WO2013016267A2 - Plants and algae capable of modulating antenna size based on light intensity - Google Patents
Plants and algae capable of modulating antenna size based on light intensity Download PDFInfo
- Publication number
- WO2013016267A2 WO2013016267A2 PCT/US2012/047815 US2012047815W WO2013016267A2 WO 2013016267 A2 WO2013016267 A2 WO 2013016267A2 US 2012047815 W US2012047815 W US 2012047815W WO 2013016267 A2 WO2013016267 A2 WO 2013016267A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cao
- gene
- algae
- expression
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/649—Biodiesel, i.e. fatty acid alkyl esters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/12—Unicellular algae; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
- C12Y114/13122—Chlorophyllide-a oxygenase (1.14.13.122)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention provides methods, and compositions for modulating the PSII peripheral antenna SIZE of photosynthetic organisms by negatively regulating the expression of chlorophyll a oxygenase (CAO) to high light intensity. Also provided are transgenic photosynthetic organisms that are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity, and other enhanced traits, and methods for their use.
- CAO chlorophyll a oxygenase
- Phototroph or photosynthetic organisms mostly belong to the kingdom Plantae. They include familiar organisms such as trees, herbs, bushes, grasses, vines, ferns, mosses, and green algae. Photosynthetic organisms obtain most of their energy from sunlight via a process called photosynthesis.
- Photosynthesis is a process that converts carbon dioxide into organic compounds, especially sugars, using the energy from sunlight (Smith, A.
- Photosynthetic organisms absorb sunlight via their light harvesting or antenna complexes (LHC), which transfer excitation energy to the reaction center complexes of photosystems ⁇ (PS- ⁇ ) and I (PS-I) that drive linear electron transfer and oxygenic photosynthesis.
- LHC light harvesting or antenna complexes
- the light harvesting antenna for PSI (termed LHCI) and PSII (termed LHCH) bind the light harvesting pigments including Chlorophyll a (Chi a) and Chlorophyll b (Chi b) and carotenoids.
- photosynthetic organisms such as plant and algal cells may acclimate to altered light environments to optimize energy capture and conversion efficiency.
- Cells acclimated to low light typically possess larger light harvesting antenna than those acclimated to high light intensities so as to maximize light capture at limiting light conditions.
- Chlorophyll Chlorophyll
- the qE (energy-dependent quenching) processes involve the de-excitation of Chi singlet excited states formed in the PSII antenna upon light absorption to minimize the formation of Chi triplets and reactive oxygen species in the photosynthetic apparatus (Muller, et al., (2001), Plant Physiology. 125: 1558 - 1566). Processes associated with qT are involved in regulating the relative excitation of PSII and PSI and helps regulate the balance between linear and cyclic electron flow during photosynthesis (Wollman, F.A., (2001), EMBO J. 20: 3623 - 3630; Eberhard, et al., (2008), Annu. Rev. Genet. 42: 463 - 515).
- the PSII light harvesting complex includes the proximal antenna Chi a binding proteins associated with the PSII reaction center; and the peripheral (distal) antenna Chi a, Chi b, and carotenoid binding proteins.
- the peripheral antenna complex of PSII (LHCH) further comprises the major (outer) more abundant trimeric antenna that is encoded for by nine genes (LHCBM1-LHCBM9) and a minor (inner) antenna that is encoded for by three genes (LHCB4, LHCB5 and LHCB7) (Minagawa, J. and Takahashi, (2004), Photosynth. Res 82: 241 - 263).
- LHCII proteins account for binding up to 50% of the total Chi in plant and algal thylakoid membrane.
- Chi b is synthesized from Chi a by the action of the enzyme Chi a oxygenase (CAO) (von Wettstein, et al., (1995), Plant Cell 7: 1039 - 1057) and insertional mutants of Chlamydomonas that lack a functional CAO gene, lack Chi b (Tanaka, A., et al., ( 1998), Proc. Natl. Acad. Sci. USA 95: 12719 - 12723).
- CAO Chi a oxygenase
- the over expression of the CAO gene leads to the enhancement of Chi b biosynthesis in Arabidopsis and consequently to an enlargement of the PSII-associated peripheral antenna (Tanaka, et al., (2001), The Plant Journal 24: 365 - 373).
- Chi b-less mutants ⁇ cbs-3) of Chlamydomonas have substantially elevated light-saturated photosynthetic oxygen evolution rates (up to 2.5 fold when expressed on a per Chi basis) compared to the wild-type and do not light saturate at full sunlight intensities (Polle, et al., (2000), Planta 211: 335 - 344).
- wild-type Chlamydomonas light saturates photosynthesis at 25% of full sunlight intensity.
- the present disclosure describes methods for generating transgenic photosynthetic organisms that are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity.
- wild-type algae have pre-existing mechanisms to modulate the expression and size of their PSII light- harvesting antenna at the transcriptional and posttranscriptional level under varying light levels (Durnford, et al., (2003), Physiol. Plant. 118: 193 - 205), the range of PSII antenna adjustment in wild type photosynthetic organisms is limiting and is of little practical use.
- This invention takes advantage of a recently described light regulated and redox- sensitive, trans-acting factor (NAB 1) that binds to LHCII mRNAs, negatively regulating their translation leading to a reduction of LHCII content under high light growth conditions (Mussgnug, et al., (2005) The Plant Cell 17: 3409 - 3421).
- This nucleic acid binding protein 1 (NAB 1) binds to a cold-shock domain consensus sequence (CSDCS) motif found in several LHCII mRNAs, sequestrating them into translationally silent messenger ribonucleoprotein complexes.
- SDCS cold-shock domain consensus sequence
- the resulting transgenic photosynthetic organisms are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity.
- Such enhanced photosynthetic organisms, including algal, provide for improved production systems with higher flexibility in growth conditions and improved yields.
- the present invention includes a transgenic algae capable of modulating PSII antenna size in response to ambient light intensity; wherein the transgenic algae exhibit an increase in Chi a b ratios when grown under high light conditions, and a decrease in Chi a/b ratios when grown under low light conditions compared to wild type cells grown under identical conditions.
- the increase in Chi a/b ratio is at least 5 % greater than observed with wild type cells.
- transgenic algae's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
- the transgenic algae comprises a DNA construct comprising heterologous expression control sequences that are capable of binding to a redox sensitive modulator that is responsive to ambient light intensity.
- redox sensitive repressor is more active at low light intensity, than at high light intensity.
- the redox sensitive modulator is NAB 1.
- the expression control sequences comprise a cold-shock domain consensus sequence (CSDDCS) motif.
- the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence.
- the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
- the expression control sequences are operatively coupled to a polynucleotide sequence encoding CAO.
- the polynucleotide sequence encoding CAO is a heterologous nucleic acid sequence.
- the transgenic algae is selected from the group consisting of the chlorophyta including, Chlamydomas perigran lata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella sp; Chlorella vulgaris, Chlorella protothecoides, Chlorella sorokiniana, Chlorella keslerii, Scenedesmus sp, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
- the chlorophyta including, Chlamydomas perigran lata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella sp; Chlorella vulgaris,
- the transgenic algae comprise a heterologous redox sensitive modulator.
- the heterologous redox sensitive modulator is NAB 1.
- the transgenic algae exhibit exhibits an increase in biomass production compared to wild-type algae grown under identical conditions.
- the current invention includes a method of producing an improved photosynthetic organism, comprising the steps of;
- CSDDCS cold-shock domain consensus sequence
- heterologous polynucleotide sequences comprise targeting sequences specific for the photosynthetic organism's endogenous CAO gene.
- the photosynthetic organism's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
- the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence.
- the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
- the expression control sequences are operatively coupled to a polynucleotide sequence encoding CAO.
- the photosynthetic organism is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliqu s, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
- the selection is based on screening transgenic organisms that exhibit an increase in Chi a/b ratios when grown under high light conditions, and a decrease in Chi a/b ratios when grown under low light conditions.
- the selection is based on screening photosynthetic organism that exhibit an increase in biomass production compared to wild type organisms grown under identical conditions.
- the photosynthetic organism comprises a heterologous redox sensitive modulator.
- the heterologous redox sensitive modulator is NAB 1.
- the invention includes a method of enhancing yields of photosynthetic productivity under conditions of high light intensity, and or high density growth, the method comprising;
- polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO; wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity; ii) cultivating the photosynthetic organism at high light intensity and / or high density.
- CSDDCS cold-shock domain consensus sequence
- the invention includes a method of enhancing bio-oil, or bio- diesel production from a photosynthetic organism the method comprising;
- CSDDCS cold-shock domain consensus sequence
- the invention includes a method of enhancing beta-carotene, lutein, or zeaxanthin production from a photosynthetic organism, the method comprising; i) providing algae comprising a heterologous polynucleotide sequence
- CSDDCS cold-shock domain consensus sequence
- the transgenic organism's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
- the photosynthetic organism is an alga.
- the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence.
- the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
- the polynucleotide sequence encoding CAO is a heterologous nucleic acid sequence.
- the algae is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
- the algae exhibit an increase in Chi a/b ratios when grown under high light conditions of at least 5 %.
- the algae comprise a heterologous redox sensitive repressor.
- the heterologous redox sensitive repressor is NAB 1.
- the current invention includes an expression vector comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO.
- CSDDCS cold-shock domain consensus sequence
- the expression vector further comprises a promoter operatively linked to the cold-shock domain consensus sequence.
- the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
- the expression vector comprises a CSDDCS motif is selected from the group consisting of SEQ ID. No. 39, SEQ ID. No. 40, SEQ ID. No. 41, SEQ ID. No. 42, SEQ ID. No. 43, SEQ ID. No. 44, SEQ ID. No. 45, SEQ ID. No. 46, and SEQ ID. No. 47.
- the expression vector comprises a CAO gene selected from the group consisting of SEQ ED. No. 34, SEQ ID. No. 35, SEQ ID. No. 36, SEQ ID. No. 37, and SEQ ED. No. 38.
- FIG. 1 shows a schematic representation of the gene constructs used for the modulation of Chlorophyll b synthesis in Chlamydomonas.
- FIG. 2 shows the Chlorophyll fluorescence induction in CC-424 (WT), CR transformants and cbs-3.
- FIG. 3 shows a real-time RT-PCR analysis of the CR transformants.
- FIG. 4. Shows the relationship between Chlorophyll a b ratio and % saturation
- FIG. 5 Shows a visualization of the LHCII complex in CC-424 (WT), CR-1 18, 133 and cbs-3 cell clones via non-denaturing PAGE.
- FIG. 6. Shows oxygen evolution rates of the clones CC-424 (WT), CR-1 18, 133 and cbs-3 as a function of light intensity and normalized based on Chlorophyll content.
- FIG. 7 Shows oxygen evolution rates of the clones CC-424 (WT), CR-1 18, 133 and cbs-3 as a function of light intensity and normalized based on cell density.
- FIG. 8 Shows photoautotrophic growth of the WT, CR- 188 and 133 and cbs-3 cells at low and high light intensities.
- FIG. 9 Shows changes in Chlorophyll a/b ratios in the complemented WT (CAO-4, 22), CC-2137 (also WT), N1BSCAO and altNlBSCAO transgenic clones during acclimation to low and high light.
- FIG. 10 Shows changes in Chlorophyll fluorescence induction in the complemented WT (CAO-4, 22), CC-2137 (also WT), N1BSCAO and altNlBSCAO transgenic clones during acclimation to low and high light.
- the terms "cell,” “cells,” “cell line,” “host cell,” and “host cells,” are used interchangeably and, encompass animal cells and include plant, invertebrate, non- mammalian vertebrate, insect, algal, and mammalian cells. All such designations include cell populations and progeny.
- the terms “transformants” and “transfectants” include the primary subject cell and cell lines derived therefrom without regard for the number of transfers.
- control photosynthetic organism means a photosynthetic organism that does not contain the recombinant DNA that expressed a protein that imparts an enhanced trait.
- a control photosynthetic organism is to identify and select a transgenic photosynthetic organism that has an enhance trait.
- a suitable control photosynthetic organism can be a non-transgenic photosynthetic organism of the parental line used to generate a transgenic photosynthetic organism, i.e. devoid of recombinant DNA.
- a suitable control photosynthetic organism may in some cases be a progeny of a hemizygous transgenic photosynthetic organism that does not contain the recombinant DNA, known as a negative segregant.
- the phrase "conservative amino acid substitution” or “conservative mutation” refers to the replacement of one ' amino acid by another amino acid with a common property.
- a functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer- Verlag). According to such analyses, groups of amino acids can be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer- Verlag).
- amino acid groups defined in this manner include: a "charged / polar group,” consisting of Glu, Asp, Asn, Gin, Lys, Arg and His; an "aromatic, or cyclic group,” consisting of Pro, Phe, Tyr and Trp; and an "aliphatic group” consisting of Gly, Ala, Val, Leu, He, Met, Ser, Thr and Cys.
- subgroups can also be identified, for example, the group of charged / polar amino acids can be sub-divided into the sub-groups consisting of the "positively-charged sub-group,” consisting of Lys, Arg and His; the negatively-charged subgroup,” consisting of Glu and Asp, and the "polar sub-group” consisting of Asn and Gin.
- the aromatic or cyclic group can be sub-divided into the sub-groups consisting of the "nitrogen ring sub-group,” consisting of Pro, His and Tip; and the "phenyl sub-group” consisting of Phe and Tyr.
- the aliphatic group can be sub-divided into the sub-groups consisting of the "large aliphatic non-polar sub-group,” consisting of Val, Leu and He; the "aliphatic slightly-polar sub-group,” consisting of Met, Ser, Thr and Cys; and the "small- residue sub-group,” consisting of Gly and Ala.
- Examples of conservative mutations include substitutions of amino acids within the sub-groups above, for example, Lys for Arg and vice versa such that a positive charge can be maintained; Glu for Asp and vice versa such that a negative charge can be maintained; Ser for Thr such that a free -OH can be maintained; and Gin for Asn such that a free -N3 ⁇ 4 can be maintained.
- CSDDCS cold-shock domain consensus sequence
- Enhanced trait or “enhanced phenotype” as used herein refers to a measurable improvement in a trait of photosynthetic organism including, but not limited to, yield increase, including increased yield under non-stress conditions and increased yield under environmental stress conditions
- Many enhanced traits can affect “yield”, including without limitation, number of cells in a liquid culture of unicellular or multi cellular photosynthetic organism, increased efficiencies of light utilization by a photosynthetic organism, amount of biomass production by a photosynthetic organism, amount of bio fuel production by a photosynthetic organism, and amounts of nutraceuticals including but not limited to Agar, Alginate, Carrageenan, Omega fatty acids, Coenzyme Q10, Astaxanthin, and Beta-Carotene .
- Nutraceutical a term combining the words "nutrition” and “pharmaceutical”, is a food or food product that provides health and medical benefits, including the prevention and treatment of disease. Such products may range from isolated nutrients, dietary supplements and specific diets to genetically engineered foods, herbal products, and processed foods such as cereals, soups, and beverages. Other enhanced trait include plant height, pod number, pod position on the plant, number of internodes, incidence of pod shatter, grain size, efficiency of nodulation and nitrogen fixation, efficiency of nutrient assimilation, resistance to biotic and abiotic stress, carbon assimilation, plant architecture, resistance to lodging, percent seed germination, seedling vigor, and juvenile traits. Other traits that can affect yield include, efficiency of germination (including germination in stressed conditions), growth rate (including growth rate in stressed conditions), ear number, seed number per year, seed size, composition of seed (starch, oil, protein) and characteristics of seed fill.
- the term "expression” as used herein refers to transcription and/or translation of a nucleotide sequence within a host cell.
- the level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired polypeptide encoded by the selected sequence.
- mRNA transcribed from a selected sequence can be quantified by Northern blot hybridization, ribonuclease RNA protection, in situ hybridization to cellular RNA or by PCR.
- Proteins encoded by a selected sequence can be quantified by various methods including, but not limited to, e.g., ELISA, Western blotting, radioimmunoassays, immunoprecipitation, assaying for the biological activity of the protein, or by immunostaining of the protein followed by FACS analysis.
- "Expression control sequences” are regulatory sequences of nucleic acids, such as promoters, leaders, enhancers, introns, recognition motifs for RNA, or DNA binding proteins, polyadenylation signals, terminators, internal ribosome entry sites (IRES) and the like, that have the ability to affect the transcription or translation of a coding sequence in a host cell.
- a “gene” is a sequence of nucleotides which code for a functional "gene product”.
- a gene product is a functional protein.
- a gene product can also be another type of molecule in a cell, such as RNA (e.g., a tRNA or an rRNA).
- a gene may also comprise regulatory (i.e., non-coding) sequences as well as coding sequences and introns. Exemplary regulatory sequences include promoters, enhancers and terminators.
- the transcribed region of the gene may also include untranslated regions including introns, a 5'-untranslated region (5'-UTR) and a 3'-untranslated region (3 - UTR).
- heterologous DNA refers to DNA which has been introduced into a cell, or a nucleic acid molecule, that is derived from another source, or which is from the same source but is located in a different (i.e. non native) context.
- high light intensity refers to a photon flux of about 500 ⁇ m "2 s "1 or more; conversely the term “low light intensity” refers to a photon flux of about 50 ⁇ m "2 s "1 or less.
- the term "homology” describes a mathematically based comparison of sequence similarities which is used to identify genes or p ro teins. with similar functions or motifs.
- the nucleic acid and protein sequences of the presen' 'n ve ntion can be used as a "query sequence" to perform a search against public databases to, for example, identify other family members, related sequences or homologs. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
- Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402.
- the default parameters of the respective programs e.g., XBLAST and BLAST
- homologous refers to the relationship between two proteins that possess a "common evolutionary origin", including proteins from superfamilies (e.g., the immunoglobulin superfamily) in the same species of animal, as well as homologous proteins from different species of animal (for example, myosin light chain polypeptide, etc.; see Reeck et al., Cell, 50:667, 1987).
- proteins and their encoding nucleic acids
- sequence homology as reflected by their sequence similarity, whether in terms of percent identity or by the presence of specific residues or motifs and conserved positions.
- the term “increase” or the related terms “increased”, “enhance” or “enhanced” refers to a statistically significant increase.
- the terms generally refer to at least a 10% increase in a given parameter, and can encompass at least a 20% increase, 30% increase, 40% increase, 50% increase, 60% increase, 70% increase, 80% increase, 90% increase, 95% increase, 97% increase, 99% or even a 100% increase over the control value.
- isolated when used to describe a protein or nucleic acid, means that the material has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with research, diagnostic or therapeutic uses for the protein or nucleic acid, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.
- the protein or nucleic acid will be purified to at least 95% homogeneity as assessed by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated protein includes protein in situ within recombinant cells, since at least one component of the protein of interest's natural environment will not be present. Ordinarily, however, isolated proteins and nucleic acids will be prepared by at least one purification step.
- identity means the percentage of identical nucleotide or amino acid residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H.
- Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm described in Smith & Waterman 1981 , by the homology alignment algorithm described in Needleman & Wunsch 1970, by the search for similarity method described in Pearson & Lipman 1988, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the GCG Wisconsin Package, available from Accelrys, Inc., San Diego, California, United States of America), or by visual inspection. See generally, (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)).
- One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in (Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; & Altschul, S., et al., J. Mol. Biol. 215: 403- 410 (1990).
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold.
- HSPs high scoring sequence pairs
- These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always; 0) and N (penalty score for mismatching residues; always; 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the - 27 cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm parameters W. T. and X determine the sensitivity and speed of the alignment.
- the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix.
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is in one embodiment less than about 0.1 , in another embodiment less than about 0.01 , and in still another embodiment less than about 0.001.
- the "Oil” as used herein refers to any combination of fractionable lipid fractions of a biomass.
- “Lipid,” “lipid fraction,” or “lipid component” as used herein can include any hydrocarbon soluble in non-polar solvents and insoluble, or relatively insoluble, in water.
- the fractionable lipid fractions can include, but are not limited to, free fatty acids, waxes, sterols and sterol esters, triacylglycerols, diacylglycerides, monoacylglycerides, tocopherols, eicosanoids, glycoglycerolipids, glycosphingolipds, sphingolipids, and phospholipids.
- the lipid fractions can also comprise other liposoluble materials such as chlorophyll and other algal pigments, including, for example, antioxidants such as astaxanthins.
- a nucleic acid molecule according to the invention includes one or more DNA elements capable of opening chromatin and/or maintaining chromatin in an open state operably linked to a nucleotide sequence encoding a recombinant protein.
- a nucleic acid molecule may additionally include one or more DNA or RNA nucleotide sequences chosen from: (a) a nucleotide sequence capable of increasing translation; (b) a nucleotide sequence capable of increasing secretion of the recombinant protein outside a cell; (c) a nucleotide sequence capable of increasing the mRNA stability, and (d) a nucleotide sequence capable of binding a trans-acting factor to modulate transcription or translation, where such nucleotide sequences are operatively linked to a nucleotide sequence encoding a recombinant protein.
- nucleotide sequences that are operably linked are contiguous and, where necessary, in reading frame.
- an operably linked DNA element capable of opening chromatin and/or maintaining chromatin in an open state is generally located upstream of a nucleotide sequence encoding a recombinant protein; it is not necessarily contiguous with it.
- Operable linking of various nucleotide sequences is accomplished by recombinant methods well known in the art, e.g. using PCR methodology, by ligation at suitable restrictions sites or by annealing. Synthetic oligonucleotide linkers or adaptors can be used in accord with conventional practice if suitable restriction sites are not present.
- nucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple- stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non- natural or derivatized nucleotide bases.
- the backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups.
- a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
- a nucleic acid molecule can take many different forms, e.g., a gene or gene fragment, one or more exons, one or more introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches.
- a polynucleotide includes not only naturally occurring bases such as A, T, U, C, and G, but also includes any of their analogs or modified forms of these bases, such as methylated nucleotides, internucleotide modifications such as uncharged linkages and thioates, use of sugar analogs, and modified and/or alternative backbone structures, such as polyamides.
- a "promoter” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
- the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
- a transcription initiation site (conveniently defined by mapping with nuclease S I) can be found within a promoter sequence, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
- Prokaryotic promoters contain Shine-Dalgamo sequences in addition to the -10 and -35 consensus sequences.
- promoters including constitutive, inducible and repressible promoters, from a variety of different sources are well known in the art.
- Representative sources include for example, viral, mammalian, insect, plant, yeast, and bacterial cell types, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available on line or, for example, from depositories such as the ATCC as well as other commercial or individual sources.
- Promoters can be unidirectional (i.e., initiate transcription in one direction) or bi-directional (i.e., initiate transcription in either a 3' or 5' direction).
- Non-limiting examples of promoters active in plants include, for example nopaline synthase (nos) promoter and octopine synthase (ocs) promoters carried on tumor-inducing plasmids of Agrobacterium tumefaciens and the caulimovirus promoters such as the Cauliflower Mosaic Virus (CaMV) 19S or 35S promoter (U.S. Pat. No. 5,352,605), CaMV 35S promoter with a duplicated enhancer (U.S. Pat. Nos.
- CaMV Cauliflower Mosaic Virus
- a "photosynthetic organism” means an organism capable of performing photosynthetic reaction in presence of light belonging to kingdom "Plantae” that include familiar organisms such as trees, herbs, bushes, grasses, vines, ferns, mosses, and algae. Photosynthetic organisms can be unicellular, or multi cellular.
- purified refers to material that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including native materials from which the material is obtained.
- a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell. Methods for purification are well-known in the art.
- substantially free is used operationally, in the context of analytical testing of the material.
- purified material substantially free of contaminants is at least 50% pure; more preferably, at least 75% pure, and more preferably still at least 95% pure.
- Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
- the term "substantially pure” indicates the highest degree of purity, which can be achieved using conventional purification techniques known in the art.
- sequence similarity refers to the degree of identity or correspondence between nucleic acid or amino acid sequences that may or may not share a common evolutionary origin (see Reeck et al., supra).
- sequence similarity when modified with an adverb such as “highly”, may refer to sequence similarity and may or may not relate to a common evolutionary origin.
- two nucleic acid sequences are "substantially homologous" or “substantially similar” when at least about 85%, and more preferably at least about 90% or at least about 95% of the nucleotides match over a defined length of the nucleic acid sequences, as determined by a sequence comparison algorithm known such as BLAST, FASTA, DNA Strider, CLUSTAL, etc.
- BLAST Altschul et al.
- FASTA DNA Strider
- CLUSTAL etc.
- An example of such a sequence is an allelic or species variant of the specific genes of the present invention.
- Sequences that are substantially homologous may also be identified by hybridization, e.g., in a Southern hybridization experiment under, e.g., stringent conditions as defined for that particular system.
- the term "specific” is applicable to a situation in which one member of a specific binding pair will not show any significant binding to molecules other than its specific binding partner(s).
- the term is applicable to the situation where two complementary polynucleotide strands can anneal together, yet each single stranded polynucleotide exhibits little or no binding to other polynucleotide sequences under stringent hybridization conditions.
- two amino acid sequences are "substantially homologous” or “substantially similar” when greater than 90% of the amino acid residues are identical.
- Two sequences are functionally identical when greater than about 95% of the amino acid residues are similar.
- the similar or homologous polypeptide sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Version 7, Madison, Wis.) pileup program, or using any of the programs and algorithms described above.
- the term “suppressed” in the context of “suppressed CAO expression” encompasses the absence of endogenous Chlorophyll A oxygenase protein in a plant cell, e.g., algae, as well as protein expression that is present but reduced as compared to the level of Chlorophyll A oxygenase protein expression in a wild type plant, e.g., algae.
- the term “suppressed” also encompasses an amount of Chlorophyll A oxygenase protein that is equivalent to wild type levels, but where the protein has a reduced level of activity in comparison to wild type plants.
