KR101428799B1 - A recombinant industrial yeast having auxotrophic marker, a recombinant yeast producing ethanol from pentose and hexose prepared by using the yeast, and a method for producing ethanol from pentose and hexose using the same - Google Patents

Abstract

The present invention relates to a recombinant yeast having an auxotrophic selectable marker for uracil inactivated by the activity of the ura3 gene, a method for producing a recombinant strain using the recombinant yeast, and a method for producing an oligosaccharide- An industrial recombinant yeast capable of fermenting a saccharified saccharide, and a method for producing ethanol in a medium containing pentose and hexose saccharide in high yield using the same.

Description

Technical Field [0001] The present invention relates to a recombinant industrial yeast having an auxotrophic marker, a pentose sugar and a recombinant yeast capable of fermenting the hexose sugar, and a method for producing ethanol from a pentose and a hexose sugar using the recombinant industrial yeast having a auxotrophic marker producing ethanol from pentose and hexose prepared by using the yeast, and a method for producing ethanol from pentose and hexose using the same}

The present invention relates to an industrial yeast strain for gene recombination having a nutritional requirement marker due to gene deletion so as to facilitate gene recombination, a method for producing a recombinant strain using the yeast strain, and a method for producing an oligosaccharide A recombinant yeast strain, and a method for producing ethanol using the same.

Recently, environmental problems and securing energy resources have stimulated interest in bioethanol as an alternative energy source. Worldwide, the production of bioethanol also increases every year, securing its position as an alternative energy source for transportation fuels. In Korea, demonstration of the application of bioethanol has been carried out, and meetings and policies on the implementation of the RFS have been prepared.

Bioethanol is a biofuel produced by fermentation of microorganisms. Yeast is mainly used. The reason for this is that it has been used for the longest period of ethanol fermentation easily and is industrially easy because it has excellent resistance and stability against various inhibitions. For this reason, the selection and improvement of yeast strains suitable for each industrial field have been reported. In recent years, according to the development of recombinant DNA technology, many studies on the production of recombinant proteins and biochemical production using yeast are underway. Nevertheless, most of the recombinant yeasts reported so far are at the laboratory level only and do not show the stability and productivity of the industrial yeast level. On the other hand, the industrial yeasts that have been used in the past are those in which the nuclear bodies are diploid, triple, It is known that yeast is difficult to recombine to give other characteristics.

One of the important factors to consider in bioethanol production using recombinant yeast is the introduction of appropriate selection markers.

The most commonly used selectable marker in microbial genetic recombination is the antibiotic resistance gene. A host cell carrying an antibiotic resistance gene can grow in a medium supplemented with an antibiotic that can be degraded by the antibiotic resistant gene product, but the cells that do not have the antibiotic resistance gene are killed by the antibiotic, so that the microorganism can be selected. However, the presence of antibiotic resistance genes in microorganisms has led to environmental, regulatory, and commercial problems and has been identified as a potential risk to biological safety. Also, in the case of yeast, widely used antibiotic markers are limited, and the selection sensitivity is different according to each strain, so there are many restrictions on the use of antibiotic markers.

Thus, nutritional screening markers were developed as an alternative to antibiotic screening. In particular, since yeast has a limited range of widely used antibiotic markers, and the sensitivity of selection varies widely with each strain, universal laboratories and laboratories use genetic defects of protein biosynthetic genes in yeast, . However, in the case of industrial yeast recombination, it is difficult to genetically manipulate yeast due to the characteristics of polyploidy. Thus, there is a limitation in development of excellent industrial strains, and selection marker for antibiotic resistance is still used, . Therefore, the need for a primary recombinant yeast-based technology such as the insertion of recombinant selection markers into industrial yeast is highlighted.

Another important factor to consider in bioethanol production using recombinant yeast is to increase the availability of fermentation substrates.

Studies on the production of bioethanol using recombinant yeast have recently focused on the pentose fermentation that can improve the ethanol fermentation yield in relation to the second generation bioethanol production using the fibrous biomass. Most of the pretreated fibrous biomass is converted to glucose, but xylose is also occupied by more than 10%, so that total ethanol production and fermentation yield can be improved by using xylose.

However, Saccharomyces cerevisiae strain, which is a yeast widely used for ethanol fermentation, is excellent in the metabolism efficiency of chitosan sugar such as glucose, but fermentation of pentose sugar such as xylose is impossible. In order to convert xylose to ethanol, fermentation using Pichia spp. Or Candida spp., Which is a yeast capable of fermenting pentose, has been attempted. However, fermentation such as Saccharomyces cerevisiae It is difficult to find a strain with high yield and yield. In addition, methods in which xylose fermentation is enabled by inserting a gene related to metabolism of xylose into Saccharomyces cerevisiae is not available for industrial use because the yield and productivity of fermentation are insufficient for industrial yeast.

Therefore, in the sugar ethanol fermentation industry, it is urgently required to develop an industrial yeast in which a selection marker is introduced so as to facilitate gene recombination, and an industrially recombinant yeast capable of fermenting pentane sugar and hexane sugar to improve the yield of ethanol fermentation.

Therefore, the inventors of the present invention found that the ura3 gene involved in the biosynthesis of uracil through the gene deletion method using homologous recombination was introduced into the Saccharomyces cerevisiae CHY1011 strain (Korean Patent Registration No. 10-0955945) Inactivating yeast CHY1001 having auxotrophic selectable markers for uracil was prepared. Further, in the CHY1001 strain, the xylose isomerase (XI) related to xylem metabolism and the xylulose isomerase kinase, XK) was codon-optimized to produce an industrial ethanol-fermenting yeast CHY1002x having an ethanol-efficacious effect of pentose sugar, thereby completing the present invention.

