC 6803 is transformed with the two piasmids pAB1298 and pABI299. These two piasmids together cany all of the genes of the gas vesicle cassette from Bacillus megateriuin. However, if AB1299 (and therefore the PDC-ADH cassette) is lost from a cell, gvpB, the main structural protein of the gas vesicle, will also be lost, which should lead to a change in buoyancy in that cell.

[000272] The transformation of pABl 299 can be performed by conjugation, essentially following the method described in Example 3.

[000273] pAB1298 can be transformed into PCC 6803 using electroporatioii, using the following protocol. The cyanobacteria are cultured to mid- to late-log phase. Cells are harvested and washed three times in 1 mM HEPES. The pellet is resuspended in 1 mM HEPES to a concentration of ~5xl 0^s cells/ml. 1 ml of cells is cennifoged at 5000 x rcf for 5 mill. 900 μΐ of supernatant is removed and the pellet is resuspended in the remaining 100 ul. 2mm electroporatioii cuvettes are chilled on ice. Approximately 100 ng of pAB129S DNA is mixed with cells and added to the cuvette. After a 1 minute incubation on ice, the cells are pulsed at resistance of 200 W and capacitance of 25 mF. Immediately, 1 ml of BG-11 (containing 10 mM HEPES) is added to the cells, which are then transferred to a 14-ml culture tube. The cells are incubated for 48 hours in dim light at 28° C. The cells are then centrifuged at 5000 x rcf for 5 minutes and the supernatant is discarded. The cells are resuspended in 100 μΐ ofBG-11 and plated onto selective media. Colonies form in 1.-2 weeks.

EXAMPLE 18

Use of homologous gas vesicle genes

[000274] In a prophetic example, based on the unanticipated success of the experiments described in the present application wherein gas vesicle genes from the non- planktonic heterotrophic soil bacterium Bacillus m gaterhim enable the functional expression of enhanced buoyancy in cyanobacteria, gas vesicle gene clusters from more closely related cyanobacteria are transferred to cyanobacteria! strains of interest and confer improved gas vesicle fimetionality.

[000275] Suitable homologous genes may be derived, for example, from

Microcystis sp. BC 8401 (Gyp gene cluster, sequence AY965344.1) (SEQ ID NO: 24). This gene cluster encodes the gas vesicle-related proteins GvpAI (SEQ ID NO: 31), GvpA2 (SEQ ID NO: 32), GvpC (SEQ ID NO: 33), GvpN (SEQ ID NO: 34), GvpJ (SEQ ID NO: 35), GvpX (SEQ ID NO: 36), GvpK (SEQ ID NO: 37), GvpF (SEQ ID NO: 38), GfpG (SEQ ID NO; 39), GvpV (SEQ ID NO; 40), and GvpW (SEQ ID NO: 4 ).

Additionally, exemplary homologous genes are present in Nostoc sp. PCC 7120 (Gvp genes, sequence BAQ000I9 REGION; 2701500..2707130) (SEQ ID NO: 25). This gene cluster encodes the gas vesicle-related proteins GvpA (SEQ ID NO: 42), GvpB ( SEQ ID NO: 43), GvpC (SEQ ID NO: 44), GvpN (SEQ ID NO; 45), GvpJ (SEQ ID NO: 46), GvpK (SEQ ID NO; 47), GvpF (SEQ ID NO; 48), AND GvpG (SEQ ID NO: 49).

77 EXAMPLE 1

Gas vesicle genes from other genera

[000276] In a prophetic example, gas vesicle genes, including but not limited to any of the SEQ ID NOs: 11-23, are derived from Arthronema strain ABCC1507 (Table 5) or L ngb a strain ABCC1499 (Table 6). FIG. 16 shows the buoyancy feature of

Arthron na strain ABCC1507 cells.

[000277] Several gas vesicle genes were identified in Arthronema africanism strain ABCC^' 1507 d Lynghya sps. strain ABCC1499 in a BlastP search of the proprietary genome sequences. The parameters used for a. BlasiP search are (Matrix: BLOSUM62; Wordsize: 3; Gap Penalties -Existence. i l , Extension:!; Filter: Off). Table 5 (SEQ ID NO: 16), and Table 6 (SEQ ID NO: 18 and SEQ ID NO: 20) show iionioSogs of

buoyancy genes, in particular GvpA (or GVPa), the main structural protein of gas vesicles.

[000278] SEQ ID NO: 20 has >90% identities with GvpA protein of Arthrospir platemis (NCBI Reference Sequence: ZP_03276570.1), Pianktothrix bescens (Swiss- Prof; P0A3GO.2); Pseudocmabaena (Swiss-Prof: P22453.2),. Oscfflatoria (NCBI

Reference Sequence: ZP_07113226.1), Synechococeus (Swiss-Prot: Q2JKK1.1), Nostoc pnnctifornie. (Swiss-Prot: B2J663.1) and Dolichosp rnm flos-aquae. (Swiss-Prot

P10397.3).

[000279] In some embodiments, the sequence described in SEQ ID NO; 20 provides one of the structural components of the physical feature for buoyancy, namely, gas vesicles. In some embodiments, the gene for gvpA (or gvpB, a paralog of gvpA in Bacillus) may be isolated from an organism selected from a group consisting of Arihrospira, Plcmktothrix. Pseudoanabaena, Oscillators, Nosioc, Octadecab cter, Halohacteri m, Haloferax, Spi lnia, Sy echo occtis, Bacillus and Dolichospermi i. [000280] SEQ ID NO: Ϊ 8 is an ORF from. Lyngbya strain ABCC1499, 112 amino acid residues in length. It lias 83% identity wife Arihrospira maxima gas vesicle protein Gvpa (NCBI Reference Sequence: ZP_03276567.i) and 84% identity with Arihrospira platensis gas vesicle protein GvpJ (NCBI Reference Sequence: ZP_06381477.1). [000281] In some embodiments, the buoyancy ORFs are provided by the SEQ ID NOs; 11-23 in Tables 5 and 6.

[000282] In some embodiments SEQ ID NOs: 11-16 and SEQ ID NOs: 17-23 are used for constructing gas vesicle gene clusters for buoyancy as a physical feature for any cyanobacterial constructs producing a product of interest.

[000283] Several additional homologous sequences for each of the various gas vesicle genes can be found in Table 7, below.

[000284] Table 5. Description of amino acid sequences from gas vesicle gene cluster in Arthronema africmmm strain ABCC1507.

ABCC1507 Description Length Corresponding % Identity with Sequence (amino acids) gene in Bacillus

Bacillus megaterium gas megaterium vesicle amino acid sequence

SEQ ID NO: Putative gas vesicle 247

23

11 protein F/L

SEQ ID NO: Gas vesicle protein 231 gvpL J\

12

SEQ ID NO: Gas vesicle protein 108

19

13 GvpK SEQ ID NO: Gas vesicle protein 134 gvpJ 40 14 GvpJ

SEQ ID NO: Gas vesicle protein 426 gvpN 27

15 GvpN

SEQ ID NO: Gas vesicle protein 72 ■gvpA 67

16 GvpA

[000285] Table 6. Description of amino acid sequences from gas vesicles gene cluster in Lyngbya sp. strain ABCC1499.

ABCC1499 Description Sequence Corresponding % Identity with Sequence Length Bacillus Bacillus

(amino acids) megaterium megaterium gas gene vesicle sequence

SEQ ID Gas vesicle protein 152 gvpU 31 NO: 17 GvpU

SEQ ID Gas vesicle protein 112 gvpJ 45 NO: IS GVPa

SEQ ID Gas vesicle protein 429 gvpN 30 NO: 19 GvpN

SEQ ID Gas vesicle protein 72 gvpA 68 NO: 20 GVPa

SEQ ID Gas vesicle protein 149 gvpK 23 NO: 21 GvpK

SEQ ID Putative gas vesicle 244 gvpF 26 NO: 22 protein F/L

SEQ ID Gas vesicle protein 88 gvpG 18 NO: 23 G. GvpG [000286] Table 7. Examples of gas vesicle gene sequences for enabling spatial or physical separation of the metabo^'lically enhanced cells in a cell culture from other cells by expression of buoyancy or production of a gas vesicle.

