WO2011133923A1 - Modulation de l'expression de la lactosylcéramide synthase (lcs) - Google Patents

Modulation de l'expression de la lactosylcéramide synthase (lcs) Download PDF

Info

Publication number
WO2011133923A1
WO2011133923A1 PCT/US2011/033653 US2011033653W WO2011133923A1 WO 2011133923 A1 WO2011133923 A1 WO 2011133923A1 US 2011033653 W US2011033653 W US 2011033653W WO 2011133923 A1 WO2011133923 A1 WO 2011133923A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
antisense
wing segment
antisense oligonucleotide
modified
Prior art date
Application number
PCT/US2011/033653
Other languages
English (en)
Inventor
Jozsef Karman
Canwen Jiang
James Dodge
Nelson S. Yew
Yunxiang Zhu
Seng H. Cheng
Hongmei Zhao
Andrew Leger
Huynh-Hoa Bui
Original Assignee
Isis Pharmaceuticals, Inc.
Genzyme Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals, Inc., Genzyme Corporation filed Critical Isis Pharmaceuticals, Inc.
Publication of WO2011133923A1 publication Critical patent/WO2011133923A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===

Definitions

  • LCS mRNA and protein in an animal.
  • methods, compounds, and compositions having a LCS inhibitor for reducing LCS related diseases or conditions in an animal are useful, for example, to treat, prevent, delay, decrease or ameliorate any one or more airway inflammation or airway
  • AHR hyperresponsiveness
  • Lipid rafts present in the cell membrane of mast cells and granulocytes reportedly can play an important role in modulating the activation of these cells (Draber, P. et al., Mol Immunol. 2002, 38: 1247-52), which in turn can be regulated by the composition of glycosphingolipids (GSL) in the rafts' membrane (Mishra, S. et al., J
  • Lactosylceramide synthase (also known as LCS, B4GALT6 or UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6) catalyzes the transfer of galactose from UDP- Galactose to glucosylceramide to form lactosylceramide.
  • Lactosylceramide is a
  • glycosphingolipid present in many mammalian cells and is the precursor for the synthesis of several classes of glycosphingolipids (Takizawa et al., Biochim Biophys Acta. 1999,
  • Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of LCS expression.
  • Antisense oligonucleotides targeted to a number of targets including, but not limited to p38 alpha MAP kinase (US Patent Publication No. 20040171566, incorporated by reference); the CD28 receptor ligands B7-1 and B7-2 (US Patent Publication 20040235164, incorporated by reference);
  • ICM intracellular adhesion molecule
  • adenosine A ⁇ receptor WO 2004/108945, incorporated by reference
  • AHR airway hyperresponsiveness
  • JNK-1 Jun N-terminal Kinase
  • oligonucleotides targeted to JNK-1 were not effective at reducing methacholine induced AHR, eosinophil recruitment, or mucus production at any of the antisense oligonucleotide doses tested (Zhang, J.P. et al., Clin Exp Immunol. 2000. 122: 20-27).
  • RNAi and dsRNA enzymes are provided herein.
  • compounds useful for modulating gene expression and associated pathways via antisense mechanisms of action such as RNaseH, RNAi and dsRNA enzymes, as well as other antisense mechanisms based on target degradation or target occupancy.
  • the LCS related disease or condition is airway inflammation, airway hyperresponsiveness or a pulmonary disease.
  • the compounds or compositions of the invention comprise a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to LCS.
  • the LCS target can have a sequence selected from any one of SEQ ID NOs: 1-3.
  • the modified oligonucleotide targeting LCS can have a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of SEQ ID NOs: 1-3.
  • the modified oligonucleotide can have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases.
  • the contiguous nucleobase portion of the modified oligonucleotide can be complementary to an equal length portion of a LCS region selected from any one of SEQ ID NOs: 1-3.
  • the contiguous nucleobase portion of the modified oligonucleotide can be a sequence selected from any one of SEQ ID NOs: 35-113.
  • the compound comprises a modified oligonucleotide having a gap motif with a gap segment consisting of eight to twelve linked deoxynucleosides, a 5' wing segment consisting of three to seven linked nucleosides and a 3' wing segment consisting of three to seven linked nucleosides, wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment.
  • the compound comprises a modified oligonucleotide having at least one 2'-MOE sugar, at least one phosphorothioate linkage and at least one 5'- methylcytosine.
  • Certain embodiments provide a pharmaceutical composition
  • a pharmaceutical composition comprising the compound of the invention, or a salt thereof, and a pharmaceutically acceptable carrier or diluent.
  • Certain embodiments provide a method of reducing LCS expression in an animal comprising administering to the animal a compound comprising the modified oligonucleotide targeting LCS described herein.
  • inflammation, airway hyperresponsiveness or pulmonary disease in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeted to LCS described herein, wherein the modified oligonucleotide reduces LCS expression in the animal.
  • Certain embodiments provide a method for treating an animal with airway inflammation and/or airway hyperresponsiveness comprising: 1) identifying the animal prone to airway inflammation and/or airway hyperresponsiveness, and 2) administering to the animal a therapeutically effective amount of a compound consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to SEQ ID NO: 1 -3 as measured over the entirety of said compound.
  • the therapeutically effective amount of the compound administered to the animal reduces airway inflammation and/or airway
  • 2'-0-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2'-0-methoxyethyl nucleotide means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety.
  • 3' target site refers to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound or oligonucleotide.
  • 5' target site refers to the nucleotide of a target nucleic acid which is complementary to the 5' -most nucleotide of a particular antisense compound or oligonucleotide.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5-methylcytosine is a modified nucleobase.
  • “About” means within ⁇ 10% of a value. For example, if it is stated, “the compounds affected at least about 70% inhibition of LCS", it is implied that the LCS levels are inhibited within a range of 63% and 77%.
  • Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual.
  • an antisense compound targeted to LCS is an active pharmaceutical agent.
  • Active target region or “target region” means a region to which one or more active antisense compounds is targeted.
  • Active antisense compounds means antisense compounds that reduce target nucleic acid levels or protein levels.
  • administering refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing an agent to an animal, and includes, but is not limited to, administering by a medical professional and self-administering. Administering the antisense compound of the invention to an animal can be performed by a variety of routes including, but not limited to, intranasal, intrapulmonary and intratracheal. Devices for administration of the antisense compound include, but are not limited to, metered dose inhalers, nebulizers and colloidal dispersion systems.
  • Agent means an active substance that can provide a therapeutic benefit when administered to an animal.
  • First Agent means a therapeutic compound of the invention.
  • a first agent can be an antisense oligonucleotide targeting LCS.
  • second agent means a second therapeutic compound of the invention (e.g. a second antisense oligonucleotide targeting LCS) and/or a non-LCS therapeutic compound.
  • Airway inflammation means inflammation of the air passages of a subject.
  • Airway inflammation can be present in subjects suffering from a variety of diseases including, but not limited to, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma (e.g., allergic asthma, non-allergic asthma).
  • diseases including, but not limited to, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma (e.g., allergic asthma, non-allergic asthma).
  • COPD chronic obstructive pulmonary disease
  • Airway hyperresponsiveness is a state where the airways (bronchioles) of a subject are easily triggered to spasm (constrict). Airway hyperresponsiveness can be assessed in a subject with a challenge test. For example,