It is an object of the present invention to provide an industrial yeast strain having an auxotrophic selectable marker so as to enable industrially various gene recombination, and to provide a high yield recombinant yeast capable of fermenting ethanol of xylose using the strain. It is another object of the present invention to provide a method for producing ethanol at a high yield through fermentation of xylose in a fermentation medium containing xylose.

Specifically, one object of the present invention is to provide a strain of Saccharomyces cerevisiae CHY1001 (Accession No. KCTC 12179BP) which is an industrial yeast for gene recombination, in which the ura3 gene is inactivated to have auxotrophic selection markers for uracil .

It is another object of the present invention to provide a method for producing a recombinant strain, which comprises introducing a ura3 gene and a foreign gene into the strain.

It is still another object of the present invention to provide a method for screening a ura3 gene, a gene encoding xylose isomerase, and a gene encoding xylulose kinase in a strain of Saccharomyces cerevisiae CHY1001 (Accession No. KCTC 12179BP) Which is capable of fermenting the pentose and the saccharified saccharomyces cerevisiae strain into which the gene coding for the saccharomyces cerevisiae is introduced.

It is another object of the present invention to provide a method for producing the Saccharomyces cerevisiae CHY1002x strain.

It is another object of the present invention to provide a composition for producing ethanol comprising the strain Saccharomyces cerevisiae CHY1002x.

It is another object of the present invention to provide a method for producing ethanol comprising culturing the strain in a culture medium containing pentose, or pentose and hexose.

In one embodiment, the present invention relates to Saccharomyces cerevisiae KCTC 12179BP strain, a recombinant industrial yeast strain in which the ura3 gene is inactivated to have auxotrophic selection markers for uracil.

The term " auxotrophy "as used herein refers to a cell that has been modified to eliminate or reduce the ability to produce a particular substance required for growth and metabolism. In contrast, "prototrophy" refers to a cell capable of producing a specific substance required for growth and metabolism.

In the present invention, "ura3 gene" is a structural gene encoding 5-phosphate decarboxylase of pyrimidine biosynthesis system, preferably having the nucleotide sequence of SEQ ID NO: 1.

The term "inactive" in the present invention means a state in which a mutation such as deletion, insertion, substitution, inversion, or redundancy occurs in a part or whole of a gene and the activity of the microorganism in its natural state is lost or decreased. For the purpose of the present invention, the inactivation of the ura3 gene means a state in which a mutation occurs in a part or all of the ura3 gene to obtain nutritional requirements for uracil.

In a vector system using a yeast strain, a nutritional requirement marker using a gene related to the biosynthesis of an essential amino acid is preferable to a selection marker using an antibiotic resistance gene conventionally used in bacterial gene recombination. In the present invention, the ura3 gene was targeted to introduce a selection marker to industrial yeast.

When the mutation occurs in the ura3 gene, it shows the nutritional requirement for uracil and the 5-fluoro-orotic acid (5-FOA) resistance mutant. Thus, strains with the ura3 gene mutation can not grow on the media from which uracil is removed, but growth can be achieved even with 5-FOA in media containing uracil. On the other hand, strains having ura3 activity can grow in the medium from which uracil is removed, but when 5-FOA is added to the medium in which uracil is present, 5-FOA acts as 5-fluorouracil (5- fluorouracil), so that the growth of the strain is impossible.

Therefore, the strain in which the ura3 gene is inactivated in the present invention is suitable as a host strain for gene recombination since it is easy to select using 5-FOA and uracil.

Preferably, the ura3 auxotrophic strains of the present invention are obtained by introducing the ura3 gene deletion cassette into the strain Saccharomyces cerevisiae CHY1011 (domestic patent registration 10-0955945), which is a yeast for high productivity ethanol fermentation industry, And by inactivating the ura3 gene through a gene deletion method.

The host strain Saccharomyces cerevisiae CHY1011 strain is a strain provided by the present inventors in accordance with Korean Patent Registration No. 10-0955945 and is represented by Accession No. KCTC 11250BP and is isolated from the soil of the ethanol production plant and can be dissolved in ethanol It is an excellent strain. Wherein the CHY1011 strain is ellipsoidal, flowable anaerobically and has a growth temperature of 10 to 45 DEG C, a growth pH of 2.5 to 7, an optimum fermentation temperature of 30 to 40 DEG C and a fermentation ratio of 80% to 95% to be. Korean Patent Registration No. 10-0955945 for strain CHY1011 is incorporated herein by reference in its entirety.

In a specific example of the present invention, a pYE-UKO vector was prepared by inserting a 1.3 kbp gene fragment into the ura3 gene region of pYX12 (Chonbuk National University), which is a shuttle vector containing the ura3 gene, The PCR product was purified and recovered using primer No. 8 and Pfu polymerase, and a homologous sequence of about 100 bp or more was added to both ends of the ura3 gene to enable homologous recombination. The ura3 gene A deficient cassette (SEQ ID NO: 2) was prepared. Subsequently, the ura3 gene-deficient cassette was transformed into CHY1011 strain, and genetic defects by homologous crossing were induced to obtain a mutant strain in which the ura3 gene was inactivated.

The present inventors confirmed by PCR that the ura3 gene-deficient cassette was successfully transformed and homologous to the above strain, and that the mutant strain had a nutritional requirement for uracil and 5-FOA resistance (Fig. 2) (Fig. 3). Further, it was confirmed that when the vector containing the ura3 gene was inserted into the mutant strain, normal growth was possible in the minimal medium by the ura3 gene compensation (Fig. 4).