Gene CBI Accession

gvpA AAA587G8.1, AAAS8709. 1, AAA82 95 1, AAA82 96

&A&82437.1, AAA82 98. 1, AA&82499 1, AAB2333X .1,

AAB23332 .1, AAB23333. 1, AAB23334 1, AAB23335.1, AA823336.1, AAP34328. 1, AAP34329 1. AAP34330.1, AAP343 1.1, ΑΆΡ46Β38. 1, AAP46539 1, ΑΆΡ46Β 0.1, AAP 65 1.1, ΑΆΡ46Β42. 1, AAP46543 1, ΑΆΡ46Β44 -1/ &AP 65 5.1, AAP46546. 1, AAP 65 7 1, AAP46548 ■ 1, AAP4GS49.1. AAP46550. 1, ΑΆΡ46ΒΒ1 1 AAP46552.1, AAP46553.1, &AP 655 . 1, AAP46555 1. AAP 6556.1 AAP46557.1 AAP465B8.1 AAP4S5S9.1 ΑΆΡ46560.1»

&AP 656I.1, AAP46562. 1, AAP 6563 1, AAP46564 ■ 1, &AP 6565.1, AAP46566. 1, AAP 6567 1, AAP46568 ■ 1, AAP46569.1, AAP46570. 1, ΑΆΡ46Β71 1 AAP46572 .1, AAP46573.1, AAP 657 . 1, AAP46575 1. &AZ2349Q .1, AA229491.1, A.A22 492. 1, AA229 3 1, A.A22 494 -1/ &AZ23495.1, AAZ29496. 1, &AZ23437 1, AAZ2 98 ■ 1, AA22 499.1. AA229500. 1, AA229B01 1, AA229502.1, ΑΆ229Β03.1 AA229SQ .1 , AA22950 1, AA229SQ6.1, ABAI9700.1, ΑΒΑ13 ΌΙ 1, ABAI 70 . ■ 1, ΑΒΑ13 Ό5. ■ 1, ABC99Q3 .1, ABD02788 1 ABGS51544 , ■ 1, ABG51B 5. • 1, ABG51546.1, ABG51547 1. ABG51552. ■ 1, ABG5155 . ■ 1, ABG51BB6.1., ABK3 6 1, ABK34497. • 1, AB 34 8 , ■1, AB 34439.1, ABK34514 1, AB 34515. ■ 1, ABK34516. ■ 1, AB 515 2.1, ABK515 3 1, AB 51544. ■ 1, ABK515 5. ■ 1, ABK51546.1, ABK51B 1, ABK51548, ■1, ABK51B 9. ■ 1/ ABK51550.1, AB 51551 1. ABK51552. ■ 1, AB 51553. ■ 1, ABE56839.1., ABK56840 1, ABE568 1. ■ 1/ ABK568 2 , ■1, ABK56843.1, ABK56844 1, ABK56845. ■ 1, &BK56846, ■ 1, ABK568 7.1, ABE568 8 1, ABK568 9. ■1, ABE568B0. .1, ABK568S1.1, ABE568B2 1 ABK568S3 , ■1, ABE568B4. • 1, ABK56855.1, ABK56856 1. ABK56857. ■ 1, ABK56858. ■ 1, ABU5S390.1., ACC80758 1, ACC807B9. .1, ACC8076 , ■1, BQJP 6.1, E2J663.1, BAB73953.1, BAI91031.1,

CAA00Q64.1, CAA2 467.1. CAA40898.1, CAB59B15.

CAB53516.1, CAB59517.1, CAB53519.1, CAB59521.

CAB53523.1, CAB59543.1, CAB53544.1, CAB59546.

CAB59548.1, CAB595S1.1, CAB59BB2.1., CAB595S5,

CAB59559.1, CAB5356Q.1, CA859561.1, CAB53562.

CAM1961.1, CAD41963.1, CAB41965.1, CAE11899.

CAE11900.1, CAJI5636.1, CEN58418.1, CBJ858421.

ED2918B9.1, ED291862.1, EFA70B86.1, EFA70537,

EFA73418.1, EFA73 19.1, EGE83 B5.1, EGK83 S6,

EGK83957.1, NP 486293.1, P 486294.1, P07Q6Q.

P08412.3, P0A3G0.2 P0A3G1.2, P10397.3, P22453.

P809S7 , 1, Q2J KI.1, Q2JW39.1, Q8XFU1.3 , Q9R5H8 YP 00165877 1, YP_001658773-1, YP_001658774.1 YP_00186570 1, YP_001865702.1, YP_001865706.1 YP_32Q595.1 YP_320596.1, YP_3 Q599 , 1, YP 3206 00.1, YP_474296.1 YP_478051.1, YP_722017.1_i YPJ722Q18.1, yy 722019.1 YP 722020.1, YP 722025.1.. YP_722027.1, AA22949 .1. AAFi6863.1, ΒΑΪ9Ϊ031.1., AAC38419.1 ADF40146.1, YP 003598496.1, ADB70325.1,

YP_0035637B9.1, ADC49593.1, ADC49B96.1,

YP 003426485.1, YP 003426488.1, YP 001203420.1.

EFA73418,1, EQ&83955.1, P 486289,1, P55148.1, y8Y'J72.1, YP_Q01658?8i3.1, YP_001865?0 .1,

YP_320595.1 , YP_4?4913.1, YP_ 77701.1 ₍ ¥p_7220; .1, ZP_016315QS .1 , ZP_03273326 - 1 ,^' SP__0630461.1^'.^"l ,

ZP 06307560.1, ϋΡ 06381373.1, ,2P_Q7113230.1 , ZP 08495288.1

gvpL, gvpF A.AAS8714.1 , ΑΛΑ78472.1, AAS78475.1, AAY34448.1,

AAY34 S1.1, ABA19696 - 1, ABA19699.1, ABC98249.1, ABC99413.1, ABD02393.1, ABDQ2512.1, &BG51559.1, ABG51SS0.1, ACC80 60.1, ACC80762.1, BAS73944.1, BAB73947-1, BAC90259.1, BAG03589.1, BAG03592.1, BM90192.1, CAS11906. A, CAE11 09.1, CA0887S6.1, CA088759.1, CBN55884.1, CBM558S7.1, EAW43901.1, EAW43904.1, EDZ93569.1, SFA70588.1, EFA70591.1,

EFA73414.1, EFA73417.1, EGK83952.1, EGE8395 .1, MP 486285.1, NP 486288.1, NP_92526 .1, P55143.1, YP^OOIS58781.1 , ^'""YP_001658784.1 , YP_001865703.1 , YP_001865705.1, YP 32Ob91.1, YP_320594.1,

YP_473S12.1, YP 474676.1 , YP_477^'656.1, YP_477775. YPJ722Q32.1, YP_72 033.1, ZP_Q1631501.1,

SP_016315Q4 -1... ZP_03274843.1 , iSP 06304607.1, ZP_0S30461Q.l, 2Ρ_06307361.1 , ZP_Q6307364.1 , ZP_06380386, 1, ZP_06331372.1, ZP_Q711Q726.1 , ZP 07110729.1, ZP 08495285.1 , ZP 0849528 .1, gvpN AAAS8 .il.1. ΑΆΡ34331.1, ΆΑΡ465 1.1, ΑΆΡ46545.1,

AAP46546.1, AAS78468.1, AAY3444 .1, ABA13702.1, ABC99Q30.1, ABD02785.1, ABG51551.1, ABG51555.1, ACC80757.1, BAS739S0.1, SAG03535.1, BA191033.1,

CAC32463.1, CAC32 64.1, CAB11902.1, CBM58420.1, EAW43907.1, EB291860.1, EFA70585.1, EFA73420.1, EGK83958.1, 486291.1, P55150.1.. YP_001658777.1...

YP_00136S700.1, YP_32QS97.1, YP_4 4 293.1,

YP 478048.1, YP 722024.1, YP_722028 .1, SP_016315Q7.1... i 03276368.1, ZP_06 304613.1, ZP_0S307353.1, 2P_06381478.1 , 2P_„Q 113228.1, ZP 08495291.1

gvpP AAC38418.1 ADE70324.1 ADF40145.I YP 003563758.1

YP 003598495.1

gvpQ AAC38417.1 ADE70323.1 ADF40144.1 YP 003563

YP 003598494.1

gvpR AAC38415.1, ADC49592.1, ABB70247.1, ADE70321.1,

ADF40142.1, EGF76QS4.1, YP_003426 S4.1 ,

YP 003563681.1, YP 003563755.1, YP 003598492.1

I 1AB2 A, 1AB3 A, 1GKH A, 1GVP A, AAC38410.1,

ACZ83565.1, ADD44345.1, ABB70251.1, ADE70316.1, ADF40137.1, ADG90Q76.1, BAH48583.1, CAA22Q44.1, CAB61174.1, CAJ61667.1, CAL75172.1, CBG68862.1, EFB64936.1, EFO79420.1, EGB34869.1, STP_62496 .1, MP_63Q589.1, 068671.1.. P09413.1, P10397.3, P55147. P5S148.1, P5S149.1, P5515Q.1, YP_Q01203409.1 , YP_00 777528.1 , YP_0033 2308.1 , YP_003487427.1 , YP_003513438.1, YP_003563685.1, YP_003563750.1 , YP_003598487.1, YP_003653969.1, YPJ713234.1, SP_06274790.1... ZP_07686595.1, iSP 07709318.1, ZP 08201095.1

gvpT AAC38407.1, ADC49584.1, ΑΒΕ7Ό313.1, ADF40134.1.

