WO2013023172A1 - Modulation de réponses inflammatoires par saa1 et saa2 - Google Patents

Modulation de réponses inflammatoires par saa1 et saa2 Download PDF

Info

Publication number
WO2013023172A1
WO2013023172A1 PCT/US2012/050417 US2012050417W WO2013023172A1 WO 2013023172 A1 WO2013023172 A1 WO 2013023172A1 US 2012050417 W US2012050417 W US 2012050417W WO 2013023172 A1 WO2013023172 A1 WO 2013023172A1
Authority
WO
WIPO (PCT)
Prior art keywords
saa
animal
certain embodiments
modified
compound
Prior art date
Application number
PCT/US2012/050417
Other languages
English (en)
Inventor
Merrill D. Benson
Barbara KLUVE-BECKERMAN
Adam Mullick
Susan M. Freier
Original Assignee
Isis Pharmaceuticals, Inc.
Indiana University Research And Technology Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals, Inc., Indiana University Research And Technology Corporation filed Critical Isis Pharmaceuticals, Inc.
Publication of WO2013023172A1 publication Critical patent/WO2013023172A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525—MOE, methoxyethoxy

Definitions

  • the present invention provides methods, compounds, and compositions for modulating an inflammatory response by administering a serum amyloid A (SAA) modulator to an animal.
  • SAA serum amyloid A
  • Inflammation is a complex biological process of the body in response to an injury or abnormal stimulation caused by a physical, chemical or biological stimulus. Inflammation is a protective process by which the body attempts to remove the injury or stimulus and begins to heal affected tissue in the body.
  • inflammatory responses although generally helpful to the body to clear an injury or stimulus, can sometimes cause injury to the body.
  • a body's immune response inappropriately triggers an inflammatory response where there is no known injury or stimulus to the body.
  • AA amyloidosis usually develops as a complication of chronic inflammatory disorders such as rheumatoid arthritis, ankylosing spondylitis, inflammatory bowel disease, and the hereditary autoinflammatory syndromes, e.g., familial Mediterranean fever (FMF) and tumor necrosis factor (TNF) receptor-associated periodic syndrome, but is still seen in association with long-standing infections (e.g., osteomyelitis, decubitus ulcers, bronchiectasis) (Lachmann et al., Natural history and outcome in systemic AA amyloidosis.
  • FMF familial Mediterranean fever
  • TNF tumor necrosis factor
  • Acute phase SAA is produced chiefly if not exclusively by the liver, and its expression is upregulated in response to proinflammatory cytokines interleukin IL-6, IL-1, and to a lesser extent TNF-a (Ganapathi et al., Effect of combinations of cytokines and hormones on synthesis of serum amyloid A and C-reactive protein in Hep 3B cells.
  • SAA is secreted into the blood and circulates in association with high density lipoprotein
  • Benditt et al. Amyloid protein SAA is an apolipoprotein of mouse plasma high density lipoprotein. Proc Natl Acad Sci USA 1979;76:4092-4096.
  • SAA level in the serum of healthy individuals is very low, ( ⁇ 5 ⁇ g/ml) levels can increase to more than 1000 ⁇ g/ml depending on the severity of inflammation (de Beer et al., Serum amyloid A protein concentration in inflammatory diseases and its relationship to the incidence of reactive systemic amyloidosis. Lancet 1982;2:231-234).
  • SAA levels rapidly return to baseline once the inflammatory stimulus is pondered, but remain elevated if inflammation persists.
  • AA amyloidosis patients continue to present with this disease, indicating that sufficient therapeutic effect is not always achieved.
  • Drugs such as methotrexate and colchicine commonly used to treat chronic inflammatory diseases and FMF, respectively, are non-specific, and while the newer biologic therapies specifically target TNF, IL-6, or IL-1 , these agents can have widespread effects or be ineffective or contraindicated (Nakamura T. Clinical strategies for amyloid A amyloidosis secondary to rheumatoid arthritis. Mod Rheumatol 2008; 18:109-118).
  • Eprodisate an anti-amyloid small molecule therapeutic designed to disrupt amyloid fibril formation, has gone through phase III clinical trial, but failed to gain FDA approval and is currently being re-tested (Dember et al., Eprodisate for AA Amyloidosis Trial Group. Eprodisate for the treatment of renal disease in AA amyloidosis. N Engl J Med 2007;356:2349- 2360). Kidney transplant is a treatment option for AA amyloid patients whose chief manifestation is renal failure, but this course is considered only after normal SAA levels have been re-established and are then well-maintained.
  • a new line of therapy based on the universal presence of serum amyloid P in amyloid is currently under investigation and involves administration of the bis-D-proline compound CPHPC which binds and induces clearance of SAP from the circulation, followed by administration of anti-human SAP antibody which triggers complement-dependent phagocytic clearance of amyloid.
  • a compound specifically targeting SAA to an animal for ameliorating an inflammatory disease, disorder or condition in an animal; treating an animal at risk for an inflammatory disease, disorder or condition; inhibiting SAA expression in an animal suffering from an inflammatory disease, disorder or condition; and reducing the risk of inflammatory disease, disorder or condition in an animal.
  • SAA specific inhibitors decrease levels of SAA mRNA and/or protein.
  • SAA specific inhibitors are nucleic acids, proteins, or small molecules.
  • an animal suffering from, or at risk for, an inflammatory disease, disorder or condition is selected and treated by administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is complementary to a SAA nucleic acid as shown in any of SEQ ID NOs: 1 -8.
  • an animal having an inflammatory disease, disorder or condition is treated by administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is complementary to a SAA nucleic acid as shown in any of SEQ ID NOs: 1 -8.
  • an animal having an inflammatory disease, disorder or condition is treated by administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to a target segment or target region of SEQ ID NOs: 1 -8 as described herein.
  • the modified oligonucleotide has a nucleobase sequence comprising a contiguous nucleobase portion complementary to a target segment or target region of SEQ ID NOs: 1-8 as described herein.
  • modulation of SAA can occur in a cell, tissue, organ or organism.
  • the cell, tissue or organ is in an animal.
  • the animal is a human.
  • SAA mRNA levels are reduced.
  • SAA protein levels are reduced. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.
  • oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is complementary to a SAA nucleic acid as shown in SEQ ID NOs: 1-8.
  • the modified oligonucleotide has a nucleobase sequence comprising a contiguous nucleobase portion complementary to a target segment or target region of SEQ ID NOs: 1-8 as described herein.
  • the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to a target segment or target region of SEQ ID NOs: 1 -8 as described herein.
  • the oligonucleotide consists of 20 nucleobases with a sequence selected from any one of SEQ ID NOs: 9-12.
  • 2'-0-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • cytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5-methylcytosine is a modified nucleobase.
  • ABSOR means within ⁇ 10% of a value. For example, if it is stated “the compounds inhibited SAA by at least about 70%”, it is implied that the SAA levels are inhibited within a range of 63% to 77%.
  • Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual.
  • an antisense oligonucleotide targeted to SAA is an active pharmaceutical agent.
  • Active target region or “target region” means a region to which one or more active antisense compounds is targeted.
  • Active antisense compounds means antisense compounds that reduce target nucleic acid levels or protein levels.
  • administering refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
  • “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition.
  • amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art. For example, amelioration of amyloidosis in silver nitrate or azocasein treated mice can be determined by clinically scoring the amount of amyloidosis in the mice.
  • Amyloidosis refers to a condition wherein amyloid proteins are abnormally deposited in organs and/or tissues. "Amyloid proteins” are proteins that can form insoluble aggregates. Types of amyloidosis include reactive (AA) amyloidosis.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and
  • Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • Antisense inhibition means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • Bicyclic sugar means a furosyl ring modified by the bridging of two non-geminal ring atoms.
  • a bicyclic sugar is a modified sugar.
  • BNA Bicyclic nucleic acid
  • BNA a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0- methoxyethyl modifications.
  • Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions.
  • Co-administration means administration of two or more pharmaceutical agents to an individual.
  • the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses concomitant, parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition may be a liquid, e.g. saline solution.
  • “Disease modifying drug”, “Disease modifying anti-rheumatic drug” or “DMARD” refers to any agent that modifies the symptoms and/or progression associated with an inflammatory disease, disorder or condition, including autoimmune diseases (e.g. some types of amyloidosis).
  • Dose means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period.
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
  • Effective amount means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support R ase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as a "gap segment” and the external regions may be referred to as "wing segments.”
  • Gap-widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxynucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
  • Identifying an animal at risk for an inflammatory disease, disorder or condition means identifying an animal having been diagnosed with an inflammatory disease, disorder or condition or identifying an animal predisposed to develop an inflammatory disease, disorder or condition. Individuals predisposed to develop an inflammatory disease, disorder or condition, for example in individuals with a familial history of amyloidosis. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments. "Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • Inflammatory response refers to any disease, disorder or condition related to inflammation in an animal.