Therefore, the present inventors named CHY1001 as a mutant strain in which the ura3 gene was inactivated, and deposited this on April 4, 2012 at the Korea Research Institute of Bioscience and Biotechnology, located at No. 125, Science Route, Yuseong-Gu, Daejeon Metropolitan City and received the accession number KCTC 12179BP .

As described above, the Saccharomyces cerevisiae CHY1001 strain having the uracil auxotrophic selectable marker is industrially useful for production of recombinant protein through gene recombination and specific metabolism manipulation, so that it can be used as an expression host for genetic recombination have.

Accordingly, as another embodiment, the present invention relates to a method for producing a recombinant strain comprising the step of introducing a ura3 gene and a foreign gene into the CHY1001 strain.

The present invention provides a method for producing various recombinant strains using Saccharomyces cerevisiae CHY1001 strain having the urasin auxotrophic selection marker as described above.

The term "foreign gene" or "objective gene" in the present invention means a gene derived from a strain other than an exogenous or host strain not belonging to the host strain, or a genetically modified form from its native form, The gene encodes the polypeptide with the specific target nucleic acid to be transcribed. For the purpose of the present invention, preferably, the foreign gene may be useful genes related to ethanol fermentation and production so that the productivity of CHY1001 strain can be further improved, An example is a gene encoding an enzyme involved in the ethanol fermentation pathway. In a specific embodiment of the present invention, a gene coding for xylose isomerase and xylulose kinase is introduced, but various foreign genes can be introduced in addition to the gene encoding xylose isomerase and xylulose kinase.

The introduction of the ura3 gene in the present invention is intended to restore the original nutritional status of the strain by the ura3 gene compensation in the CHY1001 strain. Preferably, prior to the introduction of the ura3 gene and the foreign gene, the CHY1001 strain lacking the ura3 gene is cultured and maintained in a medium supplementing nutritional requirements such as uracil-added medium. After introduction of the ura3 gene and the foreign gene, And then cultured in the removed medium. In this case, the host strains in which the ura3 gene and the foreign gene are not successfully introduced can still be screened for the recombinant strain in this manner because the ura3 gene is still deficient and can not grow in the uracil-free medium have.

The ura3 gene and the foreign gene may be introduced into the CHY1001 strain while being inserted into the vector. Various vectors such as a plasmid, a virus, and a cosmid may be used as the vector. The recombinant vector includes a cloning vector and an expression vector. The recombinant vector comprises an essential regulatory element operably linked to the expression of the ura3 gene and the foreign gene in the host cell and includes, for example, a promoter, an initiation codon, a gene encoding the desired protein, a termination codon and a terminator . In addition, DNA encoding the signal peptide, an enhancer sequence, a comparative marker region at the 5 'end and the 3' end of the desired gene, a selectable marker region, or a replicable unit may suitably be contained.

Methods for introducing ura3 gene and foreign gene include calcium phosphate method or calcium chloride / rubidium chloride method, lithium acetate method, electroporation, electroinjection, chemical treatment such as PEG, gun), which are widely used in the art.

In a preferred embodiment of the present invention, the gene coding for xylose isomerase and xylulose kinase associated with xylose metabolism, together with the ura3 gene, is introduced into the CHY1001 strain having the uracil auxotrophic selection marker as described above, Provides industrial ethanol-fermented yeast CHY1002x with added efficacy.

Accordingly, in another aspect, the present invention provides a method for producing a mutant strain of Saccharomyces cerevisiae CHY1001, which comprises introducing a ura3 gene, a gene encoding xylose isomerase, and a gene coding for xylulose kinase, The present invention relates to a strain of Saccharomyces cerevisiae capable of fermentation. Preferably, the strain is Saccharomyces cerevisiae CHY1002x strain with accession number KCTC 12180BP.

The present invention also relates to a method for producing a recombinant vector of Saccharomyces cerevisiae CHY1001 comprising transforming a vector comprising a ura3 gene, a gene encoding xylose isomerase and a gene encoding xylulose kinase, And a method for producing a Saccharomyces cerevisiae strain capable of fermenting the saccharified saccharin. Preferably, the strain is Saccharomyces cerevisiae CHY1002x strain with accession number KCTC 12180BP.

In the present invention, "ethanol fermentation" means fermentation in which sugar is decomposed by carbon dioxide and ethanol by yeast. Saccharomyces cerevisiae, a yeast widely used for ethanol fermentation, has excellent chitosan metabolism efficiency such as glucose, but fermentation of pentose sugar such as xylose is impossible. Therefore, in order to provide industrially recombinant yeast capable of ethanol fermentation at high yield using not only hexose but also oligosaccharide such as xylose as a substrate, a gene coding for xylose isomerase and a gene encoding xylulose isomerase in CHY1001 strain Lt; / RTI >

In the present invention, "xylose" is a major constituent of hemicellulose, which is a non-cellulose polysaccharide constituting 10 to 40% of biomass constituting plant cell walls. It is a biomass obtained from wood or agricultural by- It is the saccharide that exists. The D-xylose metabolic pathway of prokaryotes and eukaryotes is converted to D-xylulose-5-phosphate by D-xylulose through different metabolic pathways at an early stage.

In the present invention, "xylose isomerase" is an enzyme that catalyzes the isomerization reaction between xylose and xylulose. Bacterial-derived xylose isomerase is known to be an efficient metabolic process because it can convert xylose to xylulose without accumulating xylitol as an intermediate metabolite. However, when expressed in yeast, There are many limitations on expression and protein activity due to differences. Therefore, in the present invention, it is preferable that the gene coding for xylose isomerase is changed to a codon frequently used in S. cerevisiae by codon optimization, more preferably the nucleotide sequence of SEQ ID NO: 3 Can be used.