  • Airway hyperresponsiveness can include any number of conditions, including, but not limited to, emphysema, chronic bronchitis or asthma.
  • “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition.
  • the severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an oligonucleotide can be an antisense compound.
  • antisense compound also encompasses pharmaceutically acceptable derivatives of the compounds described herein.
  • Antisense inhibition means the reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • the term “antisense oligonucleotide” encompasses pharmaceutically acceptable derivatives of the compounds described herein.
  • asthma is a predisposition to inflammation of the lungs where airways are reversibly narrowed and which can progress into a chronic inflammation of the lungs.
  • the smooth muscle cells in the airways constrict, the airways become inflamed and swollen, edema of the mucosa occurs, mucus accumulates in the bronchi and bronchioles and breathing becomes difficult.
  • Indications of asthma can include airflow obstruction, bronchial hyperresponsiveness, and an underlying inflammation.
  • Allergic asthma is asthma caused by an allergen.
  • Bicyclic sugar means a furosyl ring modified by the bridging of two non-geminal ring atoms.
  • a bicyclic sugar is a modified sugar.
  • BNA Bicyclic nucleic acid
  • BNA a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0-methoxyethyl modifications.
  • Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions.
  • Co-administration means administration of two or more agents to an individual.
  • the two or more agents can be in a single pharmaceutical composition, or can be in separate pharmaceutical compositions.
  • Each of the two or more agents can be administered through the same or different routes of administration.
  • Co-administration encompasses parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • complementarity between the first and second nucleic acid may be between two DNA strands, between two RNA strands, or between a DNA and an RNA strand.
  • some of the nucleobases on one strand are matched to a complementary hydrogen bonding base on the other strand.
  • all of the nucleobases on one strand are matched to a complementary hydrogen bonding base on the other strand.
  • a first nucleic acid is an antisense compound and a second nucleic acid is a target nucleic acid. In certain such embodiments, an antisense
  • oligonucleotide is a first nucleic acid and a target nucleic acid is a second nucleic acid.
  • Consstrained ethyl or “cEt” refers to a bicyclic nucleoside having a furanosyl sugar that comprises a methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') bridge between the 4' and the 2' carbon atoms.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • COPD chronic bronchitis or emphysema
  • Cross-reactive means an oligomeric compound targeting one nucleic acid sequence can hybridize to a different nucleic acid sequence.
  • an antisense oligonucleotide targeting human LCS can cross-react with a murine LCS.
  • Whether an oligomeric compound cross-reacts with a nucleic acid sequence other than its designated target depends on the degree of complementarity the compound has with the non-target nucleic acid sequence.
  • “Cure” means a method that restores health or a prescribed treatment for an illness.
  • Decreasing airway inflammation and/or airway hyperresponsiveness means to ameliorate at least one symptom or aspect of airway inflammation or airway hyperresponsiveness. For example, increasing lung function (as assayed by spirometry or plethysmography) decreases airway inflammation and/or airway hyperresponsiveness.
  • Deoxyribonucleotide means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition can be a liquid, e.g. saline solution.
  • Dosage unit means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art.
  • a dosage unit is a vial containing lyophilized antisense oligonucleotide.
  • a dosage unit is a vial containing reconstituted antisense oligonucleotide.
  • Dose means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period.
  • a dose can be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously.
  • Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month. Doses can be expressed, for example, as mg/kg.
  • Effective amount or “therapeutically effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
  • the effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Fully complementary” or “100% complementary” means each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid.
  • a first nucleic acid is an antisense compound and a second nucleic acid is a target nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region can be referred to as a "gap segment” and the external regions can be referred to as "wing segments.”
  • Gap- widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
  • Identifying or “selecting a subject having airway inflammation and/or airway hyperresponsiveness” means identifying or selecting a subject prone to or having been diagnosed with a airway inflammation and/or airway hyperresponsiveness; or, identifying or selecting a subject having airway inflammation and/or airway hyperresponsiveness or symptom thereof, including, but not limited to, reduced lung function, reduced lung volume, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma.
  • identification may be accomplished by any method, including but not limited to, standard clinical tests or assessments, such as measuring lung function, lung volume and the like.
  • “Improved pulmonary outcome” means a reduction in the occurrence of adverse pulmonary events, or the risk thereof.
  • adverse pulmonary events include, without limitation, death, airway restriction, an asthmatic attack, airway inflammation and airway hyperresponsiveness.
  • “Individual” or “subject” or “animal” means a human or non-human animal selected for treatment or therapy.
  • an amount effective to inhibit the activity or expression of LCS means that the level of activity or expression of LCS in a treated sample will differ from the level of LCS activity or expression in an untreated sample. Such terms are applied to, for example, levels of expression, and levels of activity.
  • “Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Intravenous administration means administration into a vein of a subject.
  • Intranasal administration means administration into the nose of a subject.
  • Intrapulmonary administration means administration into the lungs of a subject.
  • Intratracheal administration means administration into the trachea of a subject.
  • LCS or "lactosylceramide synthase” means any nucleic acid or protein of
  • LCS expression means the level of mRNA transcribed from the gene encoding LCS or the level of protein translated from the mRNA. LCS expression can be determined by art known methods such as a Northern or Western blot.
  • LCS nucleic acid means any nucleic acid encoding LCS.
  • a LCS nucleic acid includes a DNA sequence encoding LCS, a RNA sequence transcribed from DNA encoding LCS (including genomic DNA comprising introns and exons), and a mRNA sequence encoding LCS.
  • “LCS mRNA” means a mRNA encoding a LCS protein.
  • Linked nucleosides means adjacent nucleosides which are bonded together.
  • mismatch or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
  • Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
  • a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising at least one modified nucleotide.
  • Modified sugar refers to a substitution or change from a natural sugar.
  • Microtif means the pattern of chemically distinct regions in an antisense compound.
  • Natural sugar moiety means a sugar found in DNA (2'-H) or RNA (2'-OH).
  • Nucleic acid refers to molecules composed of monomelic nucleotides.
  • a nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • a nucleic acid can also comprise a combination of these elements in a single molecule.
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the oligonucleotide and the target nucleic acid are considered to be complementary at that nucleobase pair.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound; for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics such as non furanose sugar units.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Oligomeric compound refers to a polymeric structure comprising two or more sub-structures and capable of hybridizing to a region of a nucleic acid molecule.