CA 38689.1, CAP94591.1, YP_003426476.1,

YP 003563747.1, YP 003598484.1

gvpU AAC38406.1, AAM35196.1, AA 77608.1, ABC43582.1,

ADC49583.1, ADE70312.1, ADF40133.1, CAL19022.1,

640660.1, YP_002345418.1 , YP 003426474.1, YP_003426475.1 , YP_003563746.1 , YP_00359848 .1 , YP_202993.1, ii 07709322.1, SP_07709323.1 ₍

2P 07711092.1 gvp^'W A&.S7847S ,1, AAY¾4 S1.1. ABC98249.1, ABD02393.1,

ACC8 762 .1, BAGQ3592.1, ΒΑΪ90192.1, CAEI1909.1,

CAG887S6 .1, YP 001658784.1, YP 001865705.1,

YP 473SI 2 . 1 , YP 47765b .1

EXAMPLE 20

Co-expression of gvp genes and kanamycin resistance gene

[000287] The increased buoyancy shown in cyanobacteria PCC 7942: pSA499 and PCC 6803; pSA499 containing gvp genes compared to wild type strains, as shown in FIG. 7, FIG. S and FIGS. 24-27, implies functionality of the gvp genes. Along with gvp genes, these cyanobacteria also contain a kananiycm resistance gene and are resistant to

kanamycm. This demonstrates that in addition to the gas vesicle operon. whe additional genes with other functions are added, the plasniid pSA499 can express additional

functions, such as increased buoyancy and kananiycm resistance. This is the first instance of altering buoyant density of two cyanobacteria! genera Synechococcus (PCC 7942) and Synechocystis (PCC 6803), which are not known to produce gas vesicles by expression of heterologous genes for gas vesicles. This is also a first instance of successful functional co-expression of gas vesicle genes and antibiotic resistance genes in these genera of cyanobacteria.

EXAMPLE 21

Construction of a cyanobacterium expressing ethanoiogenic and gas vesicles genes from a single plasmid but under two different promoters

[000288] Plasniid pSA499 was designed to contain several unique restriction sites at convenient locations for future siibcloning. By digesting the plasniid with Pmel or BsrGI, functional ethanoiogenic genes from the plasmid p309, shown in FIG. 11, may be inserted upstream of the gvp genes. By digesting the plasmid with Pmll or SnaBL the

SO ethanoiogenic gene cassette from the plasmid p309 may be inserted downstream of the gvp genes. The resulting construct may be transformed by conjugatio protocol into PCC 6803. Ethanol production is measured by gas chromatography using standard GC-FH) protocols.

[000289] By placing the genes for ethanol production and increased buoyancy on the same plasmid, both functions may be linked to the continued existence of the same plasmid in the cell. If a cell loses the plasmid and ceases to produce ethanol, it also loses the gvp genes and settles to the bottom at a rate faster than a cell with the plasmid.

EXAMPLE 22

Construction of a cyanohacteriam expressing ethanoiogenic and gas vesicles genes from a single promoter

[000290] By digesting plasmid pSA499 with Sail, Xhol, or PspOML ethanoiogenic genes from may be inserted downstream of Plac promoter and upstream the gvp genes. Using one single promoter for both sets of genes links two functions, namely product formation and the physical property to stay buoyant function. If a mutation or recombination event decreases the effectiveness of the promoter and lowers the

transcription of the ethanoiogenic genes, it also lowers the transcription of the gvp genes, which lead to decreased buoyancy.

[000291 ] By placing the genes for ethanol production and increased buoyancy on the same plasmid, both functions may be linked to the continued existence of the same plasmid in the cell. If a cell loses the plasmid and ceases to produce ethanol it also loses the gvp genes and settles to the bottom at a rate faster than a cell with the plasmid. EXAMPLE 23

Metabolkailv enhanced cyanobacteria that produce ethanol by harboring an

ethanologenic cassette

[000292] In a prophetic example, the nietabolically enhanced, cyanobacteria produce ethanol enabled by an ethanologenie cassette comprising at least pdc and adh genes. The gene pdc encodes pyruvate carboxylase and adh encodes alcohol dehydrogenase.

EXAMPLE 24

Metabolically enhanced cyanobacteria that produce biofuels and chemicals

[000293] In a prophetic example, the metabolically enhanced cyanobacteria produce the product of interest enabled by the assembly of gene cassettes on the second nucleotide sequence for producing biofuels and chemicals including but not limited to

pharmaceutical drags, nutraceiiticals, bioplastics, monomers, polymers, alcohols, aldehydes, diols, ketones, isoprenoids, organic acids, ethanol, glycerol, isopropanol, 1,2- propanediol, 1,3-propanedioi, n-propaiiol, n-butanol and isobutanol.

EXAMPLE 25

Metabolically enhanced cyanobacteria with increased buoyancy

[000294] In a prophetic example, this invention provides a buoyant metabolically enhanced photoautotrophic host cell comprising at least one set of genetic enliancements enabling expression of gas vesicle proteins for increased buoyancy of cells. Ei the prophetic example, this invention provides a buoyant metabolically enhanced

photoautotrophic host cell comprising a first set of genetic modifications resulting in an enhanced level of biosynthesis of pyruvate, aeetyl-CoA, acetaklehyde, ethanol, isopropanol, isobutanol, isobuiyraldehyde, 1 ,2-propanediol. L 3 -propanediol, n-butanol,

C _, n-propanol, propanal. butadiene, isopropionaldehyde. compared to the respective wild type host cell, and at least one second set of genetic modifications different from the second set of genetic modifications comprising expression of gas vesicle protein for increased buoyancy of cells.

EXAMPLE 26

Meiabolieallv enhanced cyanofaaeteria with decreased buoyancy [000295] In a prophetic example, this invention also provides a metabolically enhanced photoautotrophic host cell that has a decreased buoyancy, (or increased cell density), instead of an increased buoyancy. Such cells would tend to^' sink in a culture, compared to cells not having the .modification. Thus, the genetic modification would also allow the modified cells to be spatially separated from non-modified cell by any suitable means.

[000296] In this prophetic example, the gene(s) that are expressed cause the modified cells to be less buoyant. The cells can also have modifications that allow them to produce products of interest, such as, for example; ethanol, pyruvate, acetyl-CoA, acetaldehyde, ethanol, isopropanol, isobutanol, isobutyraldehyde, 1,2-propanediol, 1,3- propanediol, n-butanol, n-propanol, propanal, butadiene, or isopropionaldehyde, compared to the respective wild type host cell.

EXAMPLE 27

Metabolkallv enhanced cyanobacteria with altered cell surface charge

[000297] In another prophetic example, this invention also provides a metabolically enhanced photoautotrophic host cell that has an altered smiace charge, compared to wild- type or non-modified cells. In this way, the altered sur face charge can be used to assist in separating the modified cyanobacterial cells from non-modified cyanobacteriai cells (such as those that are wild-type, or have lost an inserted plasrmd, or are revertants) in a culture. Thus, the genetic modification would also allow the modified cells to be spatially separated from non-modified cells by any suitable means, such as ion exchange or other charge-based separation methods.

[000298] Such cells can also have modifications thai allow them to produce products of interest, such as, for example, ethanol, pyruvate, aeetyl-CoA, acetaldehyde. ethanol, isopropanol, isobufanol, isobutyraldehyde, 1,2-propanediol, 1,3 -propanediol, n- butanol, n-propanol, propanal. butadiene, or isopropionaldehyde, compared to the respective wild type host cell.

EXAMPLE 28

Nucleic acids and proteins

[000299] In a prophetic example, this invention provides nucleic acids that are at least 60%, 70%, 80%, 90% or 95% identical to promoter nucleic acids or to nucleic acids encoding proteins for the genes disclosed herein. With regard to the promoters, truncated versions of the promoters including only a small portion of the native promoters upstream of the transcription start point, such as the region ranging fi om -35 to the transcription start, can often be used. The invention is fmther directed to amino acid sequences which are at least 60%, 70%, 80%, 90% or 95% identical to the amino acid sequences disclosed herein.