  • inflammatory responses include an immune response by the body of the animal to clear the injury or stimulus responsible for initiating the inflammatory response.
  • an inflammatory response can be initiated in the body even when no known injury or stimulus is found such as in autoimmune diseases.
  • Inflammatory disease means a disease, disorder or condition related to an inflammatory response to injury or stimulus characterized by clinical signs of increased redness (rubor), temperature (calor), swelling (tumor), pain (dolor) and/or loss of function (functio laesa) in a tissue.
  • “Intemucleoside linkage” refers to the chemical bond between nucleosides.
  • Linked nucleosides means adjacent nucleosides which are bonded together.
  • mismatch or “non-complementary nucleobase” or “MM” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified intemucleoside linkage refers to a substitution or any change from a naturally occurring intemucleoside bond (i.e. a phosphodiester intemucleoside bond).
  • Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified intemucleoside linkage, or modified nucleobase.
  • a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising a modified intemucleoside linkage, a modified sugar, or a modified nucleobase.
  • Modified sugar refers to a substitution or change from a natural sugar.
  • Modulating refers to changing or adjusting a feature in a cell, tissue, organ or organism.
  • modulating SAA mRNA can mean to increase or decrease the level of SAA mRNA and/or SAA protein in a cell, tissue, organ or organism.
  • Modulating SAA mRNA and/or protein can lead to an increase or decrease in an inflammatory response in a cell, tissue, organ or organism.
  • a “modulator” effects the change in the cell, tissue, organ or organism.
  • a SAA antisense oligonucleotide can be a modulator that increases or decreases the amount of SAA mRNA and/or SAA protein in a cell, tissue, organ or organism.
  • Motif means the pattern of chemically distinct regions in an antisense compound.
  • “Naturally occurring internucleoside linkage” means a 3' to 5' phosphodiester linkage.
  • Natural sugar moiety means a sugar found in DNA (2'-H) or RNA (2' -OH).
  • NSAED refers to a Non-Steroidal Anti-Inflammatory Drug. NSAEDs reduce inflammatory reactions in a subject but in general do not ameliorate or prevent a disease from occurring or progressing.
  • Nucleic acid refers to molecules composed of monomelic nucleotides.
  • a nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Oligomer means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection or infusion.
  • Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
  • Peptide means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • "Portion” means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • SAA refers to both serum amyloid Al (SAAl) and/or serum amyloid A2 (SAA2).
  • SAA nucleic acid or “SAA nucleic acid” means any nucleic acid encoding SAA.
  • a SAA nucleic acid includes a DNA sequence encoding SAA, an RNA sequence transcribed from DNA encoding SAA (including genomic DNA comprising introns and exons), and an mRNA sequence encoding SAA.
  • SAA mRNA means an mRNA encoding a SAA protein.
  • SAA specific inhibitor refers to any agent capable of specifically inhibiting the expression of SAA mRNA and/or SAA protein at the molecular level.
  • SAA specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of SAA mRNA and/or SAA protein.
  • by specifically modulating SAA mRNA level and/or SAA protein expression SAA specific inhibitors may affect components of the inflammatory pathway. Similarly, in certain embodiments, SAA specific inhibitors may affect other molecular processes in an animal.
  • Side effects means physiological responses attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Targeting or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5'-most nucleotide of a target segment.
  • 3' target site refers to the 3'-most nucleotide of a target segment.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • Treat refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
  • one or more pharmaceutical compositions can be administered to the animal.
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an R A nucleotide (i.e. ⁇ -D-ribonucleotide) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleotide).
  • SAA modulators In certain embodiments, provided are SAA modulators.
  • the SAA modulators can be SAA specific inhibitors, for use in treating, preventing, or ameliorating an
  • SAA specific inhibitors are nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of SAA mRNA and/or SAA protein.
  • the SAA nucleic acid is any of the murine sequences set forth in GENBANK Accession NM_009117.3 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NM 011314.1 (incorporated herein as SEQ ID NO: 2).
  • the SAA nucleic acid is any of the human sequences set forth in GENBANK Accession X56652.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession NM_000331.3 (incorporated herein as SEQ ID NO: 4), GENBANK Accession NMJ99161.2 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. M26152.1
  • provided for use in the methods are compounds comprising a modified oligonucleotide.
  • the compounds comprise a modified oligonucleotide consisting of 12 to 30 linked nucleosides.
  • the compounds for use in the methods may comprise a modified oligonucleotide comprising a nucleobase sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NOs: 1-8.
  • the compound may comprise a modified oligonucleotide comprising a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NOs: 1 -8.
  • the compounds for use in the methods comprises a modified oligonucleotide comprising a nucleobase sequence complementary to at least a portion of a target region as set out below as nucleobase ranges on the target RNA sequence.
  • oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases of a nucleobase sequence complementary to any of the sequences recited in SEQ ID NOs: 1-8.
  • the modified oligonucleotide for use in the methods consists of 12 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked nucleosides.
  • the modified oligonucleotide consists of 20 nucleobases with a sequence selected from any one of SEQ ID NOs: 9-12.
  • the compound for use in the methods consists of a single-stranded modified oligonucleotide.
  • the compound for use in the methods has at least one modified intemucleoside linkage.
  • the modified intemucleoside linkage is a
  • each modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • the compound for use in the methods has at least one nucleoside comprising a modified sugar.
  • at least one modified sugar is a bicyclic sugar.
  • at least one modified sugar comprises a 2'-0-methoxyethyl (2'MOE).
  • the compound for use in the methods has at least one nucleoside comprising a modified nucleobase.
  • the modified nucleobase is a 5- methylcytosine.
  • the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of linked deoxynucleosides; (ii) a 5' wing segment consisting of linked nucleosides; (iii) a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of eight to sixteen linked deoxynucleosides; (ii) a 5' wing segment consisting of two to six linked nucleosides; (iii) a 3' wing segment consisting of two to six linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0- methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
  • the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of ten linked deoxynucleosides; (ii) a 5' wing segment consisting of five linked nucleosides; (iii) a 3' wing segment consisting of five linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
  • Modulation of SAA can lead to an increase or decrease of SAA mRNA and protein expression in order to increase or decrease an inflammatory response as needed.
  • SAA inhibition in an animal is reversed by administering a modulator targeting SAA.
  • SAA is inhibited by the modulator.
  • the SAA modulator can be a modified oligonucleotide targeting SAA.
  • the inflammatory response is decreased.
  • the method for ameliorating an inflammatory disease in an animal comprises administering to the animal a compound targeting SAA.
  • compositions for treating an animal at risk for an inflammatory disease, disorder or condition comprising administering a
  • provided are methods, compounds and compositions for reducing the risk of inflammatory disease, disorder or condition, in an animal comprising administering a compound targeting SAA to the animal.
  • provided is a method comprising selecting an animal suffering from, or at risk of, an inflammatory disease, disorder or condition and administering a compound targeting SAA to the animal.
  • provided are methods, compounds and compositions for treating an animal at risk for an inflammatory disease, disorder or condition or an animal having an inflammatory disease, disorder or condition comprising administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is complementary to a SAA nucleic acid as shown in SEQ ID NOs: 1 -8.
  • provided are methods, compounds and compositions for treating an animal having an inflammatory disease, disorder or condition or an animal having an inflammatory disease, disorder or condition comprising administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is complementary to a SAA nucleic acid as shown in SEQ ID NOs: 1 -8.
  • the animal is pre-treated with one or more SAA modulators.
  • the animal is a human.
  • the inflammatory disease, disorder or condition is amyloidosis.
  • the amyloidosis is reactive (AA) amyloidosis.
  • provided are methods, compounds and compositions for treating an animal comprising selecting an animal suffering from, or at risk of, amyloidosis and administering a compound targeting SAA to the animal, thereby treating the animal.
  • the amyloidosis is decreased.
  • a symptom or therapeutic endpoint of an inflammatory disease, disorder or condition can be selected from one or more of amyloidosis formation, time of amyloidosis formation, inflammasone activation, cytokine levels, kidney failure, proteinuria, inflammation and degeneration of the peripheral nerves (peripheral neuropathy), carpal tunnel syndrome, numbness at the limbs, diarrhea, constipation, blood pressure, dizziness, fainting, enlargement of the liver and spleen, inflamed tongue, malnutrition, abdominal pain and bleeding, skin papules, hemorrhage beneath the skin (purpura), hair loss, dryness of the mouth, cardiovascular disease and obstruction of nasal airways.