In the present invention, "xylulose kinase" is an enzyme that catalyzes a conversion reaction between D-xylulose and D-xylulose-5-phosphate whereby D-xylulose is phosphorylated, Ethanol production takes place via the EMP pathway. In the present invention, the nucleotide sequence of SEQ ID NO: 4 derived from Saccharomyces cerevisiae can be used to introduce a gene encoding xylulose kinase into the CHY1001 strain.

In a specific embodiment of the present invention, a codon-optimized xylose isomerase gene (SEQ ID NO: 3) and a xylulose kinase gene derived from S. cerevisiae (sequence No. 4), respectively, to prepare a recombinant vector pYXIXKopt containing both the ura3 gene, the xylose isomerase gene and the xylulose kinase gene (Fig. 5) and introduced into the ura3 deletion yeast CHY1001 obtained above.

The present inventors confirmed that the recombinant yeast into which pYXIXKopt was introduced produced ethanol while consuming not only glucose as a chitin but also xylose as a pentose, and produced 13.1 g / L of ethanol in comparison with CHY1011 as a parent strain. (Fig. 6).

Therefore, the present inventors named CHY1002x as the strain obtained the above-mentioned osteogenic effect and deposited this on Apr. 4, 2012 at the Korea Biotechnology Research Institute located at No. 125, Science Route, Yuseong-Gu, Daejeon Metropolitan City and granted the accession number KCTC 12180BP received. The above-mentioned strain can metabolize xylose, which is a pentane sugar as well as a hexane, industrially and can be usefully used for industrial production of ethanol by increasing ethanol production.

Accordingly, in another aspect, the present invention provides a method for producing a strain of Saccharomyces cerevisiae strain CHY1001, comprising the step of culturing the ura3 gene, the gene encoding xylose isomerase, and the gene encoding xylulose kinase, And culturing the strain of Leviathiae in a medium containing pentose, or pentose and hexose.

The present invention also relates to a composition for producing ethanol comprising the above-mentioned Saccharomyces cerevisiae strain.

Preferably, the strain is Saccharomyces cerevisiae CHY1002x strain with accession number KCTC 12180BP.

The present invention provides a high yield ethanol production method using the recombinant yeast CHY1002x, wherein the fermentation medium containing xylose is capable of additionally fermenting xylose, which is a saccharide, as well as glucose as a saccharide.

The cultivation can be carried out according to well-known methods, and the conditions such as the culture temperature, the culture time and the pH of the culture medium can be appropriately adjusted. In addition, the culture method includes a batch culture, a cintinuous culture and a fed-batch culture, preferably by a semi-continuous or continuous production process, But is not limited thereto. For example, the semi-continuous or continuous process may be an ethanol production process including a pretreatment process, a saccharification process, a fermentation process, and a purification process of the fibrous biomass.

 The pretreatment of the fibrous biomass may be carried out by adjusting the appropriate temperature and time using a pretreatment liquid such as sodium hydroxide, ammonia, diluted hydrochloric acid, sulfuric acid, etc. The saccharification process is a process in which the pretreated biomass is heated in the saccharification tank And by enzymatic hydrolysis with controlled time.

The fermentation process may be to perform ethanol fermentation using the saccharomyces cerevisiae. In the fermentation process, the saccharified fiber is fermented, and in the case of the non-saccharified fiber, saccharification continues. The saccharification step and the fermentation step can be performed simultaneously using the properties of the yeast. In addition, in the case of the fermentation process, the saccharification process can be omitted because not only fermentation but also saccharification proceed.

In addition, as a specific example of the above-mentioned production method, a substrate containing at least one selected from the group consisting of starch, sugar, fiber and glucose is semi-continuously or continuously supplied into an ethanol fermentation tank, and the substrate and saccharomyces cerevisiae The process according to any of the preceding claims, characterized in that the method comprises the step of performing ethanol fermentation using CHY1002x to produce ethanol and semi-continuous or continuous release of the ethanol-containing fermentation broth, and the saccharomyces cerevisiae CHY1002x It can be used.

The method for recovering ethanol can be carried out by separating ethanol from a cell or a culture medium by a method widely known in the art. Examples of the ethanol recovery method include distillation, filtration, chromatography, and HPLC. However, the present invention is not limited to these examples.

The present invention provides industrially useful yeast hosts that can use the ura3 gene as a selection marker for gene recombination, and thus production of recombinant proteins and specific metabolism manipulation are industrially useful. The present invention also provides a recombinant yeast in which an ethanol fermentation-related gene of xylose is inserted using this host, so that it is industrially useful for the industrial production of ethanol because it can metabolize xylose, which is a pentose as well as a hexane, and increase ethanol production .

Fig. 1 (A) shows the results of PCR for the ura3 gene using the primers of SEQ ID NO: 1 and SEQ ID NO: 2. Fig. 1 (B) shows the result of confirming the PCR products of the ura3-deficient cassette using the primers of SEQ ID NO: 3 and SEQ ID NO: 4. lane 1 is the PCR product using the cDNA of S. cerevisiae CHY1011, lane 2 is the PCR product using the pYX12 vector having the ura3 gene as a control, lane 3 is the PCR product for the ura3 deletion cassette, lane M is the PCR product, Represents a 1 kb ladder marker.
FIG. 2 (A) shows the result of confirming the homology crossing of the ura3 gene using the primers of SEQ ID NO: 1 and SEQ ID NO: 2 through PCR products. Fig. 2 (B) shows the result of confirming the homology crossing of the ura3 gene using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 through PCR products. lane M represents a 1 kb ladder marker, lane 1 represents a PCR product using the cDNA of the gene deletion strain CHY1011 / ura- as a template, and lane 2 and 3 represent PCR products using the cDNA of the control strain CHY1011 as a template.
FIG. 3 shows the result of confirming the nutritional composition of uracil of the finally selected deficient yeast (CHY1011 / ura-). (A) shows the results in the minimal medium MM + 5-FOA (uracil added) medium and (B) in the MM (uracil added) medium.
Fig. 4 shows the result of confirming the transformation of the plasmid by the ura3 gene compensation of the finally selected deletion yeast (CHY1011 / ura-). (A) shows the result of spiking the CHY1011 / ura-strain on the minimal medium (MM) as a control for transformation, (B) transforms the plasmid using the ura3 gene as a selection marker in CHY1011 / ura- MM medium.
5 shows a schematic diagram of the production process of the xylose metabolism-related gene recombination vector pYXIXKopt.
6 is a graph showing the metabolism of glucose and xylose and the production of ethanol by comparing the recombinant yeast CHY1002x of the present invention with the control strain CHY1011.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  One. ura  3 gene defect Cassette  making