[000300] The percentage of identity of two nucleic acid sequences or two amino acid sequences can be determined using the algorithm of Thompson et al. (C istal W, 1 94 Nucleic Acid Research vol. 22, pp. 4,673 to 4.680). A nucleotide sequence or an amino acid sequence can also be used as so-called "query sequence" to perform a nucleic acid or amino acid sequence search against public nucleic acid or protein sequence databases in order to, for example, identif further unknown homologous promoters,, or homologous protein sequences and nucleic acid sequences that can also be used in embodiments of this invention. In addition, any nucleic acid sequences or protein sequences disclosed in this patent application can also be used as a "query sequence" in order to identify yet unknown sequences in public databases, which can encode, for example, new enzymes that could be useful in this invention. Such searches can be performed using the algorithm of Karlin and Altschul (1999 Proceedings of the National Academy of Sciences USA, vol. 87, pp. 2264 to 2268), modified as in Karlin and Altschul (1993 Proceedings of the National Academy of Sciences USA, vol. 90, pp. 5873 to 5877). Such an algorithm is incorporated in the Nblast and Xblast programs of Altschul et al. (1999 Journal of Molecular Biology, vol. 215, pp. 403 to 410). Suitable parameters for these database searches with these programs are, for example, a score of 100 and a word length of 2 for ast nucleotide searches, as performed with the Nblast program. Blast protein searches are performed with the Xblast program with a score of 50 and a word length of 3. Where gaps exist between two sequences, gapped blast is utilized as described in Altschul et al. (1997 Nucleic Acid Research, vol. 25, pp. 3389 to EXAMPLE 29

Separation of productive biomstss from nonproductive biomass

[000301] In Example 4, in which no mixing is induced, fee settling rate v_s) of the slowest-settling non-produetive cells PCC7942 is approximately 1 era-day, and the settling rate (}¾) of the slowest-settling productive cells PCC7942: pSA499 is approximately 0.33 cm day. In a prophetic example, PCC7942: pSA499 cells are grown in a photobioreactor Ϊ 12 connected to a holding vessel 101 incorporating baffles 102, as shown in FIGS. 12. 13, 14, and 15.

[000302] The PCC7942: pSA499 cells that cany fee production plasmid express the production genes and the as vesicles proteins. These cells exhibit increased buoyancy relative to PCC7942 cells. The PCC7942: pSA499 cells that have lost the plasmid are not productive and exhibit decreased buoyancy. Non-productive cells therefore settle gradually to the bottom and are transferred to a holding vessel 101 , which contains a series of twelve baffles 102. In some embodiments the number of baffles 102 may vary from six to eighteen.

[000303] The overflow rate (V₀) represents the settling rate of the smallest particle which the holding vessel 101 will remove under ideal conditions, in which gravit pulls the particle down as the flow of aqueous culture 113 moves the particle forward through the holding vessel 101 to produce a trajectory moving both forward and down.

[000304] The overflow rate (V₀) is defined to be the rate to empty the volume of the holding vessel 101. The value h ÷ (V₀) is the time to empty the entire volume of the holding vessel 101 when flow of the aqueous cultur e 113 is transverse to gra vity, wherein h is the height of the holding vessel 101. [000305] For holding vessels 101 in which a constant height h is defined by volume ÷ settling area, overflow rate (V₀) can. be defined as the volume of flow per unit of time (0 divided by the settling area (A) of the holding vessel 101.:

[000306] Vo = Q÷A

[000307] Cyaaobacteria with a settling rate (i¾) greater than or equal to the overflow rate {Vo) will settle out in the holding vessel 101. Cyanobaeteria with a settling rate less than the overflow rate (VQ) will settle out in the holding vessel 101 in the ratio i%> ÷ Vo-

[000308] According to the present invention, the computation of overflow rate (V₀) and the correlation between fraction of cyanobaeteria thai that will settle out in the holding vessel 10 and the ratio of settling rate to overflow rate (V₀) is valid for an "ideal holding vessel" that has the shape of a rectilineal^' prism, such as a box, but not, for example, a horizontally-oriented tube or a trapezoidal prism, and in which the direction of flow of aqueous culture 1 13 is horizontal, or miidireciioiial and perpendicular to gravity, and there are no interactions among cellular particles, such as electrostatic interactions between cellular membranes.

[000309] In the prophetic example, the overflow rate ( Vo) is set equal to the settling rate of PCC7942 cells of approximately 1 cm/day, such that approximately 100% of PCC7942 cells in the aqueous culture 1 13 transferred to the holding vessel 101 will settle out in the holding vessel 101. in the prophetic example, the proportion of PCC7942: pSA499 cells in the aqueous culture 113 transferred to the holding vessel 101 that will settle out in the holding vessel 101 will be i¾ ÷ Vo = 0.33 cm per day ÷ 1 cm per day = [000310] In the prophetic example, the settling area (A) of the holding vessel 101 is 1 meter². Accordingly, the rate of flow of aqueous culture 113 transferred from the photobioreacior 112 to the holding vessel 101 is calculated as

[000311] Q = V₀ A = 0.01 meter per day x. 1 meter² = 0.01 meter³ per day = 10 liters per day .

[000312] One of ordinary skill in the art will understand that the volume of flow per unit of time (Q) and the settling area (A) of the holding vessel 101 may be varied as required by considerations of, for example, energy usage for pumping, or space available for the holding vessel 10 Ϊ .

[000313] In some embodiments, the volume of aqueous culture 113 transferred from the photobioreacior 112 to flie holding vessel 101 is drawn from the lowest depths of the photobioreacior 112. The aqueous culture 113 flows through the cross-sectional area of the plioiobioreactor Ϊ 12, bounded by the bottom and sides of the photobioreacior 112 with a dmi iishmg gradient of axial velocity from the bottom of the photobioreacior 112 toward the top surface of the aqueous culture 113.

[000314] In the prophetic example, the depth of the vertical cross-sectional area of the photobioreacior 1 12 from the bottom surface of the photobioreacior 112 is calculated as

[000315] D_T ÷ D_c = V_T ÷ V_c

[000 16] where D_T = depth of aqueous culture 113 transferred from the

plioiobioreactor 112 to the holding vessel 101,

[000317] Dc = total depth of aqueous culture 113 initially present in the

photobioreacior 112, [000318] FT = volume of aqueous culture 113 transferred from the piiotobioreacior 112 to the holding vessel 101 , and

[000319] Vc = volume of aqueous culture 1 13 initially present in the

photobioreaetor 112.

[000320] For a photobioreaetor 1 12 containing 1,000 liters of aqueous culture 113 having a depth of 20 cm in which 10 liters per day of aqueous culture 113 is transferred from the photobioreaetor 1 12 to the holding vessel 101, the depth of aqueous culture 1 13 transferred to the holding vessel 101 may be calculated as

[000321] Dr = F_T ÷ F_C -^■ D_c = 10 liters ÷ 1 ,000 liters x 20 cm = 0.2 cm.

[000322] Average settling rate of the cyanobacteria increases as buoyancy decreases. Average settling rate decreases as agitation of the aqueous culture is increased. Average sedimentation velocity may also vary among different strains of cyanobacteria, and may also be affected by irradiation of the aqueous culture at different states.

[000323] As shown in FIGS. 13, 14, and 15, the aqueous culture 113 flowing through the holding vessel 101 may vertically stratify into a layer 1 17 of PCC7942:

pSA499 cells having greater buoyancy, a layer 104 of mixed PCC7942: pSA499 cells and PCC7942 cells, and a layer 103 of PCC7942 cells that settle to the bottom of the holding vessel 101. In the prophetic example, the utilization of baffles 102 in the holding vessel 101 enhances sedimentation of the cyanobacteria and offsets deviations from ideal sedimentation conditions. The aqueous culture 113 transferred from the photobioreaetor 1 12 to the holding vessel 101 passes over the baffles 102 in the direction of flow. The baffles 1 2 differentially retain PCC7942 cells while permitting PCC7942: pSA499 cells to continue in the direction of flow. The PCC7942: pSA499 cells remain closer to the surface of the aqueous culture 113 than the PCC7942 cells and pass over the edge of the baffle 102 nearest to the .surface of the aqueous culture 113. The PCC7942 cells settle toward the bottom of the holding vessel 101 and are removed through the chain

105. ^'When the aqueous culture 13 is passed over multiple successive baffles 102, additional PCC7942 cells are removed at each baffle 102. The fraction of the PCC7942: pSA499 cells in the flow volume is fliereby increased as the aqueous culture 113 flows through the holding vessel 101.

[000324] In the prophetic example, the pump 109 and flow connectors 108, are sized to accommodate flow rates in the aqueous solution Ϊ 13 of approximately 0 liters per day.

EXAMPLE 30

Separation of Synecfaoeoccus sp. PCC7942 cells by settling to produce spatial separation

[000325] In a prophetic example, the aqueous culture 113 contained in the

photobioreactor 112 is agitated itermittently. According to the present invention, when agitation of the aqueous culture 13 contained in the photobioreactor 112 is halted periodically for a predetermined length of time, PCC7942 cells will settle to the bottom of the photobioreactor 112, while PCC7942: pSA499 cells will remain suspended in the aqueous culture 113.