  • the symptom or therapeutic endpoint of the inflammatory disease is decreased.
  • the marker can be selected from one or more of amyloidosis formation, time of amyloidosis formation, inflammasone activation and cytokine levels. In certain embodiments, the amyloidosis formation, time of amyloidosis formation, inflammasone activation and/or cytokine levels is decreased.
  • cytokines examples include IL- ⁇ ⁇ , VEGF, GCSF, IL-6, IL-10, IL-12p70 and CXCL1.
  • the compounds of the invention treats, prevents or ameliorates an inflammatory response, disease, disorder or condition in an animal.
  • the inflammatory response, disease, disorder or condition is associated with SAA.
  • the inflammatory response, disease, disorder, or condition may include, but is not limited to, or may be due to or associated with, amyloidosis, arthritis, colitis, embolism, fibrosis, allergic inflammation, asthma, cardiovascular disease, diabetes, sepsis, antiphospholipid syndrome, graft-related diseases and autoimmune diseases, or any combination thereof.
  • the inflammatory response, disease, disorder or condition is decreased.
  • inflammatory diseases, disorders or conditions producing secondary or reactive amyloidosis include, but are not limited to infections (e.g. tuberculosis (TB), bronchiectasis, osteomyelitis and leprosy) and inflammatory conditions (e.g. rheumatoid arthritis (RA), juvenile idiopathic arthritis, Crohn's disease and familial Mediterrenean fever).
  • infections e.g. tuberculosis (TB), bronchiectasis, osteomyelitis and leprosy
  • inflammatory conditions e.g. rheumatoid arthritis (RA), juvenile idiopathic arthritis, Crohn's disease and familial Mediterrenean fever.
  • the compounds and compositions are administered to an animal to treat, prevent or ameliorate an inflammatory disease, disorder or condition.
  • the inflammatory disease, disorder or condition is amyloidosis.
  • the compounds and compositions are administered to an animal to treat, prevent or ameliorate amyloidosis.
  • the amyloidosis is reactive (AA) amyloidosis. In certain embodiments, the amyloidosis is decreased.
  • administration to an animal is by a parenteral route.
  • the parenteral administration is any of subcutaneous or intravenous administration.
  • the compound is co-administered with one or more second agent(s).
  • the second agent includes NSAIDs, DMAJ Ds and colchicine
  • NSAIDS include, but are not limited to, acetyl salicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone,
  • phenylbutazone piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, meloxicam and tramadol.
  • the compound of the invention and one or more NSAIDS can be administered
  • DMARDs disease modifying drugs
  • examples of disease modifying drugs include, but are not limited to, methotrexate,
  • B7 or CTLA4 blockers or antagonists e.g., abatacept
  • cyclophosphamide azathioprine
  • corticosteroids cyclosporin A
  • aminosalicylates e.g., sulfasalazine, hydroxychloroquine
  • pyrimidine synthesis inhibitors e.g., leflunomide
  • tumor necrosis factor-alpha (TNFalpha) blockers or antagonists e.g., etanercept, infliximab
  • LFA-1 blockers or antagonists e.g., efalizumab
  • 6-mercapto-purine (6-MP) cytokine blockers or antagonists.
  • cytokine blockers include, but are not limited to, antisense oligonucleotides, small molecules and antibodies targeting cytokines such as interleukins (e.g, IL-1, IL-6, IL-10, IL-12), VEGF, GCSF and CXCL1.
  • cytokines such as interleukins (e.g, IL-1, IL-6, IL-10, IL-12), VEGF, GCSF and CXCL1.
  • the compound of the invention and one or more disease modifying drug can be administered concomitantly or sequentially.
  • a compound or oligonucleotide is in salt form.
  • the compounds or compositions are formulated with a pharmaceutically acceptable carrier or diluent.
  • SAA has a sequence as shown in any of SEQ ED NOs: 1-8.
  • a modified oligonucleotide is used for treating an inflammatory response or inflammatory disease, disorder, or condition.
  • a modified oligonucleotide is used in the manufacture of a medicament for treating an inflammatory response or inflammatory disease, disorder, or condition.
  • the modified oligonucleotide has a nucleobase sequence comprising a portion of nucleobases complementary to any of SEQ ID NOs: 1-8.
  • the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to any of SEQ ID NOs: 1 -8.
  • a SAA modulator as described herein in the manufacture of a medicament for treating, ameliorating, or preventing inflammatory diseases, disorders, and conditions associated with SAA.
  • a SAA modulator as described herein for use in treating, preventing, or ameliorating an inflammatory response or inflammatory disease, disorder, or condition as described herein.
  • the SAA modulator can be used in combination therapy with one or more additional agent or therapy as described herein.
  • Agents or therapies can be administered concomitantly or sequentially to an animal.
  • a SAA modulator as described herein in the manufacture of a medicament for treating, preventing, or ameliorating an inflammatory disease, disorder or condition as described herein.
  • the SAA modulator can be used in combination therapy with one or more additional agent or therapy as described herein.
  • Agents or therapies can be administered concomitantly or sequentially to an animal.
  • kits for treating, preventing, or ameliorating an inflammatory response, disease, disorder or condition as described herein comprising: (i) a SAA specific inhibitor as described herein; and optionally (ii) an additional agent or therapy as described herein.
  • kits of the present invention may further include instructions for using the kit to treat, prevent, or ameliorate an inflammatory disease, disorder or condition as described herein by combination therapy as described herein.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
  • An oligomeric compound can be "antisense" to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound targeted to SAA nucleic acid is 10 to 30 nucleotides in length.
  • antisense compounds are from 10 to 30 linked nucleobases.
  • the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases.
  • the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense oligonucleotide.
  • the antisense compound comprises a shortened or truncated modified oligonucleotide.
  • the shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5' end (5' truncation), the central portion or alternatively from the 3' end (3' truncation).
  • a shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5' end, two or more nucleosides deleted from the central portion or alternatively can have two or more nucleosides deleted from the 3' end.
  • the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one or more nucleoside deleted from the 5 ' end, one or more nucleoside deleted from the central portion and/or one or more nucleoside deleted from the 3' end.
  • the additional nucleoside can be located at the 5' end, 3' end or central portion of the oligonucleotide.
  • the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5' end (5' addition), to the 3' end (3' addition) or the central portion, of the oligonucleotide.
  • the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one or more nucleoside added to the 5' end, one or more nucleoside added to the 3' end, and/or one or more nucleoside added to the central portion.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
  • antisense compounds targeted to a SAA nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • each distinct region comprises uniform sugar moieties.
  • wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y- Z” has a configuration such that the gap segment is positioned immediately adjacent each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other embodiments they are different.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides.
  • gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 1-8-1, 2-6-2, 6- 8-6, 5-8-5, 1-8-1, 2-6-2, 2-13-2, 1-8-2, 2-8-3, 3-10-2, 1-18-2, or 2-18-2.
  • the antisense compound as a "wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer
  • wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.
  • antisense compounds targeted to a SAA nucleic acid possess a 5-10-5 gapmer motif.
  • antisense compounds targeted to a SAA nucleic acid possess a 3-14-3 gapmer motif.
  • antisense compounds targeted to a SAA nucleic acid possess a 2-13-5 gapmer motif.
  • an antisense compound targeted to a SAA nucleic acid has a gap-widened motif.
  • a gap-widened antisense oligonucleotide targeted to a SAA nucleic acid has a gap segment of fourteen 2'-deoxyribonucleosides positioned immediately adjacent to and between wing segments of three chemically modified nucleosides.
  • the chemical modification comprises a 2'-sugar modification.
  • the chemical modification comprises a 2'-MOE sugar modification.
  • a gap-widened antisense oligonucleotide targeted to a SAA nucleic acid has a gap segment of thirteen 2'-deoxyribonucleosides positioned immediately adjacent to and between a 5' wing segment of two chemically modified nucleosides and a 3' wing segment of five chemically modified nucleosides.
  • the chemical modification comprises a 2'-sugar modification.
  • the chemical modification comprises a 2'-MOE sugar modification.
  • Nucleotide sequences that encode SAA include, without limitation, the following: GENBANK Accession NM_009117.3 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No.
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for SAA can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the target region.
  • a "target segment” is a smaller, sub-portion of a target region within a nucleic acid.
  • a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compound is targeted.
  • “5' target site” refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3'-most nucleotide of a target segment.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
  • Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • reductions in SAA mRNA levels are indicative of inhibition of SAA expression.
  • Reductions in levels of a SAA protein are also indicative of inhibition of target mRNA levels.
  • phenotypic changes are indicative of inhibition of SAA expression. For example, a decrease in colon shrinkage can be indicative of inhibition of SAA expression. In another example, a decrease in diarrhea can be indicative of inhibition of SAA expression. In another example, a decrease in colon vascular permeability can be indicative of inhibition of SAA expression.