  • oligomeric compounds are oligonucleosides.
  • oligomeric compounds are oligonucleotides.
  • oligomeric compounds are antisense compounds.
  • oligomeric compounds are antisense oligonucleotides.
  • oligomeric compounds are chimeric oligonucleotides.
  • “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Admimstration can be continuous, or chronic, or short or intermittent.
  • Peptide means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.
  • “Pharmaceutical agent” means a substance that provides a therapeutic benefit when administered to an individual.
  • an antisense compound targeted to LCS is pharmaceutical agent.
  • composition means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution.
  • “Pharmaceutically acceptable carrier” means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain, of such carries enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. Certain of such carriers enable pharmaceutical compositions to be formulated for injection, infusion or topical administration.
  • a pharmaceutically acceptable carrier can be a sterile aqueous solution.
  • “Pharmaceutically acceptable derivative” encompasses derivatives of the compounds described herein such as solvates, hydrates, esters, prodrugs, polymorphs, isomers, isotopically labelled variants, conjugates, pharmaceutically acceptable salts and other derivatives known in the art.
  • pharmaceutically acceptable salts of antisense compounds i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • pharmaceutically acceptable salt or “salt” includes a salt prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic or organic acids and bases.
  • “Pharmaceutically acceptable salts” of the compounds described herein may be prepared by methods well-known in the art. For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley- VCH, Weinheim, Germany, 2002). Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic aclrninistration to humans. Accordingly, in one embodiment the compounds described herein are in the form of a sodium salt.
  • Phosphorothioate linkage means a linkage between nucleosides where the
  • phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • Portion means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e. a drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • Pulmonary Disease means a disease of the lung. Pulmonary disease can include, but is not limited to, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, pulmonary hyperresponsiveness, emphysema, chronic obstructive pulmonary disease (COPD) and asthma.
  • COPD chronic obstructive pulmonary disease
  • Region or target region is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • “Ribonucleotide” means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.
  • “Second agent” or “second therapeutic agent” means an agent that can be used in combination with a “first agent”.
  • a second therapeutic agent can be any agent that treats, prevents, delays, decreases or ameliorates airway inflammation and/or airway
  • a second therapeutic agent can include, but is not limited to, an siRNA or antisense oligonucleotide including antisense oligonucleotides targeting LCS.
  • a second agent can also include antibodies (e.g., anti-LCS antibodies), peptide inhibitors (e.g., LCS peptide inhibitors) and anti-inflammatory agents.
  • a “target segment” means the sequence of nucleotides of a target nucleic acid to which one or more antisense compounds is targeted.
  • “5' target site” refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • Side effects means physiological responses attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased
  • aminotransferase levels in serum can indicate liver toxicity or liver function abnormality.
  • increased bilirubin can indicate liver toxicity or liver function abnormality.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Subcutaneous administration means administration just below the skin.
  • Subject means a human or non-human animal selected for treatment or therapy.
  • Targeting or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid “Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • Treat refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.
  • Unmodified nucleotide means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • the compounds of the invention comprise an oligonucleotide.
  • the antisense oligonucleotide can comprise 10 to 30 linked nucleosides in length targeted to LCS.
  • the LCS target can have a sequence selected from any one of SEQ ID NOs: 1-3.
  • the antisense oligonucleotide can consist of 10 to 30 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NOs: 1-3.
  • the antisense oligonucleotide can consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NO: 43 or 63. In certain embodiments, the antisense
  • oligonucleotide can consist of 10 to 30 linked nucleosides and have a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NO: 35-113.
  • the antisense oligonucleotide consists of any one of the nucleobase sequences recited in SEQ ID NO: 35-113.
  • the antisense oligonucleotide consists of any one of the nucleobase sequences recited in SEQ ID NO: 43 or 63
  • the compound of the invention comprises a salt.
  • the compound of the invention comprises a pharmaceutically acceptable carrier or diluent.
  • the compound of the invention is single-stranded.
  • the nucleobase sequence of the compound is at least 70%, 80%, 90%, 95% or 100%) complementary to any one of SEQ ID NO: 1-3 as measured over the entirety of the compound.
  • the compound of the invention consists of 20 linked nucleosides.
  • At least one internucleoside linkage of said compound is a modified internucleoside linkage.
  • each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • At least one nucleoside of the compound comprises a modified sugar.
  • the compound comprises at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces a furanose ring.
  • each of the at least one tetrahydropyran modified nucleoside has the structure:
  • At least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2'-0-methoxyethyl or a 4'- (CH 2 ) n -0-2' bridge, wherein n is 1 or 2.
  • At least one nucleoside of said compound comprises a modified nucleobase.
  • the modified nucleobase is a 5-methylcytosine.
  • the compound comprises an antisense oligonucleotide with: a) a gap segment consisting of linked deoxynucleosides; b) a 5' wing segment consisting of linked nucleosides; and c) a 3' wing segment consisting of linked nucleosides.
  • the gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar.
  • the compound comprises an antisense oligonucleotide consisting of 20 linked nucleosides, the gap segment consisting of ten linked deoxynucleosides, the 5' wing segment consisting of five linked nucleosides, the 3' wing segment consisting of five linked nucleosides, the gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar and each internucleoside linkage is a phosphorothioate linkage.
  • the antisense oligonucleotide of the invention consists of 20 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NO: 1-3, wherein the antisense oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides.
  • each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine residue is a 5- methylcytosine.
  • the antisense oligonucleotide of the invention consists of 20 linked nucleosides having a nucleobase sequence 100% complementary to an equal length portion of any of SEQ ID NO: 1-3, wherein the antisense oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides.
  • each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine residue is a 5-methylcytosine.
  • the antisense oligonucleotide comprises at least 8 contiguous nucleobases of a nucleobase sequence selected from a sequence recited in any of SEQ ID NOs: 35-113. In certain embodiments, the antisense oligonucleotide consists of a nucleobase sequence selected from any of SEQ ID NOs: 43 or 63.
  • Certain embodiments provide methods, compounds, and compositions for inhibiting LCS expression.
  • Certain embodiments provide a method of reducing LCS expression in an animal comprising administering to the animal a compound of the invention 10 to 30 linked nucleosides in length targeted to LCS.