Since the industrial high productivity ethanol fermenting yeast CHY1011 (Accession No. KCTC 11250BP) used in the present invention is not genomic sequenced and has no information on the ura3 gene, it has been previously identified as Saccharomyces cerevisiae (Korean Patent No. 10- 0955945), the ura3 gene sequence was referred to using the Saccharomyces cerevisiae base sequence in the NCBI database. To confirm whether the ura3 gene exists in yeast CHY1011 in the same manner, ura3 gene cloning primers (SEQ ID NOS: 5 and 6) were prepared, and it was confirmed by PCR that the gene was also present in the sugar yeast.

SEQ ID NO: 5: 5'- GAATTCTTGTGAGTTTAGTATACA -3 '

SEQ ID NO: 6: 5'-GAATTCCGGTAATCTCCGAACAGA -3 '

Then, to construct a vector pYE-UKO containing the ura3 gene-deficient cassette, the ura3 gene of pYX12 (Chonbuk National University) was used, and the gene fragment of about 1.3 kb for inactivating the ura3 gene using Apa I site inside the ura3 gene Was inserted. The gene fragment was amplified by PCR by adding Apa I restriction site at both ends of the clone. The amplified DNA fragments were purified and recovered, treated with Apa I restriction enzyme, and ligated with the same enzyme-treated pYX12 vector to construct pYE-UKO vector. The ura3 gene-deficient cassette was purified by PCR using the primers of SEQ ID NO: 7 and SEQ ID NO: 8 and Pfu polymerase using the pYE-UKO vector as a template, followed by purification and recovery (FIG. In addition, the ura3 gene deletion cassette was prepared to have a homologous base sequence of about 100 bp so that homologous crossover with the ura3 gene occurs at both end regions. The nucleotide sequence of the cassette is shown in SEQ ID NO: 2.

SEQ ID NO: 7: 5'-CAGTACCCTTAGTATATT-3 '

SEQ ID NO: 8: 5'-TCTGTCTTCGAAGAGTA-3 '

Example  2. ura3  Fabrication of genetically-defective recombinant yeast

The CHY1011 strain (Korean Patent Registration No. 10-0955945) was not capable of genetically recombinant because it did not have a good yeast for ethanol fermentation industry or a selectable marker for recombination. Thus, Ure3 gene-deficient recombinant yeast strains were prepared using the gene-deficient cassette of Example 1 in order to introduce nutritional requirement markers for uracil, which can be used for gene recombination, for various industrial applications of CHY1011.

First, the ura3 gene deletion cassette prepared in Example 1 was used to induce transcriptional and homologous crossing-induced gene deletion by LiAc (lithium acetate) transformation, which is a chemical transformation method. YPD-5-FOA agar medium (yeast extract 1%, peptone 2%, glucose 2%, 5-FOA 0.1%, agar 2%) was cultured at 32 ° C for about 1 hour after the transformation. . After culturing in the selection medium for 2 to 3 days, the identified colonies were subcultured in another YPD-5-FOA medium 5 times or more using a sterilization tip so that the genetic defect of the recombinant strain was stably maintained. The final defective strain was amplified by PCR using SEQ ID NOs: 5 and 6 and SEQ ID NOs: 7 and 8 described in Example 1. The amplified fragments were compared with those of CHY1011 as shown in the following figure, and the ura3 gene Was increased by the length of the inserted DNA fragment (about 1.3 kb) (Figs. 2A and 2B).

Example  3. ura3  Gene-deficient yeast Nutritional requirements  Confirm

In order for the ura3-deficient strain obtained in Example 2 to be used for gene recombination, the nutritional requirement for uracil, which is an essential amino acid due to the inactivation of the ura3 gene, must be established. For this purpose, uracil (0.005%) and 5-FOA (0.1%) were added to a minimal medium (0.067% of casamino acid without amino acid (w / o aa), glucose 2%, agar 2% One medium and minimal medium without uracil were streaked with the control strains, respectively. The parent strain CHY1011 used as a control was not able to grow due to the activity of the ura3 gene in the FOA supplemented medium. In the minimal medium from which uracil was removed, the growth of the essential amino acid from the glucose was possible due to the activity of the ura3 gene. On the other hand, S2805 (ura-) strain (ura3 gene-deficient yeast, non-industrial yeast strain) and selective deletion strain (CHY1011 / ura-), widely used as laboratory strains, , But the growth was not possible in the minimal media from which uracil was removed. Thus, the nutritional composition of uracil of the screening strain CHY1011 / ura3- was confirmed (Figs. 3A and 3B).