- At least a 50% decrease in endogenous Chlorophyll A oxygenase activity, or expression, or the like is preferred, in other aspect, at least about 75%, or at least about 95% , or 100 % (i.e. no endogenous activity) being particularly preferred.
- a "transgenic photosynthetic organism” is one whose genome has been altered by the incorporation of exogenous genetic material, e.g. by transformation as described herein.
- the term "transgenic photosynthetic organism” is used to refer to the photosynthetic organism produced from an original transformation event, or progeny from later generations or crosses of a transgenic photosynthetic organism, so long as the progeny contains the exogenous genetic material in its genome.
- exogenous is meant that a nucleic acid molecule, for example, a recombinant DNA, originates from outside the photosynthetic organism into which it is introduced.
- An exogenous nucleic acid molecule may comprise naturally or non-naturally occurring DNA, and may be derived from the same or a different photosynthetic organism species than that into which it is introduced.
- transformation refers to the transfer of one or more nucleic acid molecules into a host cell or organism.
- Methods of introducing nucleic acid molecules into host cells include, for instance, calcium phosphate transfection, DEAE- dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, scrape loading, ballistic introduction or infection with viruses or other infectious agents.
- Transformed in the context of a cell, refers to a host cell or organism into which a recombinant or heterologous nucleic acid molecule (e.g., one or more DNA constructs or RNA, or siRNA counterparts) has been introduced.
- the nucleic acid molecule can be stably expressed (i.e. maintained in a functional form in the cell for longer than about three months) or non-stably maintained in a functional form in the cell for less than three months i.e. is transiently expressed.
- “transformed,” “transformant,” and “transgenic” cells have been through the transformation process and contain foreign nucleic acid.
- the term “untransformed” refers to cells that have not been through the transformation process.
- the present invention provides methods, and compositions for modulating the PSII peripheral antenna size of photosynthetic organisms by negatively regulating the expression of chlorophyll a oxygenase (CAO) to high light intensity.
- CAO chlorophyll a oxygenase
- the current invention includes a method of producing an improved photosynthetic organism, comprising the steps of; a) stably transforming a photosynthetic organism with a heterologous polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif, that is capable of binding to a redox sensitive modulator that is responsive to ambient light intensity; b) selecting a transformant that is capable of modulating PSII antenna size in response to ambient light intensity.
- CSDDCS cold-shock domain consensus sequence
- the current invention includes a method of enhancing yields of photosynthetic productivity under conditions of high light intensity, and or high density growth, the method comprising;
- CAO cold-shock domain consensus sequence
- the current invention includes a method of enhancing bio-oil, or bio-diesel production from a photosynthetic organism the method comprising;
- expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
- CSDDCS cold-shock domain consensus sequence
- the present invention includes a method of enhancing beta- carotene, lutein, or zeaxanthin production from a photosynthetic organism, the method comprising;
- expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
- CSDDCS cold-shock domain consensus sequence
- chlororophyll A oxygenase or “CAO” refers to enzymes capable of the synthesis of chlorophyll b via the oxidation of the methyl group on ring II of chlorophyll a.
- Exemplary genes encoding CA) include those listed in Table Dl.
- chlororophyll A oxygenase or “CAO” refers to all naturally-occurring and synthetic forms of chlorophyll A oxygenase.
- the "chlorophyll A oxygenase” is from algae.
- the chlorophyll A oxygenase is from a plant.
- the chlorophyll A oxygenase is from Chlamydomonas. Representative species and Gene bank accession numbers for various species of chlorophyll A oxygenase are listed below in Table Dl, and genes from other species may be readily identified by standard homology searching of publicly available databases. Table Dl
- XM_00295384 TATCTGCGTA AGCGCCGGAA GAACTGGGAG CGCATCTTTG AGTACGTCAC TAAGCAGGAC
- the chlorophyll A oxygenase may be in its native form, i.e., as different apo forms, or allelic variants as they appear in nature, which may differ in their amino acid sequence, for example, by truncation (e.g., from the N- or C-terminus or both) or other amino acid deletions, additions, insertions, substitutions, or post-translational modifications.
- Naturally- occurring chemical modifications including post-translational modifications and degradation products of the chlorophyll A oxygenase are also specifically included in any of the methods of the invention including for example, pyroglutamyl, iso-aspartyl, proteolytic, phosphorylated, glycosylated, reduced, oxidized, isomerized, and deaminated variants of the chlorophyll A oxygenase.
- the chlorophyll A oxygenase which may be used in any of the methods of the invention may have amino acid sequences which are substantially homologous, or substantially similar to the native chlorophyll A oxygenase amino acid sequences, for example, to any of the native chlorophyll A oxygenase gene sequences listed in Table Dl.
- the chlorophyll A oxygenase may have an amino acid sequence having at least 30% preferably at least 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, or 99% identity with chlorophyll A oxygenase listed in Table Dl.
- the chlorophyll A oxygenase for use in any of the methods of the present invention is at least 80% identical to the mature chlorophyll A oxygenase from Chlamydomonas.
- the invention provides methods, compositions, and transgenic plants and algae having a reduced chlorophyll antenna size by suppressing the endogenous expression of chlorophyll A oxygenase, and operatively coupling the expression of a heterologous CAO to expression control sequences that are regulated by the activity of a redox sensitive modulator.
- the present invention includes transgenic plants and algae in which the endogenous CAO gene has been knocked out, or the expression of the gene suppressed.
- Exemplary chlorophyll A oxygenase nucleic acid sequences can be used to prepare expression cassettes useful for inhibiting or suppressing chlorophyll A oxygenase expression, and for providing for heterologous recombinant CAO genes, are listed in Table Dl above.
- a number of methods can be used to inhibit gene expression in plants. For instance, siRNA, antisense, or ribozyme technology can be conveniently used.
- antisense inhibition can be used to decrease expression of a targeted gene (e.g., Schroda, et al (1999) Plant Cell 1 1 : 1 165-78,).
- RNA interference construct can be used (e.g., Schroda, et al., (2006) Curr Genet. 49:69-84).
- a nucleic acid segment from the desired chlorophyll A oxygenase gene is cloned and operably linked to a promoter such that the antisense strand of RNA will be transcribed.
- the expression cassette is then transformed into plants, e.g., algae, and the antisense strand of RNA is produced.
- the antisense nucleic acid sequence transformed into plants will be substantially identical to at least a portion of the endogenous gene or genes to be repressed. The sequence, however, does not have to be perfectly identical to inhibit expression.
- an antisense or sense nucleic acid molecule encoding only a portion of chlorophyll A oxygenase can be useful for producing a plant in which chlorophyll A oxygenase expression is suppressed.
- the vectors of the present invention can be designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene.
- the introduced sequence also need not be full length relative to either the primary transcription product or fully processed mRNA. Generally, higher homology can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective. Normally, a sequence of between about 30 or 40 nucleotides and about full length nucleotides should be used, though a sequence of at least about 100 nucleotides is preferred, a sequence of at least about 200 nucleotides is more preferred, and a sequence of at least about 500 nucleotides is especially preferred. Sequences can also be longer, e.g., 1000 or 2000 nucleotides are greater in length.
- RNA molecules or ribozymes can also be used to inhibit expression of chlorophyll A oxygenase genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA cleaving activity upon them, thereby increasing the activity of the constructs.
- Ribozymes e.g., Group I introns
- Ribozymes have also been identified in the chloroplast of green algae (see, e.g., Cech et al., (1990) Annu Rev Biochem 59:543-568; Bhattacharya et al., (1996) Molec Biol and Evol 13:978-989; Erin, et al., (2003) Amer J Botany 90:628-633,; Turmel, et al., (1993) Nucl Acids Res.
- RNA-specific ribozymes The design and use of target RNA-specific ribozymes is described, e.g., in Haseloff et al. (1 88) Nature, 334:585-591.
- sense suppression also known as co- suppression
- Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to be an effective means by which to block the transcription of target genes.
- this method to modulate expression of endogenous genes see, Napoli et al., (1990) The Plant Cell 2:279- 289; Flavell, (1994) Proc. Natl. Acad. Sci., USA 91 :3490-3496; Kooter and Mol, (1993) Current Opin. Biol. 4: 166-171 ; and U.S. Pat. Nos. 5,034,323, 5,231 ,020, and 5,283, 184.
- the introduced sequence generally will be substantially identical to the endogenous sequence intended to be repressed. This minimal identity will typically be greater than about 65%, but a higher identity might exert a more effective repression of expression of the endogenous sequences. Substantially greater identity of more than about 80% is preferred, though about 90% or 95% to absolute identity would be most preferred. As with antisense regulation, the effect should apply to any other proteins within a similar family of genes exhibiting homology or substantial homology.
- the introduced sequence in the expression cassette needing less than absolute identity, also need not be full length, relative to either the primary transcription product or fully processed mRNA. This may be preferred to avoid concurrent production of some plants that are over-expressers. A higher identity in a shorter than full length sequence compensates for a longer, less identical sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and identity of non- coding segments will be equally effective. Normally, a sequence of the size ranges noted above for antisense regulation is used.
- RNA interference which uses a double-stranded RNA having a sequence identical or similar to the sequence of the target chlorophyll A oxygenase gene.
- RNAi RNA interference
- RNAi is the phenomenon in which when a double-stranded RNA having a sequence identical or similar to that of the target gene is introduced into a cell, the expressions of both the inserted exogenous gene and target endogenous gene are suppressed.
- the double-stranded RNA may be formed from two separate complementary RNAs or may be a single RNA with internally complementary sequences that form a double-stranded RNA.
- the introduced double-stranded RNA is initially cleaved into small fragments, which then serve as indexes of the target gene in some manner, thereby degrading the target gene.
- RNAi is known to be also effective in plants (see, e.g., Chuang, C. F. & Meyerowitz, E.
- RNAi RNA having the sequence of a DNA encoding the protein, or a substantially similar sequence thereof (including those engineered not to translate the protein) or fragment thereof, is introduced into a plant of interest, e.g., green algae.
- the resulting plants may then be screened for a phenotype associated with the target protein and/or by monitoring steady-state RNA levels for transcripts encoding the protein.
- the genes used for RNAi need not be completely identical to the target gene, they may be at least 70%, 80%, 90%, 95% or more identical to the CAO target gene sequence; such as, for example, a gene from Table Dl. See, e.g., U.S. Patent Publication No. 2004/0029283.
- the constructs encoding an RNA molecule with a stem-loop structure that is unrelated to the target gene and that is positioned distally to a sequence specific for the gene of interest may also be used to inhibit target gene expression. See, e.g., U.S. Patent Publication No. 2003/022121 1 , and the current examples.
- the RNAi polynucleotides may encompass the full-length target RNA or may correspond to a fragment of the target RNA. In some cases, the fragment will have fewer than 100, 200, 300, 400, 500 600, 700, 800, 900 or 1 ,000 nucleotides corresponding to the target sequence. In addition, in some embodiments, these fragments are at least, e.g., 15, 20, 25, 30, 50, 100, 150, 200, or more nucleotides in length.
- fragments for use in RNAi will be at least substantially similar to regions of a target protein that do not occur in other proteins in the organism or may be selected to have as little similarity to other organism transcripts as possible, e.g., selected by comparison to sequences in analyzing publicly- available sequence databases.
- RNAi fragments may be selected for similarity or identity with the N terminal region of the chlorophyll A oxygenase sequences of the invention (i.e., those sequences lacking significant homology to sequences in the databases) or may be selected for identity or similarity to conserved regions of chlorophyll A oxygenase proteins.
- Expression vectors that continually express siRNA in transiently- and stably- transfected cells have been engineered to express small hairpin RNAs, which get processed in vivo into siRNAs molecules capable of carrying out gene-specific silencing (Brummelkamp et al., (2002) Science 296:550-553, and Paddison, et al., (2002) Genes & Dev. 16:948-958).
- Post-transcriptional gene silencing by double-stranded RNA is discussed in further detail by Hammond et al. Nature Rev Gen 2: 1 10-1 19 (2001), Fire et al. (1998) Nature 391 :806-81 1 and Timmons and Fire (1998) Nature 395:854.
- the present invention exploits the ability of certain proteins (redox sensitive modulators) to act as reversible thiol-based redox switches to regulate gene expression in plants and algae to enable the light dependent regulation of PSII antenna size.
- proteins represent a growing family of proteins that is widely dispersed within the plant and animal kingdoms. See generally Antelmann H, & Helmann ID. (2010) Thiol-based redox switches and gene regulation. Antioxid Redox Signal. 2010 Jul 14. [Epub ahead of print], Brandes et al., (2009) Thiol-based redox switches in eukaryotic proteins. Antioxid Redox Signal. 1 1(5):997-1014, Paget MS, & Buttner M (2003) Thiol-based regulatory switches. Annu Rev Genet. 37:91-121.
- redox sensitive modulators refers to the group of proteins capable of mediating the reversible redox dependent regulation of gene transcription or translation.
- redox sensitive modulators include proteins that include the conserved cold shock domain (Prosite motif PS00352; Bucher and Bairoch, (In) ISMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology, Airman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., pp 53-61, AAAIPress, Menlo Park, 1994; Hofmann et al., Nucleic Acids Res. 27:215, 1999).
- the cold shock domain is among the most ancient and well conserved nucleic acid binding domains from bacteria to higher animals and plants (Chsikam et al., BMB reports (2010) 43(1) 1 -8; Nakaminami et al., (2006) 103(26) 10123-10127). Proteins containing a CSD motif are also referred to as Y box proteins and eukaryotic members of this large family generally contain a secondary auxiliary RNA domain which modulates the RNA affinity of the protein, but can be dispensable for selective RNA recognition.
- An exemplary redox sensitive modulator includes the cytosolic RNA binding protein NAB l (SEQ. BD. NO. 22) from Chlamydomonas. NAB l harbors 2 RNA binding motifs and one of these motifs, located at the N-terminus, is a cold shock domain. NAB l represses the translation of LHCTI (light harvesting complex of photosystem II) by sequesting the encoding mRNAs into translationally silent mRNP complexes. (Mussgnug et al., The Plant Cell (2005) 17 3409-3421).
- LHCTI light harvesting complex of photosystem II
- NAB l contains 2 cysteine residues, Cys- 181 and Cys-226, within its C- terminal RNA recognition motif. Modification of these cysteines either by oxidation or by alkylation in vitro is accompanied by a decrease in RNA binding affinity for the target mRNA sequence. Recent studies have confirmed that NAB l is fully active ' in its dithiol reduced state, and is reversibly deactivated by modification of its cysteines. (Wobbe et al., (2009) Pro. Nat. Acad. Sci. 106(32) 13290-13295).
- NAB l as used herein includes all naturally-occurring and synthetic forms of NAB 1 that retain redox sensitive modulator activity.
- NAB 1 proteins include the protein from Chlamydomonas, as well as peptides derived from other plant species and genera, and in one aspect algae.
- “NAB l” refers to the Chlamydomonas NAB 1 having the amino acid sequence SEQ. ID. NO. 22 in Table D2.
- NAB l from a number of different species have been sequenced, and are known in the art to be at least partially functionally interchangeable. It would thus be a routine matter to identify and select a variant being a NAB l from a species or genus other than Chlamydomonas.
- NAB l i.e., representative NAB l proteins from other species
- Table D2 See SEQ. ID. NOs. 22-33.
- rsgaaggert cyncgegghi arecqnestg narqgggggg NO.25 gnrscytcge aghlardc
- the NAB 1 may thus include one or more amino acid deletions, additions, insertions, and / or substitutions based on any of the naturally-occurring isoforms of NAB 1. These may be contiguous or non-contiguous. Representative variants may include those having 1 to 8, or more preferably 1 to 4, 1 to 3, or 1 or 2 amino acid substitutions, insertions, and / or deletions as compared to any of sequences listed in Table D2.
- NAB 1 polypeptides which may be used in any of the methods of the invention may have amino acid sequences which are substantially homologous, or substantially similar to any of the NAB 1 sequences listed in Table 1.
- the NAB 1 may have an amino acid sequence having at least 30% preferably at least 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, or 99% identity with a NAB l listed in Table D2.
- the NAB 1 is substantially homologous, or substantially similar to SEQ. ID. NO. 22.
- fragments of native or synthetic NAB l sequences may also have the desirable functional properties of the peptide from which they were derived and may be used in any of the methods of the invention.
- fragment as used herein thus includes fragments of NAB l provided that the fragment retains the biological activity of the whole molecule.
- the fragment may also include an N-terminal or C-terminal fragment of NAB l .
- Preferred fragments comprise residues 1 -80 of native NAB l , comprising the cold shock domain, or residues 160 to 247 comprising the RNA recognition motif.
- fragments having N- and / or C-terminal extensions or flanking sequences are also included. The length of such extended peptides may vary, but typically are not more than 50, 30, 25, or 20 amino acids in length.
- Fusion proteins of NAB l , and fragments of NAB l to other proteins are also included, and these fusion proteins may enhance NAB l ' s biological activity, targeting, binding or redox sensitivity.
- a flexible molecular linker optionally may be interposed between, and covalently join, the NAE 1 and any of the fusion proteins disclosed herein. Any such fusion protein many be used in any of the methods of the present invention.
- Variants may include, e.g., different allelic variants as they appear in nature, e.g., in other species or due to geographical variation. All such variants, derivatives, fusion proteins, or fragments of NAB 1 are included, may be used in any of the methods claims disclosed herein, and are subsumed under the term "NAB 1".
- the variants, derivatives, and fragments are functionally equivalent in that they have detectable redox dependent RNA binding activity. More particularly, they exhibit at least 40%, preferably at least 60%, more preferably at least 80% of the activity of wild type NAB 1 , particularly Chlamydomonas NAB 1. Thus they are capable of functioning as NAB 1, i.e., can substitute for NAB 1 itself..
- Such activity means any activity exhibited by a native NAB 1 , whether a physiological response exhibited in an in vivo or in vitro test system, or any biological activity or reaction mediated by a native NAB 1 e.g., in an enzyme assay or in binding to test tissues, nucleic acids, or metal ions.
- NAB 1 binds to cold shock domain consensus sequence motifs, for example as listed in Table D3.
- An assay for NAB l activity can thus be made by assaying for redox dependent binding to a nucleic acid comprising a cold shock domain consensus sequence motif. Such an assay is described in Wobbe et al., (2009) Proc. Natl. Acad. Sci. USA 106 (32) 13290-13295.
- CSDDCS cold stock domain consensus sequence motifs
- the NAB l is endogenous to the organism. In another aspect of any of these methods and transgenic organisms, the NAB l is heterologous to the transgenic organism. IV. PHOTOSYNTHETIC ORGANISMS
- the present invention can be practiced with any photosynthetic organism, i.e. plant or algae with a light harvesting antenna.
- the algae used with the invention can include any naturally occurring plant or algal species or any genetically engineered plant or algae.
- the plant or algae used with the invention include any commercially available strain, any strain native to a particular region, or any proprietary strain. Additionally, the plant or algae can be of any Division, Class, Order, Family, Genus, or Species, or any subsection thereof. In one aspect algae which possess chloroplasts are preferred.
- the algae used with the methods of the invention are members of one of the following divisions: Chlorophyta, Cyanophyta (Cyanobacteria), and Heteromonyphyta.
- the algae used with the methods of the invention are members of one of the following classes: Chlorophyceae, Bacillariophyceae, Eustigmatophyceae, and Chrysophyceae.
- the algae used with the methods of the invention are members of one of the following genera: Chlamydomonas, Nannochloropsis, Chlorella, Dunaliella, Scenedesmus, Selenastrum, Oscillatoria, Phormidium, Spirulina, Amphora, and Ochromonas.
- algae of the genus Chlamydomonas is preferred.
- Non-limiting examples of algae species that can be used with the methods of the present invention include for example, Achnanthes orientalis, Agmenellum spp., Amphiprora hyaline, Amphora coffeiformis, Amphora coffeiformis var. linea, Amphora coffeiformis var. punctata, Amphora coffeiformis var. taylori, Amphora coffeiformis var. tenuis, Amphora americanissima. Amphora americanissima var.
- Chlorella kessleri Chlorella lobophora
- Chlorella luteoviridis Chlorella luteoviridis var. aureoviridis
- Chlorella luteoviridis var. lutescens Chlorella miniata, Chlorella minutissima, Chlorella mutabilis, Chlorella nocturna, Chlorella ovalis, Chlorella parva, Chlorella photophila, Chlorella pringsheimii, Chlorella protothecoides, Chlorella protothecoides var. acidicola, Chlorella regularis, Chlorella regularis var. minima, Chlorella regularis var.
- Dunaliella sp. Dunaliella bardawil, Dunaliella bioculata, Dunaliella granulate, Dunaliella maritime, Dunaliella minuta, Dunaliella parva, Dunaliella peircei, Dunaliella primolecta, Dunaliella salina, Dunaliella terricola, Dunaliella tertiolecta, Dunaliella viridis, Dunaliella tertiolecta, Eremosphaera viridis, Eremosphaera sp., Ellipsoidon sp., Euglena spp., Franceia sp., Fragilaria crotonensis, Fragilaria sp., Gleocapsa sp., Gloeothamnion sp., Haematococcus pluvialis, Hymenomonas sp., Isochrysis aff.
- algae of the following species are preferred, Chlamydomas perigranulata, Chlamydomonas moew sii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliqu s, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
- an expression vector can be used to deliver a nucleic acid molecule comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO.
- CSDDCS cold-shock domain consensus sequence
- the expression vector will further comprise a promoter that is operatively coupled to the CSDDCS motif and drives expression of the CAO coding region.
- the CSDDCS motif is inserted between the promoter and the start of the CAO start codon.
- the expression vector comprises a CSDDCS motif is substantially identical to a sequence selected from the group consisting of SEQ ID. No. 39, SEQ ID. No. 40, SEQ ID. No. 41, SEQ ID. No. 42, SEQ ID. No. 43, SEQ ED. No. 44, SEQ ID. No. 45, SEQ ID. No. 46, and SEQ ID. No. 47.
- the CAO gene may be an endogenous gene from the photosynthetic organism to be used with the expression vector. Accordingly in different aspects the CAO gene may be any plant, or algal CAO gene. In one aspect, the CAO gene is substantially identical to a sequence selected from the group consisting of SEQ ID. No. 34, SEQ ID. No. 35, SEQ ID. No. 36, SEQ ID. No. 37, and SEQ ID. No. 38.
- a vector can also used to deliver a nucleic acid molecule encoding a silencing RNA into a plant cell to enable the suppression of the expression of the endogenous CAO in the cell.
- the expression vectors can be, for example, DNA plasmids or viral vectors.
- Various expression vectors are known in the art. The selection of the appropriate expression vector can be made on the basis of several factors including, but not limited to the cell type wherein expression is desired.
- Agrobacterium-based expression vectors can be used to express the nucleic acids of the presently disclosed subject matter when stable expression of the vector insert is sought in a plant cell.
- Suitable algal expression vectors include for example, the PSL18 plasmid, and derivatives thereof (Depege, N., Bellafiore, S and Rochaix, J.-D., 2003, Science 299: 1572 - 1575).
- viral vectors for plant transformation.
- Such vectors include, for example, wheat dwarf virus (WDV) "shuttle" vectors, such as pWl-1 1 and pWl-GUS (Ugaki et al, 1991).
- WDV wheat dwarf virus
- pWl-1 1 and pWl-GUS Ugaki et al, 1991.
- pWl-1 1 and pWl-GUS Ugaki et al, 1991.
- a replicating vector also may be useful for delivery of genes flanked by DNA sequences from transposable elements such as Ac Ds, or Mu. It has been proposed that transposition of these elements within the maize genome requires DNA replication (Laufs et al, 1990).
- transposable elements would be useful for producing transgenic plants lacking elements necessary for selection and maintenance of the plasmid vector in bacteria, e.g., antibiotic resistance genes, or other selectable markers, and origins of DNA replication. It also is proposed that use of a transposable element such as Ac, Ds, or Mu would actively promote integration of the desired DNA and hence increase the frequency of stably transformed cells.
- Promoters The expression of the nucleotide sequence in the expression cassette can be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus.
- Basal promoters in plants typically comprise canonical regions associated with the initiation of transcription, such as CAAT and TATA boxes.
- the TATA box element is usually located approximately 20 to 35 nucleotides upstream of the initiation site of transcription.
- the CAAT box element is usually located approximately 40 to 200 nucleotides upstream of the start site of transcription. The location of these basal promoter elements result in the synthesis of an RNA transcript comprising nucleotides upstream of the translational ATG start site.
- RNA upstream of the ATG is commonly referred to as a 5' untranslated region or 5' UTR. It is possible to use standard molecular biology techniques to make combinations of basal promoters, that is regions comprising sequences from the CAAT box to the translational start site, with other upstream promoter elements to enhance or otherwise alter promoter activity or specificity.
- the promoters may be altered to contain "enhancer DNA” to assist in elevating gene expression.
- certain DNA elements can be used to enhance the transcription of DNA. These enhancers often are found 5' to the start of transcription in a promoter that functions in eukaryotic cells, but can often be inserted upstream (5') or downstream (3') to the coding sequence.
- these 5' enhancer DNA elements are introns.
- the introns that are particularly useful as enhancer DNA are the 5' introns from the rice actin 1 gene (see U.S. Pat. No. 5,641,876), the rice actin 2 gene, the maize alcohol dehydrogenase gene, the maize heat shock protein 70 gene (U.S. Pat. No. 5,593,874), the maize shrunken 1 gene, the light sensitive 1 gene of Solanum tuberosum, and the heat shock protein 70 gene of Petunia hybrida (U.S. Pat. No. 5,659,122).
- exemplary constitutive promoters include those derived from the CaMV 35S, rice actin, and maize ubiquitin genes, each described herein below.