  • reduced formation of inflammation e.g., in amyloidosis formation
  • increased time for inflammation formation e.g., in amyloidosis formation
  • SAA expression e.g., in amyloidosis expression
  • hybridization occurs between an antisense compound disclosed herein and a SAA nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a SAA nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a SAA nucleic acid).
  • Non-complementary nucleobases between an antisense compound and a SAA nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a SAA nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a SAA nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • antisense compound may be fully complementary to a SAA nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a SAA nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a SAA nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are
  • nucleobase portion of a target segment complementary to at least a 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%,
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates.
  • antisense compounds targeted to a SAA nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, Ci-Cn alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, Ci-Cn alkyl or a protecting group
  • Examples of chemically modified sugars include 2'-F-5 '-methyl substituted nucleoside (see PCT International Application WO 2008/101 157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 1 1/22/07 wherein LNA is substituted with for example a 5 '-methyl or a 5 '-vinyl group).
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'-OCH 2 CH 2 F and 2'-
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to one of the formulae: 4'-(CH 2 )-0-2' (LNA); 4'- (CH 2 )-S-2'; 4*-(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )-0-2' and 4'-CH(CH 2 OCH 3 )-0-2* (and analogs thereof see U.S.
  • bicyclic nucleosides can be prepared having one or more stereochemical sugar
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • the bridge of a bicyclic sugar moiety is -[C(R a )(R b )] n -, -[C(R a )(R b )] n -0-,
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'- (CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 -N(R)-0-2'- wherein each R is, independently, H, a protecting group or Ci-Q 2 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4 '-2' methylene-oxy bridge may be in the a-L configuration or in the ⁇ -D configuration.
  • a-L-methyleneoxy (4'-CH 2 -0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et at, Nucleic Acids Research, 2003, 27, 6365-6372).
  • bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'- (CH 2 ) 2 -0-2') BNA , (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA, (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene-amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )-2') BNA,
  • Bx is the base moiety and R is independently H, a protecting group or C r Ci 2 alkyl.
  • bicyclic nucleosides having Formula I:
  • Bx is a heterocyclic base moiety
  • Rc is C] -Ci 2 alkyl or an amino protecting group
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides are provided having Formula II:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is C]-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C]-C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ c , NJ c J d , SJ C , N3,
  • each J c , J d and J e is, independently, H, C r C6 alkyl, or substituted C C 6 alkyl and X is O or NJ C .
  • bicyclic nucleosides are provided having Formula III:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides are provided having Formula IV:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • R d is C r C 6 alkyl, substituted Q-Q alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and q d is, independently, H, halogen, C r C 6 alkyl, substituted C C alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C alkynyl, Ci-C 6 alkoxyl, substituted Ci-C 6 alkoxyl, acyl, substituted acyl, C r C6 aminoalkyl or substituted C r C 6 aminoalkyl;
  • bicyclic nucleosides are provided having Formula V:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q g and 3 ⁇ 4 are each, independently, H, halogen, C r Ci 2 alkyl or substituted C r Ci 2 alkyl.
  • the synthesis and preparation of the methyleneoxy (4'-CH 2 -0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • bicyclic nucleosides are provided having Formula VI:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2'- substituent groups can also be selected from: Ci-C ]2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 ,
  • modifed nucleosides comprise a 2'-M0E side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • a "modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoro HNA (F-HNA) or those compounds having Formula VII:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T a and T is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T a and T b is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi, q 2 , q3, q4, qs, qe and q 7 are each independently, H, C C 6 alkyl, substituted C]-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C(, alkynyl or substituted C 2 -C 6 alkynyl; and each of R
  • the modified THP nucleosides of Formula VII are provided wherein q l 5 q 2 , q 3 , q 4 , q 5 , q6 and q 7 are each H. In certain embodiments, at least one of q ] ⁇ q 2 , q 3 , q 4 , q 5 , q6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , qs, q6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R] and R 2 is fluoro. In certain embodiments, Ri is fluoro and R 2 is H; Ri is methoxy and R 2 is H, and Ri is methoxyethoxy and R 2 is H.
  • 2'-modified or “2 '-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging
  • 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the
  • 2'-OMe or "2'-OCH3" or “2'-0-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH2OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (R A) and/or
  • DNA deoxyribonucleosides
  • Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'-CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase
  • Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-fhiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6- azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • antisense compounds targeted to a SAA nucleic acid comprise one or more modified nucleobases.
  • gap-widened antisense oligonucleotides targeted to a SAA nucleic acid comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to a SAA nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • the "pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
  • the excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxyprop
  • compositions of the present invention can also be used to formulate the compositions of the present invention.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a SAA nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • one or more modified oligonucleotides of the present invention can be formulated as a prodrug.
  • a prodrug can be produced by modifying a pharmaceutically active compound such that the active compound will be regenerated upon in vivo administration.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • a pharmaceutical composition comprises a sterile lyophilized modified oligonucleotide that is reconstituted with a suitable diluent, e.g., sterile water for injection or sterile saline for injection.
  • a suitable diluent e.g., sterile water for injection or sterile saline for injection.
  • the reconstituted product is administered as a subcutaneous injection or as an intravenous infusion after dilution into saline.
  • the lyophilized drug product consists of a modified oligonucleotide which has been prepared in water for injection, or in saline for injection, adjusted to pH 7.0-9.0 with acid or base during preparation, and then lyophilized.
  • the lyophilized modified oligonucleotide may be 25-800 mg, or any dose between 25-800 mg as described above, of a modified oligonucleotide.
  • the lyophilized drug product may be packaged in a 2 mL Type I, clear glass vial (ammonium sulfate-treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum flip-off overseal.
  • compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
  • the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the
  • compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • Such materials when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.
  • the formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
  • compositions of the present invention comprise one or more modified oligonucleotides and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • a pharmaceutical composition of the present invention is prepared using known techniques, including, but not limited to mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tabletting processes.
  • the compounds of the invention targeted to a SAA nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent includes, but is not limited to, water, oils, alcohols, or phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an compound targeted to a SAA nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the compound is an antisense oligonucleotide.
  • a pharmaceutical composition of the present invention is a liquid (e.g., a suspension, elixir and/or solution).
  • a liquid pharmaceutical composition is prepared using ingredients known in the art, including, but not limited to, water, buffered saline, glycols, oils, alcohols, flavoring agents, preservatives, and coloring agents.
  • a pharmaceutical composition of the present invention is a solid (e.g., a powder, tablet, and/or capsule).
  • a solid pharmaceutical composition comprising one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders, and disintegrating agents.
  • a pharmaceutical composition of the present invention is formulated as a depot preparation. Certain such depot preparations are typically longer acting than non-depot preparations. In certain embodiments, such preparations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. In certain embodiments, depot preparations are prepared using suitable polymeric or hydrophobic materials (for example an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • a pharmaceutical composition of the present invention comprises a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • a pharmaceutical composition of the present invention comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • a pharmaceutical composition of the present invention comprises a co- solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co- solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • a pharmaceutical composition of the present invention comprises a sustained-release system.