  • Certain embodiments provide a method of preventing, decreasing or ameliorating airway inflammation and/or airway hyperresponsiveness in an animal comprising administering to the animal a compound 10 to 30 linked nucleosides in length targeted to LCS, thereby preventing, decreasing or ameliorating the airway inflammation and/or airway hyperresponsiveness in the animal.
  • the compound is administered prophylactically.
  • Certain embodiments provide a method for treating an animal with airway inflammation and/or airway hyperresponsiveness comprising: a) identifying said animal prone to or with airway inflammation and/or airway hyperresponsiveness, and b) administering to said animal a therapeutically effective amount of a compound consisting of 20 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NO: 1-3 as measured over the entirety of said compound, thereby treating the animal with airway inflammation and/or airway hyperresponsiveness.
  • the therapeutically effective amount of the compound administered to the animal reduces the airway inflammation and/or airway
  • Certain embodiments of the invention provide a method for treating airway inflammation and/or airway hyperresponsiveness in an animal comprising administering to the animal a therapeutically effective amount of the compound of the invention.
  • the compound consists of 20 linked nucleosides having a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion of any of SEQ ID NO: 1-3, wherein the compound comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5' wing segment consisting of five linked nucleosides; and c) a 3' wing segment consisting of five linked nucleosides.
  • each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine residue is a 5- methylcytosine.
  • the compound of the invention is an antisense oligonucleotide.
  • the airway inflammation and/or airway hyperresponsiveness includes, but is not limited to, pulmonary disease, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma (e.g., allergic asthma, non-allergic asthma).
  • pulmonary disease chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma (e.g., allergic asthma, non-allergic asthma).
  • COPD chronic obstructive pulmonary disease
  • one or more symptoms or indications of airway inflammation or airway hyperresponsiveness can be independently reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% by administering the compound of the invention to a subject.
  • Administering the compound of the invention can result in decreased airway constriction and/or improved air flow through a subject's airways.
  • the animal is a human.
  • the compounds or compositions of the invention are designated as a first agent and the methods of the invention further comprise administering a second agent.
  • the first agent and the second agent are co-administered.
  • the first agent and the second agent are co-administered sequentially or
  • the second agent is an anti-inflammation medication.
  • Anti- inflammatory medications can include steroids, NSAIDS (non-steroidal anti-inflammatory drugs), COX inhibitors, antihistamines and the like.
  • the second agent can be an asthma medication such as an anti-inflammatory drug, a bronchodilator (e.g., beta-2 agonists (LAB A2), theophylline, ipratropium), a leukotriene modifier, Cromolyn, nedocromil, a decongestant and immunotherapy.
  • a bronchodilator e.g., beta-2 agonists (LAB A2), theophylline, ipratropium
  • a leukotriene modifier Cromolyn, nedocromil, a decongestant and immunotherapy.
  • the compound is aerosolized and administered by inhalation to the animal.
  • the compound is administered intranasally, intrapulmonarily or intratracheally.
  • Adminstration of the compound can be by any device including, but not limited to, a metered dose inhaler, nebulizer or colloidal dispersion system.
  • airway inflammation or airway hyperresponsiveness can be pulmonary disease, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma.
  • COPD chronic obstructive pulmonary disease
  • Certain embodiments provide the use of a compound as described herein for treating, ameliorating, delaying or preventing one or more of airway inflammation or airway
  • airway inflammation or airway hyperresponsiveness can be pulmonary disease, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma.
  • AHR hyperresponsiveness
  • airway inflammation or airway hyperresponsiveness can be pulmonary disease, chronic bronchitis, pulmonary fibrosis, pulmonary inflammation, emphysema, chronic obstructive pulmonary disease (COPD) and asthma.
  • COPD chronic obstructive pulmonary disease
  • kits for treating, preventing, or ameliorating one or more of airway inflammation or airway hyperresponsiveness as described herein wherein the kit comprises: a) a compound as described herein; and optionally b) an additional agent or therapy as described herein.
  • the kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate one or more of airway inflammation or airway hyperresponsiveness.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense
  • oligonucleotides and siRNAs.
  • An oligomeric compound can be "antisense" to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense
  • oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound targeted to LCS nucleic acid is 10 to 30 nucleotides in length. In other words, antisense compounds are from 10 to 30 linked
  • the antisense compound comprises a modified
  • the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.
  • the antisense compound comprises a shortened or truncated modified oligonucleotide.
  • the shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5' end (5' truncation), central portion or alternatively from the 3' end (3' truncation).
  • a shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5' end, two or more nucleosides deleted from the central portion or alternatively can have two or more nucleosides deleted from the 3' end.
  • the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one or more nucleoside deleted from the 5' end, one or more nucleoside deleted from the 3' end and/or one or more nucleoside deleted from the central portion of the antisense compound.
  • the additional nucleoside can be located at the central portion or 5' or 3' end of the oligonucleotide.
  • the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the central portion, 5' end (5' addition), or alternatively to the 3' end (3' addition) of the oligonucleotide.
  • the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one nucleoside added to the 5' end and one subunit added to the 3' end or central portion.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo.
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo.
  • antisense compounds targeted to a LCS nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • each distinct region comprises uniform sugar moieties.
  • wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment.
  • Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other embodiments they are different.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides.
  • gapmers include, but are not limited to, for example 5-10-5, 4- 8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 1- 8-1, 2-6-2, 2-13-2, 1-8-2, 2-8-3, 3-10-2, 1-18-2 or 2-18-2.
  • the antisense compound is a "wingmer" motif, having a wing- gap or gap- wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration.
  • wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.
  • antisense compounds targeted to a LCS nucleic acid possess a 5- 10-5 gapmer motif.
  • an antisense compound targeted to a LCS nucleic acid has a gap- widened motif.
  • Nucleotide sequences that encode LCS include, without limitation, the following: the murine sequence as set forth in GenBank Accession No. NM_019737.1 (incorporated herein as SEQ ID NO: 1) and GenBank Accession No. NT_039674.7 truncated from nucleotides 17841000 to 17907000 (incorporated herein as SEQ ID NO: 2) or the human sequence as set forth in GenBank Accession No. NM 004775.2 (incorporated herein as SEQ ID NO: 3). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • antisense compounds defined by a SEQ ID NO can comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region can encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for LCS can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region can encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the target region.
  • a target segment is a smaller, sub-portion of a target region within a nucleic acid.