- Exemplary promoters for microalgae production include the actin promoter, psaD promoter (US2002/0104119; Fischer and Rochaix (2001) Mol. Gen. Genet. 265, 888- 894), B-tubulin, CAB, and rbcs promoters.
- Exemplary inducible promoters for this purpose include the chemically inducible PR- la promoter and a wound- inducible promoter, also described herein below.
- Selected promoters can direct expression in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example).
- tissue specific promoters include well- characterized root-, pith-, and leaf-specific promoters, each described herein below.
- promoter selection can be based on expression profile and expression level.
- the following are representative non-limiting examples of promoters that can be used in the expression cassettes.
- the CaMV 35S promoter can be used to drive constitutive gene expression. Construction of the plasmid pCGN1761 is described in the published patent application EP 0 392 225, which a CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC- type backbone.
- Actin Promoter Several isoforms of actin are known to be expressed in most cell types and consequently the actin promoter is a good choice for a constitutive promoter.
- the promoter from the rice Act/ gene has been cloned and characterized (McElroy et a ., 1990).
- a 1.3 kb fragment of the promoter was found to contain inter ali the regulatory elements required for expression in rice protoplasts.
- numerous expression vectors based on the Act/ promoter have been constructed specifically for use in monocotyledons (McElroy et a/., 1991).
- Ubiquitin Promoter Ubiquitin is another gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g. sunflower—Binet et al., 1991 and maize-Christensen et a/., 1989).
- the maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926 which is herein incorporated by reference.
- Taylor et al., 1993 describe a vector (pAHC25) that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment.
- the ubiquitin promoter is suitable for gene expression in transgenic plants, especially monocotyledons.
- Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
- the double 35S promoter in pCGN1761E X can be replaced with any other promoter of choice that will result in suitably high expression levels.
- one of the chemically regulatable promoters described in U.S. Patent No. 5,614,395 can replace the double 35S promoter.
- the promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate terminal restriction sites.
- the selected target gene coding sequence can be inserted into this vector, and the fusion products (i.e., promoter-gene-terminator) can subsequently be transferred to any selected transformation vector, including those described below.
- fusion products i.e., promoter-gene-terminator
- Various chemical regulators can be employed to induce expression of the selected coding sequence in the plants transformed according to the presently disclosed subject matter, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,31 1 and 5,614,395, herein incorporated by reference.
- Transcriptional Terminators A variety of transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation.
- RNA polymerase ⁇ terminators are those that are known to function in the relevant microalgae or plant system.
- Representative plant transcriptional terminators include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, and the pea rbcS E9 terminator.
- these terminators typically comprise a - 52 run of 5 or more consecutive thymidine residues.
- an RNA polymerase ⁇ terminator comprises the sequence TTTTTTT. These can be used in both monocotyledons and dicotyledons.
- endogenous 5' and 3' elements from the genes listed above i.e. appropriate 5' and 3' flanking sequences from the, psbA, psbD, rbcl, actin, psaD, B-tubulin, CAB, rbcs and psal genes may be used.
- intron sequences have been shown to enhance expression, particularly in monocotyledonous cells.
- the introns of the maize Adbl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells.
- Intron 1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et a/., 1987).
- the intron from the maize bronzes gene had a similar effect in enhancing expression.
- Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
- leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells.
- TMV Tobacco Mosaic Virus
- MCMV Maize Chlorotic Mottle Virus
- AY Alfalfa Mosaic Virus
- Agrobacterium Transformation Vectors Many vectors are available for transformation using Agrobacterium tumefaciens and may be used for plant transformation. These typically carry at least one T-DNA border sequence and include vectors such as ⁇ 19 (Bevan, 1984) and related vectors.
- Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T- DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation), vortexing with glass beads, and microinjection.
- the choice of vector can depend on the technique chosen for the species being transformed. In particular particle bombardment methods and the use of glass beads are preferred for microalgae.
- Selectable Markers For certain target species, different antibiotic or herbicide selection markers can be preferred. Selection markers used routinely in transformation include the nptn gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982; Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et a/., 1990; Spencer et a/., 1990), the hph gene, which confers resistance to the antibiotic hygromycin (Blochlinger & Diggelmann, 1984), the dhfr gene, which confers resistance to methotrexate (Bourouis & Jarry, 1983), and the EPSP synthase gene, which confers resistance to glyphosate (U.S. Patent Nos. 4, 940,935 and 5,188,642).
- Screenable markers that may be employed include a ⁇ -glucuronidase or uidA gene (Jefferson et al, 1986; the protein product is commonly referred to as GUS), isolated from E. coli, which encodes an enzyme for which various chromogenic substrates are known; an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al, 1988); a ⁇ -lactamase gene (Sutcliffe, 1978), which encodes an enzyme for which various chromogenic substrates are known ⁇ e.g., PAD AC, a chromogenic cephalosporin); a xylE gene (Zukowsky et al, 1983) which encodes a catechol dioxygenase that can convert chromogenic catechols; an a-amylase gene (Ikuta et al, 1990); a tyrosinase gene (
- the R gene complex in maize encodes a protein that acts to regulate the production of anthocyanin pigments in most seed and plant tissue.
- Maize strains can have one, or as many as four, R alleles which combine to regulate pigmentation in a developmental and tissue specific manner.
- an R gene introduced into such cells will cause the expression of a red pigment and, if stably incorporated, can be visually scored as a red sector.
- a maize line carries dominant alleles for genes encoding for the enzymatic intermediates in the anthocyanin biosynthetic pathway (C2, Al , A2, Bzl and Bz2), but carries a recessive allele at the R locus, transformation of any cell from that line with R will result in red pigment formation.
- Exemplary lines include Wisconsin 22 which contains the rg-Stadler allele and TR1 12, a K55 derivative which has the genotype r-g, b, PI.
- any genotype of maize can be utilized if the CI and R alleles are introduced together.
- R gene regulatory regions may be employed in chimeric constructs in order to provide mechanisms for controlhng the expression of chimeric genes. More diversity of phenotypic expression is known at the R locus than at any other locus (Coe et al., 1988). It is contemplated that regulatory regions obtained from regions 5' to the structural R gene would be valuable in directing the expression of genes for, e.g., insect resistance, herbicide tolerance or other protein coding regions. For the purposes of the present invention, it is believed that any of the various R gene family members may be successfully employed (e.g., P, S, Lc, etc). However, the most preferred will generally be Sn (particularly Sn:bol3).
- Sn is a dominant member of the R gene complex and is functionally similar to the R and B loci in that Sn controls the tissue specific deposition of anthocyanin pigments in certain seedling and plant cells, therefore, it's phenotype is similar to R.
- a screenable marker contemplated for use in the present invention is firefly luciferase, encoded by the lux gene.
- the presence of the lux gene in transformed cells may be detected using, for example, X-ray film, scintillation counting, fluorescent spectrophotometry, low-light video cameras, photon counting cameras or multiwell luminometry. It also is envisioned that this system may be developed for populational screening for bioluminescence, such as on tissue culture plates, or even for whole plant screening.
- the gene which encodes green fluorescent protein is contemplated as a particularly useful reporter gene (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al. , 1996; Tian et al., 1997; PCT Publication WO 97/41228). Expression of green fluorescent protein may be visualized in a cell or plant as fluorescence following illumination by particular wavelengths of light. Where use of a screenable marker gene such as lux or GFP is desired, the inventors contemplated that benefit may be realized by creating a gene fusion between the screenable marker gene and a selectable marker gene, for example, a GFP-NPTII gene fusion (PCT Publication WO 99/60129). This could allow, for example, selection of transformed cells followed by screening of transgenic plants or seeds. In a similar manner, it is possible to utilize other readily available fluorescent proteins such as red fluorescent protein (CLONTECH, Palo Alto, CA).
- Suitable methods for plant transformation for use- with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts (Omirulleh et ai, 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus et ai , 1985), by electroporation (U.S. Patent No. 5,384,253, specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler et ai, 1990; U.S. Patent No. 5,302,523, and U.S. Patent No.
- friable tissues such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly.
- pectolyases pectolyases
- Examples of some species which have been transformed by electroporation of intact cells include maize (U.S. Patent No. 5,384,253; D'Halluin et al., 1992), wheat (Zhou et al., 1993), and soybean (Christou et al, 1987).
- One also may employ protoplasts for electroporation transformation of plants (Bates, 1994; Lazzeri, 1995).
- protoplasts for electroporation transformation of plants
- the generation of transgenic soybean plants by electroporation of cotyledon-derived protoplasts is described by Dhir and Widholm in PCT Publication WO 92/17598 (specifically incorporated herein by reference).
- Other examples of species for which protoplast transformation has been described include barley (Lazerri, 1995), sorghum (Battraw and Hall, 1991), maize (Bhattacharjee et al, 1997), wheat (He et al., 1994) and tomato (Tsukada, 1989).
- microprojectile bombardment U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; and PCT Publication WO 95/06128; each of which is specifically incorporated herein by reference in its entirety.
- particles may be coated with nucleic acids and delivered into cells by a propelling force.
- Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. Hence, it is proposed that DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
- cells in suspension are concentrated on filters or solid culture medium.
- immature embryos or other target cells may be arranged on solid culture medium.
- the cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
- An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is the Biolistics Particle Delivery System (BioRad, Hercules, CA), which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with monocot plant cells cultured in suspension.
- the screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing the damage inflicted on the recipient cells by projectiles that are too large.
- Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species.
- species for which have been transformed by microprojectile bombardment include monocot species such as maize (PCT Publication WO 95/06128), barley (Ritala et al, 1994; Hensgens et al., 1993), wheat (U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety), rice (Hensgens et al , 1993), oat (Torbet et al, 1995; Torbet et al., 1998), rye (Hensgens et al.,
- Agrobacterium-med ated transfer is a preferred system that is widely applicable for introducing genes into plant.
- the use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described by Fraley et al. (1985), Rogers et al. ( 1987) and U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety.
- Agrobacterium-mediated transformation is most efficient in dicotyledonous plants and is the preferable method for transformation of dicots, including Arabidopsis, tobacco, tomato, and potato. Indeed, while Agrobacterium-mediated transformation has been routinely used with dicotyledonous plants for a number of years, it has only recently become applicable to monocotyledonous plants. Advances in Agrobacterium-mediated transformation techniques have now made the technique applicable to nearly all monocotyledonous plants. For example, Agrobacterium- ediated transformation techniques have now been applied to rice (Hiei et al., 1997; Zhang et al, 1997; U.S. Patent No.
- a number of wild-type and disarmed strains of Agrobacterium tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri plasmids can be used for gene transfer into plants.
- the Agrobacterium hosts contain disarmed Ti and Ri plasmids that do not contain the oncogenes which cause tumorigenesis or rhizogenesis, respectively, which are used as the vectors and contain the genes of interest that are subsequently introduced into plants.
- Preferred strains would include but are not limited to Agrobacterium tumefaciens strain C58, a nopaline-type strain that is used to mediate the transfer of DNA into a plant cell, octopine-type strains such as LBA4404 or succinamopine-type strains e.g., EHA101 or EHA105.
- octopine-type strains such as LBA4404 or succinamopine-type strains e.g., EHA101 or EHA105.
- the use of these strains for plant transformation has been reported and the methods are familiar to those of skill in the art.
- the Agrobacterium can be prepared either by inoculating a liquid such as Luria Burtani (LB) media directly from a glycerol stock or streaking the Agrobacterium onto a solidified media from a glycerol stock, allowing the bacteria to grow under the appropriate selective conditions, generally from about 26° C - 30° C, more preferably about 28° C, and taking a single colony from the plate and inoculating a liquid culture medium containing the selective agents.
- LB Luria Burtani
- a loopful or slurry of Agrobacterium can be taken from the plate and resuspended in liquid and used for inoculation.
- an Agrobacterium culture is inoculated from a streaked plate or glycerol stock and is grown overnight, and the bacterial cells are washed and resuspended in a culture medium suitable for inoculation of the explant.
- Suitable inoculation media for the present invention include, but are not limited 1 ⁇ 2 MSPL (2.2 g/L GIBCO (Carlsbad, CA) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 1 15 g/L L-proline, 26 g/L D-glucose, 68.5 g/L sucrose, pH 5.4) or 1 ⁇ 2 MS VI (2.2 g/L GIBCO (Carlsbad, CA) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 1 15 g/L L-proline, 10 g/L D-glucose, and 10 g/L sucrose, pH 5.4).
- MSPL 2.2 g/L GIBCO (Carls
- the inoculation media may be supplemented with a growth inhibiting agent (PCT Publication WO 01/09302).
- a growth inhibiting agent PCT Publication WO 01/09302
- the range and concentration of the growth inhibition agent can vary and depends of the agent and plant system.
- Growth inhibiting agents including, but not limited to, silver nitrate, silver thiosulfate, or carbenicillin are the preferred growth inhibition agents.
- the growth inhibiting agent is added in the amount necessary to achieve the desired effect.
- Silver nitrate is preferably used in the inoculation media at a concentration of about ⁇ (micromolar) to 1 mM (millimolar), more preferably 5 ⁇ - 100 ⁇ .
- the concentration of carbenicillin used in the inoculation media is about 5 mg/L to 100 mg/L, more preferably about 50 mg/L.
- a compound which induces Agrobacterium virulence genes such as acetosyringone can also be added to the inoculation
- the Agrobacterium used for inoculation are pre- induced in a medium such as a buffered media with appropriate salts containing acetosyringone, a carbohydrate, and selective antibiotics.
- the Agrobacterium cultures used for transformation are pre-induced by culturing at about 28°C in AB-glucose minimal medium (Chilton et al, 1974; Lichtenstein and Draper, 1986) supplemented with acetosyringone at about 200 ⁇ and glucose at about 2%.
- the concentration of selective antibiotics for Agrobacterium in the pre-induction medium is about half the concentration normally used in selection.
- the density of the Agrobacterium cells used is about 10 7 - 10 10 cfu/ml of Agrobacterium. More preferably, the density of Agrobacterium cells used is about 5 X 10 8 - 4 x 10 9 cfu/me. Prior to inoculation the Agrobacterium can be washed in a suitable media such as 1 ⁇ 2 MS.
- the next stage of the transformation process is the inoculation.
- the explants and Agrobacterium cell suspensions are mixed together.
- the mixture of Agrobacterium and explant(s) can also occur prior to or after a wounding step.
- wounding as used herein is meant any method to disrupt the plant cells thereby allowing the Agrobacterium to interact with the plant cells.
- Those of skill in the art are aware of the numerous methods for wounding. These methods would include, but are not limited to, particle bombardment of plant tissues, sonicating, vacuum infiltrating, shearing, piercing, poking, cutting, or tearing plant tissues with a scalpel, needle or other device.
- the duration and condition of the inoculation and Agrobacterium cell density will vary depending on the plant transformation system.
- the inoculation is generally performed at a temperature of about 15°C - 30°C, preferably 23°C - 28°C from less than one minute to about 3 hours.
- the inoculation can also be done using a vacuum infiltration system.
- any excess Agrobacterium suspension can be removed and the Agrobacterium and target plant material are co-cultured.
- the co-culture refers to the time post-inoculation and prior to transfer to a delay or selection medium.
- Any number of plant tissue culture media can be used for the co-culture step.
- a reduced salt media such as half-strength MS-based co-culture media is used and the media lacks complex media additives including but not limited to undefined additives such as casein hydolysate, and B5 vitamins and organic additives.
- Plant tissues after inoculation with Agrobacterium can be cultured in a liquid media.
- plant tissues after inoculation with Agrobacterium are cultured on a semi-solid culture medium solidified with a gelling agent such as agarose, more preferably a low EEO agarose.
- a gelling agent such as agarose, more preferably a low EEO agarose.
- the co-culture duration is from about one hour to 72 hours, preferably less than 36 hours, more preferably about 6 hours to 35 hours.
- the co-culture media can contain one or more Agrobacterium growth inhibiting agent(s) or combination of growth inhibiting agents such as silver nitrate, silver thiosulfate, or carbenicillin.
- the concentration of silver nitrate or silver thiosulfate is preferably about 1 ⁇ to 1 mM, more preferably about 5 ⁇ to 100 ⁇ , even more preferably about 10 ⁇ to 50 ⁇ , most preferably about 20 ⁇ .
- the concentration of carbenicillin in the co-culture medium is preferably about 5 mg/L to 100 mg/L more preferably 10 mg L to 50 mg/L, even more preferably about 50 mg/L.
- the co-culture is typically performed for about one to three days more preferably for less than 24 hours at a temperature of about 18° C - 30° C, more preferably about 23° C - 25° C.
- the co-culture can be performed in the light or in light-limiting conditions. Preferably, the co-culture is performed in light-limiting conditions.
- light-limiting conditions as used herein is meant any conditions which limit light during the co-culture period including but not limited to covering a culture dish containing the plant; 'Agrobacterium mixture with a cloth, foil , or placing the culture dishes in a black bag, or placing the cultured cells in a dark room. Lighting conditions can be optimized for each plant system as is known to those of skill in the art.
- the explants can be placed directly onto selective media.
- the explants can be sub-cultured onto selective media in successive steps or stages.
- the first selective media can contain a low amount of selective agent, and the next sub-culture can contain a higher concentration of selective agent or vice versa.
- the explants can also be placed directly on a Fixed concentration of selective agent. Alternatively, after co-culture with Agrobacterium, the explants can be placed on media without the selective agent. Those of skill in the art are aware of the numerous modifications in selective regimes, media, and growth conditions that can be varied depending on the plant system and the selective agent. In the preferred embodiment, after incubation on nonselective media containing the antibiotics to inhibit Agrobacterium growth without selective agents, the explants are cultured on selective growth media.
- Typical selective agents include but are not limited to antibiotics such as geneticin (G418), kanamycin, paromomycin, herbicides such as glyphosate or phosephinothericine, or other growth inhibitory compounds such as amino acid analogues, e.g., 5 methyltryptophan.
- Additional appropriate media components can be added to the selection or delay medium to inhibit Agrobacterium growth.
- Such media components can include, but are not limited to antibiotics such as carbenicillin or cefotaxime.
- cells can be analyzed for efficiency of DNA delivery by a transient assay that can be used to detect the presence of one or more gene(s) contained on the transformation vector, including, but not limited to a screenable marker gene such as the gene that codes for ⁇ -glucuronidase (GUS).
- GUS ⁇ -glucuronidase
- the total number of blue spots (indicating GUS expression) for a selected number of explants is used as a positive correlation of DNA transfer efficiency.
- the efficiency of T-DNA delivery and the effect of various culture condition manipulations on T-DNA delivery can be tested in transient analyses as described.
- a reduction in the T-DNA transfer process can result in a decrease in copy number and complexity of integration as complex integration patterns can originate from co-integration of separate T-DNAs (DeNeve et al., 1997).
- the effect of culture conditions of the target tissue can be tested by transient analyses and more preferably, in stably transformed plants. Any number of methods are suitable for plant analyses, including but not limited to, histochemical assays, biological assays, and molecular analyses.
- the next steps generally concern identifying the transformed cells for further culturing and plant regeneration.
- identifying the transformed cells for further culturing and plant regeneration.
- one may desire to employ a selectable or screenable marker gene as, or in addition to, the expressible gene of interest.
- Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, e.g., Potrykus et al, 1985; Lorz et al, 1985; Omirulleh et al, 1993; Fromm et al, 1986; Uchimiya et al, 1986; Callis et al, 1987; Marcotte et al, 1988).
- Examples of the use of direct uptake transformation of cereal protoplasts include transformation of rice (Ghosh- Biswas et al, 1994), sorghum (Battraw and Hall, 1991), barley (Lazerri, 1995), oat (Zheng and Edwards, 1990) and maize (Omirulleh et al, 1993).
- DNA is introduced into only a small percentage of target cells in any one experiment.
- a means for selecting those cells that are stably transformed is to introduce into the host cell, a marker gene which confers resistance to some normally inhibitory agent, such as an antibiotic or herbicide.
- antibiotics which may be used include the aminoglycoside antibiotics neomycin, kanamycin, G418 and paromomycin, or the antibiotic hygromycin.
- aminoglycoside antibiotics Resistance to the aminoglycoside antibiotics is conferred by aminoglycoside phosphostransferase enzymes such as neomycin phosphotransferase ⁇ (NPT II) or NPT I, whereas resistance to hygromycin is conferred by hygromycin phosphotransferase.
- aminoglycoside phosphostransferase enzymes such as neomycin phosphotransferase ⁇ (NPT II) or NPT I
- hygromycin phosphotransferase Resistance to the aminoglycoside antibiotics is conferred by aminoglycoside phosphostransferase enzymes such as neomycin phosphotransferase ⁇ (NPT II) or NPT I, whereas resistance to hygromycin is conferred by hygromycin phosphotransferase.
- Glyphosate inhibits the action of the enzyme EPSPS, which is active in the aromatic amino acid biosynthetic pathway. Inhibition of this enzyme leads to starvation for the amino acids phenylalanine, tyrosine, and tryptophan and secondary metabolites derived thereof.
- U.S. Patent No. 4,535,060 describes the isolation of EPSPS mutations which confer glyphosate resistance on the Salmonella typhimurium gene for EPSPS, aw A.
- the EPSPS gene was cloned from Zea mays and mutations similar to those found in a glyphosate resistant aroA gene were introduced in vitro. Mutant genes encoding glyphosate resistant EPSPS enzymes are described in, for example, PCT Publication WO 97/04103. The best characterized mutant EPSPS gene conferring glyphosate resistance comprises amino acid changes at residues 102 and 106, although it is anticipated that other mutations will also be useful (PCT Publication WO 97/04103). Furthermore, a naturally occurring glyphosate resistant EPSPS may be used, e.g., the CP4 gene isolated from Agrobacterium encodes a glyphosate resistant EPSPS (U.S. Patent No. 5,627,061).
- tissue is cultured for 0 - 28 days on nonselective medium and subsequently transferred to medium containing from 1 -3 mg/1 bialaphos or 1 -3 mM glyphosate as appropriate. While ranges of 1 - 3 mg/1 bialaphos or 1-3 mM glyphosate will typically be preferred, it is believed that ranges of 0.1-50 mg 1 bialaphos or 0.1-50 mM glyphosate will find utility in the practice of the invention. Bialaphos and glyphosate are provided as examples of agents suitable for selection of transformants, but the technique of this invention is not limited to them.
- Bialaphos is a tripeptide antibiotic produced by Streptomyces hygroscopicus and is composed of phosphinothricin (PPT), an analogue of L-glutamic acid, and two L-alanine residues. Upon removal of the L-alanine residues by intracellular peptidases, the PPT is released and is a potent inhibitor of glutamine synthetase (GS), a pivotal enzyme involved in ammonia assimilation and nitrogen metabolism (Ogawa et ai, 1973). Synthetic PPT, the active ingredient in the herbicide LibertyTM also is effective as a selection agent. Inhibition of GS in plants by PPT causes the rapid accumulation of ammonia and death of the plant cells.
- PPT phosphinothricin
- GS glutamine synthetase
- Synthetic PPT the active ingredient in the herbicide LibertyTM also is effective as a selection agent. Inhibition of GS in plants by PPT causes the rapid accumulation of ammonia
- the organism producing bialaphos and other species of the genus Streptomyces also synthesizes an enzyme phosphinothricin acetyl transferase (PAT) which is encoded by the bar gene in Streptomyces hygroscopicus and the pat gene in Streptomyces viridochromogenes.
- PAT phosphinothricin acetyl transferase
- the use of the herbicide resistance gene encoding phosphinothricin acetyl transferase (PAT) is referred to in DE 3642 829 A, wherein the gene is isolated from Streptomyces viridochromogenes.
- this enzyme acetylates the free amino group of PPT preventing auto-toxicity (Thompson et ai, 1987).
- the bar gene has been cloned (Murakami et ai, 1986; Thompson et ai, 1987) and expressed in transgenic tobacco, tomato, potato (De Block et ai, 1987) Brassica (De Block et ai , 1989) and maize (U.S. Patent No. 5,550,318).
- some transgenic plants which expressed the resistance gene were completely resistant to commercial formulations of PPT and bialaphos in greenhouses.
- the herbicide dalapon 2,2-dichloropropionic acid
- the enzyme 2,2- dichloropropionic acid dehalogenase inactivates the herbicidal activity of 2,2- dichloropropionic acid and therefore confers herbicidal resistance on cells or plants expressing a gene encoding the dehalogenase enzyme (Buchanan-Wollaston et ai, 1992; U.S. Patent No. 5,780,708).
- anthranilate synthase which confers resistance to certain amino acid analogs, e.g., 5-methyltryptophan or 6-methyl anthranilate, may be useful as a selectable marker gene.
- the use of an anthranilate synthase gene as a selectable marker was described in U.S. Patent No. 5,508,468 and US Patent No. 6, 1 18,047.
- An example of a screenable marker trait is the red pigment produced under the control of the R-locus in maize. This pigment may be detected by culturing cells on a solid support containing nutrient media capable of supporting growth at this stage and selecting cells from colonies (visible aggregates of cells) that are pigmented. These cells may be cultured further, either in suspension or on solid media. In a similar fashion, the introduction of the CI and B genes will result in pigmented cells and/or tissues.
- the enzyme luciferase may be used as a screenable marker in the context of the present invention.
- cells expressing luciferase emit light which can be detected on photographic or x-ray film, in a luminometer (or liquid scintillation counter), by devices that enhance night vision, or by a highly light sensitive video camera, such as a photon counting camera. All of these assays are nondestructive and transformed cells may be cultured further following identification.
- the photon counting camera is especially valuable as it allows one to identify specific cells or groups of cells that are expressing luciferase and manipulate cells expressing in real time.