EXAMPLE 31

System for separation of biomass hv settling to produce spatial separation [000326] In a prophetic example, aqueous culture 113 contained in a photobioreactor 11.2 is agitated from the surface of the aqueous culture 113 to a depth that is less than the total depth of the aqueous culture 113, such that a portion of the aqueous culture 113 contained in Hie photobioreactor 112 is agitated and the remainin portion of the aqueous culture 113 is not agita ted. According to the present invention, PCC7942 cells will settle to the bottom of the photobioreactor 112 in the portion of the aqueous culture 113 farthest from the surface of the aqueous culture 113 and are removed, or stay on the bottom and may be recycled, while PCC7942: pSA499 cells having greater buoyancy are preferentially retained nea the surface of the aqueous culture 113 by mixing.

[000327] In the prophetic example, a mixing system comprising one or more foils disposed in a vertical or horizontal array is used to agitate the aqueous culture 113 contained in the photobioreactor 112 by moving the foils longitudinally through the photobioreactor 112. In the exemplary embodiment, the mixing system is configured to provide agitation only in a desired poition of the aqueous culture 113 contained in the photobioreactor 112.

[000328] As shown in FIGS. IS and 20, in some embodiments, the mixing system comprises one or more horizontally oriented foils that generate trailing vortices which agitate the aqueous culture 113 contained in the photobioreactor 112 when the one or more foils move laterally through the aqueous culture 113, wherein the span of each foil is less than the depth of the aqueous culture 113 such that the foils genera te trailing vortices having a diameter less than the depth of the aqueous culture 113 that agitate the aqueous culture 113 fiom the surface of the aqueous culture 1 13 to a desired depth, and wherein the foils are laterally spaced apart greater than the span of the foils.

[000329] In some embodiments, the mixing system comprises one or more vertically oriented foils having a span less than the depth of the aqueous culture 113 such that the foils agitate the aqueous culture 113 fiom the siiriace of the aqueous culture 113 to a desired depth.

EXAMPLE 3.2

Separation of cells by mixing a portion oi^* the photobioreactor to produce spatial separation of ceils with buoyancy differences

[000330] In a prophetic example, aqueous culture 113 contained in a

photobioreactor 112 is mixed along a portion of the length of the photobioreactor 112. in accordance with the present invention, the unmixed portion of the aqueous culture 113 acts as a quiescent zone. In accordance with the present invention, PCC7942 cells are less buoyant than PCC7942: pSA499 cells. The PCC7942 cells preferentially migrate to the quiescent zone and settle to the bottom of the photobioreactor 112, where they are removed.

EXAMPLE 33

Modeling of cell population dynamics and determination of ratio of settling volume

area to photobioreactor area

[000331] One of ordinary skill in tiie art will appreciate that, for passive settling, a minimum surface area is needed to achieve a desired removal rate of non-buoyant ceils from either a separate holding vessel 101 into which an aqueous culture 113 is introduced or a quiescent settling volume t¾in a photobioreactor 112 that is either laterally or vertically removed from agitation. In a prophetic example, the following population growth models are used to provide a means of determining the removal rate and thus the settling area As compared to the area of the bioreactor A3, within the bounds of the accuracy of the representation. The ratio is dependent on measured and desired biological parameters.

[000332] In the prophetic example, the cell density per unit area is Φ and that the photobioreactor 112 shape is a rectangular prism. The cell density per unit volume in the photobioreactor 112 is so with a settling rate of v$ , the vertical flux of cells from a uiescent settling volume V_s of area A_s is given by

[000334] which when normalized by the bioreactor area A3 and cell density represents the specific removal rate

[000336] Two competing species inside the producing section of the

photobioreactor 112 can have different settling and growth rates μ. The equation for logistic growth, encompassing both exponential and limited growth, incorporate a total carrying capacity A' to model the maximum achievable density in a light limited culture and s for a removal rate. The rate of plasmid loss, r, characterizes the change of desirable species 1 to a less buoyant species 2. The growth of these two species is given by

da , ά + φ> _% ,

[000337] dt K <!ψ> . ... φ, + φ₇ ,

— - = μ, Λ ΐ—^■ - > >. r<¾ - 3·.^ ₇

[000338] dt ^{" "} Κ ^{" " "}

[000339] In steady state, the rate of change is zero, so algebraic manipulation will lead to solutions for φι and φ?-

[000342] These solutions provide valid equilibrium population values when / _; > /^■ r - .v.. — -i r ^; .v, )

+ s_} and when so that the cells have the capacity to produce at a rate greater than they are lost. Then the steady state ratio of nonbuoyant cells to the total population can be given by

[000344] A further restriction is that M (^{r +} ¾ so that the fraction/ < 2. The preceding equation can be rearranged so that for a desired maxiimim percentage/ of nonproductive (less buoyant cells) cells in the photobioreactor 112 a quiescent settling volume F<_? area ratio A 'As can be selected. This relation is given by

[000345]

[000346] Here the operational nondimensional parameters are the settling rate ratio

Vsi / ι·¾ι?, growth rate ratio · μ ?/μ_.ί, and reversion rate to settling rate of species 1, r

In the prophetic example, the settling rate of 'buoyant^? cells {¾) is 0.33 cm day and ¾? is 1 cm day, for cells that have lost a plasniid to generate the buoyancy; a rectangular photobioreactor 112 has a 200 mm depth; the rate of reversion is 0.1% day; and the specific growth rate ratio is = 1.33. This yields a minimum requirement of A^A >0.\9 in order to maintain the nonproductive, nonbuoyant cells at a level less than 20%. Projected needs for other growth rate ratios are shown in FIG. 23.

[000347] hi the prophetic example, the reversion rates are 0.1% and 0.5%/day which correspond to the nondimensional parameter r 0IB/VSI) = 0.061 and 0.303 respectively. According to the present invention, for these small reversion rates, the restrictive conditions for the validity of the equations

[000351] are met. Both plots hi FIG. 23 have poles when μ μ] approaches the ratio of settling rates i¾_? ivsi (here equal to 3) as the denominator in the equation

[000353] approaches zero, which suggests that no amount of settling area can compensate for the increased growth rate of the uiidesired species in such situations. From a practical standpoint, an area ratio of 1, equivalent to a quiescent settling volume below the phatobioreactor 112 will limit the growth rate ratios that can be sustained. For the presumed reversion rates of 0.1% and 0.5%/day in the prophetic example, the limits are μ₂/μι = 2.65 and 1.33 respectively.

[000 54] The validity of this model for the indicated parameters has been investigated (but not included here) by numerical simulation and linear stability analysis. Both methods show that for these exemplary conditions in FIG. 23, the model equilibrium states are indeed stable.

[000355] In the case that species 1 would be completely neutrally buoyant ( i¾j =0). the pole of the equation

[000357] moves to infinity and the equation reduces to

[000359] As seen in FIG. 17, provided species 1 is neutrally buoyant, the system can sustain a given ratio of unproductive cells with less settling area than if species 1 settles with a finite velocity. It would also be more resistant to competitive growth rate ratios. Under the previous assumptions, with an area ratio of 1 and presumed reversion rates of 0.1 % and 0.5%/day, the growth rate ratio would only need to be βτ/μι < 46 and 6 respectively- to maintain a culture with at most 20% unproductive cells.

[000360] Hie previous equations ignore the death of cells assuming that it is a minor component compared to the rate at which they settle out. It is likely that episodic stress events can increase the rate of death to cells differentially, as well as settling velocities and be a controlling factor in the population dynamics. It is assumed that in absence of such large perturbations, the present model would suffice in describing quasi steady state populations.

[000361] A shown in FIG. 21 and FIG. 22, respectively, a settling chamber can be either vertically displaced or laterally displaced and in direct communication with aqueous culture 113 so that there is a net turbulent flux of cells into the quiescent settling volume V . This flu across an interface can be estimated by the mixing length and characteristic velocity of the turbulence multiplied by the potential gradient of cell concentration. Equilibrium in the quiescent settling volume V_s will exist, so the amount of cells flowing to the quiescent settling volume Vs via this turbulence flux will balance the settling rate.

[000362] A shown in FIG.21, vertical displacement of the quiescent settling volume V_s is preferable in that the large planar interface acts more efficiently for removing the cells into and to the bottom of the quiescent settling volume Vs. A second benefit is that no photosyntheiieaily active area is wasted. However, it may be more difficult to remove an extensive bottom layer of sediment in this configuration compared to a horizontally displaced qiiieseent settling volume- Vs, but solutions exist if it is found to be necessary.