  • a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compounds are targeted.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • a target region can contain one or more target segments. Multiple target segments within a target region can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
  • Suitable target segments can be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment can specifically exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments can include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm can be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off- target sequences).
  • Reductions in levels of LCS protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes, such as a reduction of the level of airway constriction or an increase in airway flow, can be indicative of inhibition of LCS mRNA and/or protein expression.
  • hybridization occurs between an antisense compound disclosed herein and a LCS nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a LCS nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a LCS nucleic acid).
  • An antisense compound can hybridize over one or more segments of a LCS nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a LCS nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group,
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • an antisense compound can be fully complementary to a LCS nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase can be at the 5' end or 3' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases can be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases are present, they can be either contiguous (i.e. linked) or non-contiguous.
  • a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16,
  • nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a LCS nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, such as a LCS nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment.
  • antisense compounds that are complementary to at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein can also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or sequence of a compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases can be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein. Modifications
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.
  • Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • Modified Intemucleoside Linkages
  • RNA and DNA are naturally occurring intemucleoside linkage of RNA and DNA.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known.
  • antisense compounds targeted to a LCS nucleic acid comprise one or more modified internucleoside linkages.
  • internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkages are phosphorothioate linkages.
  • internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R !
  • R, Ri and R 2 are each independently H, Q- C 12 alkyl or a protecting group) and combinations thereof.
  • chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5*,2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S.
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R orS), 4*-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'- OCH 2 CH 2 F and 2'-0(CH 2 ) 2 OCH 3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to one of the formulae: 4*-(CH 2 )-0-2* (LNA); 4 , -(CH 2 )-S-2'; 4 , -(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )- 0-2' and 4'-CH(CH 2 OCH 3 )-0-2' (and analogs thereof see U.S.
  • Patent 7,427,672 issued on September 23, 2008
  • 4'-CH 2 -C(H)(CH 3 )-2' see Chattopadhyaya et al, J. Org. Chem., 2009, 74, 118-134
  • ⁇ -CBb-C ⁇ CH ⁇ )- ⁇ and analogs thereof see published International Application WO 2008/154401, published on December 8, 2008.
  • bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • x is 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • the bridge of a bicyclic sugar moiety is -[C(R a )(R b )] n -,
  • the bridge is 4*-CH 2 -2', 4'-(CH2)2-2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 )2-0-2 * , 4'-CH 2 -0-N(R)-2' and 4*-CH 2 - N(R)-0-2'- wherein each Ris, independently, H, a protecting group or Ci-C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric
  • a nucleoside comprising a 4' -2' methylene-oxy bridge
  • a nucleoside may be in the a-L configuration or in the ⁇ -D configuration.
  • a-L-methyleneoxy (4'-CH2-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365-6372).
  • bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA , (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA, (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene-amino (4' -CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )-2') BNA
  • Bx is the base moiety and R is independently H, a protecting group or Q-Cn alkyl.
  • bicyclic nucleosides are provided having Formula I:
  • Bx is a heterocyclic base moiety
  • -Q a -Q b -Qc- is -CH 2 -N(Rc)-CH 2 -, -CH 2 -0-N(Rc)-, -CH 2 -N(Rc)-0- or
  • Rc is Ci-Cn alkyl or an amino protecting group
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides are provided having Formula II: wherein:
  • Bx is a heterocyclic base moiety
  • T a and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is Ct-Q alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C ⁇ Q alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • bicyclic nucleosides are provided having Formula III:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides are provided having Formula IV: wherein:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Rd is C C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , qb, q c and qa is, independently, H, halogen, C C6 alkyl, substituted Q-C6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C6 alkynyl, alkoxyl, substituted C C 6 alkoxyl, acyl, substituted acyl, Ci-C 6 aminoalkyl or substituted C ⁇ -Ce aminoalkyl;
  • bicyclic nucleosides are provided having Formula V:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides are provided having Formula VI:
  • Bx is a heterocyclic base moiety
  • qi and qj or 3 ⁇ 4 and q k together are -C(q g )(q h ), wherein q g and q h are each, independently, H, halogen, C!-C 12 alkyl or substituted Ci-C 12 alkyl.
  • q g and q h are each, independently, H, halogen, C!-C 12 alkyl or substituted Ci-C 12 alkyl.
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring which connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2' modifications are selected from substituents including, but not limited to:
  • 2'- substituent groups can also be selected from: Ci-C alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'-MOE side chain (Baker et ah, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2 -MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O- methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2 -MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim.
  • a "modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoro HNA F-HNA) or those compounds having Formula VII:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T a and T b is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T a and T b is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each independently, H, C ⁇ -Ce alkyl, substituted Ci-C 6 alkyl,
  • the modified THP nucleosides of Formula VII are provided wherein q ls q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q4, qs, q6 and q 7 is other than H. In certain embodiments, at least one of q ls q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R 2 is fluoro. In certain embodiments, is fluoro and R 2 is H; R ⁇ is methoxy and R 2 is H, and R ⁇ is H and R 2 is methoxyethoxy.
  • 2 '-modified or “2 '-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2 '-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-Q-Cio alkyl, -OCF 3 , 0-(CH 2 ) 2 -0-CH 3 , 2'-0(CH 2 ) 2 SCH 3 , 0-(CH 2 ) 2 -0-N(R m )(R n ), or 0-CH 2 -C(O)- N(R m )(R n ), where each
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position.
  • 2'-OMe or “2'-OCH 3 " or “2'-0-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleobase moieties are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )- 0-2') bridging group.
  • the (4'-CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • the bicyclic nucleotide is a cEt.
  • the cEt bicyclic nucleotides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
  • Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil
  • Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5 -substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