- Another screenable marker which may be used in a similar fashion is the gene coding for green fluorescent protein (GFP) or a gene coding for other fluorescing proteins such as DsRed® (Clontech, Palo Alto, CA).
- a selection agent such as bialaphos or glyphosate
- selection with a growth inhibiting compound, such as bialaphos or glyphosate at concentrations below those that cause 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as luciferase or GFP would allow one to recover transformants from cell or tissue types that are not amenable to selection alone.
- combinations of selection and screening may enable one to identify transformants in a wider variety of cell and tissue types. This may be efficiently achieved using a gene fusion between a selectable marker gene and a screenable marker gene, for example, between an ⁇ gene and a GFP gene (WO 99/60129).
- Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay may be cultured in media that supports regeneration of plants.
- MS and N6 (Chu et al., 1975) media may be modified by including further substances such as growth regulators.
- Preferred growth regulators for plant regeneration include cytokins such as 6-benzylamino pierine, zeahin or the like, and abscisic acid. Media improvement in these and like ways has been found to facilitate the growth of cells at specific developmental stages.
- Tissue may be maintained on a basic media with auxin type growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration, then transferred to media conducive to maturation of embryoids. Cultures are transferred every 1 -4 weeks, preferably every 2-3 weeks on this medium. Shoot development will signal the time to transfer to medium lacking growth regulators.
- the transformed cells identified by selection or screening and cultured in an appropriate medium that supports regeneration, will then be allowed to mature into plants.
- Developing plantlets were transferred to soiless plant growth mix, and hardened off, e.g. , in an environmentally controlled chamber at about 85% relative humidity, 600 ppm CO2, and 25-250 microeinsteins m "2 s "1 of light, prior to transfer to a greenhouse or growth chamber for maturation.
- Plants are preferably matured either in a growth chamber or greenhouse. Plants are regenerated from about 6 wk to 10 months after a transformant is identified, depending on the initial tissue.
- cells are grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Cons.
- Regenerating plants are preferably grown at about 19 to 28°C. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing. Plants may be pollinated using conventional plant breeding methods known to those of skill in the art and seed produced.
- Progeny may be recovered from transformed plants and tested for expression of the exogenous expressible gene.
- seeds on transformed plants may occasionally require embryo rescue due to cessation of seed development and premature senescence of plants.
- embryo rescue To rescue developing embryos, they are excised from surface- disinfected seeds 10-20 days post-pollination and cultured.
- An embodiment of media used for culture at this stage comprises MS salts, 2% sucrose, and 5.5 g/1 agarose.
- embryo rescue large embryos (defined as greater than 3 mm in length) are germinated directly on an appropriate media. Embryos smaller than that may be cultured for 1 wk on media containing the above ingredients along with 10 "5 M abscisic acid and then transferred to growth regulator-free medium for germination.
- assays include, for example, “molecular biological” assays, such as Southern and Northern blotting and PCR; “biochemical” assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
- Genomic DNA may be isolated from callus cell lines or any plant parts to determine the presence of the exogenous gene through the use of techniques well known to those skilled in the art. Note, that intact sequences will not always be present, presumably due to rearrangement or deletion of sequences in the cell.
- DNA elements introduced through the methods of this invention may be determined by polymerase chain reaction (PCR). Using this technique discreet fragments of DNA are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a gene is present in a stable transformant, but does not necessarily prove integration of the introduced gene into the host cell genome. Typically, DNA has been integrated into the genome of all transformants that demonstrate the presence of the gene through PCR analysis. In addition, it is not possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the genome, i.e., whether transformants are of independent origin. Using PCR techniques it is possible to clone fragments of the host genomic DNA adjacent to an introduced gene.
- PCR polymerase chain reaction
- Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition, it is possible through Southern hybridization to demonstrate the presence of introduced genes in high molecular weight DNA, i.e., confirm that the introduced gene has been integrated into the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a gene, but also demonstrates integration into the genome and characterizes each individual transformant.
- Both PCR and Southern hybridization techniques can be used to demonstrate transmission of a transgene to progeny. In most instances the characteristic Southern hybridization pattern for a given transformant will segregate in progeny as one or more Mendelian genes (Spencer et al., 1992) indicating stable inheritance of the transgene.
- RNA will only be expressed in particular cells or tissue types and hence it will be necessary to prepare RNA for analysis from these tissues.
- PCR techniques referred to as RT-PCR, also may be used for detection and quantitation of RNA produced from introduced genes.
- RT-PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA.
- PC techniques while useful, will not demonstrate integrity of the RNA product.
- Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species also can be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and will only demonstrate the presence or absence of an RNA species.
- TAQMAN® technology (Applied Biosystems, Foster City, CA) may be used to quantitate both DNA and RNA in a transgenic cell.
- Southern blotting and PCR may be used to detect the gene(s) in question, they do not provide information as to whether the gene is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced genes or evaluating the phenotypic changes brought about by their expression.
- Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins.
- Unique physical-chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography.
- the unique structures of individual proteins offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as Western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used.
- Assay procedures also may be used to identify the expression of proteins by their functionality, especially the ability of enzymes to catalyze specific chemical reactions involving specific substrates and products. These reactions may be followed by providing and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be analyzed and may include assays for PAT enzymatic activity by following production of radiolabeled acetylated phosphinothricin from phosphinothricin and I4 C-acetyl CoA or for anthranilate synthase activity by following an increase in fluorescence as anthranilate is produced, to name two.
- bioassays Very frequently the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms, including but not limited to, analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of genes encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes which change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays.
- Southern blotting, PCR and RT-PCR techniques can be used to identify the presence or absence of a given transgene but, depending upon experimental design, may not specifically and uniquely identify identical or related transgene constructs located at different insertion points within the recipient genome.
- To more precisely characterize the presence of transgenic material in a transformed plant one skilled in the art could identify the point of insertion of the transgene and, using the sequence of the recipient genome flanking the transgene, develop an assay that specifically and uniquely identifies a particular insertion event. Many methods can be used to determine the point of insertion such as, but not limited to, Genome WalkerTM technology (CLO TECH, Palo Alto, CA), VectoretteTM technology (Sigma, St.
- restriction site oligonucleotide PCR (Sarkar et ai, 1993; Weber et al, 1998), uneven PCR (Chen and Wu, 1997) and generation of genomic DNA clones containing the transgene of interest in a vector such as, but not limited to, lambda phage.
- oligonucleotide primers can be designed, one wholly contained within the transgene and one wholly contained within the flanking sequence, which can be used together with the PCR technique to generate a PCR product unique to the inserted transgene.
- the two oligonucleotide primers for use in PCR could be designed such that one primer is complementary to sequences in both the transgene and adjacent flanking sequence such that the primer spans the junction of the insertion site while the second primer could be homologous to sequences contained wholly within the transgene.
- the two oligonucleotide primers for use in PCR could be designed such that one primer is complementary to sequences in both the transgene and adjacent flanking sequence such that the primer spans the junction of the insertion site while the second primer could be homologous to sequences contained wholly within the genomic sequence adjacent to the insertion site.
- Confirmation of the PCR reaction may be monitored by, but not limited to, size analysis on gel electrophoresis, sequence analysis, hybridization of the PCR product to a specific radiolabeled DNA or RNA probe or to a molecular beacon (Tyagi and Kramer, 1996), or use of the primers in conjugation with a TAQMANTM probe and technology (Applied Biosystems, Foster City, CA).
- site-specific integration or excision of transformation constructs prepared in accordance with the instant invention.
- An advantage of site-specific integration or excision is that it can be used to overcome problems associated with conventional transformation techniques, in which transformation constructs typically randomly integrate into a host genome and multiple copies of a construct may integrate. This random insertion of introduced DNA into the genome of host cells can be detrimental to the cell if the foreign DNA inserts into an essential gene.
- the expression of a transgene may be influenced by "position effects" caused by the surrounding genomic DNA.
- Homologous recombination is a reaction between any pair of DNA sequences having a similar sequence of nucleotides, where the two sequences interact (recombine) to form a new recombinant DNA species.
- the frequency of homologous recombination increases as the length of the shared nucleotide DNA sequences increases, and is higher with linearized plasmid molecules than with circularized plasmid molecules.
- Homologous recombination can occur between two DNA sequences that are less than identical, but the recombination frequency declines as the divergence between the two sequences increases.
- Introduced DNA sequences can be targeted via homologous recombination by linking a DNA molecule of interest to sequences sharing homology with endogenous sequences of the host cell. Once the DNA enters the cell, the two homologous sequences can interact to insert the introduced DNA at the site where the homologous genomic DNA sequences were located. Therefore, the choice of homologous sequences contained on the introduced DNA will determine the site where the introduced DNA is integrated via homologous recombination. For example, if the DNA sequence of interest is linked to DNA sequences sharing homology to a single copy gene of a host plant cell, the DNA sequence of interest will be inserted via homologous recombination at only that single specific site.
- the DNA sequence of interest is linked to DNA sequences sharing homology to a multicopy gene of the host eukaryotic cell, then the DNA sequence of interest can be inserted via homologous recombination at each of the specific sites where a copy of the gene is located.
- DNA can be inserted into the host genome by a homologous recombination reaction involving either a single reciprocal recombination (resulting in the insertion of the entire length of the introduced DNA) or through a double reciprocal recombination (resulting in the insertion of only the DNA located between the two recombination events).
- a homologous recombination reaction involving either a single reciprocal recombination (resulting in the insertion of the entire length of the introduced DNA) or through a double reciprocal recombination (resulting in the insertion of only the DNA located between the two recombination events).
- a homologous recombination reaction involving either a single reciprocal recombination (resulting in the insertion of the entire length of the introduced DNA) or through a double reciprocal recombination (resulting in the insertion of only the DNA located between the two recombination events).
- the introduced DNA should contain sequences homologous to the selected gene.
- a double recombination event can be achieved by flanking each end of the DNA sequence of interest (the sequence intended to be inserted into the genome) with DNA sequences homologous to the selected gene.
- a homologous recombination event involving each of the homologous flanking regions will result in the insertion of the foreign DNA.
- only those DNA sequences located between the two regions sharing genomic homology become integrated into the genome.
- a number of different site specific recombinase systems could be employed in accordance with the instant invention, including, but not limited to, the Cre/lox system of bacteriophage PI (U.S. Patent No. 5,658,772, specifically incorporated herein by reference in its entirety), the FLP/FRT system of yeast (Golic and Lindquist, 1989), the Gin recombinase of phage Mu (Maeser et al. , 1991 ), the Pin recombinase of E. coli (Enomoto et al , 1983), and the R/RS system of the pSRl plasmid (Araki et al. , 1992).
- the bacteriophage PI Cre/lox and the yeast FLP/FRT systems constitute two particularly useful systems for site specific integration or excision of transgenes.
- a recombinase (Cre or FLP) will interact specifically with its respective site-specific recombination sequence (lox or FRT, respectively) to invert or excise the intervening sequences.
- the sequence for each of these two systems is relatively short (34 bp for lox and 47 bp for FRT) and therefore, convenient for use with transformation vectors.
- the FLP/FRT recombinase system has been demonstrated to function efficiently in plant cells.
- Experiments on the performance of the FLP FRT system in both maize and rice protoplasts indicate that FRT site structure, and amount of the FLP protein present, affects excision activity. In general, short incomplete FRT sites leads to higher accumulation of excision products than the complete full-length FRT sites.
- the systems can catalyze both intra- and intermolecular reactions in maize protoplasts, indicating its utility for DNA excision as well as integration reactions.
- the recombination reaction is reversible and this reversibility can compromise the efficiency of the reaction in each direction. Altering the structure of the site- specific recombination sequences is one approach to remedying this situation.
- the site-specific recombination sequence can be mutated in a manner that the product of the recombination reaction is no longer recognized as a substrate for the reverse reaction, thereby stabilizing the integration or excision event.
- Cre-lox In the Cre-lox system, discovered in bacteriophage PI, recombination between lox sites occurs in the presence of the Cre recombinase (see, e.g., U.S. Patent No. 5,658,772, specifically incorporated herein by reference in its entirety). This system has been utilized to excise a gene located between two lox sites which had been introduced into a yeast genome (Sauer, 1 87). Cre was expressed from an inducible yeast GAL1 promoter and this Cre gene was located on an autonomously replicating yeast vector.
- lox sites on the same DNA molecule can have the same or opposite orientation with respect to each other. Recombination between lox sites in the same orientation results in a deletion of the DNA segment located between the two lox sites and a connection between the resulting ends of the original DNA molecule.
- the deleted DNA segment forms a circular molecule of DNA.
- the original DNA molecule and the resulting circular molecule each contain a single lox site. Recombination between lox sites in opposite orientations on the same DNA molecule result in an inversion of the nucleotide sequence of the DNA segment located between the two lox sites.
- reciprocal exchange of DNA segments proximate to lox sites located on two different DNA molecules can occur. All of these recombination events are catalyzed by the product of the Cre coding region.
- ancillary sequences such as selectable marker or reporter genes, for tracking the presence or absence of a desired trait gene transformed into the plant on the DNA construct.
- ancillary sequences often do not contribute to the desired trait or characteristic conferred by the phenotypic trait gene.
- Homologous recombination is a method by which introduced sequences may be selectively deleted in transgenic plants.
- homologous recombination results in genetic rearrangements of transgenes in plants. Repeated DNA sequences have been shown to lead to deletion of a flanked sequence in various dicot species, e.g. Arabidopsis thaliana (Swoboda et al.
- Deletion of sequences by homologous recombination relies upon directly repeated DNA sequences positioned about the region to be excised in which the repeated DNA sequences direct excision utilizing native cellular recombination mechanisms.
- the first fertile transgenic plants are crossed to produce either hybrid or inbred progeny plants, and from those progeny plants, one or more second fertile transgenic plants are selected which contain a second DNA sequence that has been altered by recombination, preferably resulting in the deletion of the ancillary sequence.
- the first fertile plant can be either hemizygous or homozygous for the DNA sequence containing the directly repeated DNA which will drive the recombination event.
- the directly repeated sequences are located 5' and 3' to the target sequence in the transgene.
- the transgene target sequence may be deleted, amplified or otherwise modified within the plant genome.
- a deletion of the target sequence flanked by the directly repeated sequence will result.
- DNA sequence mediated alterations of transgene insertions may be produced in somatic cells.
- recombination occurs in a cultured cell, e.g., callus, and may be selected based on deletion of a negative selectable marker gene, e.g., the periA gene isolated from Burkholderia caryolphilli which encodes a phosphonate ester hydrolase enzyme that catalyzes the hydrolysis of glyceryl glyphosate to the toxic compound glyphosate (US Patent No. 5,254,801).
- a negative selectable marker gene e.g., the periA gene isolated from Burkholderia caryolphilli which encodes a phosphonate ester hydrolase enzyme that catalyzes the hydrolysis of glyceryl glyphosate to the toxic compound glyphosate
- transgenic plants may be made by crossing a plant having a construct of the invention to a second plant lacking the construct.
- a selected coding region operably linked to a promoter can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the current invention not only encompasses a plant directly regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants.
- progeny denotes the offspring of any generation of a parent plant prepared in accordance with the instant invention, wherein the progeny comprises a construct prepared in accordance with the invention.
- Crossing a plant to provide a plant line having one or more added transgenes relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a transgene of the invention being introduced into a plant line by crossing a starting line with a donor plant line that comprises a transgene of the invention.
- step (e) repeating steps (b) and (c) for the purpose of transferring the desired gene, DNA sequence or element from a plant of a first genotype to a plant of a second genotype.
- Introgression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion.
- a plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid.
- a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
- the plasmid for inducing RNAi-mediated silencing of the CAO (SEQ ID. No. 1) gene in Chlamydomonas reinhardtii strain CC-424 (arg2 cwl5 sr-u-2-60 mt-, Chlamydomonas Genetic Center) was constructed using the genomic-sense/cDNA-antisense strategy of Fuhrmann et al. (Fuhrmann et al. (2001) /. Cell Sci. 114: 3857 - 3863).
- a 1032 bp fragment SEQ. ID.
- Genomic DNA isolation from CC-424 was carried out using the xantine buffer protocol (Tillett and Neilan, (2000); J. Phycol. 36: 251 - 258).
- the corresponding cDNA region spanning exons 1 and 2 (604 bp) of CAO was then obtained using RNA extracted from the CC-424 strain and cDNA synthesis (Promega). RNA extraction was performed using the manufacturer's protocol for trizol (Invitrogen) extraction.
- the 604 bp cDNA fragment was amplified using the forward and reverse primers CAOExl2CAS_F (SEQ. ID. No 5) and CAOExl2CAS_R (SEQ. ID.
- the psaD promoter and terminator cassette of the PSL18 vector was used to drive RNAi.
- the pSL18 vector (backbone) also contains the paromomycin resistance gene driven by the Hsp70/RbcS2 fusion promoter (Sizova et al, (2001) Gene 277: 221 - 229), placed in tandem with the PsaD promoter and terminator cassette (Depege et al., (2003) Science 299: 1572 - 1575).
- transformants generated using the PSL18 vector can be selected based on resistance to paromomycin.
- the CAO gene was amplified with the N1BSCAO-F (SEQ. ED. NO. 9) forward and CAO-Rev (SEQ. ID. NO. 10) reverse primers using genomic DNA isolated from Chlamydomonas strain CC-2137 (Chlamydomonas Genetic Center) as template (Table El).
- the 13-bp NAB l binding site (NI BS) in this construct corresponds to the sequence 5 ' -GCCAGACCCCCGC-3 ' (SEQ. ID. NO. 15).
- Genomic DNA was extracted from Chlamydomonas using the xantine buffer protocol as described above.
- the Ndel and Xbal restriction sites were used in cloning of the amplified gene into the nuclear gene expression vector PSL18, to generate the PSL18-N1 BS- CAO vector, which is shown schematically in FIG. 1).
- CAO-F ATCTTCATATGCTTCCTGCGTCGCTTCAAC SEQ. ID. NO. 1 1 altNlBSCAO-F ATCTTCATArGGGGCAAACACCGGCGGGCCTTCCTGC SEQ. ID. NO. 12 GTCGCTTCAACGCAAGG
- the cell wall-less CC-424 Chlamydomonas strain was transformed with the CAO-RNAi plasmid by glass bead- mediated nuclear transformation (Kindle, et al., (1990) Proc Natl Acad Sci USA. 87: 1228 - 1232). Briefly, the CC-424 cells, a CW-15 wall less mutant were grown in 100 mL of Tris- Acetate-Phosphate (TAP) media (Harris, 1989) containing 100 pg/mL L-arginine (Sigma) and harvested after 4-5 days of growth (mid-log phase) by low speed centrifugation.
- TAP Tris- Acetate-Phosphate
- the cells were resuspended in 900 pL of TAP plus 40 mM sucrose and divided equally into 3 tubes containing 300 mg 500 micron acid washed sterile glass beads. After the addition of 100 pL of 20% PEG and 1 pg of Seal linearized CAO-RNAi plasmid, each tube was vortexed at maximum speed for 25 sec. The cells were then resuspended in 3 mL TAP plus arginine media and grown for 24 h on a lighted incubator-shaker. Following this, the cells were spread on to TAP agar plates containing 100 pg/mL L-arginine and 50 pg/mL paromomycin for selection of the transformants.
- RNA from the CR transformants (CR-15, 28, 56, 68, 118 and 133) and CC-424 wild-type was extracted using Trizol according to manufacturer's instructions (TRI REAGENT®, Ambion, Catalog # AM9738). After treatment with DNase (Promega, Catalog # M610A), RNA was precipitated using 3M Na Acetate and 95% ethanol.
- RNA concentration and quality of RNA was assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.) and only samples that had 260/280 and 260/230 ratios of above 1.8 were used for further analysis.
- DNase-treated RNA samples (1-2 ⁇ g) were reverse transcribed with an anchored oligo (dT) primer and 200 units superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) in a final reaction volume of 20 ⁇ according to the manufacturer's instructions.
- RT reverse transcription
- cDNA synthesis was successful, PCR was performed with the CQ_CBLP-F (SEQ. ID. NO. 16) and RT_CBLP-R primers (SEQ. ID". NO.
- the PSL18-CAO, PSL18-N1BS-CAO and PSL18-altNlBS-CAO plasmids were used to generate the complemented wild-type strains (CAO), N1BS-CAO and altNlBS- CAO transgenic strains (see below). Plasmids were introduced into the CAO deletion strain cbs-3 (a kind gift of Dr. Ayumi Tanaka, Kyoto University) by particle gun bombardment in separate transformation events.
- the cbs-3 culture was grown in TAP media for -5-6 d, and harvested by centrifugation while still in log phase.
- the concentrated cells were spotted onto the center of a TAP agar plate (-0.4-0.5 mL) and dried in a sterile-transfer hood.
- Chlamydomonas nuclear transformation was carried out using a Bio-Rad PDS-1000/He system where DNA- coated gold particles were accelerated into cells of the host strain cbs-3 using pressurized helium.
- the gold particles (1.2 ⁇ diameter, InBio Gold) were sterilized with ethanol and resuspended in water prior to binding of the DNA.
- a 50 ⁇ L ⁇ aliquot of 60 mg/mL sterile gold particles were mixed with 5 ⁇ ⁇ of plasmid DNA (1 mg/mL), 50 ⁇ _, of 2.5 M CaCb, and 20 ⁇ _ 0.1 M spermidine and incubated at room temperature for 20-30 min. The mixture was then centrifuged and precipitated 70% ethanol before a final resuspension in 45 ⁇ - of 95% ethanol. 15 ⁇ _ of the gold coated DNA mixture was pipetted on to a sterile macrocarrier (InBio Gold) and dried. The macrocarrier holder was installed into the chamber of the biolistic system about - 15 cm above the TAP agar plate containing the cells to be transformed and the chamber evacuated under 25 inches of Hg.
- a sterile macrocarrier InBio Gold
- the particles were then propelled into the target cells using 1 10 psi of helium pressure.
- the bombarded cells were then recovered overnight in 3 mL of TAP medium and spread onto 4-5 TAP plates containing 50 ⁇ g/mL ampicillin and 25 ⁇ g/mL paromomycin.
- the plates were incubated at 21 °C under dim light until small green, paromomycin resistant colonies began to appear, about two weeks.
- the colonies were transferred to fresh TAP plates containing 50 ⁇ / ⁇ ⁇ paromomycin to minimize spontaneous transformants or escapes.
- CC-424 (WT), CR transformants 1 18 and 133, and the cbs-3 strain were grown in 100-200 mL of liquid High Salt (HS) media supplemented with 100-200 Mg/mL L- arginine under low light intensities (50 ⁇ light m "2 s "1 ) with continuous shaking at 225 rpm for 6 days. Cells were harvested by centrifugation at 3,000 x g for 5 min at 4 °C.
- HS liquid High Salt
- the cell pellet was resuspended in buffer A (0.3M Sucrose, 25 mM HEPES, pH 7.5, I mM MgCl 2 ) plus 20 ⁇ 7 ⁇ - of protease inhibitor cocktail (Roche), to yield a final Chi concentration of 1 mg/mL.
- Cells were then disrupted by sonication (Biologies, Inc, Model 300 V/T Ultrasonic Homogenizer) two times for 10s each time (pulse mode, 50% duty cycle, output power 5) on ice.
- the unbroken cells were pelleted by centrifugation at 3,000 x g for 2 min at 4 °C.
- Samples for electrophoresis were prepared by solubilization of thylakoid membranes isolated from the WT, CR-1 18, 133 and cbs-3 cells, with LiDodS0 4 as described previously (Delepelaire and Chua, (1 79) Proc. Natl. Acad. Sci. USA 76: 1 1 1 - 1 15).
- Chlamydomonas cultures were grown in low and high light conditions as indicated for 6 days. 10 ml aliquots of culture were centrifuged and the photosynthetic pigments extracted with 100% acetone in the dark for 20 min. After incubation, samples were centrifuged to pellet the cell debris and the supernatant was transferred to glass tube and dried under vacuum. The samples were then resuspended in 750 ⁇ of acetonitrile: water: triethylamine (900:99: 1 , v/v/v) for HPLC analysis. Pigment separation and chromatographic analysis was performed on a Beckman HPLC equipped with UV-vis detector, using a C 18 reverse phase column at a flow rate of 1.5 mL/ min.
- Chi a oxygenase or CAO is responsible for the synthesis of Chi b via the oxidation of the methyl group on ring II of Chi a.
- the lack of Chi b an abundantly found light harvesting pigment, specifically affects the assembly of the peripheral antenna complex (LHCII) associated with PSII in green algae.
- RNAi-mediated gene silencing was used to repress CAO gene expression and reduce cellular Chi b levels to confirm that this approach would be effective in reducing the size of the antenna complex.
- RNAi expression vector specific for the CAO gene FOG. 1
- CR transformants independent CAO-RNAi transformants
- CAO-RNAi (CR) transgenic clones had slower fluorescence induction kinetics than WT and reached only 75- 80% saturation when WT reached 90-92% saturation. (FIG. 2) This is potentially reflective of a smaller PSII antenna absorption cross-section in the CR mutants relative to WT. The Chi b less cbs-3 mutant did not light saturate under these measurement conditions.
- Example 2 Characterization of the correlation of Chlorophyll fluorescence rise kinetics with Chi b content and size of the PSII antenna complex in wild type and CAO- RNAi (CR) transgenic clones.
- thylakoid membranes were isolated from the wild-type, two CAO-RNAi strains CR- 1 18 and CR- 133 and the cbs-3 mutant, and the LHC content was determined empirically using non-denaturing gels and densitometry (Delepelaire and Chua, (1979) Proc. Natl. Acad. Sci. USA 76: 1 1 1 - 1 15).