In addition, when a vector containing the ura3 gene is inserted, since the ura3 gene can be compensated for, it can be used as a final recombinant selection marker if it can grow normally in a minimal medium. Therefore, Experiments were conducted. CHY1011 / ura- was transfected by LiAc transformation using pYES2 vector containing ura3 gene and plated on the minimal medium lacking uracil, the selection medium. As a control, CHY1011 / ura- was carried out in the same minimal medium with the same transformation method without vector. As a result, it was confirmed that the CHY1011 / pYES2 strain transformed with the pYES2 vector was selected as shown in Fig. 4A and Fig. 4B, while the control group CHY1011 / ura- was not grown in the minimal medium.

From this, the final selection candidate CHY1011 / ura- was confirmed to be genetically recombinant as an industrial yeast, and named Saccharomyces cerevisiae CHY1001 and deposited a patent with the Korea Biotechnology Research Institute (Accession No. KCTC 12179BP).

Example  4. Xylose  Metabolism-related gene recombination vector and recombinant yeast production

Bacterial-derived xylose isomerase (XI) was used to induce ethanol production using xylose from Saccharomyces cerevisiae. Bacterial-derived xylose isomerase has less effect on the redox balance than xylose and xylose metabolism, and it does not accumulate xylitol as an intermediate metabolite, but directly converts xylose to xylulose ), Which is known as an efficient metabolic process. However, this metabolic process has been reported to be restricted in expression and protein activity in yeast by using a gene derived from bacteria. Therefore, the gene coding for bacterial origin xylose isomerase was changed to codons frequently used in S. cerevisiae by codon optimization and used in the present invention. The codon optimization of XI was designed by using Genotech's codon optimization system.

The xylose metabolism-related gene recombination vector pYXIXKopt was constructed by introducing a codon-optimized XI gene (SEQ ID NO: 3) into the yeast-E. coli shuttle vector pYX12 vector and xylulose kinase (XK-sc) ) Is a gene-conjugated vector. The XI-opt gene and the XK-sc gene, which were codon-optimized using the gene synthesis service from bioneer, were synthesized. After treatment with the Bam H I and Xho I restriction enzymes from the synthesized pGEM-XI-opt and pGEM-XK-sc And ligated together with a shuttle vector treated with Bam H I restriction enzyme to complete the recombinant vector pYXIXKopt (FIG. 5).

The completed recombinant vector pYXIXKopt was introduced into the ura3-deficient yeast CHY1001 obtained above using the LiAc transformation method. The transformant was cultured on the minimal medium of uracil deficiency tested and incubated for 2 to 3 days at 32 ° C., and transformed to form a single colony . The selected transformants were subcultured more than 5 times in MMX agar medium (0.067% of casamino acid w / o aa, 2% of xylose, 2% of agar) supplemented with 2% of xylose instead of glucose, Were selected. The final recombinant yeast was identified as S. cerevisiae CHY1002x because it had a fermentation tendency to consume xylose in xylose-containing medium and convert it into ethanol, unlike parent strain CHY1001. (Accession No. KCTC 12180BP).

Example  5. Ethanol fermentation using pentose fermented recombinant yeast

Ethanol fermentation was confirmed using the xylose-containing medium as described below using the fermented yeast of xylose fermentation obtained in Example 4. The recombinant yeast CHY1002x and the control strain CHY1011 were inoculated in a 50 ml falcon tube containing 15 ml of YPGX (yeast extract 0.5%, peptone 0.5%, glucose 2.5%, xylose 2.5%) and cultured at 32 ° C for 14 hours. 150 ml of the same YPGX And then cultured for another 5 hours. This solution was used as the inoculum for the fermentation of omega-3-phosphate fermentation. The main fermentation was carried out in a 2L fermenter at 32 ° C inoculated with 1.5L of YPGX (yeast extract 1%, peptone 2%, glucose 2%, xylose 5%) inoculum. The stirring speed of the fermenter was fixed at 200 rpm and no air was injected. As a result, as shown in the following figure, 20 g / L of glucose consumed within 10 hours of both strains. Thereafter, the control strain CHY1011 had no additional consumption of xylose or ethanol production, while the recombinant yeast CHY1002x consumed xylose While ethanol was produced. In the medium containing 20 g / L of glucose and 50 g / L of xylose, the control strain CHY1011 only metabolized 20 g / L glucose to produce 9.3 g / L of ethanol due to restriction of sugar availability, and the recombinant yeast CHY1002x Consumed not only 20 g / L glucose but also xylose, producing a total of 22.4 g / L of ethanol. That is, it was confirmed that ethanol was additionally produced at 13.1 g / L compared to CHY1011 (FIG. 6). These results are expected to be very useful for the ethanol production from the fibrous biomass-based ethanol fermentation which has a starch-type starch-mixed starch-containing mixed sugar medium containing xylose partially.

Korea Biotechnology Research Institute KCTC12179BP 20120404 Korea Biotechnology Research Institute KCTC12180BP 20120404