  • a sustained-release system is a semi -permeable matrix of solid hydrophobic polymers.
  • sustained-release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks or months.
  • a pharmaceutical composition of the present invention is prepared for oral administration.
  • a pharmaceutical composition is formulated by combining one or more compounds comprising a modified oligonucleotide with one or more pharmaceutically acceptable carriers.
  • pharmaceutically acceptable carriers enable pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject.
  • pharmaceutical compositions for oral use are obtained by mixing oligonucleotide and one or more solid excipient.
  • Suitable excipients include, but are not limited to, fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • PVP polyvinylpyrrolidone
  • such a mixture is optionally ground and auxiliaries are optionally added.
  • pharmaceutical compositions are formed to obtain tablets or dragee cores.
  • disintegrating agents e.g., cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate are added.
  • dragee cores are provided with coatings.
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to tablets or dragee coatings.
  • compositions for oral administration are push-fit capsules made of gelatin.
  • Certain of such push-fit capsules comprise one or more pharmaceutical agents of the present invention in admixture with one or more filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • pharmaceutical compositions for oral administration are soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • one or more pharmaceutical agents of the present invention are be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added.
  • compositions are prepared for buccal administration. Certain of such pharmaceutical compositions are tablets or lozenges formulated in conventional manner.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer (e.g., PBS).
  • physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer (e.g., PBS).
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
  • a pharmaceutical composition is prepared for transmucosal
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art.
  • a pharmaceutical composition is prepared for administration by inhalation.
  • Certain of such pharmaceutical compositions for inhalation are prepared in the form of an aerosol spray in a pressurized pack or a nebulizer.
  • Certain of such pharmaceutical compositions comprise a propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined with a valve that delivers a metered amount.
  • capsules and cartridges for use in an inhaler or insufflator may be formulated.
  • Certain of such formulations comprise a powder mixture of a pharmaceutical agent of the invention and a suitable powder base such as lactose or starch.
  • a pharmaceutical composition is prepared for rectal administration, such as a suppositories or retention enema.
  • Certain of such pharmaceutical compositions comprise known ingredients, such as cocoa butter and/or other glycerides.
  • a pharmaceutical composition is prepared for topical administration.
  • Certain of such pharmaceutical compositions comprise bland moisturizing bases, such as ointments or creams.
  • ointments or creams include, but are not limited to, petrolatum, petrolatum plus volatile silicones, and lanolin and water in oil emulsions.
  • suitable cream bases include, but are not limited to, cold cream and hydrophilic ointment.
  • a pharmaceutical composition of the present invention comprises a modified oligonucleotide in a therapeutically effective amount.
  • the modified oligonucleotide in a therapeutically effective amount.
  • therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated.
  • compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect.
  • the desired effect can be, for example, reduction of SAA or the prevention, reduction, amelioration or slowing the progression of a disease or condition associated with SAA.
  • the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject.
  • “Concentration of pharmaceutical composition” as used with regard to dose regimen can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition.
  • dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.
  • Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from 0.01 g to 1 OOmg per kg of body weight, or within a range of 0.001 mg to
  • 1 OOOmg dosing may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to lOOmg per kg of body weight, once or more daily, to once every 20 years or ranging from 0.001 mg to 1 OOOmg dosing.
  • the compounds or pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be oral, inhaled or parenteral.
  • parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • parenteral administration is by infusion.
  • Infusion can be chronic or continuous or short or intermittent.
  • infused pharmaceutical agents are delivered with a pump.
  • parenteral administration is by injection.
  • the injection can be delivered with a syringe or a pump.
  • the injection is a bolus injection.
  • the injection is administered directly to a tissue or organ.
  • formulations for parenteral, intrathecal or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • formulations for oral administration of the compounds or compositions can include, but is not limited to, pharmaceutical carriers, excipients, powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable.
  • oral formulations are those in which compounds provided herein are administered in conjunction with one or more penetration enhancers, surfactants and chelators.
  • administration includes pulmonary administration.
  • pulmonary administration comprises delivery of aerosolized oligonucleotide to the lung of a subject by inhalation.
  • oligonucleotide distributes to cells of both normal and inflamed lung tissue, including alveolar macrophages, eosinophils, epithelium, blood vessel endothelium, and bronchiolar epithelium.
  • a suitable device for the delivery of a pharmaceutical composition comprising a modified oligonucleotide includes, but is not limited to, a standard nebulizer device. Additional suitable devices include dry powder inhalers or metered dose inhalers.
  • compositions are administered to achieve local rather than systemic exposures.
  • pulmonary administration delivers a pharmaceutical composition to the lung, with minimal systemic exposure.
  • Additional suitable administration routes include, but are not limited to, rectal, transmucosal, intestinal, enteral, topical, suppository, intrathecal, intraventricular, intraperitoneal, intranasal, intraocular, intramuscular, intramedullary, and intratumoral.
  • the compounds of the invention can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate,
  • phenanthridine anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability.
  • stabilizing groups include cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini.
  • Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003. Cell culture and antisense compounds treatment
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA). Antisense
  • oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes
  • LIPOFECT AMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes
  • Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI- MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes OligofectamineTM (Invitrogen Life Technologies, Carlsbad, CA). Antisense oligonucleotide is mixed with OligofectamineTM in Opti-MEMTM-l reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide with an OligofectamineTM to oligonucleotide ratio of approximately 0.2 to 0.8 ⁇ ⁇ per 100 nM.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum-free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 ⁇ . of FuGENE 6 per 100 nM.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001).
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LBPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001). RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the
  • ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT reverse transcriptase
  • cDNA complementary DNA
  • the RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A or GAPDH, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A or GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Carlsbad, CA). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.
  • Probes and primers are designed to hybridize to a SAA nucleic acid.
  • Methods for designing realtime PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA).
  • the PCR probes can have JOE or FAM covalently linked to the 5 ' end and TAMRA or MGB covalently linked to the 3' end, where JOE or FAM is the fluorescent reporter dye and TAMRA or MGB is the quencher dye.
  • primers and probe designed to a sequence from a different species are used to measure expression.
  • a human GAPDH primer and probe set can be used to measure GAPDH expression in monkey-derived cells and cell lines.
  • Gene target quantities obtained by RT, real-time PCR can be normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR).
  • GAPDH expression can be quantified by RT, realtime PCR, by being run simultaneously with the target, multiplexing, or separately.
  • Total RNA can be quantified using RiboGreenTM RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). Analysis of Protein Levels
  • Antisense inhibition of SAA nucleic acids can be assessed by measuring SAA protein levels.
  • Protein levels of SAA can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of human and rat SAA are commercially available.
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of SAA and produce phenotypic changes, such as, reduced formation of amyloidosis (i.e., reduced amyloid deposition) or increased time for amyloidosis formation. Testing can be performed in normal animals, or in experimental disease models. Testing may be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous.
  • RNA is isolated from liver tissue and changes in SAA nucleic acid expression are measured. Changes in SAA protein levels can also be measured. Changes in SAA expression can be measured by determing the level of inflammation, inflammatory conditions (e.g., amyloidosis) or inflammatory markers (inflammatory cytokines) present in the animal.
  • inflammatory conditions e.g., amyloidosis