- Example 4 Photosynthetic growth of WT, CR-118, 133 and cbs-3 cells under low and high light intensities
- Example 5 Initial characterization of transgenic strains carrying the NAB1 regulated CAO gene construct
- NAB 1 binding domain mutants In order to demonstrate that the NAB 1 binding domain interacted with the NAB 1 protein we generated NAB 1 binding domain mutants and assessed their ability to undergo light-dependent changes in chlorophyll b content.
- the CAO knock out strain was complemented with the wild-type CAO gene lacking the 5' NIBS sequence to generate the complemented wild- type.
- a mutagenized NAB 1 binding site (different from LHCBM6 mRNA CDSCS by 4 bp) (5'-GGCAAACACCGGC-3 ' ; SEQ. ED. NO. 21) was also constructed and inserted into the 5' coding sequence of the CAO gene and transformed into the Chi b-less strain, cbs-3, to generate the altNlBS-CAO transgenic cell lines.
- the PsaD promoter was used to drive the expression of the gene construct so as to decouple any potential effects of the native CAO promoter.
- the resulting transgenic clones were selected initially on the basis of antibiotic resistance and then further screened by pigment extraction and quantification. Selected transgenic clones having Chi a/b ratios intermediate between wild-type (CC-2137) and Chi b-less cells were confirmed for the presence of the transgene by PCR (data not shown). The amplified region was verified by DNA sequence analysis.
- the Chi a/b ratios of the individual transformants were determined by pigment extraction and HPLC analysis of cultures grown at LL (50 ⁇ photons m "2 s '1 ) or at HL (500 ⁇ photons m "2 s "1 ) for 6 days. Each strain was inoculated into fresh HS media using a 2% v/v culture inoculum to avoid self-shading and nutrient limitation. Chi a/b ratios were then monitored through two sets of alternating periods of low and high irradiance as shown in FIG. 9.
- the altNl BS-CAO transgenics showed trends, i.e. a lack of change in chlorophyll b content with changes in light intensity, similar to the complemented wild-type and CC-2137 strains suggesting that NAB l binding to the CAO transcript was probably perturbed due to the alterations to the sequence of the binding site.
- Example 6 Characterization of Chi fluorescence induction in transgenic strains carrying the NABl regulated CAO gene construct
- test cells were subjected to flash fluorescence induction as described previously. After each light period, the percentage light saturation or reaction center closure was calculated for the transformants at a time point where the complemented wild type strain, CAO-4, achieved 90% saturation. The values obtained for each strain under low and high light were compared to yield a percentage decrease/increase in Chi fluorescence yield.
- the results shown in FIG. 10 show reversible changes in Chi fluorescence induction kinetics of up to -10% that were observed after each light cycle in the N 1 BS-CAO transgenics as compared to less than - 1-2% change in the CC-2137 wild-type control.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Botany (AREA)
- Molecular Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Cultivation Of Seaweed (AREA)
Abstract
Methods, and compositions for modulating the PSII peripheral antenna size of photosynthetic organisms by negatively regulating the expression of chlorophyll a oxygenase (CAO) to high light intensity. Transgenic photosynthetic organisms that are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity, and methods for their use.
Description
PLANTS AND ALGAE CAPABLE OF MODULATING ANTENNA SIZE BASED ON
LIGHT INTENSITY.
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S. Provisional Application Serial No. 61/510,641 , Filed July 22, 201 1 , the contents of which are herein incorporated by reference in their entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR
DEVELOPMENT
[0002] This invention was made with government support under DOE grant # DE- SC0001035-WU-HT-10-07 awarded by the Department of Energy; and grant number FA9550-08-1-0451 from the USAF, OSR- Air Force Office of Scientific Research. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
Field of the Invention
[0003] The present invention provides methods, and compositions for modulating the PSII peripheral antenna SIZE of photosynthetic organisms by negatively regulating the expression of chlorophyll a oxygenase (CAO) to high light intensity. Also provided are transgenic photosynthetic organisms that are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity, and other enhanced traits, and methods for their use.
[0004] Nature's most sophisticated and important solar energy harvesting and storage systems are found in photosynthetic organisms or prototroph, including plants, algae and a variety of types of bacteria. All these organisms utilize sunlight to power cellular processes and ultimately derive most or all of their biomass through chemical reactions driven by light. Phototroph, or photosynthetic organisms mostly belong to the kingdom Plantae. They include familiar organisms such as trees, herbs, bushes, grasses, vines, ferns, mosses, and green algae. Photosynthetic organisms obtain most of their energy from sunlight via a process called photosynthesis.
[0005] Photosynthesis is a process that converts carbon dioxide into organic compounds, especially sugars, using the energy from sunlight (Smith, A. L.; 1997, Oxford dictionary of biochemistry and molecular biology; Oxford, Oxfordshire: Oxford University Press, p. 508. ISBN 0- 19-854768-4.). Photosynthetic organisms absorb sunlight via their light harvesting or antenna complexes (LHC), which transfer excitation energy to the reaction center complexes of photosystems Π (PS-Π) and I (PS-I) that drive linear electron transfer and oxygenic photosynthesis.
[0006] In plants and algae, the light harvesting antenna for PSI (termed LHCI) and PSII (termed LHCH) bind the light harvesting pigments including Chlorophyll a (Chi a) and Chlorophyll b (Chi b) and carotenoids. In nature, photosynthetic organisms such as plant and algal cells may acclimate to altered light environments to optimize energy capture and conversion efficiency. Cells acclimated to low light typically possess larger light harvesting antenna than those acclimated to high light intensities so as to maximize light capture at limiting light conditions.
[0007] However a negative consequence of having very efficient light harvesting complexes is that photosynthetic electron transfer in nearly all photosynthetic cells becomes light saturated at only 25% of full sunlight intensity (2000 pmol light m"2 s"1) (Polle, et al., (2001), Plant Cell Physiol. 42: 482 - 491). At high photon flux densities, the rate of photon absorption far exceeds the rate at which photosynthesis can. convert the excited state into charge transfer processes. Over-excitation of the light harvesting antenna under high light increases the potential for long-lived excited states and photo-oxidative damage in photosynthetic organisms due to the generation and accumulation of Chlorophyll (Chi) triplets and reactive oxygen species (Krieger-Liszkay, et al., (2008), Photosyn. Res. 98: 551 - 564. ; Vass, I., and Cser, K.; (2009), Trends Plant Sci. 14: 200 - 205).
[0008] Hence algae as well as plants have both short and long term responses that protect the photosynthetic apparatus from the harmful effects of excess light (Niyogi, K. (2009), In Chlamydomonas Sourcebook, D. Stern, ed. Boston: Academic Press, pp. 847 - 870). Short term responses include the thermal dissipation of excess absorbed photons (qE) and state transitions (qT) both of which are components of non-photochemical quenching of chlorophyll fluorescence (NPQ). The qE (energy-dependent quenching) processes involve the de-excitation of Chi singlet excited states formed in the PSII antenna upon light absorption to minimize the formation of Chi triplets and reactive oxygen species in the photosynthetic apparatus (Muller, et al., (2001), Plant Physiology. 125: 1558 - 1566). Processes associated with qT are involved in regulating the relative excitation of PSII and PSI
and helps regulate the balance between linear and cyclic electron flow during photosynthesis (Wollman, F.A., (2001), EMBO J. 20: 3623 - 3630; Eberhard, et al., (2008), Annu. Rev. Genet. 42: 463 - 515). Longer term responses occur over hours and days after high light exposure and include transcriptional and translation level changes in LHC mRNAs and high light induced mRNAs, D l turnover and PSII repair, and increases in the xanthophyll cycle pool (Niyogi, K. ,(2009), In Chlamydomonas Sourcebook, D. Stern, ed. Boston: Academic Press, pp. 847 - 870). Hence, under high light intensities, up to 80% of absorbed photons can be dissipated as heat or fluorescence due to the activation of the short term photo protective responses (NPQ) causing large decreases in light utilization and photosynthetic productivities (Polle, et al., International Journal of Hydrogen Energy. 27: 1257 - 1264).
[0009] Photosynthetic cells acclimated to high light intensities have -50% lower cellular Chi contents and show only slight (if any) increases in Chi a/b ratio (Neale, P.J., and Melis, A., (1986), /. Phycol. 22: 531 - 538). The PSII light harvesting complex includes the proximal antenna Chi a binding proteins associated with the PSII reaction center; and the peripheral (distal) antenna Chi a, Chi b, and carotenoid binding proteins. The peripheral antenna complex of PSII (LHCH) further comprises the major (outer) more abundant trimeric antenna that is encoded for by nine genes (LHCBM1-LHCBM9) and a minor (inner) antenna that is encoded for by three genes (LHCB4, LHCB5 and LHCB7) (Minagawa, J. and Takahashi, (2004), Photosynth. Res 82: 241 - 263). LHCII proteins account for binding up to 50% of the total Chi in plant and algal thylakoid membrane.
[0010] The lack of Chi b in Chlamydomonas has been shown to affect the assembly of the major peripheral light harvesting complex associated with PSII reducing the functional size of the PSII antenna from 320 Chi (a and b) to about 95 Chi a molecules (Polle, et al., (2000), Planta 211: 335 - 344). The PSI antenna, LHCI (290 Chi) and the minor LHCII complex can still assemble presumably by replacing Chi a for Chi b. Chi b is synthesized from Chi a by the action of the enzyme Chi a oxygenase (CAO) (von Wettstein, et al., (1995), Plant Cell 7: 1039 - 1057) and insertional mutants of Chlamydomonas that lack a functional CAO gene, lack Chi b (Tanaka, A., et al., ( 1998), Proc. Natl. Acad. Sci. USA 95: 12719 - 12723). Conversely, the over expression of the CAO gene leads to the enhancement of Chi b biosynthesis in Arabidopsis and consequently to an enlargement of the PSII-associated peripheral antenna (Tanaka, et al., (2001), The Plant Journal 24: 365 - 373). Significantly, Chi b-less mutants {cbs-3) of Chlamydomonas have substantially elevated light-saturated photosynthetic oxygen evolution rates (up to 2.5 fold when expressed on a per Chi basis) compared to the wild-type and do not light saturate at full sunlight intensities (Polle, et al.,
(2000), Planta 211: 335 - 344). In contrast, wild-type Chlamydomonas light saturates photosynthesis at 25% of full sunlight intensity. Moreover, studies where the size of the LHCII has been preferentially attenuated have shown that reducing PSII antenna size (and not PSI) results in higher rates of oxygen evolution at high light intensities than wild-type cells (Polle, et al., (2001), Plant Cell Physiol. 42: 482 - 491 ; Polle, et al., (2002), International Journal of Hydrogen Energy 27: 1257 - 1264 ).
[0011] The present disclosure describes methods for generating transgenic photosynthetic organisms that are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity. Although wild-type algae have pre-existing mechanisms to modulate the expression and size of their PSII light- harvesting antenna at the transcriptional and posttranscriptional level under varying light levels (Durnford, et al., (2003), Physiol. Plant. 118: 193 - 205), the range of PSII antenna adjustment in wild type photosynthetic organisms is limiting and is of little practical use.
[0012] This invention takes advantage of a recently described light regulated and redox- sensitive, trans-acting factor (NAB 1) that binds to LHCII mRNAs, negatively regulating their translation leading to a reduction of LHCII content under high light growth conditions (Mussgnug, et al., (2005) The Plant Cell 17: 3409 - 3421). This nucleic acid binding protein 1 (NAB 1) binds to a cold-shock domain consensus sequence (CSDCS) motif found in several LHCII mRNAs, sequestrating them into translationally silent messenger ribonucleoprotein complexes. By inserting the CSDCS element of the LHCMB6 mRNA into the promoter region used to control the expression of the CAO gene, we have created transgenic organisms in which the expression of the CAO gene is modulated in a light dependent manner. At high light intensity the NAB 1 protein binds to its respective mRNA binding site on the engineered CAO transcript, repressing its translation and the synthesis of Chi b, resulting in a reduced PSII peripheral antenna size. Conversely, under lower intensities translational repression by NAB 1 is reduced allowing for increased levels of CAO translation and Chi b synthesis leading to the assembly of wild-type levels of the peripheral PSII antenna and in increased light capture at lower light intensities.
[0013] The resulting transgenic photosynthetic organisms are capable of modulating their PSII peripheral antenna size as a function of light intensity, and exhibit enhanced photosynthetic productivity. Such enhanced photosynthetic organisms, including algal, provide for improved production systems with higher flexibility in growth conditions and improved yields.
SUMMARY OF THE INVENTION
[0014] In one embodiment, the present invention includes a transgenic algae capable of modulating PSII antenna size in response to ambient light intensity; wherein the transgenic algae exhibit an increase in Chi a b ratios when grown under high light conditions, and a decrease in Chi a/b ratios when grown under low light conditions compared to wild type cells grown under identical conditions. In one aspect, the increase in Chi a/b ratio is at least 5 % greater than observed with wild type cells.
[0015] In another aspect, the transgenic algae's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
[0016] In another aspect, the transgenic algae comprises a DNA construct comprising heterologous expression control sequences that are capable of binding to a redox sensitive modulator that is responsive to ambient light intensity. In one aspect, redox sensitive repressor is more active at low light intensity, than at high light intensity. In one aspect, the redox sensitive modulator is NAB 1. In one aspect, the expression control sequences comprise a cold-shock domain consensus sequence (CSDDCS) motif. In one aspect, the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence. In one aspect, the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin. In one aspect, the expression control sequences are operatively coupled to a polynucleotide sequence encoding CAO. In one aspect, the polynucleotide sequence encoding CAO is a heterologous nucleic acid sequence.
[0017] In another aspect, the transgenic algae is selected from the group consisting of the chlorophyta including, Chlamydomas perigran lata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella sp; Chlorella vulgaris, Chlorella protothecoides, Chlorella sorokiniana, Chlorella keslerii, Scenedesmus sp, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
[0018] In another aspect, the transgenic algae comprise a heterologous redox sensitive modulator. In one aspect, the heterologous redox sensitive modulator is NAB 1.
[0019] In another aspect, the transgenic algae exhibit exhibits an increase in biomass production compared to wild-type algae grown under identical conditions.
[0020] In another embodiment, the current invention includes a method of producing an improved photosynthetic organism, comprising the steps of;
a) stably transforming a photosynthetic organism with a heterologous polynucleotide sequence comprising expression control sequences comprising a cold-shock domain
consensus sequence (CSDDCS) motif, that is capable of binding to a redox sensitive modulator that is responsive to ambient light intensity; b) selecting a transformant that is capable of modulating PSII antenna size in response to ambient light intensity. .
[0021] In one aspect, the heterologous polynucleotide sequences comprise targeting sequences specific for the photosynthetic organism's endogenous CAO gene.
[0022] In one aspect, the photosynthetic organism's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
[0023] In one aspect, the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence. In one aspect, the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin. In one aspect, the expression control sequences are operatively coupled to a polynucleotide sequence encoding CAO.
[0024] In another aspect, the photosynthetic organism is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliqu s, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
[0025] In one aspect, the selection is based on screening transgenic organisms that exhibit an increase in Chi a/b ratios when grown under high light conditions, and a decrease in Chi a/b ratios when grown under low light conditions.
[0026] In one aspect, the selection is based on screening photosynthetic organism that exhibit an increase in biomass production compared to wild type organisms grown under identical conditions. In one aspect, the photosynthetic organism comprises a heterologous redox sensitive modulator. In one aspect, the heterologous redox sensitive modulator is NAB 1.
[0027] In another embodiment, the invention includes a method of enhancing yields of photosynthetic productivity under conditions of high light intensity, and or high density growth, the method comprising;
i) providing a photosynthetic organism comprising a heterologous
polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO; wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
ii) cultivating the photosynthetic organism at high light intensity and / or high density.
[0028] In another embodiment, the invention includes a method of enhancing bio-oil, or bio- diesel production from a photosynthetic organism the method comprising;
i) providing algae comprising a heterologous polynucleotide sequence
comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity; ii) cultivating the algae at high light intensity and / or high density.
[0029] In another embodiment, the invention includes a method of enhancing beta-carotene, lutein, or zeaxanthin production from a photosynthetic organism, the method comprising; i) providing algae comprising a heterologous polynucleotide sequence
comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity; ii) cultivating the algae at high light intensity and / or high density.
[0030] In one aspect of any of these methods, the transgenic organism's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed. In one aspect of any of these methods, the photosynthetic organism is an alga.
[0031] In another aspect of any of these methods, the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence. In one aspect of this embodiment, the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
[0032] In another aspect of any of these methods, the polynucleotide sequence encoding CAO is a heterologous nucleic acid sequence.
[0033] In another aspect of any of these methods, the algae is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis. In aspect of this embodiment, the algae exhibit an increase in Chi a/b ratios when grown under high light conditions of at least 5 %.
[0034] In another aspect of any of these methods, the algae comprise a heterologous redox sensitive repressor. In one aspect of this embodiment, the heterologous redox sensitive repressor is NAB 1.
[0035] In another embodiment, the current invention includes an expression vector comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO.
[0036] In one aspect, the expression vector further comprises a promoter operatively linked to the cold-shock domain consensus sequence. In one aspect, the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin. In one aspect the expression vector comprises a CSDDCS motif is selected from the group consisting of SEQ ID. No. 39, SEQ ID. No. 40, SEQ ID. No. 41, SEQ ID. No. 42, SEQ ID. No. 43, SEQ ID. No. 44, SEQ ID. No. 45, SEQ ID. No. 46, and SEQ ID. No. 47.
[0037] In one aspect the expression vector comprises a CAO gene selected from the group consisting of SEQ ED. No. 34, SEQ ID. No. 35, SEQ ID. No. 36, SEQ ID. No. 37, and SEQ ED. No. 38.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] A better understanding of the features and advantages of the present invention can be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0039] FIG. 1 shows a schematic representation of the gene constructs used for the modulation of Chlorophyll b synthesis in Chlamydomonas.
[0040] FIG. 2 shows the Chlorophyll fluorescence induction in CC-424 (WT), CR transformants and cbs-3.
[0041] FIG. 3 shows a real-time RT-PCR analysis of the CR transformants.
[0042] FIG. 4. Shows the relationship between Chlorophyll a b ratio and % saturation
(reaction center closure).
[0043] FIG. 5 Shows a visualization of the LHCII complex in CC-424 (WT), CR-1 18, 133 and cbs-3 cell clones via non-denaturing PAGE.
[0044] FIG. 6. Shows oxygen evolution rates of the clones CC-424 (WT), CR-1 18, 133 and cbs-3 as a function of light intensity and normalized based on Chlorophyll content.
[0045] FIG. 7 Shows oxygen evolution rates of the clones CC-424 (WT), CR-1 18, 133 and cbs-3 as a function of light intensity and normalized based on cell density.
[0046] FIG. 8 Shows photoautotrophic growth of the WT, CR- 188 and 133 and cbs-3 cells at low and high light intensities.
[0047] FIG. 9 Shows changes in Chlorophyll a/b ratios in the complemented WT (CAO-4, 22), CC-2137 (also WT), N1BSCAO and altNlBSCAO transgenic clones during acclimation to low and high light.
[0048] FIG. 10 Shows changes in Chlorophyll fluorescence induction in the complemented WT (CAO-4, 22), CC-2137 (also WT), N1BSCAO and altNlBSCAO transgenic clones during acclimation to low and high light.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0049] In order that the present disclosure may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description. As used herein and in the appended claims, the singular forms "a," "an," and "the," include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "a molecule" includes one or more of such molecules, "a reagent" includes one or more of such different reagents, reference to "an antibody" includes one or more of such different antibodies, and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.
[0050] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0051] The terms "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or 2 standard deviations, from the mean value. Alternatively, "about" can mean plus or minus a range of up to 20%, preferably up to 10%, more preferably up to 5%.
[0052] As used herein, the terms "cell," "cells," "cell line," "host cell," and "host cells," are used interchangeably and, encompass animal cells and include plant, invertebrate, non- mammalian vertebrate, insect, algal, and mammalian cells. All such designations include cell populations and progeny. Thus, the terms "transformants" and "transfectants" include the primary subject cell and cell lines derived therefrom without regard for the number of transfers.
[0053] As used herein a "control photosynthetic organism" means a photosynthetic organism that does not contain the recombinant DNA that expressed a protein that imparts an enhanced trait. A control photosynthetic organism is to identify and select a transgenic photosynthetic organism that has an enhance trait. A suitable control photosynthetic organism can be a non-transgenic photosynthetic organism of the parental line used to generate a transgenic photosynthetic organism, i.e. devoid of recombinant DNA. A suitable control photosynthetic organism may in some cases be a progeny of a hemizygous transgenic photosynthetic organism that does not contain the recombinant DNA, known as a negative segregant.
[0054] The phrase "conservative amino acid substitution" or "conservative mutation" refers to the replacement of one'amino acid by another amino acid with a common property. A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer- Verlag). According to such analyses, groups of amino acids can be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer- Verlag).
[0055] Examples of amino acid groups defined in this manner include: a "charged / polar group," consisting of Glu, Asp, Asn, Gin, Lys, Arg and His; an "aromatic, or cyclic group," consisting of Pro, Phe, Tyr and Trp; and an "aliphatic group" consisting of Gly, Ala, Val, Leu, He, Met, Ser, Thr and Cys.
[0056] Within each group, subgroups can also be identified, for example, the group of charged / polar amino acids can be sub-divided into the sub-groups consisting of the "positively-charged sub-group," consisting of Lys, Arg and His; the negatively-charged subgroup," consisting of Glu and Asp, and the "polar sub-group" consisting of Asn and Gin. The aromatic or cyclic group can be sub-divided into the sub-groups consisting of the "nitrogen ring sub-group," consisting of Pro, His and Tip; and the "phenyl sub-group" consisting of Phe and Tyr. The aliphatic group can be sub-divided into the sub-groups consisting of the "large aliphatic non-polar sub-group," consisting of Val, Leu and He; the "aliphatic slightly-polar sub-group," consisting of Met, Ser, Thr and Cys; and the "small- residue sub-group," consisting of Gly and Ala.
[0057] Examples of conservative mutations include substitutions of amino acids within the sub-groups above, for example, Lys for Arg and vice versa such that a positive charge can be maintained; Glu for Asp and vice versa such that a negative charge can be maintained; Ser for Thr such that a free -OH can be maintained; and Gin for Asn such that a free -N¾ can be maintained.
[0058] The term "cold-shock domain consensus sequence (CSDDCS) motif or "CSDDCS motif refers to a nucleic acid sequence that is substantially identical to any of SEQ. ID. NOs. 22 to 30.
[0059] "Enhanced trait" or "enhanced phenotype" as used herein refers to a measurable improvement in a trait of photosynthetic organism including, but not limited to, yield increase, including increased yield under non-stress conditions and increased yield under environmental stress conditions Many enhanced traits can affect "yield", including without limitation, number of cells in a liquid culture of unicellular or multi cellular photosynthetic organism, increased efficiencies of light utilization by a photosynthetic organism, amount of biomass production by a photosynthetic organism, amount of bio fuel production by a photosynthetic organism, and amounts of nutraceuticals including but not limited to Agar, Alginate, Carrageenan, Omega fatty acids, Coenzyme Q10, Astaxanthin, and Beta-Carotene . Nutraceutical, a term combining the words "nutrition" and "pharmaceutical", is a food or food product that provides health and medical benefits, including the prevention and treatment of disease. Such products may range from isolated nutrients, dietary supplements and specific diets to genetically engineered foods, herbal products, and processed foods such as cereals, soups, and beverages. Other enhanced trait include plant height, pod number, pod position on the plant, number of internodes, incidence of pod shatter, grain size, efficiency of nodulation and nitrogen fixation, efficiency of nutrient assimilation, resistance
to biotic and abiotic stress, carbon assimilation, plant architecture, resistance to lodging, percent seed germination, seedling vigor, and juvenile traits. Other traits that can affect yield include, efficiency of germination (including germination in stressed conditions), growth rate (including growth rate in stressed conditions), ear number, seed number per year, seed size, composition of seed (starch, oil, protein) and characteristics of seed fill.
[0060] The term "expression" as used herein refers to transcription and/or translation of a nucleotide sequence within a host cell. The level of expression of a desired product in a host cell may be determined on the basis of either the amount of corresponding mRNA that is present in the cell, or the amount of the desired polypeptide encoded by the selected sequence. For example, mRNA transcribed from a selected sequence can be quantified by Northern blot hybridization, ribonuclease RNA protection, in situ hybridization to cellular RNA or by PCR. Proteins encoded by a selected sequence can be quantified by various methods including, but not limited to, e.g., ELISA, Western blotting, radioimmunoassays, immunoprecipitation, assaying for the biological activity of the protein, or by immunostaining of the protein followed by FACS analysis. "Expression control sequences" are regulatory sequences of nucleic acids, such as promoters, leaders, enhancers, introns, recognition motifs for RNA, or DNA binding proteins, polyadenylation signals, terminators, internal ribosome entry sites (IRES) and the like, that have the ability to affect the transcription or translation of a coding sequence in a host cell. Exemplary expression control sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). A "gene" is a sequence of nucleotides which code for a functional "gene product". Generally, a gene product is a functional protein. However, a gene product can also be another type of molecule in a cell, such as RNA (e.g., a tRNA or an rRNA). A gene may also comprise regulatory (i.e., non-coding) sequences as well as coding sequences and introns. Exemplary regulatory sequences include promoters, enhancers and terminators. The transcribed region of the gene may also include untranslated regions including introns, a 5'-untranslated region (5'-UTR) and a 3'-untranslated region (3 - UTR). The term "heterologous DNA" refers to DNA which has been introduced into a cell, or a nucleic acid molecule, that is derived from another source, or which is from the same source but is located in a different (i.e. non native) context. The term "high light intensity" refers to a photon flux of about 500 μΕ m"2 s"1 or more; conversely the term "low light intensity" refers to a photon flux of about 50 μΕ m"2 s"1 or less.