<110> CHANGHAE ETHANOL CO., LTD. <120> A recombinant industrial yeast having auxotrophic marker, a          recombinant yeast producing ethanol from pentose and hexose          prepared by using the yeast, and a method for producing ethanol          from pentose and hexose using the same <130> DPP20121423 <160> 8 <170> Kopatentin 1.71 <210> 1 <211> 1107 <212> DNA <213> Saccharomyces cerevisiae <220> <221> gene (1). (1107) <223> ura3 gene <400> 1 gggtaataac tgatataatt aaattgaagc tctaatttgt gagtttagta tacatgcatt 60 tacttataat acagtttttt agttttgctg gccgcatctt ctcaaatatg cttcccagcc 120 tgcttttctg taacgttcac cctctacctt agcatccctt ccctttgcaa atagtcctct 180 tccaacaata ataatgtcag atcctgtaga gaccacatca tccacggttc tatactgttg 240 acccaatgcg tctcccttgt catctaaacc cacaccgggt gtcataatca accaatcgta 300 accttcatct cttccaccca tgtctctttg agcaataaag ccgataacaa aatctttgtc 360 gctcttcgca atgtcaacag tacccttagt atattctcca gtagataggg agcccttgca 420 tgacaattct gctaacatca aaaggcctct aggttccttt gttacttctt ctgccgcctg 480 cttcaaaccg ctaacaatac ctgggcccac cacaccgtgt gcattcgtaa tgtctgccca 540 ttctgctatt ctgtatacac ccgcagagta ctgcaatttg actgtattac caatgtcagc 600 aaatttttct gtcttcgaag agtaaaaatt gtacttggcg gataatgcct ttagcggctt 660 aactgtgccc tccatggaaa aatcagtcaa gatatccaca tgtgttttta gtaaacaaat 720 tttgggacct aatgcttcaa ctaactccag taattccttg gtggtacgaa catccaatga 780 agcacacaag tttgtttgct tttcgtgcat gatattaaat agcttggcag caacaggact 840 aggatgagta gcagcacgtt ccttatatgt agctttcgac atgatttatc ttcgtttcct 900 gcaggttttt gttctgtgca gttgggttaa gaatactggg caatttcatg tttcttcaac 960 actacatatg cgtatatata ccaatctaag tctgtgctcc ttccttcgtt cttccttctg 1020 ttcggagatt accgaatcaa aaaaatttca aagaaaccga aatcaaaaaa aagaataaaa 1080 aaaaaatgat gaattgaatt gaaaagc 1107 <210> 2 <211> 1527 <212> DNA <213> Artificial Sequence <220> <223> ura3 deletion cassette <400> 2 cagtaccctt agtatattct ccagtagata gggagccctt gcatgacaat tctgctaaca 60 tcaaaaggcc tctaggttcc tttgttactt cttctgccgc ctgcttcaaa ccgctaacaa 120 tacctgggcc cagccggcca gatctgagct cgcggccgcg atatcgctag ctcgagccca 180 cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt tctcggactc 240 cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt cccctctttc 300 ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg gaaaagaaaa aagagaccgc 360 ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt ttatcacgtt tctttttctt 420 gaaaattttt ttttttagtt tttttctctt tcgatgacct cccattgata tttaagttaa 480 taaacggtct tcaatttctc aagtttcagt ttcatttttc ttgttctatt acaacttttt 540 ttacttcttg ctcattagaa agaaagcata gcaatctaat ctaagggcgg cgttgacaat 600 taatcatcgg catagtatat cggcatagta taatacgaca aggtgaggaa ctaaaccatg 660 gccaagcctt tgtctcaaga agaatccacc ctcattgaaa gagcaacggc tacaatcaac 720 agcatcccca tctctgaaga ctacagcgtc gccagcgcag ctctctctag cgacggccgc 780 atcttcactg gtgtcaatgt atatcatttt actgggggac cttgtgcaga actcgtggtg 840 ctgggcactg ctgctgctgc ggcagctggc aacctgactt gtatcgtcgc gatcggaaat 900 ggaacaggg gcatcttgag cccctgcgga cggtgccgac aggtgcttct cgatctgcat 960 cctgggatca aagccatagt gaaggacagt gatggacagc cgacggcagt tgggattcgt 1020 gaattgctgc cctctggtta tgtgtgggag ggctaagcac ttcgtggccg aggagcagga 1080 ctgacacgtc cgacgcggcc cgacgggtcc gaggcctcgg agatccgtcc cccttttcct 1140 ttgtcgatat catgtaatta gttatgtcac gcttacattc acgccctccc cccacatccg 1200 ctctaaccga aaaggaagga gttagacaac ctgaagtcta ggtccctatt tattttttta 1260 tagttatgtt agtattaaga acgttattta tatttcaaat ttttcttttt tttctgtaca 1320 gacgcgtgta cgcatgtaac attatactga aaaccttgct tgagaaggtt ttgggacgct 1380 cgaaggcttt aatttgcaag ctgaagggcc caccacaccg tgtgcattcg taatgtctgc 1440 ccattctgct attctgtata cacccgcaga gtactgcaat ttgactgtat taccaatgtc 1500 agcaaatttt tctgtcttcg aagagta 1527 <210> 3 <211> 1317 <212> DNA <213> Clostridium phytofermentans <220> <221> gene &Lt; 222 > (1) .. (1317) <223> xylose isomerase (codon optimization) <400> 3 atgaaaaatt actttcccaa cgtccctgaa gtaaaatacg aaggccctaa ttcaacaaac 60 ccatttgctt ttaagtacta cgacgccaat aaagtcgttg cgggtaaaac aatgaaagaa 120 cactgtagat ttgcattatc ttggtggcac actctatgtg caggcggtgc tgatccattc 180 ggtgtaacca ccatggatag aacttacgga aatataacag atccaatgga attggctaag 240 gcaaaagttg acgctggttt cgaattaatg actaaactcg gaatagaatt cttctgtttt 300 catgacgcag atatagctcc ggaaggtgat acttttgaag agtcaaagaa gaatttattt 360 gaaatcgttg attacataaa agagaagatg gaccagactg gtatcaagtt attatggggg 420 acggcgaata acttttcaca tccaagattt atgcatggtg cttccacgtc ttgcaacgca 480 gacgtgtttg catatgcagc tgctaagatt aagaatgctt tagatgctac gattaaactg 540 ggcgggaagg gttatgtgtt