  • inflammatory markers inflammatory cytokines
  • the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention.
  • the individual has or is at risk for an inflammatory disease, disorder or condition.
  • the individual is at risk for an inflammatory disease, disorder or condition as described, supra.
  • the invention provides methods for prophylactically reducing SAA expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a SAA nucleic acid.
  • administration of a therapeutically effective amount of an antisense compound targeted to a SAA nucleic acid is accompanied by monitoring of SAA levels in the serum of an individual, to determine an individual's response to administration of the antisense compound.
  • An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • administration of an antisense compound targeted to a SAA nucleic acid results in reduction of SAA expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • administration of an antisense compound targeted to a SAA nucleic acid results in a change in inflammatory disease, condition, symptom or marker (e.g., amyloidosis levels).
  • SAA antisense compound increases or decreases the inflammatory disease, condition, symptom or marker by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to SAA are used for the preparation of a medicament for treating a patient suffering or susceptible to an inflammatory disease, disorder or condition.
  • the methods described herein include administering a compound comprising a modified oligonucleotide having an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobase portion complementary to SAA.
  • a first agent comprising a modified oligonucleotide provided herein is coadministered with one or more secondary agents.
  • such second agents are designed to treat the same inflammatory disease, disorder or condition as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein.
  • such first agents are designed to treat an undesired side effect of a second agent.
  • second agents are co-administered with the first agent to treat an undesired effect of the first agent.
  • second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
  • a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.
  • second agents include, but are not limited to, NSAIDS, DMARDs and colchine.
  • the second agent is administered prior to administration of the first agent.
  • the second agent is administered following administration of the first agent.
  • the second agent is administered at the same time as the first agent.
  • the dose of a co-administered second agent is the same as the dose that would be administered if the second agent was administered alone.
  • the dose of a coadministered second agent is lower than the dose that would be administered if the second agent was administered alone.
  • the dose of a co-administered second agent is greater than the dose that would be administered if the second agent was administered alone.
  • SAA oligonucleotides oligonucleotides targeting a nucleic acid encoding SAA protein
  • an inflammatory condition such as amyloidosis
  • Example 1 In vivo antisense inhibition of murine serum amyloid A (SAA) Several antisense oligonucleotides were designed that were targeted to murine SAA1
  • the target start sites and sequences of each oligonucleotide are described in Table 1.
  • the chimeric antisense oligonucleotides in Table 1 were designed as 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of 10 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising 5 nucleosides each.
  • Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification.
  • mice Groups of 5 C57BL/6 mice each were injected with 50 mg/kg of ISIS 145016, ISIS 145020, ISIS 145021, or ISIS 145030 administered weekly for 6 weeks.
  • a control group of mice was injected with phosphate buffered saline (PBS) administered weekly for 6 weeks.
  • PBS phosphate buffered saline
  • the mice were administered 25 ⁇ g of lipopolysaccharide (LPS) each to induce an inflammatory response.
  • Blood was harvested from the mice 24 hrs later. Mice were sacrificed at the end of the study at week 6. Whole liver was harvested for RNA analysis and plasma was collected for protein analysis.
  • RTS594 forward sequence GCTGACCAGGAAGCCAACAG, designated herein as SEQ ID NO: 13
  • reverse sequence CAGGCAGTCCAGGAGGTCTG designated herein as SEQ ID NO: 14
  • probe sequence CATGGCCGCAGTGGCAAAGACC designated herein as SEQ ED NO: 15
  • RNA samples were also assayed with primer probe set mSAAl_LTS00418_MGB (forward sequence CCTCCTGGACTGCCTGACAA, designated herein as SEQ ID NO: 16; reverse sequence CCCAGCACAACCTACTGAGCTA, designated herein as SEQ ID NO: 17; probe sequence ACTGAGCGTCCTCC, designated herein as SEQ ID NO: 18), which measures only SAAl levels.
  • the mRNA levels were normalized using either Cyclophilin or RIBOGREEN®. As shown in Table 2, the antisense oligonucleotides achieved significant reduction of murine SAA over the PBS control. Results are presented as percent inhibition of SAA, relative to control.
  • SAA plasma levels were measured 24 hrs after LPS administration by ELISA (Biosource Inc, CA). As shown in Table 3, antisense inhibition of SAA by some of the ISIS oligonucleotides resulted in a significant dose-dependent reduction of SAA protein. Results are presented as percent inhibition of SAA, relative to PBS control.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz NW (Ed): Clinical Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). Plasma concentrations of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in Table 5 expressed in IU/L. Several of the ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.
  • Example 2 In Vivo Effect of Antisense Inhibition in a model of chronic low inflammation: apoE knockout mice model fed a Western diet
  • mice fed a high fat diet, serving as a model for low chronic inflammation.
  • Female apoE knockout mice were obtained from The Jackson Laboratory (Bar Harbor, Maine). The mice were fed ad libitum the Western diet (TD88137; 42% cal from fat, 0.2% cholesterol; Harlan Laboratories,
  • mice Groups of 5 mice each were injected with 50 mg/kg of ISIS 145016, ISIS 145020, ISIS 145021, or ISIS 145030 administered weekly for 4 weeks.
  • a control group of mice was injected with phosphate buffered saline (PBS) administered weekly for 4 weeks.
  • Mice were sacrificed at the end of the study, livers were harvested for RNA analysis, and plasma was collected for protein analysis.
  • SAA plasma levels (at 1 : 5 dilution) were measured by ELISA (Biosource Inc, CA). As shown in Table 7, antisense inhibition of SAA by some of the ISIS oligonucleotides resulted in a significant dose-dependent reduction of SAA protein. Results are presented as percent inhibition of SAA, relative to PBS control.
  • ISIS oligonucleotides To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma concentrations of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY) (Nyblom, H. et al., Alcohol & Alcoholism 39: 336-339, 2004; Tietz NW (Ed): Climcal Guide to Laboratory Tests, 3rd ed. W. B. Saunders, Philadelphia, PA, 1995). Plasma concentrations of ALT and AST were measured and the results are presented in Table 9 expressed in IU/L. Most of the ISIS oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.
  • ALT and AST levels (IU/L) of apoE KO mice
  • Example 3 In Vivo Effect of Antisense Inhibition in a model of acute inflammation: mice stimulated with azocasein
  • the first phase defined as the latency or pre-deposition phase, consists of a prolonged period between onset of inflammation and initiation of fibril deposition. This phase culminates in formation of the amyloid nidus or seed and is followed by the deposition phase. With a nidus in place, amyloid deposition can progress rapidly, depending on availability of the amyloid-forming substrate SAA.
  • AA amyloidosis can be induced in mice by a method of daily injections of an inflammatory stimulus such as azocasein given over a period of time (Skinner et al., Murine amyloid protein AA in casein-induced experimental amyloidosis. Lab Invest 1977;36:420-427).
  • mice Female NIH Swiss White mice were obtained from Harlan Labs (Indianapolis, IN). The mice were fed ad libitum standard lab chow.
  • mice All mice were injected with azocasein (0.5 mL of a 2% solution) to stimulate inflammation and induce SAA expression.
  • SAA was measured in sera collected 24 hrs after azocasein injection.
  • SAA levels were determined by ELISA (Immunology Consultants Laboratory, Inc, Newberg, OR). Sera collected at the peak of an acute phase response were diluted 10,000-fold prior to assay. The linear range of the assay was between 30 and 1000 ng/ml. Absolute SAA levels were expressed as mg/mL. The percent reduction in SAA levels relative to the PBS control is also presented. The results are presented in Table 11 and indicate that SAA levels in ISIS 145020-treated mice were significantly lower compared to the control. The mean serum level of SAA in ISIS 145020-treated mice was 41-65% lower than the level in PBS controls.
  • Example 4 In Vivo Effect of Antisense Inhibition in a model of acute inflammation: mice stimulated with silver nitrate
  • Inflammation can be induced in mice by injections of an inflammatory stimulus, such as silver nitrate given over a period of time (Glojnaric, I. et al., Int. Immunopharmacol. 7: 1544-
  • Female NIH Swiss White mice were obtained from Harlan Labs (Indianapolis, IN). The mice were fed ad libitum standard lab chow.
  • mice were injected with silver nitrate (0.2 mL of a 2% solution) to stimulate inflammation and induce SAA expression.
  • Groups of 5-6 mice each were injected with 50 mg/kg of ISIS 145020, administered either concurrently with or prior to silver nitrate, as indicated in Table 12.
  • SAA was measured in sera collected 24 hrs after silver nitrate injection. Table 12
  • ISIS 145030 The dose-response effect of ISIS 145030 was evaluated during silver nitrate-stimulated acute inflammation. All mice were injected with silver nitrate (0.2 mL of a 2% solution) to stimulate inflammation and induce SAA expression. Groups of 6 mice each were injected with 10 mg/kg, 25 mg/k or 50 mg/kg of ISIS 145020, administered 72 hrs prior to silver nitrate, as indicated in Table 14. A control group of 6 mice was injected with PBS administered 72 hrs prior to silver nitrate. SAA was measured in sera collected 24 hrs and 72 hrs after silver nitrate injection.