  • antisense compounds targeted to a LCS nucleic acid comprise one or more modified nucleobases.
  • oligonucleotides targeted to a LCS nucleic acid comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense compounds such as oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • Antisense compound targeted to a LCS nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • the "pharmaceutical carrier” or “excipient” is a
  • the excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxyprop
  • compositions of the present invention can also be used to formulate the compositions of the present invention.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin,
  • hydroxymethylcellulose polyvinylpyrrolidone and the like.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a LCS nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or an oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • Antisense compounds can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures.
  • the cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini.
  • Cap structures are well known in the art and include, for example, inverted deoxy abasic caps.
  • 3' and 5 -stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.
  • LCS nucleic acids The effects of antisense compounds on the level, activity or expression of LCS nucleic acids can be tested in vitro in a variety of cell types.
  • Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, VA; Zen- Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g.
  • Illustrative cell types include, but are not limited to, 3T3, 3T3-L1, HepG2 cells, Hep3B cells, Huh7 (hepatocellular carcinoma) cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.
  • Described herein are methods for treatment of cells with antisense compounds such as oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN ® (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN ® in OPTI-MEM ® 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000 ® (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000 ® in OPTI-MEM ® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE ® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin ® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin ® in OPTI-MEM ® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin ® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes OligofectamineTM (Invitrogen Life Technologies, Carlsbad, CA). Antisense oligonucleotide is mixed with OligofectamineTM in Opti-MEMTM-l reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide with an OligofectamineTM to oligonucleotide ratio of approximately 0.2 to 0.8 ⁇ , per 100 nM.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum-free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 of FuGENE 6 per 100 nM.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrooke and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001).
  • Cells are treated with antisense oligonucleotides by routine methods.
  • Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrooke and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art.
  • Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000 ® , Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL ® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM ® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels can be accomplished by quantitative real-time PCR using the ABI PRISM ® 7600, 7700, or 7900 Sequence Detection System (PE-Applied
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT and real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR can be normalized using either the expression level of a gene whose expression is constant, such as GAPDH or cyclophilin A, or by quantifying total RNA using RIBOGREEN ® (Invitrogen, Inc. Carlsbad, CA).
  • Cyclophilin A or GAPDH expression is quantified by real time PCR, by being run
  • RNA quantification by RIBOGREEN ® is taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
  • a CYTOFLUOR ® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN ® fluorescence.
  • Probes and primers are designed to hybridize to a LCS nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and can include the use of software such as PRIMER EXPRESS ® Software (Applied Biosystems, Foster City, CA).
  • Table 1 primers and probes used to measure GAPDH or Cyclophilin A expression in the cell types described herein.
  • the PCR probes have JOE or FAM covalently linked to the 5' end and TAMRA or MGB covalently linked to the 3' end, where JOE or FAM is the fluorescent reporter dye and TAMRA or MGB is the quencher dye.
  • primers and probe designed to a sequence from a different species are used to measure expression.
  • a human GAPDH primer and probe set can be used to measure GAPDH expression in monkey-derived cells and cell lines.
  • Antisense inhibition of LCS nucleic acids can be assessed by measuring LCS protein levels. Protein levels of LCS can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. In vivo testing of antisense compounds
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of LCS and produce phenotypic changes. Testing can be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides can be formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline or other aqueous solution.
  • a pharmaceutically acceptable diluent such as phosphate-buffered saline or other aqueous solution.
  • Administration routes of the antisense compound such as an antisense oligonucleotide to a subject can include parenteral routes of administration such as inhaled, intranasal, intrapulmonary or intratracheal. Oligonucleotides can be delivered using devices such as nebulizers, dry powder inhalers, metered dose inhalers or colloidal dispersion systems. Calculation of antisense oligonucleotide dosage and dosing frequency depends upon factors such as route of administration and animal body weight.
  • RNA is isolated from tissue and changes in LCS nucleic acid expression are measured. Changes in LCS protein levels are also measured.
  • provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein.
  • the individual has airway inflammation and/or airway hyperresponsiveness.
  • provided herein are methods for ameliorating a symptom associated with airway inflammation and/or airway hyperresponsiveness in a subject in need thereof.
  • a method for reducing the rate of onset of a symptom associated with airway inflammation and/or airway hyperresponsiveness In certain embodiments, provided is a method for reducing the severity of a symptom associated with airway inflammation and/or airway hyperresponsiveness.
  • the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeted to a LCS nucleic acid.
  • administration of a therapeutically effective amount of an antisense compound targeted to a LCS nucleic acid is accompanied by monitoring of LCS levels or markers of airway inflammation, airway hyperresponsiveness or other disease process associated with the expression of LCS, to determine an individual's response to administration of the antisense compound.
  • An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • administering results in reduction of LCS expression by at least about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to LCS are used for the preparation of a medicament for treating a patient suffering or susceptible to airway inflammation and/or airway hyperresponsiveness.
  • the methods described herein include administering an antisense compound comprising a modified oligonucleotide having an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobase portion.
  • the antisense compounds and compositions as described herein are administered parenterally.
  • parenteral administration is inhalation, intranasal, intrapulmonary or intratracheal. Administration can be chronic or continuous or short or intermittent.
  • the antisense compound is aerosolized for administration to a subject.
  • pharmaceutical agents are delivered with a device such as a nebulizer, an inhaler (e.g., dry powder or metered dose) or colloidal dispersion system.
  • formulations for parenteral administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect.
  • the desired effect can be, for example, reduction of LCS or the prevention, reduction, amelioration or slowing the progression of a disease or condition associated with LCS.
  • the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject.
  • dose regimen can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition.
  • dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.
  • Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from 0.01 ⁇ g to 100 mg per kg of body weight, or within a range of 0.00 lmg to 600mg, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years.
  • oligonucleotide is administered in maintenance doses, ranging from 0.0 ⁇ g to lOOmg per kg of body weight or from 0.00 lmg to 600mg, once or more daily, to once every 20 years.
  • a first agent comprising the antisense compound of the invention is co-administered with one or more secondary agents.
  • such second agents are designed to treat the same airway inflammation and/or airway hyperresponsiveness as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein.
  • second agents are co- administered with the first agent to treat an undesired effect of the first or second agent.
  • second agents are co-administered with the first agent to produce a combinational effect.
  • second agents are co-administered with the first agent to produce a synergistic effect.
  • the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
  • a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.
  • second agents include, but are not limited to, anti-inflammation drugs.
  • Anti-inflammatory drugs can include steroids, NSAIDS (non-steroidal anti-inflammatory drugs), COX inhibitors, antihistamines and the like.
  • the second agent can be an asthma drug such as an anti-inflammatory drug, a bronchodilator (e.g., beta-2 agonists (LABA2), theophylline, ipratropium), a leukotriene modifier, Cromolyn, nedocromil, a decongestant and immunotherapy.
  • a bronchodilator e.g., beta-2 agonists (LABA2), theophylline, ipratropium
  • a leukotriene modifier Cromolyn, nedocromil, a decongestant and immunotherapy.
  • Example 1 Antisense inhibition of murine lactosylceramide synthase (LCS) in b.END cells
  • Antisense oligonucleotides targeted to a murine LCS nucleic acid were tested for their effect on LCS RNA transcript in vitro.
  • Cultured b.END cells at a density of 4,000 cells per well were transfected using CytofectinTM reagent (Genlantis, San Diego, CA) with 90 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and LCS RNA transcript levels were measured by quantitative real-time PCR with murine primer probe set
  • RTS3038 forward sequence ACAGCGGCTGGAATTTGC, designated herein as SEQ ID NO: 32; reverse sequence GCATCGCACGATTGAATGG, designated herein as SEQ ID NO: 33; probe sequence TTTTATGTCATCGAACAGACCGGCACACX, where X is the fluorophore, designated herein as SEQ ID NO: 34.
  • LCS RNA transcript levels were adjusted according to total RNA content, as measured by RJBOGREEN ® . Results are presented as percent inhibition of LCS relative to untreated control cells.
  • the antisense oligonucleotides in Tables 2 and 3 are 5-10-5 gapmers, where the gap segment comprises ten 2'-deoxynucleosides and each wing segment comprises five 2'-MOE nucleosides.
  • 'Target start site' indicates the 5 '-most nucleotide to which the antisense oligonucleotide is targeted.
  • 'Target stop site' indicates the 3 '-most nucleotide to which the antisense oligonucleotide is targeted.
  • the murine oligonucleotides of Tables 2 and 3 may also be cross-reactive with human gene sequences. The greater the complementarity between the murine oligonucleotide and the human sequence, the more likely the murine oligonucleotide can cross-react with the human sequence.
  • the murine oligonucleotides in Tables 2 and 3 were compared to SEQ ID NO: 3 (GENBANK Accession No. NM_004775.2).
  • "Human Target start site" indicates the 5'-most nucleotide to which the gapmer is targeted in the human gene sequence. 'Mismatches' indicate the number of nucleobases by which the murine oligonucleotide is mismatched with a human gene sequence with "n/a" indicating more than 3 mismatches.
  • Example 3 In vivo antisense inhibition of murine LCS in C57BL/6 mice
  • Selected antisense oligonucleotides from Example 2 were evaluated for their potency and tolerability in vivo.
  • mice were maintained on a 12-hour light/dark cycle and fed ad libitum Teklad lab chow (Harlan Laboratories, Indianapolis, IN). Animals were acclimated for at least 7 days in the research facility before initiation of the experiment.
  • Antisense oligonucleotides were prepared in PBS and sterilized by filtering through a 0.2 micron filter. Oligonucleotides were dissolved in 0.9% PBS for injection.
  • mice were divided into seven treatment groups of 4 mice each.
  • Six groups received subcutaneous injections of ISIS 421853, ISIS 421856, ISIS 421859, ISIS 421869, ISIS 421871, or ISIS 421893 at a dose of 25 mg/kg twice a week for 6 weeks.
  • One group of mice received subcutaneous injections of PBS twice a week for 6 weeks. This PBS group served as the control group.
  • Blood was withdrawn from each mouse at weeks 3 and 6 and plasma samples analyzed. Two days following the final dose, the mice were euthanized, organs harvested and analyses done.
  • oligonucleotides were considered tolerable in the mice, as demonstrated by their liver transaminase profile.
  • mice The body weights of the mice were measured pre-dose and at the end of the treatment period. The body weights are presented in Table 9, and are expressed as percent increase over the PBS control weight taken before the start of treatment. Liver, spleen and kidney weights were measured at the end of the study, and are also presented in Table 9 as a percentage change over the respective organ weights of the PBS control.
  • Example 4 Effect of antisense inhibition of murine LCS in a prophylactic mouse model for asthma
  • OVA ovalbumin
  • ISIS 421869 and ISIS 421871 which displayed significant antisense inhibition in vivo (Example 3) was used to inhibit LCS expression in this assay.
  • the effect of antisense inhibition of LCS in preventing airway hyper-responsiveness was measured by various standard assays.
  • mice (Jackson Laboratories, ME) were used in a prophylactic model for airway hyper-responsiveness. The mice were 6-8 week old at the start of the studies.
  • mice were pre-sensitized by intraperitoneal injections of OV A/alum or PBS/alum on days 1 and 14 (sensitization). Mice of the treatment groups were then treated between days 28-44 by intranasal instillation of 200 ⁇ g/kg of control oligonucleotide ISIS 141923 or ISIS 421869 or ISIS 421871.
  • mice groups were then challenged with OVA in PBS intranasally between days 41-44.
  • a group of mice was treated intraperitoneally with Dexamethasone (Dex) at 2.5 mg/kg between days 34-44, which prevents mast cell degranulation and therefore served as a positive control.
  • the treatment of the various mice groups is displayed in Table 10.
  • mice groups Treatment of mice groups in a prophylactic model of airway hyper-responsiveness
  • mice were exposed to nebulized metacholine, a drug which provokes
  • mice were exposed to increasing concentrations of metacholine (Sigma-Aldrich, St Louis, MO) aerosolized in PBS.
  • Plethysmography of these mice was then performed using a plethysmography according to the manufacturer's instructions (Buxco Research Systems, Wilmington, NC) to measure airway resistance with and without metacholine treatment. Briefly, each mouse was placed without any restraint in a plethysmograph chamber, which was equipped with a port for aerosol delivery, a water bottle port and a gas sampling port.
  • the system involves measuring a "box flow" which is the sum of nasal and thoracic flows. Actual flows are calculated in the software, taking into account temperature, humidity, and pressure.
  • Enhanced Pause (Penh) parameter was measured and is shown in Table 11. The data indicates that treatment with ISIS 421869 of mice sensitized to OVA (Group 6) and treatment with ISIS 421871 of mice sensitized to OVA (Group 7) reduced the enhanced pause and therefore reduced airway resistance, comparable to mice sensitized to OVA and treated with Dex (Group 4) compared to the control group (Group 5).
  • the tissue distribution of LCS was determined by RT-PCR analysis of the various tissues extracted from C57/BL6 mice which had received no treatment.
  • LCS mRNA levels were measured by the primer probe set RTS3038.
  • the RNA expression levels are expressed as the ratio of 1 / 2 A X (where X is the number of PCR cycles required to obtain 50% expression of LCS mRNA) and the total RNA of the tissue, as measured by RIBOGREEN. The results are presented in Table 12.