[000363] FIG. 22 shows a representation of a horizontally displaced quiescent settling volume V_s with a baffle. The baffle is optional, but depicted to show that only the plan, area As = J¾¾ is important for settling, k and the amount of turbulence determines the flux to this reeion and can limit the effective removal rate assumed in the calculation.

EXAMPLE 34

Separation of metabotically enhanced bacteria expressing fluorescence

[000364] In a prophetic example, this invention provides a piasmid comprising ethanologenic ca ssette further comprising the genes of pyruvate to acetaldehyde conversion (pyruvate decarboxylase. EC 4.1.1.1) and acetaldehyde to ethanol conversion (alcohol dehydrogenase, EC 1.1.1.1) and GFP protein or its fluorescent variants. The GFP genes and ethanologenic genes may be co-transcribed or transcribed from

independent promoters. An exemplary GFP gene, GFP wild type CCD28594, is provided as SEQ ID NO: 26. The wild type GFP amino acid sequence is present in SEQ ID NO: 50.

[000365] Fluorescence-activated cell sorting (FACS) method lias been used to select variants of GFP (green fluorescence protein) that fluoresce between 20-and 35-fold more intensely than wild type when excited at 488 mn (Gene (1996) 173: 33-3S). GFPmiit2 (GenBank # AAN72829.1) (nucleic acid SEQ ID NO; 27: amino acid SEQ ID NO: 1) is a mutant of GFP (green fluorescent protein) wit an excitation maximum of 481 am. Wild type GFP has excitation maximum at 395 am. [000366] In some embodiments of this invention fluorescence may be used for .spatial or physical separation fay miking the GFP nucleotide sequence to the gene cassettes for producing a product of interest for any cyanobaeteria.

EXAMPLE 35

Separation of metabolicaily enhanced cyanobaeteria expressing genes essential for photosynthesis

[000367] In a prophetic example, a eyanobacierial host is transformed with a plasmid carrying genes for ethanol production and a gene for a key enzyme in the production or assembly of chlorophyll, photosystem I, photosystem II or another key photosynthesis gene. The gene for the key enzyme in the production or assembly of chlorophyll, photosystem I, photosystem H or other essential photosynthes s gene is deleted from the genome of the cyanobacterial host. If the transformed eyanobacierial host loses the plasmid, it also loses the essential gene for photosynthesis and will become unable to photosynthesize and grow. Thus, loss of the plasmid will result in the death of the cyanobacterial host, and the cell will cease to compete with enhanced cells for photons. According to this embodiment, a host cell comprises a plasmid carrying genes for ethanol production and a gene for expression of an enzyme in the production or assembly of chlorophyll, photosystem I, photosystem II or another photosynthesis gene, wherein the endogenous gene for expressing the enzyme in the production or assembly of clilorophyll, photosystem I, photosystem II or othe essential photosynthesis gene is deleted from the genome of the cyanobacterial host.

[000368] An exemplary gene for production of chlorophyll, glutamyl-tR A

reductase [derived from Synechocystis sp. PCC 6803] (NP_441058.2) (EC: 1.2.1.70) is provided as nucleic acid SEQ ID NO: 28; amino acid SEQ ID NO: 52. An exemplary gene for the expression ofphotosystem I, P700 chlorophyll a apoprotein Al [derived from Synechocystis sp. PCC 6803] (NP_440757.1), is provided as nucleic acid SEQ ID NO: 29; amino acid SEQ ID NO: 53. An exemplary gene for the expression of photosystera II, Dl protein [derived from Synechoeystis sp. PCC 6803] (NP_4 1550.1), is provided as nucleic acid SEQ ID NO: 30; amino acid SEQ ID NO: 54.

[000369] I accordance with the present invention, this approach could be applied to any gene that is essential for the host cell's survival, such as, for example, replication machinery, ribosomes and cell wall components.

EXAMPLE 36

Separation of metabolkaliy enhanced cvanobacteria in a vertical photobioreactor

[000370] Cells in accordance with the present invention in which buoyancy and productivity are genetically linked may be useful in, for example, vertical

photobioreactor designs known to those of skill in the art. hi that context, the population of productive cells preferentially would remain neutrally buoyant and vertically dispersed throughout the liquid culture in the vertical photobioreactor, while nonproductive cells settle to the bottom of the photobioreac tor, assuming that the bottom of the

photobioreactor is far enough away from any agitation so that there is is a quiescent zone and resuspension of the nonproductive cells does not occur.

[000371] Although the present invention has been described in considerable detail with reference to certain embodiments thereof, other embodiments are possible.

Therefore, the spirit and scope of the appended claims should not be limited to the description of the embodiments contained therein .

Claims

What is claimed is:

! , A metaboHcaliy enhanced cyanobacterial cell comprising at least one

heterologous D A molecule, which comprises a nucleotide sequence for

expression of a physical characteristic enabling a spatial separation of the enhanced cell i a culture medium comprising enhanced and non-enhanced ceils.

2. The metabolica!ly enhanced cyanobacterial cell of claim 1, wherein the physical characteristic enabling a spatial separation of the metabolic-ally enhanced

cyanobacterial cell is selected from the group consisting of: altered cell density, altered surface charge, altered surface properties, altered cell size, altered settling velocity, and altered buoyancy.

3. The metabolicallv enhanced cyanobacterial cell according to claim 1 or 2,

wherein the ceil is an autotrophic cell, a photoautotrophic cell, a

photoheterotrophic cell or a chemoautotrophic cell.

4. The metaboHcaliy enhanced cyanobacterial cell according to any of claims 1 through 3, wherein the cyanobacterial cell is in the Synechococcus or

Syiiechocystis genus and wherein the cyanobacterial cell comprises a

heterologous pyruvate decarboxylase gene facilitating the formation of a product of interest.

5. The metaboHcaliy enhanced cyanobacterial ceil according to claim. 2, wherein the expression of a physical characteristic enabling a spatial separation confers altered buoyancy. The metabolically enhanced cyanobacteriai cell according to any of claims J through 5, wherein the expression of a physical characteristic enabling a spatial separation is the production of a gas vesicle.

The metabolically enhanced cyanobactenal cell according to any of claims .1 through 5, wherein the altered buoyancy is increased buoyancy.

The metabolically enhanced cyanobactenal cell of claim 5, wherein the altered buoyancy is decreased buoyancy.

The metabolically enhanced cyanobactenal cell according to any of claims 1 through 8 wherein said nucleotide sequence is present on a plasmid.

The metaboHcaUy enhanced cyanobactenal cell according to any of claims Ϊ through 8 wherein said nucleotide sequence is present on a chromosome.

The metabolically enhanced cyanobactenal cell according to any of claims 1 through 10, wherein the metabolically enhanced cyanobactenal ceil is member of Chroococcales, G!oeobacteria, Nostocales, Osesllatoriales, Pleurocapsales, Prochlorales or Stigonematales.

The metabolically enhanced cyanobactenal cell according to any of claims 1 through 1 1 , wherein the nucleotide sequence tor the expression of a physical characteristic enabling a spatial separation of the metabolically enhanced cyanobacteriai cells in a cell culture from other cells encodes at least one polypeptide for the production of a gas vesicle.

The metabolically enhanced cy anobacteriai cell according to any of claims Ϊ through 12 further comprising a first promoter element, wherein the first promoter element regulates expression of the nucleotide sequence. The metabolically enhanced cyanobacterial cell according to any of claims J through 12 further comprising at least a first promoter element and a second promoter element, wherein at least one O F of the nucleotide sequence is regula ted by the at least first promoter element and at least one ORF of the nucleotide sequence is regulated by the second promoter element.

The metabolically enhanced cyanobacterial ceil according to an of claims 1 through 12 further comprising a constitutive promoter element which regulates expression of the nucleotide sequence.

The metabolically enhanced cyanobacteria! ceil according to any of claims I through 15, wherein the nucleotide sequence for the expression of a_. physical characteristic enabling a spatial separation of the meiabolicaliy enhanced cells in a cell culture from o ther cells is for buoyancy or production of a gas vesicle and is selected torn the group consisting of gvpA, gvpB, gvpC, gvpF, gvpG, gvpJ. gvpK, gvpL, gvpN, gvpR, gvpS, gvpT and gvpU.

The metabolically enhanced cyanobacterial cell according to any of claims 13 through 15, wherein the promoter element is selected from the group consisting of PrbcL, PnbIA, Ppe i PntcA, PisiA, FpetE, PggpS, PpsbA2, PpsaA, PsigB, PktA, PhtpG, PnirA, PhspA, PclpB l, PhliB, Prbc, PcrhC, PziaA, and Plac.