  • SAA levels were determined by ELISA (Immunology Consultants Laboratory, Inc, Newberg, OR). Sera collected at the peak of an acute phase response were diluted 10,000-fold prior to assay. The linear range of the assay was between 30 and 1000 ng/ml. Absolute SAA levels were expressed as mg/mL. The percent reduction in SAA levels relative to the PBS control is also presented. The results are presented in Table 15 and indicate that SAA levels in ISIS 145020-treated mice were significantly lower compared to the control. The greatest suppression was achieved when 50 mg/mL of ISIS 145020 was administered.
  • ISIS 145016 The dose-response effect of ISIS 145016 was evaluated during silver nitrate-stimulated acute inflammation.
  • ISIS 141923 (CCTTCCCTGAAGGTTCCTCC, 5-10-5 MOE gapmer with no known murine target; SEQ ID NO: 19) was included as a control oligonucleotide in this study. All mice were injected with silver nitrate (0.2 mL of a 2% solution) to stimulate inflammation and induce SAA expression. Groups of 6 mice each were injected with 50 mg/kg of ISIS 145016 or ISIS 141923, administered 72 hrs prior to silver nitrate, as indicated in Table 16. A control group of 6 mice was injected with PBS administered 72 hrs prior to silver nitrate. SAA was measured in sera collected 24 hrs after silver nitrate injection.
  • SAA levels were determined by ELISA (Immunology Consultants Laboratory, Inc, Newberg, OR). Sera collected at the peak of an acute phase response were diluted 10,000-fold prior to assay. The linear range of the assay was between 30 and 1000 ng/ml. Absolute SAA levels were expressed as mg/mL. The percent reduction in SAA levels relative to the PBS control is also presented. The results are presented in Table 17 and indicate that SAA levels in ISIS 145016-treated mice were significantly lower compared to the control. The control oligonucleotide, ISIS 141923, did not have any significant effect of SAA levels, as expected.
  • mice were injected with silver nitrate (0.2 mL of a 2% solution) to stimulate inflammation and induce SAA expression.
  • Groups of 4-7 mice each were injected with 50 mg/kg of ISIS 145016, ISIS 145020, or control oligonucleotide ISIS 141923, administered 72 hrs prior to silver nitrate, as indicated in Table 18.
  • a control group of 6 mice was injected with PBS administered 72 hrs prior to silver nitrate. Table 18
  • Cytokine levels were assayed in sera collected 24 hrs after silver nitrate stimulation.
  • Levels of cytokines including TNF-a, IL-la, IL- ⁇ , IL-6, leptin, vascular endothelial growth factor (VEGF), insulin growth factor (IGF-1), and granulocyte colony-stimulating factor (GCSF) were compared using ELISA strips for profiling cytokines (Signosis Inc., Sunnyvale, CA). Sera were diluted prior to the assay. Signals generated by sera from the ISIS oligonucleotide-treated mice were expressed as a percentage of signals generated by sera from the PBS control.
  • mice treated with ISIS 145020 were uniformly lower in mice treated with ISIS 145020 than in the PBS control.
  • signals for ISIS oligonucleotide-treated mice averaged 67% (33% reduction) for IL- ⁇ , 74% (26% reduction) for VEGF, and 73% (27% reduction) for GCSF.
  • the two treatment groups showed little or no difference in the relative levels of leptin, TNF-a, IGF-1 , EL- 6, and IL-la.
  • MSD Multi-Array Proinflammatory 7-Plex (Meso Scale Discovery
  • CXCLl chemokine ligand 1
  • Table 19 The mean level of CXCLl was significantly lower in ISSI 145016- treated mice than that of the PBS control. A trend of reduced serum levels of IL-1 ⁇ , IL-6 and IL-10 in ISIS oligonucleotide-treated mice was observed. Decreased levels of CXCLl in ASO-treated mice suggest that SAA triggers or perpetuates a proinflammatory cytokine response, at least with CXCLl and possibly also IL-6, IL-1 ⁇ , and IL-10, that is ameliorated with ASO treatment.
  • Serum proteins were electrophoresed through 16.5% polyacrylamide-Tris-Tricine-urea (6.4 M)-sodium dodecyl sulfate gels (SDS-PAGE) (Schagger, H. and von Jagow, G. Anal. Biochem. 166: 368-379, 1987). Proteins were transferred to polyvinylidene fluoride (PVDF) and stained with Coomassie blue. N-terminal sequencing identified amyloidogenic SAAl as the faster migrating isoform (lower band) and SAA2 as the slower migrating isoform (upper band). Relative levels of SAAl and SAA2 were then determined by quantitative western analysis.
  • Serum proteins were fractionated by Tris-Tricine-urea-SDS-PAGE and transferred to nitrocellulose.
  • SAAs were detected using rabbit anti-SAA antiserum (generated in the Dept. of Pathology and Laboratory Medicine, Indiana University School of Medicine. Indianapolis, IN) and IRDye 800 CW infrared-labeled goat anti-rabbit secondary antibody (Li-Cor Biosciences, Lincoln, NE). Signals were quantified using Li-Cor Odyssey Imager software.
  • the ratio of signal intensities for SAAl and SAA2 in ISIS oligonucleotide-treated mice did not differ from the ratio seen in the PBS control, consistent with the ISIS oligonucleotides affecting SAAl and SAA2 equally.
  • Example 5 In Vivo Effect of Antisense Inhibition in a model of experimentally-induced amyloid A (AA) amyloidosis
  • AA amyloidosis can be induced in mice by an accelerated disease model wherein the long latency phase is bypassed by providing a preformed amyloid nidus, an extract of amyloid-laden tissue referred to as amyloid-enhancing factor (AEF), and then inducing inflammation with the potent stimulus silver nitrate (Kisilevsky R. Preparation and propagation of amyloid-enhancing factor. Methods Mol Biol
  • Amyloid can be detected within several days.
  • AA amyloidosis can be induced in mice by injection of amyloid- enhancing factor (AEF) and silver nitrate.
  • AEF amyloid- enhancing factor
  • AEF 100 ⁇ g in 100 L of water
  • silver nitrate 0.2 mL of a 2% solution
  • Mice received subsequent silver nitrate injections, as indicated.
  • Female NIH Swiss White mice were obtained from Harlan Labs (Indianapolis, IN)- The mice were fed ad libitum standard lab chow.
  • amyloid was first induced in all mice by injection of AEF and silver nitrate (day 1).
  • Amyloid induction was allowed to proceed. A group of mice was then treated with 25 mg/kg ISIS 145016, administered intraperitoneally on day 9 and hence, once a week thereafter (days 9, 15, 22, and 29).
  • mice were similarly treated with PBS. Inflammation was re-triggered in all mice by injections of silver nitrate on days 9, 15, and 22.
  • Sections were also deparaffinized with xylene and rehydrated with water. Endogenous peroxidase was quenched by incubation in 0.3% hydrogen peroxide in 100% methanol for 30 min. Blocking was performed for 30 min in 1.5% normal horse serum in PBS. Sections were then sequentially incubated at room temperature with rabbit anti-mouse SAA antiserum (generated in the Dept. of Pathology and Laboratory Medicine, Indiana University School of Medicine. Indianapolis, IN) for 1 hr and Impress anti- rabbit reagent (Vector Laboratories, Burlingame, CA) for 30 min. Color was developed using Sigma FAST diaminobenzidine and urea tablets (Sigma-Aldrich, St. Louis, MO) as substrate. Sections were counterstained with Gill's hematoxylin. SAA AA immunostaining was much less prominent in ISIS oligonucleotide-treated mice compared to the PBS control ( Figure 1).
  • AEF and silver nitrate were administered on day 1.
  • 50 mg/kg of ISIS 145020 or PBS was administered subcutaneously and subsequently administered on days 11, 13, 15, 18, 20, 22, 25, 27, 29, 33, and 35.
  • inflammation was re-stimulated in all mice by a second injection of silver nitrate.
  • mice were sacrificed on day 36. On necropsy, spleen from PBS control mice contained the most extensive deposits, followed sequentially by liver, intestine, and kidney. The corresponding organs in mice treated with ISIS antisense oligonucleotides contained less amyloid. Amyloid deposition was evaluated after Congo red staining (procedure described above) and by scoring the extent of Congo red staining in tissue sections. Scores ranged from 0.5 through 4. A score of 0 was assigned to sections with no stain and "trace" was assigned to sections with specks of stain too small in size and number to score. Scores for the spleen were based upon the width of perifollicular staining and percentage of follicles showing Congo red staining.
  • Scores for the liver were based upon the area of staining in periportal areas and extent to which staining extended into the parenchyma. Scores for the intestine were based upon the number of lamina basement stained and whether staining was present in the submucosa. Scores for the kidney were based upon the area of staining in the medullary refion and whether staining was present in interstitial areas of the cortex (glomerular staining was extremely rare). Scores for the heart were based upon the size and number of vascular as well as interstitial deposits. Two sections from each mouse and a minimum of 4 separate fields (10X objective) per section were examined. The results are presented in Table 20 and indicate that antisense inhibition of SAA reduced amyloid deposition in mice compared to the PBS control.
  • AEF and silver nitrate were administered on day 1.
  • 50 mg/kg of ISIS 145020 or PBS was administered subcutaneously and subsequently administered on days 1 1 , 13, 15, 17, 20, 22, 24, 27, and 29.
  • inflammation was re-stimulated in all mice by a second injection of silver nitrate.
  • Blood was collected on days 2, 8, 13, 17, 23, 27, and 31 of the first silver nitrate administration for measurement of SAA.
  • Mice were sacrificed on day 31.
  • Table 21 the spleen and liver of all five ISIS oligonucleotide-treated mice contained less amyloid than the corresponding organs of all 6 PBS-treated mice.
  • the overall level of SAA/AA as detected by immunostaining, was also reduced (Figure 2).
  • the mean levels of SAA in the serum are presented in Table 22 and indicate that treatment with ISIS 145020 reduced serum SAA levels compared to the PBS control.
  • the percent reduction in SAA levels relative to the PBS control is also presented.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des composés anti-sens et des procédés de modulation de SAA et d'une maladie, d'un trouble ou d'un état inflammatoire chez un individu qui en nécessite. Des maladies inflammatoires chez un individu, telles qu'une amylose, peuvent être améliorées ou prévenues par l'administration de composés anti-sens dirigés contre SAA.
PCT/US2012/050417 2011-08-10 2012-08-10 Modulation de réponses inflammatoires par saa1 et saa2 WO2013023172A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161522199P 2011-08-10 2011-08-10
US61/522,199 2011-08-10