[0061] The term "homology" describes a mathematically based comparison of sequence similarities which is used to identify genes or proteins. with similar functions or motifs. The
nucleic acid and protein sequences of the presen' 'nvention can be used as a "query sequence" to perform a search against public databases to, for example, identify other family members, related sequences or homologs. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and BLAST) can be used.
[0062] The term "homologous" refers to the relationship between two proteins that possess a "common evolutionary origin", including proteins from superfamilies (e.g., the immunoglobulin superfamily) in the same species of animal, as well as homologous proteins from different species of animal (for example, myosin light chain polypeptide, etc.; see Reeck et al., Cell, 50:667, 1987). Such proteins (and their encoding nucleic acids) have sequence homology, as reflected by their sequence similarity, whether in terms of percent identity or by the presence of specific residues or motifs and conserved positions.
[0063] As used herein, the term "increase" or the related terms "increased", "enhance" or "enhanced" refers to a statistically significant increase. For the avoidance of doubt, the terms generally refer to at least a 10% increase in a given parameter, and can encompass at least a 20% increase, 30% increase, 40% increase, 50% increase, 60% increase, 70% increase, 80% increase, 90% increase, 95% increase, 97% increase, 99% or even a 100% increase over the control value.
[0064] The term "isolated," when used to describe a protein or nucleic acid, means that the material has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with research, diagnostic or therapeutic uses for the protein or nucleic acid, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In some embodiments, the protein or nucleic acid will be purified to at least 95% homogeneity as assessed by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Isolated protein includes protein in situ within recombinant cells, since at least one component of the protein of interest's natural
environment will not be present. Ordinarily, however, isolated proteins and nucleic acids will be prepared by at least one purification step.
[0065] As used herein, "identity" means the percentage of identical nucleotide or amino acid residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ; and Carillo, H., and Lipman, D., SLAM J. Applied Math., 48: 1073 (1988). Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs.
[0066] Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm described in Smith & Waterman 1981 , by the homology alignment algorithm described in Needleman & Wunsch 1970, by the search for similarity method described in Pearson & Lipman 1988, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the GCG Wisconsin Package, available from Accelrys, Inc., San Diego, California, United States of America), or by visual inspection. See generally, (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)).
[0067] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in (Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; & Altschul, S., et al., J. Mol. Biol. 215: 403- 410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold.
[0068] These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each
sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always; 0) and N (penalty score for mismatching residues; always; 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the - 27 cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached. The BLAST algorithm parameters W. T. and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 1 1, an expectation (E) of 10, a cutoff of 100, M = 5, N = -4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix.
[0069] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is in one embodiment less than about 0.1 , in another embodiment less than about 0.01 , and in still another embodiment less than about 0.001.
[0070] The "Oil" as used herein refers to any combination of fractionable lipid fractions of a biomass. "Lipid," "lipid fraction," or "lipid component" as used herein can include any hydrocarbon soluble in non-polar solvents and insoluble, or relatively insoluble, in water. The fractionable lipid fractions can include, but are not limited to, free fatty acids, waxes, sterols and sterol esters, triacylglycerols, diacylglycerides, monoacylglycerides, tocopherols, eicosanoids, glycoglycerolipids, glycosphingolipds, sphingolipids, and phospholipids. The lipid fractions can also comprise other liposoluble materials such as chlorophyll and other algal pigments, including, for example, antioxidants such as astaxanthins.
[0071] The terms "operably linked" and "operatively linked," as used interchangeably herein, refer to the positioning of two or more nucleotide sequences or sequence elements in a manner which permits them to function in their intended manner. In some embodiments, a nucleic acid molecule according to the invention includes one or more DNA elements
capable of opening chromatin and/or maintaining chromatin in an open state operably linked to a nucleotide sequence encoding a recombinant protein. In other embodiments, a nucleic acid molecule may additionally include one or more DNA or RNA nucleotide sequences chosen from: (a) a nucleotide sequence capable of increasing translation; (b) a nucleotide sequence capable of increasing secretion of the recombinant protein outside a cell; (c) a nucleotide sequence capable of increasing the mRNA stability, and (d) a nucleotide sequence capable of binding a trans-acting factor to modulate transcription or translation, where such nucleotide sequences are operatively linked to a nucleotide sequence encoding a recombinant protein. Generally, but not necessarily, the nucleotide sequences that are operably linked are contiguous and, where necessary, in reading frame. However, although an operably linked DNA element capable of opening chromatin and/or maintaining chromatin in an open state is generally located upstream of a nucleotide sequence encoding a recombinant protein; it is not necessarily contiguous with it. Operable linking of various nucleotide sequences is accomplished by recombinant methods well known in the art, e.g. using PCR methodology, by ligation at suitable restrictions sites or by annealing. Synthetic oligonucleotide linkers or adaptors can be used in accord with conventional practice if suitable restriction sites are not present.
[0072] The terms "polynucleotide," "nucleotide sequence" and "nucleic acid" are used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. These terms include a single-, double- or triple- stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically, biochemically modified, non- natural or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. In addition, a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer. A nucleic acid molecule can take many different forms, e.g., a gene or gene fragment, one or more exons, one or more introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as
fluororibose and thioate, and nucleotide branches. As used herein, a polynucleotide includes not only naturally occurring bases such as A, T, U, C, and G, but also includes any of their analogs or modified forms of these bases, such as methylated nucleotides, internucleotide modifications such as uncharged linkages and thioates, use of sugar analogs, and modified and/or alternative backbone structures, such as polyamides.
[0073] A "promoter" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. As used herein, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. A transcription initiation site (conveniently defined by mapping with nuclease S I) can be found within a promoter sequence, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Prokaryotic promoters contain Shine-Dalgamo sequences in addition to the -10 and -35 consensus sequences.
[0074] A large number of promoters, including constitutive, inducible and repressible promoters, from a variety of different sources are well known in the art. Representative sources include for example, viral, mammalian, insect, plant, yeast, and bacterial cell types, and suitable promoters from these sources are readily available, or can be made synthetically, based on sequences publicly available on line or, for example, from depositories such as the ATCC as well as other commercial or individual sources. Promoters can be unidirectional (i.e., initiate transcription in one direction) or bi-directional (i.e., initiate transcription in either a 3' or 5' direction). Non-limiting examples of promoters active in plants include, for example nopaline synthase (nos) promoter and octopine synthase (ocs) promoters carried on tumor-inducing plasmids of Agrobacterium tumefaciens and the caulimovirus promoters such as the Cauliflower Mosaic Virus (CaMV) 19S or 35S promoter (U.S. Pat. No. 5,352,605), CaMV 35S promoter with a duplicated enhancer (U.S. Pat. Nos. 5, 164,316; 5,196,525; 5,322,938; 5,359, 142; and 5,424,200), and the Figwort Mosaic Virus (FMV) 35S promoter (U.S. Pat. No. 5,378,619). These promoters and numerous others have been used in the creation of constructs for transgene expression in plants or plant cells. Other useful promoters are described, for example, in U.S. Pat. Nos. 5,391 ,725; 5,428, 147; 5,447,858; 5,608,144; 5,614,399; 5,633,441; 6,232,526; and 5,633,435, all of which are incorporated herein by reference.
[0075] As used herein a "photosynthetic organism" means an organism capable of performing photosynthetic reaction in presence of light belonging to kingdom "Plantae" that
include familiar organisms such as trees, herbs, bushes, grasses, vines, ferns, mosses, and algae. Photosynthetic organisms can be unicellular, or multi cellular.
[0076] The term "purified" as used herein refers to material that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e., contaminants, including native materials from which the material is obtained. For example, a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell. Methods for purification are well-known in the art. As used herein, the term "substantially free" is used operationally, in the context of analytical testing of the material. Preferably, purified material substantially free of contaminants is at least 50% pure; more preferably, at least 75% pure, and more preferably still at least 95% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art. The term "substantially pure" indicates the highest degree of purity, which can be achieved using conventional purification techniques known in the art.
[0077] The term "sequence similarity" refers to the degree of identity or correspondence between nucleic acid or amino acid sequences that may or may not share a common evolutionary origin (see Reeck et al., supra). However, in common usage and in the instant application, the term "homologous", when modified with an adverb such as "highly", may refer to sequence similarity and may or may not relate to a common evolutionary origin.
[0078] In specific embodiments, two nucleic acid sequences are "substantially homologous" or "substantially similar" when at least about 85%, and more preferably at least about 90% or at least about 95% of the nucleotides match over a defined length of the nucleic acid sequences, as determined by a sequence comparison algorithm known such as BLAST, FASTA, DNA Strider, CLUSTAL, etc. An example of such a sequence is an allelic or species variant of the specific genes of the present invention. Sequences that are substantially homologous may also be identified by hybridization, e.g., in a Southern hybridization experiment under, e.g., stringent conditions as defined for that particular system.
[0079] The term "specific" is applicable to a situation in which one member of a specific binding pair will not show any significant binding to molecules other than its specific binding partner(s). The term is applicable to the situation where two complementary polynucleotide strands can anneal together, yet each single stranded polynucleotide exhibits little or no binding to other polynucleotide sequences under stringent hybridization conditions.
[0080] Similarly, in particular embodiments of the invention, two amino acid sequences are "substantially homologous" or "substantially similar" when greater than 90% of the amino
acid residues are identical. Two sequences are functionally identical when greater than about 95% of the amino acid residues are similar. Preferably the similar or homologous polypeptide sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Version 7, Madison, Wis.) pileup program, or using any of the programs and algorithms described above. The program may use the local homology algorithm of Smith and Waterman with the default values: Gap creation penalty = -(1 + 1//:), k being the gap extension number, Average match = 1 , Average mismatch = -0.333.
[0081] The term "suppressed" in the context of "suppressed CAO expression" encompasses the absence of endogenous Chlorophyll A oxygenase protein in a plant cell, e.g., algae, as well as protein expression that is present but reduced as compared to the level of Chlorophyll A oxygenase protein expression in a wild type plant, e.g., algae. The term "suppressed" also encompasses an amount of Chlorophyll A oxygenase protein that is equivalent to wild type levels, but where the protein has a reduced level of activity in comparison to wild type plants. Generally, at least a 50% decrease in endogenous Chlorophyll A oxygenase activity, or expression, or the like is preferred, in other aspect, at least about 75%, or at least about 95% , or 100 % (i.e. no endogenous activity) being particularly preferred.
[0082] As used herein, a "transgenic photosynthetic organism" is one whose genome has been altered by the incorporation of exogenous genetic material, e.g. by transformation as described herein. The term "transgenic photosynthetic organism" is used to refer to the photosynthetic organism produced from an original transformation event, or progeny from later generations or crosses of a transgenic photosynthetic organism, so long as the progeny contains the exogenous genetic material in its genome. By "exogenous" is meant that a nucleic acid molecule, for example, a recombinant DNA, originates from outside the photosynthetic organism into which it is introduced. An exogenous nucleic acid molecule may comprise naturally or non-naturally occurring DNA, and may be derived from the same or a different photosynthetic organism species than that into which it is introduced.
[0083] The term "transformation" or "transfection" refers to the transfer of one or more nucleic acid molecules into a host cell or organism. Methods of introducing nucleic acid molecules into host cells include, for instance, calcium phosphate transfection, DEAE- dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, scrape loading, ballistic introduction or infection with viruses or other infectious agents.
[0084] "Transformed", "transduced", or "transgenic", in the context of a cell, refers to a host cell or organism into which a recombinant or heterologous nucleic acid molecule (e.g.,
one or more DNA constructs or RNA, or siRNA counterparts) has been introduced. The nucleic acid molecule can be stably expressed (i.e. maintained in a functional form in the cell for longer than about three months) or non-stably maintained in a functional form in the cell for less than three months i.e. is transiently expressed. For example, "transformed," "transformant," and "transgenic" cells have been through the transformation process and contain foreign nucleic acid. The term "untransformed" refers to cells that have not been through the transformation process.
[0085] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. aniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1- 3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. ahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; The Chlamydomonas Sourcebook, Second Edition, published November 2008 (copyright date 2009). Available from Elsevier Science and Technology; Transgenic Microalgae as Green Cell Factories. Advances in Experimental Medicine and Biology, Volume 616. Edited by Rosa Leon, Aurora Galvan, and Emilio Fernandez, published in 2007 by Landes Bioscience and Springer Science_Business Media, LLC, New York; The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas, Edited by Jean-David Rochaix, Michel Goldschmidt- Clermont and Sabeeha Merchant, published by luwer Academic Publishers; and Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969- 630-3. Each of these general texts is herein incorporated by reference.
[0086] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, compositions, reagents, cells, similar or equivalent to those
described herein can be used in the practice or testing of the invention, the preferred methods and materials are described herein.
[0087] The publications discussed above are provided solely for their disclosure before the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
[0088] All publications and references, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference in their entirety as if each individual publication or reference were specifically and individually indicated to be incorporated by reference herein as being fully set forth. Any patent application to which this application claims priority is also incorporated by reference herein in its entirety in the manner described above for publications and references.
I. OVERVIEW OF METHODS
[0089] The present invention provides methods, and compositions for modulating the PSII peripheral antenna size of photosynthetic organisms by negatively regulating the expression of chlorophyll a oxygenase (CAO) to high light intensity.
[0090] Accordingly in one aspect, the current invention includes a method of producing an improved photosynthetic organism, comprising the steps of; a) stably transforming a photosynthetic organism with a heterologous polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif, that is capable of binding to a redox sensitive modulator that is responsive to ambient light intensity; b) selecting a transformant that is capable of modulating PSII antenna size in response to ambient light intensity.
[0091] In another embodiment, the current invention includes a method of enhancing yields of photosynthetic productivity under conditions of high light intensity, and or high density growth, the method comprising;
a) providing a photosynthetic organism comprising a heterologous polynucleotide
sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide
sequence encoding CAO; wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
b) cultivating the photosynthetic organism at high light intensity and / or high density.
[0092] In another embodiment, the current invention includes a method of enhancing bio-oil, or bio-diesel production from a photosynthetic organism the method comprising;
a) providing algae comprising a heterologous polynucleotide sequence comprising
expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
b) cultivating the algae at high light intensity and / or high density.
[0093] In another embodiment the present invention includes a method of enhancing beta- carotene, lutein, or zeaxanthin production from a photosynthetic organism, the method comprising;
a) providing algae comprising a heterologous polynucleotide sequence comprising
expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
b) cultivating the algae at high light intensity and / or high density.
II. CHLOROPHYLL A OXYGENASE (CAO)
[0094] The terms "chlorophyll A oxygenase" or "CAO" refers to enzymes capable of the synthesis of chlorophyll b via the oxidation of the methyl group on ring II of chlorophyll a. Exemplary genes encoding CA) include those listed in Table Dl.
[0095] The term "chlorophyll A oxygenase" or "CAO" refers to all naturally-occurring and synthetic forms of chlorophyll A oxygenase. In one aspect the "chlorophyll A oxygenase" is from algae. In one aspect the chlorophyll A oxygenase is from a plant. In a further embodiment the chlorophyll A oxygenase is from Chlamydomonas. Representative species and Gene bank accession numbers for various species of chlorophyll A oxygenase are listed below in Table Dl, and genes from other species may be readily identified by standard homology searching of publicly available databases.
Table Dl
Exemplary chlorophyll A oxygenase genes
Species and Sequence SEQ. accession ID. NO. number
Chlamydomon ATGGGCCAGACCCCCGCAGGGCTTCCTGCGTCGCTTCAACGCAAGGCCGCTGCCGTTGGCGGTCGCGGCCC SEQ.
CACCAACCAGAGTCGCGTGGCAGTTCGCGTCTCTGCTCAGCCGAAGGAAGCTCCTCCCGCCTCGACACCCA
as rienhardtii TCGTTGAGGACCCGGAGAGCAAGTTCCGCCGCTATGGCAAGCATTTCGGCGGCATTCACAAGCTGAGCATG
GATTGGCTTGATAGCGTTCCTCGCGTGCGCGTGCGCACCAAGGACTCTCGCCAGCTGGACGATATGTTGGA ID.
XM_00169012 GCTGGCAGTGCTCAACGAGCGCCTTGCGGGTCGCTTGGAGCCCTGGCAGGCTCGTCAGAAGCTTGAGTACC
3.1 TCCGTAAGCGGCGGAAGAACTGGGAGCGCATTTTCGAGTACGTGACGCGTCAGGATGCGGCCGCGACCCTG NO.34
GCCATGATCGAGGAGGCAAATCGCAAGGTGGAGGAGTCGCTGAGCGAGGAGGCACGCGAGAAGACTGCTGT AGGCGACCTCCGAGACCAGCTGGAGTCGCTGCGCGCGCAGGTGGCGCAGGCGCAGGAGCGCCTTGCTATGA CGCAGTCGCGCGTGGAGCAGAACCTACAGCGCGTGAATGAGCTGAAGGCGGAGGCGACCACGCTAGAGCGC ATGCGCAAGGCCTCGGACCTGGACATCAAGGAGCGCGAGCGCATCGCCATCTCCACTGTCGCCGCCAAGGG ACCGGCCTCGAGCAGCAGCAGCGCCGCCGCCGTCAGCGCCCCCGCCACGTCGGCCACGCTGACGGTGGAGC GCCCCGCCGCCACCACGGTGACGCAGGAGGTGCCGTCCACCAGCTACGGCACCCCCGTGGACCGCGCGCCG CGCCGCAGCAAGGCGGCCATCCGGCGCAGCCGCGGGCTGGAAAGCAGCATGGAGATTGAGGAGGGCCTGCG CAACTTCTGGTACCCCGCTGAGTTCTCAGCGCGCTTGCCGAAGGACACGCTGGTGCCCTTTGAGCTGTTTG GCGAGCCGTGGGTGATGTTCCGTGATGAGAAGGGGCAGCCCTCCTGCATCCGCGACGAGTGCGCACACCGC GGCTGCCCGCTCAGCCTGGGCAAGGTGGTGGAGGGACAGGTCATGTGCCCCTACCACGGCTGGGAGTTCAA CGGCGACGGCGCCTGCACCAAGATGCCCTCCACGCCCTTCTGCCGCAATGTGGGCGTTGCCGCGCTGCCTT GCGCGGAGAAGGATGGCTTCATCTGGGTCTGGCCCGGCGACGGCCTGCCAGCGGAGACGCTGCCGGACTTC GCCCAGCCGCCAGAGGGCTTTCTGATCCACGCGGAGATCATGGTGGATGTGCCTGTGGAGCACGGCCTGCT GATTGAGAACCTGCTGGACCTGGCGCACGCGCCGTTCACGCACACCAGCACCTTCGCGCGCGGCTGGCCTG TGCCCGACTTCGTCAAGTTCCATGCCAACAAGGCGCTCTCGGGCTTCTGGGACCCCTACCCCATCGACATG GCCTTCCAGCCGCCCTGCATGACGCTGTCCACCATCGGCCTGGCGCAACCCGGCAAGATTATGCGCGGCGT GACCGCCAGCCAGTGCAAGAACCACCTGCACCAGCTGCACGTGTGCATGCCCTCCAAGAAGGGCCACACGC GGCTGCTGTACCGCATGAGCCTGGACTTCCTGCCCTGGATGCGCCACGTGCCCTTCATCGACCGCATCTGG AAGCAGGTGGCGGCGCAGGTGCTGGGCGAGGACCTGGTGCTGGTGCTGGGCCAGCAGGACCGCATGCTGCG CGGCGGCAGCAACTGGTCCAACCCCGCGCCCTACGACAAGCTGGCGGTGCGCTACCGCCGCTGGCGCAACG GCGTAAACGCCGAGGTCGCACGCGTGCGCGCCGGCGAGCCACCGTCCAACCCCGTGGCAATGAGCGCGGGC GAGATGTTCTCGGTGGACGAGGATGACATGGACAACTAG
Volvox carteri ATGCTTCCAG CACAAAGACA GTGCAGGACG TCCGCCTGCC AAGGCAGGGG CATTATAAGC
TCCGTGCTGA CATGCGTCAG TATCACAGCA GCCTTCTTCA SEQ. f. nagariensis AAGAGGACTA CTTTAAAGTC
GACAAGCCTG AGCAACAGGC TGTACCGTCT ATCGTCGAGG ACCCTGAAGC GAAGTTTCGG CGTTATGGCA AGCATTTCGG TGGTATCCAT AAGCTAAATC TGGATTGGCT GGAGGCAGTT ED. CCGCGTGTGC GTGTTCGGAC CAAAGATTCA CGGCAGCTCG ACGAGCTGTT GGAGCTGGCA GTGCTCAATG AGCGCCTTGC GGGACGCTTG GAGCCTTGGC AGGCACGCCA GAAGCTTGAG N0.35
XM_00295384 TATCTGCGTA AGCGCCGGAA GAACTGGGAG CGCATCTTTG AGTACGTCAC TAAGCAGGAC
4 GCTGCTGCCA CGCTAGCCAT GATCGAGGAG GCCAACCGAA AGGTGGAGGA AGCCTTGTCG
GAAGAGGCAC GCGAGCGAAC AGCAGTGGGA GATTTGCGGG AGCAGCTTCA AGTCCTGCAA CGCCAGGTGC AGGAGGCGCA GGAGCGGCTT CAGCTCACGC AAGCACGTGT GGAGCAGAAC CTGAACCGCG TGAATGAGCT GAAGGCAGAG GCGGTCGGCC TGGAGCGGAT GCGAAACGGA AGGATGGGTG GCGATCGCAA GAAGGAGCTC CAGGTGGCGG CGCCAGTCGC TGTCACTGCC GCGGCGTCGG CGGCACGTCC TGCTGTTTCT GCTACGGCAG TGGCGGAATC AGTCCCCGCG GCCATCGTGA CAGTGGAGCC CCCTACCAGG AGCTATACCC CCAATGGCTC GTCCGATGGC ACGTCGGTTG TCGCCCCACC AGGTCGTCGC AGCAAGGTAG CCATCCGACG GGGTCGCGGT CTGGAGAGCA GCTTGGACTT CGAGCCAGGC CTTCGCAACT TTTGGTACCC TGCGGAGTTT TCAGCGAAGC TGGGTCAGGA CACGCTGGTT CCCTTCGAGC TGTTTGGGGA GCCCTGGGTC CTGTTCCGCG ACGAGAAGGG GCAGCCCGCT TGCATCAAGG ACGAATGCGC ACATCGGGCC TGCCCGTTGT CGCTTGGAAA GGTGGTAGAG GGGCAGGTTG TGTGCGCGTA CCACGGCTGG GAGTTCAACG GCGATGGCCA CTGCACCAAG ATGCCCTCCA CGCCGCATTG CCGCAACGTG GGGGTATCGG CGCTGCCCTG CGCTGAGAAG GATGGCTTCA TCTGGGTGTG GCCTGGAGAC GGACTCCCGG CGCAGACGCT CCCCGACTTC GCACGCCCAC CGGAGGGCTT TCAAGTGCAC GCTGAGATTA TGGTGGACGT GCCGGTGGAG CATGGCCTGC TCATGGAGAA CCTTTTGGAT CTGGCGCATG CGCCATTCAC CCACACCACA ACTTTTGCGC GCGGCTGGCC CGTGCCTGAC TTCGTCAAGT TCCACACCAA CAAATTACTA TCGGGATACT GGGACCCCTA CCCCATCGAC ATGGCTTTCC AGCCGCCTTG CATGGTTCTG TCCACGATTG GCTTGGCGCA ACCTGGCAAG ATTATGCGCG GCGTGACGGC ATCGCAATGC AAGAACCATC TGCACCAGCT CCATGTGTGC ATGCCGTCGA AGAAGGGCCA CACGCGGCTG CTGTACCGCA TGAGCCTAGA CTTCCTGCCG TGGATGCGCT ACGTGCCGTT TATTGACAAG GTCTGGAAGA ATGTTGCGGG CCAGGTGTTG GGCGAGGACC TGGTGCTGGT GCTGGGGCAA CAGGATCGTT TGCTGCGCGG CGGGAACACC TGGTCGAACC CGGCGCCGTA CGACAAGCTG GCGGTACGAT ACCGCCGCTG GCGCAACTCG GTCAGTCCCG ATGGCGCTGG CCTTGACGGC CCGGCGCCAC TGAACCCAGT GGCGATGAGC GCCGGGGAGA TGTTTTCAAT TGATGAAGAT GAGCAGGATC CGCGGATGCA GTGA
Dunaliella TCAACAGGGG TTGGGGCCAT GCAATCAAAG CTCTTGGGGC TTCAAGACGA GATTAGTGAG SEQ. salina GCAAGGGACA AGCTGCGTAC CTCAGAGGCA AGGGTGGCAC AAAACCTCAA GCGTGTGGAT
GAGTTGAAGG CTGAGGCGGC TTCCTTGGAG CGCATGCGCC TGGCCAGCAG CTCAAGCACT
AB021312.1 GACAGCACAG TCAGCATTGC CAGCAGGGGG GGCGCAGCTG TGGCTGCAAC CACGAGCGTA ID.