Abstract

La présente invention concerne des procédés, des composés et des compositions destinés à réduire l'expression du mARN de la lactosylcéramide synthase (LCS) et de protéine chez un animal. L'invention porte en outre sur des méthodes, des composés et des compositions destinés à prévenir ou à diminuer l'inflammation des voies respiratoires et/ou l'hyperréactivité des voies respiratoires chez un animal. Ces méthodes, composés et compositions sont utiles dans le traitement, la prévention, le retard ou l'amélioration de l'inflammation des voies respiratoires et/ou de l'hyperréactivité des voies respiratoires, ou d'un de leurs symptômes.
PCT/US2011/033653 2010-04-23 2011-04-22 Modulation de l'expression de la lactosylcéramide synthase (lcs) WO2011133923A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32760510P 2010-04-23 2010-04-23
US61/327,605 2010-04-23

Publications (1)

Publication Number Publication Date
WO2011133923A1 true WO2011133923A1 (fr) 2011-10-27

Family

ID=44834539

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/033653 WO2011133923A1 (fr) 2010-04-23 2011-04-22 Modulation de l'expression de la lactosylcéramide synthase (lcs)

Country Status (1)

Country Link
WO (1) WO2011133923A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110951731A (zh) * 2012-10-15 2020-04-03 Ionis制药公司 用于调节c9orf72表达的组合物

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070243546A1 (en) * 2006-03-31 2007-10-18 Affymetrix, Inc Analysis of methylation using nucleic acid arrays
US20070248591A1 (en) * 2004-09-08 2007-10-25 Takeda Pharmaceutical Company Limited Preventive/Therapeutic Drug for Arteriosclerosis
US20070270350A1 (en) * 2003-12-23 2007-11-22 Musc Foundation For Research Development Methods and Compositions for the Prevention and Treatment of Inflammatory Diseases or Conditions
US20090105125A1 (en) * 2006-05-09 2009-04-23 Hongmei Zhao Methods of Treating Fatty Liver Disease
US20090318536A1 (en) * 2006-11-27 2009-12-24 Iss Pharmaceuticals, Inc. Methods for treating hypercholesterolemia

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070270350A1 (en) * 2003-12-23 2007-11-22 Musc Foundation For Research Development Methods and Compositions for the Prevention and Treatment of Inflammatory Diseases or Conditions
US20070248591A1 (en) * 2004-09-08 2007-10-25 Takeda Pharmaceutical Company Limited Preventive/Therapeutic Drug for Arteriosclerosis
US20070243546A1 (en) * 2006-03-31 2007-10-18 Affymetrix, Inc Analysis of methylation using nucleic acid arrays
US20090105125A1 (en) * 2006-05-09 2009-04-23 Hongmei Zhao Methods of Treating Fatty Liver Disease
US20090318536A1 (en) * 2006-11-27 2009-12-24 Iss Pharmaceuticals, Inc. Methods for treating hypercholesterolemia

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 4 March 2010 (2010-03-04), NGAMUKOTE ET AL.: "Mus musculus UDP-Gal:betaGIcNAc beta 1,4-galactosyltransferase, polypeptide 6 (B4galt6), mRNA.", retrieved from http://www.ncbi.nlm.nih.gov/nuccore/288557341?sat=14&satkey=4274504 Database accession no. NM_019737. *
WON ET AL.: "Lactosylceramide: a lipid second messenger in neuroinflammatory disease.", J. NEUROCHEM., vol. 103, no. SUPP.1, 2007, pages 180 - 91 *
YATES.: "Role of exhaled nitric oxide in asthma.", IMMUNOL. CELL BIOL., vol. 79, no. 2, 2001, pages 178 - 190 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110951731A (zh) * 2012-10-15 2020-04-03 Ionis制药公司 用于调节c9orf72表达的组合物

Similar Documents

Publication Publication Date Title
EP2812342B1 (fr) Modulation d'arn par ciblage de répétition
AU2014306284B2 (en) Compounds and methods for modulation of dystrophia myotonica-protein kinase (DMPK) expression
AU2012312433B2 (en) Antisense modulation of GCGR expression
EP2906258A2 (fr) Compositions permettant de moduler l'expression de c90rf72
WO2014062686A1 (fr) Procédés pour moduler l'expression de c90rf72
EP3126499A2 (fr) Compositions modulant l'expression de sod-1
EP2776564B1 (fr) Modulation de l'expression de tmprss6
USRE48060E1 (en) Antisense modulation of PTP1B expression
WO2012170947A2 (fr) Procédés pour moduler l'expression du facteur 12
EP2556159A1 (fr) Modulation de l'expression de cetp
WO2011038288A1 (fr) Modulation de l'expression de ttc39 pour augmenter le hdl
WO2011127175A1 (fr) Modulation de l'expression de cd130 (gp130)
EP2717923A2 (fr) Procédés pour moduler l'expression de la kallicréine (klkb1)
WO2011133918A1 (fr) Modulation de l'expression de la synthase gm3 (gm3s)
WO2013130868A1 (fr) Méthodes de modulation de l'expression des fibrinogènes
WO2011133923A1 (fr) Modulation de l'expression de la lactosylcéramide synthase (lcs)
WO2011133915A1 (fr) Modulation de l'expression de la glucosylcéramide synthase (gcs)
WO2012161806A1 (fr) Modulation de l'expression de stat3
WO2011156673A2 (fr) Modulation de l'expression de phosphoénolpyruvate carboxykinase-mitochondriale (pepck-m)
WO2012149465A2 (fr) Modulation de l'expression de cd36

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11772808

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11772808

Country of ref document: EP

Kind code of ref document: A1