Publications (1)

Publication Number Publication Date
WO2013023172A1 true WO2013023172A1 (fr) 2013-02-14

Family

ID=47669002

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/050417 WO2013023172A1 (fr) 2011-08-10 2012-08-10 Modulation de réponses inflammatoires par saa1 et saa2

Country Status (1)

Country Link
WO (1) WO2013023172A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6455308B1 (en) * 2001-08-01 2002-09-24 Isis Pharmaceuticals, Inc. Antisense modulation of serum amyloid A4 expression
US20090280108A1 (en) * 2004-12-10 2009-11-12 Da-Wei Gong Serum amyloid a protein in inflammation and obesity
WO2010036962A1 (fr) * 2008-09-25 2010-04-01 Alnylam Pharmaceuticals, Inc. Compositions a base de preparation lipidique et methodes destinees a inhiber l'expression d'un gene de serum amyloïde a

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6455308B1 (en) * 2001-08-01 2002-09-24 Isis Pharmaceuticals, Inc. Antisense modulation of serum amyloid A4 expression
US20090280108A1 (en) * 2004-12-10 2009-11-12 Da-Wei Gong Serum amyloid a protein in inflammation and obesity
WO2010036962A1 (fr) * 2008-09-25 2010-04-01 Alnylam Pharmaceuticals, Inc. Compositions a base de preparation lipidique et methodes destinees a inhiber l'expression d'un gene de serum amyloïde a

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK retrieved from http://www.ncbi.nlm.nih.gov/nuccore/M11130.1 accession no. 11130 *
YAMAMOTO ET AL.: "Complete primary structures of two major murine serum amyloid A proteins deduced from cDNA sequences.", PROC. NAT. ACAD. SCI., vol. 82, 1985, pages 2915 - 2919 *

Similar Documents

Publication Publication Date Title
EP2521556B1 (fr) Modulation de l'expression de l'analogue de l'angiopoïétine 3
US10184125B2 (en) Modulation of TMPRSS6 expression
US9187749B2 (en) Methods for modulating factor 12 expression
AU2012267546B2 (en) Methods for modulating kallikrein (KLKB1) expression
EP2877579B1 (fr) Modulation de maladies associées au système rénine angiotensine (ras) par l'angiotensinogène
EP2640853A2 (fr) Modulation de l'expression de l'alpha synucléine
WO2011127175A1 (fr) Modulation de l'expression de cd130 (gp130)
WO2012174154A1 (fr) Modulation de réponses inflammatoires par le facteur vii
EP3265564B1 (fr) Méthodes de modulation de l'expression de mecp2
WO2014036301A1 (fr) Modulation de maladies liées au cuivre par le gène ctr1
WO2013130868A1 (fr) Méthodes de modulation de l'expression des fibrinogènes
WO2011133918A1 (fr) Modulation de l'expression de la synthase gm3 (gm3s)
WO2013023172A1 (fr) Modulation de réponses inflammatoires par saa1 et saa2
AU2017201078C1 (en) Modulation of angiopoietin-like 3 expression
WO2012161806A1 (fr) Modulation de l'expression de stat3
WO2011133915A1 (fr) Modulation de l'expression de la glucosylcéramide synthase (gcs)
WO2011133923A1 (fr) Modulation de l'expression de la lactosylcéramide synthase (lcs)
WO2014160211A1 (fr) Modulation des réponses inflammatoires par une protéine c-réactive
WO2012149465A2 (fr) Modulation de l'expression de cd36

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12821827

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12821827

Country of ref document: EP

Kind code of ref document: A1