CCGGACCATG TGGAGAGGGA AGGGATCCAG AGCAGGGTGC GGGGCAGTGG CATGGCCTCA ACAAGCTACC CCTCCCATGT ACCTCAGCCG AGCCAGGCAG TGAGACGGGG CCCTAAACCG NO.36 AAGGACAGCA GGCGACTGAG AAGCAGCCTG GAGCTGGAAG ACGGCCTGCG CAACTTCTGG TACCCGACCG AGTTTGCGAA GAAGCTGGAG CCGGGCATGA TGGTGCCCTT TGACTTGTTC GGCGTGCCGT GGGTGCTGTT CCGAGATGAG CACAGCGCCC CCACCTGCAT CAAGGACTCC TGCGCGCACC GCGCATGCCC GCTGTCACTG GGCAAGGTCA TCAACGGCCA CGTGCAGTGC CCCTACCATG GCTGGGAGTT TGACGGGAGC GGCGCGTGCA CCAAGATGCC CAGCACGCGC ATGTGCCATG GCGTGGGCGT GGCCGCGCTG CCGTGCGTGG AGAAGGACGG CTTTGTGTGG GTGTGGCCTG GGGATGGGCC CCCACCTGAC CTGCCGCCGG ACTTCACAGC CCCCCCTGCA GGCTATGACG TGCACGCAGA GATCATGGTG GATGTGCCTG TGGAGCACGG CCTGCTGATG GAGAACTTAC TTGATCTGGC CCACGCGCCC TTCACCCACA CCACCACCTT TGCGCGGGGC TGGCCCATCC CAGAGGCTGT GCGCTTCCAT GCCACCAAGA TGCTGGCAGG TGACTGGGAC CCCTACCCCA TCAGCATGTC TTTTAACCCC CCCTGCATTG CGCTGTCAAC CATCGGGCTG TCGCAGCCTG GCAAGATCAT GCGCGGCTAC AAGGCAGAGG AGTGCAAGCG CCACCTACAC CAGCTGCACG TGTGCATGCC CTCCAAGGAG GGCCACACGC GCCTGCTGTA CCGCATGAGC CTTGACTTCT GGGGCTGGGC TAAGCACGTG CCATTTGTGG ATGTGCTGTG GAAGAAGATT GCTGGCCAGG TGCTGGGTGA GGACCTGGTG CTGGTGCTGG GGCAGCAGGC TCGCATGATT GGCGGCGACG ACACCTGGTG CACGCCCATG CCGTACGACA AGCTGGCTGT GCGGTACCGG AGGTGGCGGA ACATGGTGGC TGATGGTGAG TACGAGGAGG GGTCTCGGAA TCGCTGCACA AGCCAATATG ACAGCTGGCC AGATGTTTGA CTCCCACGAT GATGAGGATC TGTATGAGCA TCAGCGCCAT GATGAGGGGA ACCTGCAGGG CCAGCAAAGC AGCGTTTTTG CTGCAAGGAA GTGAGGGCAT TCATCCTAGG TTTTTGCTTG AGCAGAAGGA GAGGCTTATA GGATGGTAGA ATTGATTGTA AAATTTTGTA ACATGCTTGG TGGTTCAATG GTTCCTGTAC TTGATGACTT GTAGAATTTT TCCCGTCGAG GGTGTTCACA CTGTTAAGTG CTATGTTGGC GGTGACTGAG GATGCATAAT TGCGCTGTCC CACCATGCAT ACTGTTGCCA GTTTTAAACG GATTTCATGT TGTCTCTCCA GTTTTGATGG ATTGCTGGAT GGTTTGTTTT GGTCTCCCCT TTAATTTCTT TAATTTGCCC TACTAAATGG GCTCTCAGTA GAACATGTGG TTGGAAATCT GTAAGGTTCA AGAACATTT
Nephroselmis TGCGGTGGAG TTCACTTCGC GCTTGGGGAA GGACATCATG GTTCCGTTTG AGTGCTTCGA SEQ. pyriformis GGAGTCCTGG GTACTCTTCC GCGACGAGGA CGGCAAGGCG GGCTGCATCA AGGACGAGTG
CGCGCACCGC GCTTGCCCGC TCTCGCTCGG CACGGTGGAG AACGGCCAGG CGACGTGCGC
AB453267 GTACCACGGC TGGCAGTTCA GCACTGGGGG GGAGTGCACC AAGATCCCGT CGGTCGGCGC ED.
GCGGGGCTGC TCGGGCGTGG GCGTGCGCGC CATGCCCACC GTGGAGCAAG ATGGCATGAT CTGGATCTGG CCCGGGGACG AGAAGCCCGC CGAGCACATC CCGTCCAAGG AGGTGCTGCC NO.37 GCCCGCGGGC CACACCCTCC ACGCGGAGAT AGTGCTGGAC GTGCCCGTGG AGCACGGCCT GCTGCTGGAG AACCTCCTGG ACCTGGCGCA CGCGCCCTTC ACCCACACGT CCACGTTCGC CAAGGGCTGG GCGGTCCCGG AACTCGTCAA GTTCTCCACG GACAAGGTGC GCGCGCTCGG GGGCGCGTGG GAACCTTACC CCATCGACAT GAGCTTCGAG CCGCCCTGCA TGGTGCTGTC CACCATCGGG CTCGCGCAGC CGGGCAAGGT AGACGCGGGC GTGCGCGCGT CCGAGTGCGA GAAGCACCTG CACCAGCTGC ACGTGTGCAT GCCCTCGGGC GCGGGGAAGA CGCGCCTGCT GTACCGCATG CACCTCGACT TCATGCCGTT CCTCAAATAC GTGCCGGGCA TGCACCTGGT GTGGGAGGCC ATGGCCAACC AGGTGCTGGG GGAGGACCTG AGGCTGGTGC TGGGGCAGCA GGACAGGCTG CAGAGGGGCG GGGACGTGTG GAGCAACCCC ATGGAGTACG ACAA
Mesostigma GACGAGGACG GCCGCGTGGC GTGCCTGCGG GATGAGTGCG CGCACCGTGC ATGCCCCCTG SEQ. viride TCACTGGGCA CGGTGGAGAA CGGGCACGCG ACCTGCCCCT ACCATGGCTG GCAGTACGAC
ACGGACGGCA AGTGCACAAA GATGCCGCAG ACGCGGCTGC GCGCGCAGGT GCGCGTGTCC AB453277.1 ACCCTGCCCG TGCGCGAGCA CGACGGCATG ATCTGGGTGT ACCCAGGGTC CAACGAGCCG ED.
CCCGAGCACC TGCCGTCGTT CCTGCCCCCC AGCAACTTCA CGGTGCACGC CGAGTTGGTG CTGGAGGTGC CCATCGAGCA CGGGCTGATG ATCGAGAACC TGCTGGACCT GGCACACGCG NO.38 CCCTTCACGC ACACCGAGAC CTTTGCCAAG GGATGGTCGG TCCCGGACTC TGTCAACTTC AAGGTCGCCG CGCAGTCGCT GGCGGGGCAT TGGGAGCCGT ACCCCATCAG CATGAAGTTT GAGCCGCCGT GCATGACGAT CTCGGAAATC GGGCTGGCCA AGCCCGGGCA GTTGGAGGCC GGCAAGTTCA GTGGCGAGTG CAAGCAGCAC CTGCACCAGC TGCACGTGTG CATGCCCGCG GGGGAGGGCC GCACGCGCAT CCTCTACCGC ATGTGCCTCG ACTTTGCGCA CTGGGTCAAG TACATACCCG GAATCCAGAA TGTGTGGTCG GGCATGGCGA CGCAGGTGCT TGGGGAGGAC CTGCGGCTGG TGGAGGGGCA GCAGGATCGC ATGCTGCGCG GCGCGGACAT CTGGTACAAC CCGGTCGCCT ATGACAAGCT GGGCGTGCGG TACCGCAGCT GGCGCCGCGC GGTCGAGCGC AACACGCGCA GCCGGTTCAT CGGGGGCCAG GAGAAGCTTG CGCCCGAGGG TAGAGACTAG TGAGCAAAAG GGGTGACTGC TCCACTGTAC CTTCATGGCC GAGCAGCCAG CTGGTACAGG CCTGACACCG TGGCAAGCCT GCACTTGGGC CATGCAGCGG GTTAAGGTTG AGGCTTCTGA TGGCAACCCT TGTCCGGTCT ATTGTACAAA ACGAGGAACG GAGAACATGG CTCCATTGCA ACTGTGAGAT GTTGAGGATG CATGCTGCTA CAAGGTGCCA GCAAGGTCTG TCACAGGGAT GCTCCAGCAT GACCAATGGG TGCCATTGCT TGAAATGGAT ATGTGCTAAC AGGGGGGGAT TTACTCTTTG CTGCCCCAGT GTANANATCA TGGCCAGGAT GATACATTCA TCNCCAATCT GCAGGGTACN TGTGAAANAA CCTGNTGGNN TTGCATGCCT TATCCNTTCC NA TGA AAN ANTTTTGNTG AGGGGCNCTT NCNGCTTNTT ACCNAAAAAN NNCTTGCCNN AAAAAAAAA
[0096] The chlorophyll A oxygenase may be in its native form, i.e., as different apo forms, or allelic variants as they appear in nature, which may differ in their amino acid sequence, for
example, by truncation (e.g., from the N- or C-terminus or both) or other amino acid deletions, additions, insertions, substitutions, or post-translational modifications. Naturally- occurring chemical modifications including post-translational modifications and degradation products of the chlorophyll A oxygenase, are also specifically included in any of the methods of the invention including for example, pyroglutamyl, iso-aspartyl, proteolytic, phosphorylated, glycosylated, reduced, oxidized, isomerized, and deaminated variants of the chlorophyll A oxygenase.
[0097] The chlorophyll A oxygenase which may be used in any of the methods of the invention may have amino acid sequences which are substantially homologous, or substantially similar to the native chlorophyll A oxygenase amino acid sequences, for example, to any of the native chlorophyll A oxygenase gene sequences listed in Table Dl. Alternatively, the chlorophyll A oxygenase may have an amino acid sequence having at least 30% preferably at least 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, or 99% identity with chlorophyll A oxygenase listed in Table Dl. In a preferred embodiment, the chlorophyll A oxygenase for use in any of the methods of the present invention is at least 80% identical to the mature chlorophyll A oxygenase from Chlamydomonas.
Suppression of chlorophyll A oxygenase Expression
[0098] The invention provides methods, compositions, and transgenic plants and algae having a reduced chlorophyll antenna size by suppressing the endogenous expression of chlorophyll A oxygenase, and operatively coupling the expression of a heterologous CAO to expression control sequences that are regulated by the activity of a redox sensitive modulator. Accordingly in one aspect, the present invention includes transgenic plants and algae in which the endogenous CAO gene has been knocked out, or the expression of the gene suppressed.
[0099] Exemplary chlorophyll A oxygenase nucleic acid sequences can be used to prepare expression cassettes useful for inhibiting or suppressing chlorophyll A oxygenase expression, and for providing for heterologous recombinant CAO genes, are listed in Table Dl above. A number of methods can be used to inhibit gene expression in plants. For instance, siRNA, antisense, or ribozyme technology can be conveniently used. For example, in Chlamydomonas, antisense inhibition can be used to decrease expression of a targeted gene (e.g., Schroda, et al (1999) Plant Cell 1 1 : 1 165-78,). Alternatively, an RNA interference construct can be used (e.g., Schroda, et al., (2006) Curr Genet. 49:69-84).
[00100] For antisense expression, a nucleic acid segment from the desired chlorophyll A oxygenase gene is cloned and operably linked to a promoter such that the antisense strand of RNA will be transcribed. The expression cassette is then transformed into plants, e.g., algae, and the antisense strand of RNA is produced. The antisense nucleic acid sequence transformed into plants will be substantially identical to at least a portion of the endogenous gene or genes to be repressed. The sequence, however, does not have to be perfectly identical to inhibit expression. Thus, an antisense or sense nucleic acid molecule encoding only a portion of chlorophyll A oxygenase can be useful for producing a plant in which chlorophyll A oxygenase expression is suppressed. The vectors of the present invention can be designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene.
[00101] For antisense suppression, the introduced sequence also need not be full length relative to either the primary transcription product or fully processed mRNA. Generally, higher homology can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective. Normally, a sequence of between about 30 or 40 nucleotides and about full length nucleotides should be used, though a sequence of at least about 100 nucleotides is preferred, a sequence of at least about 200 nucleotides is more preferred, and a sequence of at least about 500 nucleotides is especially preferred. Sequences can also be longer, e.g., 1000 or 2000 nucleotides are greater in length.
[00102] Catalytic RNA molecules or ribozymes can also be used to inhibit expression of chlorophyll A oxygenase genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA cleaving activity upon them, thereby increasing the activity of the constructs.
[00103] A number of classes of ribozymes have been identified. One class of ribozymes is derived from a number of small circular RNAs that are capable of self-cleavage and replication in plants. Ribozymes, e.g., Group I introns, have also been identified in the chloroplast of green algae (see, e.g., Cech et al., (1990) Annu Rev Biochem 59:543-568; Bhattacharya et al., (1996) Molec Biol and Evol 13:978-989; Erin, et al., (2003) Amer J Botany 90:628-633,; Turmel, et al., (1993) Nucl Acids Res. 21 :5242-5250; and Van Oppen et
al., (1993) Molec Biol and Evol 10: 1317-1326). The design and use of target RNA-specific ribozymes is described, e.g., in Haseloff et al. (1 88) Nature, 334:585-591.
[00104] Another method of suppression is sense suppression (also known as co- suppression). Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to be an effective means by which to block the transcription of target genes. For an example of the use of this method to modulate expression of endogenous genes see, Napoli et al., (1990) The Plant Cell 2:279- 289; Flavell, (1994) Proc. Natl. Acad. Sci., USA 91 :3490-3496; Kooter and Mol, (1993) Current Opin. Biol. 4: 166-171 ; and U.S. Pat. Nos. 5,034,323, 5,231 ,020, and 5,283, 184.
[00105] Generally, where inhibition of expression is desired, some transcription of the introduced sequence occurs. The effect may occur where the introduced sequence contains no coding sequence per se, but only intron or untranslated sequences homologous to sequences present in the primary transcript of the endogenous sequence. The introduced sequence generally will be substantially identical to the endogenous sequence intended to be repressed. This minimal identity will typically be greater than about 65%, but a higher identity might exert a more effective repression of expression of the endogenous sequences. Substantially greater identity of more than about 80% is preferred, though about 90% or 95% to absolute identity would be most preferred. As with antisense regulation, the effect should apply to any other proteins within a similar family of genes exhibiting homology or substantial homology.
[00106] For sense suppression, the introduced sequence in the expression cassette, needing less than absolute identity, also need not be full length, relative to either the primary transcription product or fully processed mRNA. This may be preferred to avoid concurrent production of some plants that are over-expressers. A higher identity in a shorter than full length sequence compensates for a longer, less identical sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and identity of non- coding segments will be equally effective. Normally, a sequence of the size ranges noted above for antisense regulation is used.
[00107] Endogenous gene expression may also be suppressed by means of RNA interference (RNAi), which uses a double-stranded RNA having a sequence identical or similar to the sequence of the target chlorophyll A oxygenase gene. See generally, PCT International Publication Nos. WO 99/32619 WO 99/07409, WO 00/44914. WO 00/44895, WO 00/63364 WO 00/01846, WO 01/36646, WO 01/75164, WO 01/29058, WO 02/055692, WO 02/44321, WO2005/054439, and WO2005/1 10068.
[00108] RNAi is the phenomenon in which when a double-stranded RNA having a sequence identical or similar to that of the target gene is introduced into a cell, the expressions of both the inserted exogenous gene and target endogenous gene are suppressed. The double-stranded RNA may be formed from two separate complementary RNAs or may be a single RNA with internally complementary sequences that form a double-stranded RNA. The introduced double-stranded RNA is initially cleaved into small fragments, which then serve as indexes of the target gene in some manner, thereby degrading the target gene. RNAi is known to be also effective in plants (see, e.g., Chuang, C. F. & Meyerowitz, E. M., (2000); Proc. Natl. Acad. Sci. USA 97:4985 Waterhouse et al., ( 1998) Proc. Natl. Acad. Sci. USA 95: 13959- 13964; Tabara et al. Science 282:430-431 ( 1998)). For example, to achieve suppression of the expression of a DNA encoding a protein using RNAi, a double-stranded RNA having the sequence of a DNA encoding the protein, or a substantially similar sequence thereof (including those engineered not to translate the protein) or fragment thereof, is introduced into a plant of interest, e.g., green algae. The resulting plants may then be screened for a phenotype associated with the target protein and/or by monitoring steady-state RNA levels for transcripts encoding the protein. Although the genes used for RNAi need not be completely identical to the target gene, they may be at least 70%, 80%, 90%, 95% or more identical to the CAO target gene sequence; such as, for example, a gene from Table Dl. See, e.g., U.S. Patent Publication No. 2004/0029283. The constructs encoding an RNA molecule with a stem-loop structure that is unrelated to the target gene and that is positioned distally to a sequence specific for the gene of interest may also be used to inhibit target gene expression. See, e.g., U.S. Patent Publication No. 2003/022121 1 , and the current examples.
[00109] The RNAi polynucleotides may encompass the full-length target RNA or may correspond to a fragment of the target RNA. In some cases, the fragment will have fewer than 100, 200, 300, 400, 500 600, 700, 800, 900 or 1 ,000 nucleotides corresponding to the target sequence. In addition, in some embodiments, these fragments are at least, e.g., 15, 20, 25, 30, 50, 100, 150, 200, or more nucleotides in length. In some cases, fragments for use in RNAi will be at least substantially similar to regions of a target protein that do not occur in other proteins in the organism or may be selected to have as little similarity to other organism transcripts as possible, e.g., selected by comparison to sequences in analyzing publicly- available sequence databases. Thus, RNAi fragments may be selected for similarity or identity with the N terminal region of the chlorophyll A oxygenase sequences of the invention (i.e., those sequences lacking significant homology to sequences in the databases)
or may be selected for identity or similarity to conserved regions of chlorophyll A oxygenase proteins.
[00110] Expression vectors that continually express siRNA in transiently- and stably- transfected cells have been engineered to express small hairpin RNAs, which get processed in vivo into siRNAs molecules capable of carrying out gene-specific silencing (Brummelkamp et al., (2002) Science 296:550-553, and Paddison, et al., (2002) Genes & Dev. 16:948-958). Post-transcriptional gene silencing by double-stranded RNA is discussed in further detail by Hammond et al. Nature Rev Gen 2: 1 10-1 19 (2001), Fire et al. (1998) Nature 391 :806-81 1 and Timmons and Fire (1998) Nature 395:854.
[00111] One of skill in the art will recognize that using technology based on specific nucleotide sequences (e.g., antisense or sense suppression technology), families of homologous genes can be suppressed with a single sense or antisense transcript. For instance, if a sense or antisense transcript is designed to have a sequence that is conserved among a family of genes, then multiple members of a gene family can be suppressed. Conversely, if the goal is to only suppress one member of a homologous gene family, then the sense or antisense transcript should be targeted to sequences with the most variation between family members
ΙΠ. LIGHT REGULATED TRANSLATIONAL MODULATORS
[00112] The present invention exploits the ability of certain proteins (redox sensitive modulators) to act as reversible thiol-based redox switches to regulate gene expression in plants and algae to enable the light dependent regulation of PSII antenna size. Such proteins represent a growing family of proteins that is widely dispersed within the plant and animal kingdoms. See generally Antelmann H, & Helmann ID. (2010) Thiol-based redox switches and gene regulation. Antioxid Redox Signal. 2010 Jul 14. [Epub ahead of print], Brandes et al., (2009) Thiol-based redox switches in eukaryotic proteins. Antioxid Redox Signal. 1 1(5):997-1014, Paget MS, & Buttner M (2003) Thiol-based regulatory switches. Annu Rev Genet. 37:91-121.
[00113] Accordingly the term "redox sensitive modulators" refers to the group of proteins capable of mediating the reversible redox dependent regulation of gene transcription or translation. In one aspect such redox sensitive modulators include proteins that include the conserved cold shock domain (Prosite motif PS00352; Bucher and Bairoch, (In) ISMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology,
Airman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., pp 53-61, AAAIPress, Menlo Park, 1994; Hofmann et al., Nucleic Acids Res. 27:215, 1999).
[00114] The cold shock domain (CSD) is among the most ancient and well conserved nucleic acid binding domains from bacteria to higher animals and plants (Chsikam et al., BMB reports (2010) 43(1) 1 -8; Nakaminami et al., (2006) 103(26) 10123-10127). Proteins containing a CSD motif are also referred to as Y box proteins and eukaryotic members of this large family generally contain a secondary auxiliary RNA domain which modulates the RNA affinity of the protein, but can be dispensable for selective RNA recognition.
[00115] An exemplary redox sensitive modulator includes the cytosolic RNA binding protein NAB l (SEQ. BD. NO. 22) from Chlamydomonas. NAB l harbors 2 RNA binding motifs and one of these motifs, located at the N-terminus, is a cold shock domain. NAB l represses the translation of LHCTI (light harvesting complex of photosystem II) by sequesting the encoding mRNAs into translationally silent mRNP complexes. (Mussgnug et al., The Plant Cell (2005) 17 3409-3421).
[00116] NAB l contains 2 cysteine residues, Cys- 181 and Cys-226, within its C- terminal RNA recognition motif. Modification of these cysteines either by oxidation or by alkylation in vitro is accompanied by a decrease in RNA binding affinity for the target mRNA sequence. Recent studies have confirmed that NAB l is fully active' in its dithiol reduced state, and is reversibly deactivated by modification of its cysteines. (Wobbe et al., (2009) Pro. Nat. Acad. Sci. 106(32) 13290-13295).
[00117] The term "NAB l" as used herein includes all naturally-occurring and synthetic forms of NAB 1 that retain redox sensitive modulator activity. Such NAB 1 proteins include the protein from Chlamydomonas, as well as peptides derived from other plant species and genera, and in one aspect algae. In one aspect, "NAB l " refers to the Chlamydomonas NAB 1 having the amino acid sequence SEQ. ID. NO. 22 in Table D2.
[00118] NAB l from a number of different species have been sequenced, and are known in the art to be at least partially functionally interchangeable. It would thus be a routine matter to identify and select a variant being a NAB l from a species or genus other than Chlamydomonas. Several such variants of NAB l (i.e., representative NAB l proteins from other species) are shown in Table D2 (see SEQ. ID. NOs. 22-33).
Table D2
Exemplary redox sensitive modulators
Organism / Gene Sequence SEQ. ED. NO. Bank Accession
No.
Chlamydomonas mgeqlrqqgt vkwfnatkgf gfitpgggge dlfvhqtnin SEQ. ED. reinhardtii segfrslreg evvefeveag pdgrskavnv tgpggaapeg N0.22
aprnfrgggr. grgrargarg gyaaaygypq mapvypgyyf
fpadptgrgr grggrggamp amqgvmpgva ypgmpmggvg
meptgepsgl qvvvhnlpws cqwqqlkdhf kewrveradv
XP 001696518.1 vydawgrsrg fgtvrfttke daatacdkln nsqidgrtis
vrldrfa
Chlamydomonas mgeqlrqqgt vkwfnatkgf gfitpgggge dlfvhqtnin SEQ. ED. incerta segfrslreg eavefeveag pdgrskavnv tgpagaapeg
aprnfrgggr grgrargarg gyaaaygypq mapvypgyyf
ABA01 136.1 fpadptgrgr grggrggamp gmqgvmpgva ypgmpmggvg NO.23
meatgdpsgl qvvvhnlpws cqwqqlkdhf kewrveradv
vydawgrsrg fgtvrfttke daamac
Volvox carteri f. mgeqlrqrgt vkwfnatkgf gfitpeggge dff hqtnin SEQ. ED. nagariensis sdgfrslreg eavefeveag pdgrskavsv sgpggsapeg
XP 002946304 aprnfrgggr grgrargarg ayaaygypqm ppmypgyyff
padptgrgrg rgrggmpiqg miqgmpypgi pipggleptg NO.24 epsglqv vh nlpwscqwqq Ikdhfkewrv eradvvydaw
grsrgfgtvr fatkedaaqa cekmnnsqid grtisvrldr
fe
Physcomitrella patens aketgkvkwf nsskgfgfit pdkggedlf hqtsihaegf SEQ. ED. subsp. patens rslregevve fqvessedgr tkalavtgpg gafvqgasyr
XP 001768496.1 rdgyggpgrg agegggrgtv ggagrgrgrg grgvggfvge
rsgaaggert cyncgegghi arecqnestg narqgggggg NO.25 gnrscytcge aghlardc
Zea mays maaaarqrgt vkwfndtkgf gfispedgse dlfvhqssik SEQ. ED. ACN30814.1 segfrslaeg eevefsvseg ddgrtkavdv tgpdgssasg
srllhdgawr pfciftstrq peqhrgsgsd rhdggdynhp
kpqaiaagah sllltracls skspppslav gllsvlaqrt NO.26 gptpgttgsa aslsgsspis lgfnptsflp fIqtarwlpc
sdlatssssa pssppr slap sappkkalig astgstgiat
ssgagaamsr snwlsrwvss csddaktafa avtvpllygs
slaepksips ksmyptfdvg
drilaekvsy ifrdpeisdi vifrappglq vygyssgdvf
ikrvvakggd yvevrdgklf vngvvqdedf vlephnyeme
pvlvpegyvf vlgdnrnnsf dshnwgplpv rnivgrsilr
ywppskindt iyepdvsrlt vpss
Oryza sativa Japonica maservkgtv kwfdatkgfg fitpddgged Ifvhqsslks SEQ. ED. Group dgyrslndgd vvefsvgsgn dgrtkavdvt apgggaltgg
srpsgggdrg ygggggggry ggdrgygggg ggygggdrgy
NP_001060914.1 gggggygggg gggsracykc geeghmardc sqgggggggy NO.27
ggggggyrgg ggggggggcy ncgetghiar ecpskty
Chlorella variabilis maaakatgtv kwgygfitpd sggedlfvhq taivsegfrs SEQ. ED. EFN56051.1 lregepveff vetsddgrqk avnvtgpnga apegaprrqf
ddgygagggg gsygggfggg ggggrrgggr ggggyggggy
gggydqggyg gqppiacnm NO.28
Selaginella maspadakrt gkvkwfnvtk gfgfitpddg seelfvhqsa SEQ. ID. moellendorffii ifaegfr sir egeivefsve qgedqrmraa dvtgpdgshv
XP 002981881 qgapssfgsr gggggggrgg rgragggdnp ivcyncneag
hvsrdckyqq eggggggggg ggrgppsgrr gggagggsgg NO.29 ggrgcftcga qghisrdcps ny
Vitis vinifera maqerstgvv rwfsdqkgfg fitpnegged If hqssiks SEQ. ID. CBI 17369.3 dgfrslgege tvefqivlge dgrtkavdvt gpdgssvqgs
krdnyggggg ggiaseeima aaaavvveea eae vipava
vavvitvvim gtwlgialwk aaalvgswa eveaveglva NO.30 vavdattvdr kgillenalt lt rdegkrg vivyilf fpa
sskiffpv
Triticum aestivum mgervkgtvk fnvtkgfgf ispddggedl f hqsaiksd SEQ. ID. BAD08701.1 gyrslnenda vefeiitgdd grtkasdvta pgggalsggs
rpgegggdrg grggyggggg gyggggggyg gggggygggg
ggyggggygg gggggrgcyk cgedghisrd cpqggggggg NO.31 yggggygggg gggrecykcg eeghisrdcp qggggggygg
gggrgggggg ggcfscgesg hfsrecpnka h
Cryptosporidium ekpiklvkmp lsgvckwfds tkgfgfitpd dgsedifvhq SEQ. ID. parvum Iowa II qnikvegfrs laqderveye ietddkgrrk avnvsgpnga
XP_627137 pvkgdrrrgr grgrgrgmrg rgrggrgrgf yqnqnqsqpq
sqqqpvstqs qpvah N0.32
Arabidopsis thaliana mamedqsaar sigkvswfsd gkgygfitpd dggeelfvhq SEQ. ID. NP_565427.1 ssivsdgfr s Itlgesveye ialgsdgktk aievtapggg
slnkkenssr gsggncfncg evghmakdcd ggsggksfgg
gggrrsggeg ecymcgdvgh fardcrqsgg gnsggggggg NO.33 rpcyscgevg hlakdcrggs ggnryggggg rgsggdgcym
cggvghfard crqngggnvg gggstcytcg gvghiakvct
skipsggggg gracyecggt ghlardcdrr gsgssggggg
snkcficgke ghfarectsv a
[00119] Thus all such homologues, orthologs, and naturally-occurring isoforms of NAB l from Chlamydomonas as well as other species (SEQ. ID. NOs. 22-33) are included in any of the methods and kits of the invention, as long as they retain detectable activity. It will be understood that for the recombinant production of NAB l in different species it will typically be necessary to codon optimize the nucleic acid sequence of the gene for the host
organism in question. Such codon optimization can be completed by standard analysis of the preferred codon usage for the host organism in question, and the synthesis of an optimized nucleic acid via standard DNA synthesis. A number of companies provide such services on a fee for services basis and include for example, DNA2.0, (CA, USA) and Operon Technologies. (CA, USA).