The metabolically enhanced cyanobacterial cell according to claim 1 , wherein the nucleoiide sequence encodes at least one polypeptide selected from the group consisting of SEQ ID NOs: 1 1 -23. The metabolically enhanced cyanobacterial cell according to claim. 18, wherein the at least one polypeptide sequence has more than 90% identity to any of the polypeptides selected from the group consisting of SEQ ID NOs: 1 1-23.

The metabolically enhanced cyanobacterial cell according to any of claims .1 throug 19 wherein the nucleotide sequence for the expression of a physical characteristic enabling a spatial separation of the metabolically enhanced cells in a cell culture from other cells is isolated from the microorganisms selected from the group consisting of Microcystis, Arthronema, Lyngbya, Bacillus, Arfhrospira, Planktothrix, Pseudoanabaena_y Oscil!atoria, Nost c, Octadecabacter,

Hatobacf rium ffaloferax, Spituliria, Synechococc and Bolichospermum , A metabolically enhanced cyanobacterial cell comprising gas vesicle genes from another organism,, wherein the expression of said gas vesi cle genes confers an altered buoyancy to the metabolically enhanced cyanobacterial cell.

A metabolically enhanced cyanobacterial cell comprising gas vesicle genes from Bacillus megaierium or Microcystis aeruginosa.

A method for separating meiabolicaliy enhanced cells .from other cells composing the steps of

i creating metabolicall enhanced cells comprising a nucleotide sequence the expression of which alters the density, surface charge or surface properties of the meiabolicaliy enhanced cells relative to the density, surface charge or surface properties of wild type cells, or alters the viscosity in the vicinity of the raetaboHcally enhanced cells relative to the viscosity in the vicinity of wild type ti. allowing said cells to grow in a culture which comprises cells not so metaboHcally enhanced; and

iii separating said metaboHcally enhanced cells from other ceils on the basis of difference in settling rate.

The method of claim 23 further comprising the steps

iv. detemiioing a settling rate v(enhanced) of the nietabolkally enhanced cells;

v. pro viding a holding vessel of approximately rectilinear geometry with settlma area A:

vi. selecting an overflow rate Q/A for the holding vessel such that Q/A is greater than v(enhanced), wherein Q is the flow of liquid through the holding vessel;

vii. causing the .metaboHcally enhanced cells of settling rate less than Q/A to leave the holding vessel ; and

viii. retaining cells of settling rate greater than Q/A within the holding vessel. 25. A meiaboiicaliy enhanced cell that produces a product of interest comprising at least one heterologous D A molecule, wherein the at least one heterologous UNA molecule comprises a first nucleotide sequence for the production of the product of interest and a second nucleotide sequence for the expression of a physical cha rac teristic enabl ing a spatial separation of the metabolic-ally enhanced cells in a cell culture from other cells that do not produce the product of interest in the medium, wherein the first nucleotide sequence and the second nucleotide sequence are expressed concurrently and the second nucleotide sequence is not expressed if the first nucleotide sequence is not expressed, and wherein a global separation of the metabolic-ally enhanced cells in a cell culture from other cells that do not produce the product of interest in the medium occurs because the meiabolicalfy enhanced eel is express the physical characteristic in the culture, wherein the physical characteristic enables a spatial or physical separation of the raetabolically enhanced cells from other cells that do not produce the product of interest.

6. The metabolic-ally enhanced cell of claim .25 that produces a product of interest comprising at least one heterologous DNA molecule, wherein the at least one heterologous DNA. molecule comprises a first nucleotide sequence encoding at least one polypeptide for the production of the product of interest and a second nucleotide sequence encoding at least one polypeptide for the expression of a physical characteristic enabling a spatial or physical separation of the

raetaboHcaliy enhanced cells i a cell culture from the other ceils.

7. A metabolically enhanced cell according to claim 25, wherein the raetabolically enhanced ceil is an autotrophic cell, a photoautotrophic cell, a photoheterotrophic cell or a chemoautotrophic ceil

8. A metabolic a ily enhanced cell according to claim 25, wherein the metabolically enhanced cell is a cyanobaeferiuni.

9. A .metabolic-ally enhanced cell according to claim 25, wherein the expression in the metabolically enhanced ceils of the second nucleotide sequence for the expression of a physical characteristic enabling a spatial or physical separation of the metabolicaily enhanced cells in a cell culture from other cells confers altered buoyancy.

A metabolicaily enhanced cell according to claim 25, wherein the expression in the metabolicaily enhanced cells of the second nucleotide sequence for the expression of a physical characteristic enabling a spatial or physical, separation of the metabolicaily enhanced cells in a cell culture from other cells is the production of a gas vesicle.

A metabolicaily enhanced cell according to claim 25, wherein the product of interest is a volatile organic compound.

A metabolicaily enhanced cell according to claim 25, wherein the product of interest is a pharmaceutical drug, a mrtraceutical, a bioplastie, a monomer, a polymer, an alcohol, an aldehyde, a diol, a ketone, an isoprenoid or an organic acid.

A metabolicaily enhanced cell according to claim 25, further comprising at least one plasmid, wherein the at least one plasmid comprises the at least one heterologous DN molecule.

A metabolicaily enhanced cell according to claim 25, further comprising at least one chromosome, wherein the at least one chromosome comprises the at least one heterologous DNA molecule.

A metabolicaily enhanced cell according to claim 25, wherein the metabolicaily enhanced cell is Chrooeoecaies, Gloeobacteria, Nostocales, Qscillatoriates, Ple roc ps les, Proch raies or Stigonemaiale .

A metabolicaily enhanced cell according to claim 25, wherein i. the first nucleotide sequence encodes at least one polypeptide for an enzyme for the production of ethanol selected from a group consis ting of pyruvate decarboxylases and alcohol dehydrogenases; and wherein

ii. the second nucleotide sequence for the expression of a physical characteristic enabling a global spatial or physical separation of the metaboiicaHy enhanced cells in a eel! culture from other cells encodes at least one polypeptide for the production of a gas vesicle.

37. A metabo!ical!y enhanced cell according to claim 25, further comprising first promoter element, wherein the first promoter element regulates the first nucleotide sequence and the second micieotide sequence.

38. A metaboiicaH enhanced cell according to claim 25, further comprising at least first promoter element and a second promoter element, wherein at least one ORF of the first nucleotide sequence is regulated by the at least first promoter element and at least one ORF of the second nucleotide sequence is regulated by the second promoter element.

39. A metaboiicaHy enhanced cell according to claim 25, further composing a

constitutive promoter element, wherein the first nucleotide sequence and the second nucleotide sequence are regulated by the constitutive promoter element,

40. A metaboiicaHy enhanced cell according to claim 25, further comprising at least a first promoter element, wherein the first nucleotide sequence and the second nucleotide sequence are independently regulated by the at least first promoter element. The metabolicaUy enhanced cell according to claim 25, .further comprising an. inducible promoter element, wherein the first nucleotide sequenee and the second nucleotide sequence are regulated by the inducible promoter element

A .metabolicaUy enhanced cell according to claim.25, further comprising at least one promoter element, wherein the promoter element for the first nucleotide sequence and the promoter element for the second .nucleotide sequence are the same.

A metaholkaily enhanced cell according to claim 25, further comprising at least one promoter element, wherein the promoter element for the first nucleotide sequence and the promoter element for the second nucleotide sequence are different,

A metabolic-ally enhanced cell according to claim 25, further comprising a first promoter element for the transcriptionai control of the first nucleotide sequence encoding at least one polypeptide for the production of the product of interest and the second nucleotide sequence encoding at least one polypeptide for the

expression of a physical characteristic enabling a spatial or physical separation of the metabolicaUy enhanced ceils in a cell culture from other cells, wherein i the first nucleotide sequence encoding at least one polypeptide for the produc tion of the product of interest is for eihanol production and is selected from the group consisting of ad A, pdc, adhl, adhl f and adhE;

it . the second nucleotide sequence encoding at least one polypeptide for the expression of a physical characteristic enabling a spatial or physical separation of the metabolicaliy enhanced cells in a cell cul ture from other cells is for buoyancy or production of a gas vesicle and is selected from the group consisting o gv A, gvpB, gvpC, gvpF, gvpG, gvpj, .gvpK, gvpL, gvpN, gvpR, gvpS, gvpT and gvpU; and

iii. the promoter element for the transcriptional control, of the first gene and the second gene is selected from the group consisting of PrbcL, PnblA, Ppetf PntcA, PisiA, PpetE, PggpS, PpsbA2, PpsaA, PsigB. PlrtA, PhtpG, PnirA, PhspA, PclpB l , PhUB, Pr c, and PcrhC.

45, A metaholkallv enhanced cell accordirm to claim 44 wherein the second

nucleotide sequence encodes at least one polypeptide selected from the group consisting of SEQ ID NOs: 1 1-23.