ctggggtggt agggagggtt atgaaacatt attgaataca 600 gatttgggac ttgagcttga taatatggct agactcatga aaatggctgt cgaatatggc 660 cgtgcaaatg gtttcgatgg cgacttctat attgaaccaa aacctaaaga acctactaag 720 cccaatacg attttgatac agccaccgta cttgctttct tgagaaaata tggcctagaa 780 aaagatttca agatgaacat cgaagcaaat catgctactc tagcaggtca tacctttgaa 840 cacgaactgg caatggcgcg agttaatggt gcatttggct ctgttgatgc gaaccagggc 900 gatccaaacc taggatggga tacggatcaa tttcccactg atgttcatag tgcaactttg 960 gcaatgctgg aggttttgaa ggctggtgga ttcacaaatg gaggattgaa ctttgatgca 1020 aaagtcagac gtggttcctt cgagtttgat gatattgcct atggttatat tgccggaatg 1080 gatacttttg cattaggttt aattaaagct gctgagataa tcgacgacgg gagaattgca 1140 aaatttgttg acgacagata cgcaagctat aaaacaggaa ttggtaaagc aattgtagat 1200 gggactacat ctcttgaaga attagagcaa tatgttttaa cacatagtga acctgtgatg 1260 caatcgggta ggcaagaagt tttggaaaca atcgttaata atattttgtt tagataa 1317 <210> 4 <211> 1467 <212> DNA <213> Saccharomyces cerevisiae <220> <221> gene <222> (1). (1467) <223> xylulose kinase <400> 4 atgtattata ttggtgtgga tttgggaact tcttctgtga agttagtctt gatgaaggac 60 aatggtgaaa ttaccaaagt ggtctcaaaa gaatatgatt tatttttccc gaagactgga 120 tggtcggaac aaaatccagt ggattggtat aggcaatcag ttgcaggaat aaaagaatta 180 attagtgaca tcaagaacga agaagtagct ggtattagtt ttgggggaca gatgcatgga 240 cttgttatct tagatagtga tgatgaagtc cttagacctg ccattctgtg gaatgatggc 300 aggacaggag aagaatgcga ttatttaaac aatgtcattg gaagagaaaa aatatcccgc 360 tacacagcga atatggctct aactgggttt accgctccca aattattgtg ggttaaaaaa 420 catgaacctg acatctttaa tcgaatagca aaaatcatgt taccaaagga ttaccttgca 480 tatagattta ctggagttca ttgtacggat gtttcagacg cgtctggtat gttattattc 540 gacgtagagc acaaatgctg gagcgacgaa atgatagaaa ttgtaggcat acaaaaaaat 600 caattggcaa acatttatga gagctacgaa gtggttggaa ctttaacgtc caccgctgcc 660 gaagaactag gattaacaac tgaagttaaa gttattgctg gtgctggtga caacgcagca 720 ggtgctattg gtactggaac tatcgaacat ggtatgtgtt ccgtgtcttt aggaacctcc 780 ggtacagtat ttattgcgtc ggataatttt gcagtcgatg aaaataatgc actgcactct 840 tttgcacatg cgaacggtaa ataccacttc ttaggctgta tgttatgtgc agcatctgct 900 aataaatggt ggatggaaga tgttttaaaa acgaaagaat ttgcaaagga acagcaagaa 960 attggtgaac ttggtgagaa cgaagtttac ttcttaccat atttgatggg agagagaact 1020 cctcataatg atccatcagc acgtggcgca ttcgttggta tgtcaatgaa cactactaga 1080 ggagatatga cccttgctgt cttagaaggt gttacatacg ctctgagaga cgcagttgaa 1140 atcgctaggt cttttggtgt tacagtcgaa agagtcaggt taataggtgg tggtgctaag 1200 agtgatttat ggtgtaagtt agtagctaac atcttggacg taacagttga aaaattagct 1260 tgtgaagaag gtcccggata cggtgcagca atgttagcag ctgttgggtg cggtgcttat 1320 gcgaccgtat ctgaggcagc tgataagtta attagagtta cagatacaat acatcaagag 1380 cctgccttgg tggagaagta taataagaaa tatgaggtat tccgtgagtt gtatccagca 1440 ctaaaaccag tatacagaat gctataa 1467 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for ura3 gene cloning <400> 5 gaattcttgt gagtttagta taca 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer for ura3 gene cloning <400> 6 gaattccggt aatctccgaa caga 24 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer for amplification of ura3 deletion cassette <400> 7 cagtaccctt agtatatt 18 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplification of ura3 deletion cassette <400> 8 tctgtcttcg aagagta 17

Claims (12)

Wherein the ura3 gene is inactivated by the introduction of a ura3 gene-deficient cassette comprising the nucleotide sequence of SEQ ID NO: 2 and having an auxotrophic selection marker for uracil,
A strain of recombinant multicellular industrial yeast, Saccharomyces cerevisiae strain CHY1001 (Accession No. KCTC 12179BP).
2. The strain according to claim 1, wherein the ura3 gene comprises the nucleotide sequence of SEQ ID NO: 1.
delete A method for producing a recombinant strain, which comprises introducing a ura3 gene and a foreign gene into the strain of claim 1 or 2.
The strain xylose isomerase consisting of the nucleotide sequence of SEQ ID NO: 3 and the nucleotide sequence of SEQ ID NO: 4 and the xylose isomerase gene consisting of the nucleotide sequence of SEQ ID NO: (xylulose kinase) gene, which is capable of fermenting xylose and saccharose saccharomyces cerevisiae.
delete delete delete 6. The strain of claim 5, wherein said strain is Accession No. KCTC 12180BP.
A composition for producing ethanol comprising the strain of claim 5 or 9.
8. A method for producing ethanol, comprising culturing the strain of claim 5 or 9 in a medium comprising a saccharide, xylose, or xylose and a saccharide. delete

Images