46, A metaboMcaHy enhanced cell according to claim 44 wherein the at least one polypeptide sequence has more than 90% identity to any of the polypeptides selected from the group consisting of SEQ ID NOs; 3 1 -23,

47. A metabolic-ally enhanced cell according to claim 26, further comprising a first promoter element, wherein the first promoier element controls the transcription of both the at least one gene encoding at least one polypeptide for the production of the product of interest and the at least one gene encoding at least one polypeptide for the expression of a physical charac teristic enabling a spatial or physical separation of the metabolicaliy enhanced cells hi a cell culture from other cells.

48. A metabolically enhanced cell according to any of claim 26, further comprising at least one promoter element that controls the transcription of the at least one gene encoding at least one polypeptide for the production of the product of interest and at least one promoter element that controls the transcription of the second n o iiucleoiide sequence encoding at least one polypeptide for the expression, of a physical characteristic enabling -spatial or physical separation of the

metabohcally enhanced cells in a cell culture from other cells.

A metabolicaliy enhanced cell according to claim 26 wherein the second nucleotide sequence encoding at least one polypeptide for the expression of a physical characteristic enabling a spatial or physical separation of the

metabolic-ally enhanced cells in a cell culture from other cells is isolated from the microorganisms selected from the group consisting of. Arthnmema, Lyngbya, Bacillus, Arthrospira_^ Planktothrix, Pseudoanabaen , Oseillatorm, Nostoc, Qctadec b eter, Ha bacterium, Halof rax, Spirulina, Synechococem and

Dotichospermum.

A metabolic-ally enhanced cell according to claim 25, wherein, the second nucleotide sequence for the expression of a physical characteristic enabl ing a spatial or physical separation of the metabohcally enhanced cells in a cell culture from other cells is isolated .from the microorganisms selected from the group consisting of Arihrortema, Lyngbya, Bacillus, Arthrospira, Plankiothrix,

Pseudocwabaem_s Qscilhtoria, Nostoc, Octadeeabacter, Habbacterium., Ha ferax, Spindma, Synechococcus and Doiickospermum.

The metaboHcaUy enhanced cell according to claim 25 that produces a product of interest comprising at. least one heterologous DN A molecule, wherein the at least one heterologous DNA molecule further comprises a third nucleotide sequence encoding a selectable or screenable marker. A method for differentiating metabolically enhanced cells that produce a product of interest from other cells that do not produce the product of interest, comprising: i. cui taring metabolically enhanced cells that comprise a first nucleotide sequence for the production of the product of interest and a second nucleotide sequence; wherein the other cells that do not produce the product of interest do not comprise the second nucleotide sequence, and ii. expressing in the metabolically enhanced cells, the second nucleotide sequence for the expression of a physical characteristic enabl ing a spatial or physical separation of the metabolically enhanced cells in a cell culture from the other cel ls.

The method of claim 52„ wherein the metabolic-all enhanced cells are autotrophic cells., photoauioirophie ceils, photoheterotrophic cells or chemoautotrophic cells. The method of claim 52, wherein the metabolically enhanced cells are

cyanobacteria.

A .method according to any one of the preceding claims, wherein expressing in the metabolicall enhanced cells, the second nucleotide sequence for the expression of a physical characteristic enabling a spatial or physical separation of the

metabolically enhanced cells in a cell culture from the other cells, confers altered buoyancy.

A method according to any one of the preceding claims, wherein expressing in the metabolically enhanced cells, the second nucleotide sequence for the expression of a phy sical characteristic enabling a spatial or physical separation of the metabolically enhanced ceils in a cell culture from the other cells comets production of a gas vesicle,

57. A method according to any one of the preceding claims, further -comprising

cuhuring the metabolically enhanced cells in. a medium contained m a bioreactor.

58. The method of claim 57., wherein the bioreactor is a photohioreactor .

59. The method of claim 57, wherein the metabolically enhanced cells remain closer to the surface of the medium than the other cells that do not produce the product of interest.

60. The method of claim 57, wherein the metabolic-ally enhanced cells and the other cells that do not produce- the product of interest stratify into bands or layers,

61. The method according to claim 59 or 60, wherein the metabolically enhanced cells settle to the bottom of the bioreactor at a slower .rate than the other cells that do not produce the product of interest.

62. The method according to claim 59 or 60, further comprising removing the other cells that do not produce the product of interest from the bioreactor through a. drain formed in the bottom of the bioreactor.

63. The method according to claim 59 or 60, wherein the other cells that do not produce the product of interest settle to the bottom of the bioreactor and remain on the bottom of the bioreactor .

64. A method according to any of the preceding claims, which further comprises flowing the medium over at least one baffle.

65. A system for separating metabolically enhanced cells that produce a product of interest .from cells that do not produce the product of interest comprising: i, a bioreactor;

ii. a holding vessel

iii. a baffle disposed hi the holding vessel;

iv, flow connectors connecting the bioreactor with the holding vessel;

v, a medium, containing metaboiicaiiy enhanced cells that produce a product of interest and produce gas vesicles and containing cells that do not produce the product of interest and do not produce gas vesicles; and vi. a pump adapted to induce flow of the medium between the bioreactor and the holding vessel and over the baffle.

66. A system for separating metaboiicaiiy enhanced cells that produce a product of interest from cells that do not produce the product of interest comprising;

i. a bioreactor; and

ii a medium containing metaboiicaiiy enhanced cells that produce a product of interest and produce gas vesicles and containing ceils that do not produce the product of interest and do not produce gas vesicles, wherein the cells that do not produce the product of interest settle to the bottom of the bioreactor.

67. A system for separating metaboiicaiiy enhanced cells that produce a product of interest from ceils that do not produce the product of interest, which comprises a medium comprising metaboiicaiiy enhanced cells that produce a product of interest and produce gas vesicles and cells that do not produce the product of interest and do not produce gas vesicles and a partial obstruction, wherein the medium flows over the partial obstruction. A method of culturing the metabolically enhanced cells according to claim 25 comprising the method steps of:

1. transforming autotrophic cells with fee heterologous DNA molecule; il. transferring the trans.tbr.med autotrophic cells to a culture medium in. a bioreacior;

iii expressing the first nucleotide sequence in the autotrophic cells for the productio of the produc t of interest;

iv. expressing the second nucleotide sequence in the autotrophic cells for the expression of a physical characteristic enabling a spatial or physical separation of the metabolically enhanced cells in a cell culture from other cells; and

v. transferring a portion of the autotrophic ce lls from the ^'bioreacior to a holding vessel.

A method of culturing the metabolically enhanced cells according claim 25 comprising the method steps of:

i. transforming autotrophic cells with the at least one heterologous DNA. molecule;

ii. transferring the transformed, autotrophic cells to a bioreacior;

iii. expressing the first nucleotide sequence in the autotrophic cells for the production of the product of interest;

iv. expressing the second nucleotide sequence in the autotrophic cells for the expression of a physical characteristic enabling a spatial or physical separation of the metabolicaily enhanced cells fn a cell culture from other cells;

v. transferring a portion of the autotrophic ceils from the bioreactor to a holding vessel; and

vi. returning a portion of the liquid comprising autotrophic ceils from the holding vessel to the bioreactor.

The method according to any of the claims 68 or 69, wherein during method step v. the portion of the autotrophic cells is transferred to the holding vessel by traasferring an upper portion , band, stratum or layer of the medi um, which is closer to the surface of the medium.

The method according to arty of the claims 68 or 69, wherein during method step v. the portion of the autotrophic cells is transferred to the holding vessel by transferring a base porti on, band, stratum or layer of the medium, which is closer to the bottom of the medium.

A method of cu.Huriivg the metabolicaily enhanced cells according to claim 25, comprising the method steps of:

i, transforming autotrophic cells with the heterologous DNA molecule; ii. transferring the transformed, autotrophic cells to a culture medium in a bioreactor;

.lit. expressing the first nucleotide sequence in the autotrophic cells for the production of the product of interest; and

iv. expressing the second nucleotide sequence in the autotrophic ceils for the expression of a physical characteristic enabling a spatial, or physical separation of the metabolically enhanced cells in a cell culture from other cells, wherein ihe other cells settle to the bottom of the bioreactor.

A method for producing a product of interest comprising culmring metabolically enhanced cells comprising a first nucleotide sequence for the production of a product of interest and a second nucleotide sequence for the expression of a physical characteristic enabling a spatial or physical separadon of the

metabolically enhanced cells in a cell culture from other cells not harboring the first nucleotide sequence for the produciiori of a product of interest, wherein the metabolically enhanced ceils produce the product of interest while being cultured.

1 1 ?