[00120] It is known in the art to synthetically modify the sequences of proteins or peptides, while retaining their useful activity, and this may be achieved using techniques which are standard in the art and widely described in the literature, e.g., random or site- directed mutagenesis, cleavage, and ligation of nucleic acids, or via the chemical synthesis or modification of amino acids or polypeptide chains. For instance, conservative amino acid mutations changes can be introduced into NAB land are considered within the scope of the invention.
[00121] The NAB 1 may thus include one or more amino acid deletions, additions, insertions, and / or substitutions based on any of the naturally-occurring isoforms of NAB 1. These may be contiguous or non-contiguous. Representative variants may include those having 1 to 8, or more preferably 1 to 4, 1 to 3, or 1 or 2 amino acid substitutions, insertions, and / or deletions as compared to any of sequences listed in Table D2.
[00122] NAB 1 polypeptides which may be used in any of the methods of the invention may have amino acid sequences which are substantially homologous, or substantially similar to any of the NAB 1 sequences listed in Table 1. Alternatively, the NAB 1 may have an amino acid sequence having at least 30% preferably at least 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, or 99% identity with a NAB l listed in Table D2. In one aspect, the NAB 1 is substantially homologous, or substantially similar to SEQ. ID. NO. 22.
[00123] Fragments of native or synthetic NAB l sequences may also have the desirable functional properties of the peptide from which they were derived and may be used in any of the methods of the invention. The term "fragment" as used herein thus includes fragments of NAB l provided that the fragment retains the biological activity of the whole molecule. The fragment may also include an N-terminal or C-terminal fragment of NAB l . Preferred fragments comprise residues 1 -80 of native NAB l , comprising the cold shock domain, or residues 160 to 247 comprising the RNA recognition motif. Also included are fragments having N- and / or C-terminal extensions or flanking sequences. The length of such extended peptides may vary, but typically are not more than 50, 30, 25, or 20 amino acids in length.
[00124] Fusion proteins of NAB l , and fragments of NAB l to other proteins are also included, and these fusion proteins may enhance NAB l ' s biological activity, targeting,
binding or redox sensitivity. It will be appreciated that a flexible molecular linker (or spacer) optionally may be interposed between, and covalently join, the NAE 1 and any of the fusion proteins disclosed herein. Any such fusion protein many be used in any of the methods of the present invention.
[00125] Variants may include, e.g., different allelic variants as they appear in nature, e.g., in other species or due to geographical variation. All such variants, derivatives, fusion proteins, or fragments of NAB 1 are included, may be used in any of the methods claims disclosed herein, and are subsumed under the term "NAB 1".
[00126] The variants, derivatives, and fragments are functionally equivalent in that they have detectable redox dependent RNA binding activity. More particularly, they exhibit at least 40%, preferably at least 60%, more preferably at least 80% of the activity of wild type NAB 1 , particularly Chlamydomonas NAB 1. Thus they are capable of functioning as NAB 1, i.e., can substitute for NAB 1 itself..
[00127] Such activity means any activity exhibited by a native NAB 1 , whether a physiological response exhibited in an in vivo or in vitro test system, or any biological activity or reaction mediated by a native NAB 1 e.g., in an enzyme assay or in binding to test tissues, nucleic acids, or metal ions.
[00128] Thus, it is known that NAB 1 binds to cold shock domain consensus sequence motifs, for example as listed in Table D3. An assay for NAB l activity can thus be made by assaying for redox dependent binding to a nucleic acid comprising a cold shock domain consensus sequence motif. Such an assay is described in Wobbe et al., (2009) Proc. Natl. Acad. Sci. USA 106 (32) 13290-13295.
Table D3
Exemplary cold stock domain consensus sequence motifs (CSDDCS)
Source NAB 1 binding site Sequence identity to SEQ. ID. NO.
sequences Xenopus consensus
LHCB 1 GCTGGGACACCGC 69% SEQ. ID. NO.39
LHCBM2 GCGACACCCCCGC 85% SEQ. ID. NO. 40
LHCBM3 GCTGGACCACCGT 77% SEQ. ED. NO. 41
LHCBM4 GCCTGACCCCCGA 77% SEQ. ID. NO. 42
LHCBM5 GCATCACCCCCGA 69% SEQ. ID. NO. 43
LHCBM6 GCCAGACCCCCGA 85% SEQ. ID. NO. 44
LHCBM8 GCGACACCCCCGC 85% SEQ. ID. NO. 45
LHCBM9 TCCATACCACCGT 85% SEQ. ID. NO. 46
CSDCS GCCANACCACCGC 100% SEQ. ID. NO.47 consensus Where N can be
any nucleotide
In one aspect of any of these methods and transgenic organisms, the NAB l is endogenous to the organism. In another aspect of any of these methods and transgenic organisms, the NAB l is heterologous to the transgenic organism.
IV. PHOTOSYNTHETIC ORGANISMS
[00129] The present invention can be practiced with any photosynthetic organism, i.e. plant or algae with a light harvesting antenna. The algae used with the invention can include any naturally occurring plant or algal species or any genetically engineered plant or algae.
[00130] The plant or algae used with the invention include any commercially available strain, any strain native to a particular region, or any proprietary strain. Additionally, the plant or algae can be of any Division, Class, Order, Family, Genus, or Species, or any subsection thereof. In one aspect algae which possess chloroplasts are preferred.
[00131] In certain embodiments, the algae used with the methods of the invention are members of one of the following divisions: Chlorophyta, Cyanophyta (Cyanobacteria), and Heterokontophyta. In certain embodiments, the algae used with the methods of the invention are members of one of the following classes: Chlorophyceae, Bacillariophyceae, Eustigmatophyceae, and Chrysophyceae. In certain embodiments, the algae used with the methods of the invention are members of one of the following genera: Chlamydomonas, Nannochloropsis, Chlorella, Dunaliella, Scenedesmus, Selenastrum, Oscillatoria, Phormidium, Spirulina, Amphora, and Ochromonas. In one aspect algae of the genus Chlamydomonas is preferred.
[00132] Non-limiting examples of algae species that can be used with the methods of the present invention include for example, Achnanthes orientalis, Agmenellum spp., Amphiprora hyaline, Amphora coffeiformis, Amphora coffeiformis var. linea, Amphora coffeiformis var. punctata, Amphora coffeiformis var. taylori, Amphora coffeiformis var. tenuis, Amphora delicatissima. Amphora delicatissima var. capitata, Amphora sp., Anabaena, Ankistrodesmus, Ankistrodesmus falcatus, Boekelovia hooglandii, Borodinella sp., Botryococcus braunii, Botryococcus sudeticus, Bracteococcus minor, Bracteococcus medionucleatus, Carteria, Chaetoceros gracilis, Chaetoceros muelleri, Chaetoceros muelleri var. subsalsum, Chaetoceros sp., Chlamydomas perigranulata, Chlore lla anitrata, Chlorella antarctica, Chlorella aureoviridis, Chlorella Candida, Chlorella capsulate, Chlorella desiccate, Chlorella ellipsoidea, Chlorella emersonii, Chlorella fusca, Chlorella fusca var. vacuolata, Chlorella glucotropha, Chlorella infusionum, Chlorella infusionum var. actophila, Chlorella infusionum var. auxenophila, Chlorella kessleri, Chlorella lobophora, Chlorella luteoviridis, Chlorella luteoviridis var. aureoviridis, Chlorella luteoviridis var. lutescens, Chlorella miniata, Chlorella minutissima, Chlorella mutabilis, Chlorella nocturna, Chlorella ovalis, Chlorella parva, Chlorella photophila, Chlorella pringsheimii, Chlorella
protothecoides, Chlorella protothecoides var. acidicola, Chlorella regularis, Chlorella regularis var. minima, Chlorella regularis var. umbricata, Chlorella reisiglii, Chlorella saccharophila, Chlorella saccharophila var. ellipsoidea, Chlorella salina, Chlorella simplex, Chlorella sorokiniana, Chlorella sp., Chlorella sphaerica, Chlorella stigmatophora, Chlorella vanniellii, Chlorella vulgaris, Chlorella vulgaris fo. tenia, Chlorella vulgaris var. autotrophica, Chlorella vulgaris var. viridis, Chlorella vulgaris var. vulgaris, Chlorella vulgaris var. vulgaris fo. tenia, Chlorella vulgaris var. vulgaris fo. viridis, Chlorella xanthella, Chlorella zofingiensis, Chlorella trebouxioides, Chlorella vulgaris, Chlorococcum infusionum, Chlorococcum sp., Chlorogonium, Chroomonas sp., Chrysosphaera sp., Cricosphaera sp., Crypthecodinium cohnii, Cryptomonas sp., Cyclotella cryptica, Cyclotella meneghiniana, Cyclotella sp., Chlamydomonas moewusii Chlamydomonas reinhardtii Chlamydomonas sp. Dunaliella sp., Dunaliella bardawil, Dunaliella bioculata, Dunaliella granulate, Dunaliella maritime, Dunaliella minuta, Dunaliella parva, Dunaliella peircei, Dunaliella primolecta, Dunaliella salina, Dunaliella terricola, Dunaliella tertiolecta, Dunaliella viridis, Dunaliella tertiolecta, Eremosphaera viridis, Eremosphaera sp., Ellipsoidon sp., Euglena spp., Franceia sp., Fragilaria crotonensis, Fragilaria sp., Gleocapsa sp., Gloeothamnion sp., Haematococcus pluvialis, Hymenomonas sp., Isochrysis aff. galbana, Isochrysis galbana, Lepocinclis, Micractinium, Micractinium, Monoraphidium minutum, Monoraphidium sp., Nannochloris sp., Nannochloropsis salina, Nannochloropsis sp., Navicula acceptata, Navicula biskanterae, Navicula pseudotenelloides, Navicula pelliculosa, Navicula saprophila, Navicula sp., Nephrochloris sp., Nephroselmis sp., Nitschia communis, Nitzschia alexandrina, Nitzschia closterium, Nitzschia communis, Nitzschia dissipata, Nitzschia frustulum, Nitzschia hantzschiana, Nitzschia inconspicua, Nitzschia intermedia, Nitzschia microcephala, Nitzschia pusilla, Nitzschia pusilla elliptica, Nitzschia pusilla monoensis, Nitzschia quadrangular, Nitzschia sp., Ochromonas sp., Oocystis parva, Oocystis pusilla, Oocystis sp., Oscillatoria limnetica, Oscillatoria sp., Oscillatoria subbrevis, Parachlorella kessleri, Pascheria acidophila, Pavlova sp., Phaeodactylum tricomutum, Phagus, Phormidium, Platymonas sp., Pleurochrysis carterae, Pleurochrysis dentate, Pleurochrysis sp., Prototheca wickerhamii, Prototheca stagnora, Prototheca portoricensis, Prototheca moriformis, Prototheca zopfii, Pseudochlorella aquatica, Pyramimonas sp., Pyrobotrys, Rhodococcus opacus, Sarcinoid chrysophyte, Scenedesmus armatus, Schizochytrium, Spirogyra, Spirulina platensis, Stichococcus sp., Synechococcus sp., Synechocystisf, Tagetes erecta, Tagetes patula, Tetraedron, Tetraselmis sp., Tetraselmis suecica, Thalassiosira weissflogii, and Viridiella fridericiana.
[00133] In one aspect of any of the claimed methods, algae of the following species are preferred, Chlamydomas perigranulata, Chlamydomonas moew sii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliqu s, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
V. EXPRESSION VECTORS
[00134] In any of these embodiments, an expression vector can be used to deliver a nucleic acid molecule comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO.
[00135] In one aspect the expression vector will further comprise a promoter that is operatively coupled to the CSDDCS motif and drives expression of the CAO coding region. Typically the CSDDCS motif is inserted between the promoter and the start of the CAO start codon.
[00136] In one aspect, the expression vector comprises a CSDDCS motif is substantially identical to a sequence selected from the group consisting of SEQ ID. No. 39, SEQ ID. No. 40, SEQ ID. No. 41, SEQ ID. No. 42, SEQ ID. No. 43, SEQ ED. No. 44, SEQ ID. No. 45, SEQ ID. No. 46, and SEQ ID. No. 47.
[00137] In different embodiments the CAO gene may be an endogenous gene from the photosynthetic organism to be used with the expression vector. Accordingly in different aspects the CAO gene may be any plant, or algal CAO gene. In one aspect, the CAO gene is substantially identical to a sequence selected from the group consisting of SEQ ID. No. 34, SEQ ID. No. 35, SEQ ID. No. 36, SEQ ID. No. 37, and SEQ ID. No. 38.
[00138] In any of these embodiments, a vector can also used to deliver a nucleic acid molecule encoding a silencing RNA into a plant cell to enable the suppression of the expression of the endogenous CAO in the cell.
[00139] The expression vectors can be, for example, DNA plasmids or viral vectors. Various expression vectors are known in the art. The selection of the appropriate expression vector can be made on the basis of several factors including, but not limited to the cell type wherein expression is desired. For example, Agrobacterium-based expression vectors can be used to express the nucleic acids of the presently disclosed subject matter when stable expression of the vector insert is sought in a plant cell. Suitable algal expression vectors include for example, the PSL18 plasmid, and derivatives thereof (Depege, N., Bellafiore, S and Rochaix, J.-D., 2003, Science 299: 1572 - 1575).
[00140] In other embodiments of the invention, it is contemplated that one may wish to employ replication-competent viral vectors for plant transformation. Such vectors include, for example, wheat dwarf virus (WDV) "shuttle" vectors, such as pWl-1 1 and pWl-GUS (Ugaki et al, 1991). These vectors are capable of autonomous replication in maize cells as well as E. coli, and as such may provide increased sensitivity for detecting DNA delivered to transgenic cells. A replicating vector also may be useful for delivery of genes flanked by DNA sequences from transposable elements such as Ac Ds, or Mu. It has been proposed that transposition of these elements within the maize genome requires DNA replication (Laufs et al, 1990). It also is contemplated that transposable elements would be useful for producing transgenic plants lacking elements necessary for selection and maintenance of the plasmid vector in bacteria, e.g., antibiotic resistance genes, or other selectable markers, and origins of DNA replication. It also is proposed that use of a transposable element such as Ac, Ds, or Mu would actively promote integration of the desired DNA and hence increase the frequency of stably transformed cells.
[00141] Promoters The expression of the nucleotide sequence in the expression cassette can be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. Basal promoters in plants typically comprise canonical regions associated with the initiation of transcription, such as CAAT and TATA boxes. The TATA box element is usually located approximately 20 to 35 nucleotides upstream of the initiation site of transcription. The CAAT box element is usually located approximately 40 to 200 nucleotides upstream of the start site of transcription. The location of these basal promoter elements result in the synthesis of an RNA transcript comprising nucleotides upstream of the translational ATG start site. The region of RNA upstream of the ATG is commonly referred to as a 5' untranslated region or 5' UTR. It is possible to use standard molecular biology techniques to make combinations of basal promoters, that is regions comprising sequences from the CAAT box to the translational start site, with other upstream promoter elements to enhance or otherwise alter promoter activity or specificity.
[00142] The promoters may be altered to contain "enhancer DNA" to assist in elevating gene expression. As is known in the art certain DNA elements can be used to enhance the transcription of DNA. These enhancers often are found 5' to the start of transcription in a promoter that functions in eukaryotic cells, but can often be inserted upstream (5') or downstream (3') to the coding sequence. In some instances, these 5' enhancer DNA elements are introns. Among the introns that are particularly useful as enhancer DNA
are the 5' introns from the rice actin 1 gene (see U.S. Pat. No. 5,641,876), the rice actin 2 gene, the maize alcohol dehydrogenase gene, the maize heat shock protein 70 gene (U.S. Pat. No. 5,593,874), the maize shrunken 1 gene, the light sensitive 1 gene of Solanum tuberosum, and the heat shock protein 70 gene of Petunia hybrida (U.S. Pat. No. 5,659,122).
[00143] For in vivo expression in plants, exemplary constitutive promoters include those derived from the CaMV 35S, rice actin, and maize ubiquitin genes, each described herein below. Exemplary promoters for microalgae production include the actin promoter, psaD promoter (US2002/0104119; Fischer and Rochaix (2001) Mol. Gen. Genet. 265, 888- 894), B-tubulin, CAB, and rbcs promoters.
[00144] Exemplary inducible promoters for this purpose include the chemically inducible PR- la promoter and a wound- inducible promoter, also described herein below.
[00145] Selected promoters can direct expression in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example). Exemplary tissue specific promoters include well- characterized root-, pith-, and leaf-specific promoters, each described herein below.
[00146] Depending upon the host cell system utilized, any one of a number of suitable promoters can be used. Promoter selection can be based on expression profile and expression level. The following are representative non-limiting examples of promoters that can be used in the expression cassettes.
[00147] 35S Promoter. The CaMV 35S promoter can be used to drive constitutive gene expression. Construction of the plasmid pCGN1761 is described in the published patent application EP 0 392 225, which a CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC- type backbone.
[00148] Actin Promoter. Several isoforms of actin are known to be expressed in most cell types and consequently the actin promoter is a good choice for a constitutive promoter. In particular, the promoter from the rice Act/ gene has been cloned and characterized (McElroy et a ., 1990). A 1.3 kb fragment of the promoter was found to contain inter ali the regulatory elements required for expression in rice protoplasts. Furthermore, numerous expression vectors based on the Act/ promoter have been constructed specifically for use in monocotyledons (McElroy et a/., 1991). These incorporate the Act/-intron 1 , Adbl 5' flanking sequence and Adbl-intron 1 (from the maize alcohol dehydrogenase gene) and sequence from the CaMV 35S promoter. Vectors showing highest expression were fusions of 35S and Act/
intron or the Act/ 5' flanking sequence and the AcV intron. Optimization of sequences around the initiating ATG (of the GUS reporter gene) also enhanced expression.
[00149] Ubiquitin Promoter. Ubiquitin is another gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g. sunflower—Binet et al., 1991 and maize-Christensen et a/., 1989). The maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926 which is herein incorporated by reference. Taylor et al., 1993 describe a vector (pAHC25) that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment. The ubiquitin promoter is suitable for gene expression in transgenic plants, especially monocotyledons. Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
[00150] Inducible Expression Chemically Inducible PR- la Promoter. The double 35S promoter in pCGN1761E X can be replaced with any other promoter of choice that will result in suitably high expression levels. By way of example, one of the chemically regulatable promoters described in U.S. Patent No. 5,614,395 can replace the double 35S promoter. The promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate terminal restriction sites.
[00151] The selected target gene coding sequence can be inserted into this vector, and the fusion products (i.e., promoter-gene-terminator) can subsequently be transferred to any selected transformation vector, including those described below. Various chemical regulators can be employed to induce expression of the selected coding sequence in the plants transformed according to the presently disclosed subject matter, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,31 1 and 5,614,395, herein incorporated by reference.
[00152] Transcriptional Terminators A variety of transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation.
[00153] Appropriate transcriptional terminators are those that are known to function in the relevant microalgae or plant system. Representative plant transcriptional terminators include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, and
the pea rbcS E9 terminator. With regard to RNA polymerase ΠΙ terminators, these terminators typically comprise a - 52 run of 5 or more consecutive thymidine residues. In one embodiment, an RNA polymerase ΙΠ terminator comprises the sequence TTTTTTT. These can be used in both monocotyledons and dicotyledons.
[00154] For algal use, endogenous 5' and 3' elements from the genes listed above, i.e. appropriate 5' and 3' flanking sequences from the, psbA, psbD, rbcl, actin, psaD, B-tubulin, CAB, rbcs and psal genes may be used.
[00155] Sequences for the Enhancement or Regulation of Expression Numerous sequences have been found to enhance the expression of an operatively lined nucleic acid sequence, and these sequences can be used in conjunction with the nucleic acids of the presently disclosed subject matter to increase their expression in transgenic plants.
[00156] Various intron sequences have been shown to enhance expression, particularly in monocotyledonous cells. For example, the introns of the maize Adbl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells. Intron 1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et a/., 1987). In the same experimental system, the intron from the maize bronzes gene had a similar effect in enhancing expression. Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
[00157] A number of non-translated leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells. Specifically, leader sequences from Tobacco Mosaic Virus (TMV, the "W-sequence"), Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMY) have been shown to be effective in enhancing expression (e.g. Gallie et a/., 1987; Skuzeski et a/., 1990).
[00158] Agrobacterium Transformation Vectors Many vectors are available for transformation using Agrobacterium tumefaciens and may be used for plant transformation. These typically carry at least one T-DNA border sequence and include vectors such as ρΒΓΝ19 (Bevan, 1984) and related vectors.
[00159] Other Plant Transformation Vectors: Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T- DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation),
vortexing with glass beads, and microinjection. The choice of vector can depend on the technique chosen for the species being transformed. In particular particle bombardment methods and the use of glass beads are preferred for microalgae.
[00160] Selectable Markers: For certain target species, different antibiotic or herbicide selection markers can be preferred. Selection markers used routinely in transformation include the nptn gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982; Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et a/., 1990; Spencer et a/., 1990), the hph gene, which confers resistance to the antibiotic hygromycin (Blochlinger & Diggelmann, 1984), the dhfr gene, which confers resistance to methotrexate (Bourouis & Jarry, 1983), and the EPSP synthase gene, which confers resistance to glyphosate (U.S. Patent Nos. 4, 940,935 and 5,188,642).
Screenable Markers
[00161] Screenable markers that may be employed include a β-glucuronidase or uidA gene (Jefferson et al, 1986; the protein product is commonly referred to as GUS), isolated from E. coli, which encodes an enzyme for which various chromogenic substrates are known; an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al, 1988); a β-lactamase gene (Sutcliffe, 1978), which encodes an enzyme for which various chromogenic substrates are known {e.g., PAD AC, a chromogenic cephalosporin); a xylE gene (Zukowsky et al, 1983) which encodes a catechol dioxygenase that can convert chromogenic catechols; an a-amylase gene (Ikuta et al, 1990); a tyrosinase gene (Katz et al , 1983) which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in rum condenses to form the easily- detectable compound melanin; a β-galactosidase gene, which encodes an enzyme for which there are chromogenic substrates; a luciferase (lux) gene (Ow et al, 1 86), which allows for bioluminescence detection; an aequorin gene (Prasher et al , 1985) which may be employed in calcium-sensitive bioluminescence detection; or a gene encoding for green fluorescent protein (Sheen et al, 1995; Haseloff et al, 1997; Reichel et al, 1996; Tian et al, 1997; PCT Publication WO 97/41228).
[00162] The R gene complex in maize encodes a protein that acts to regulate the production of anthocyanin pigments in most seed and plant tissue. Maize strains can have one, or as many as four, R alleles which combine to regulate pigmentation in a developmental
and tissue specific manner. Thus, an R gene introduced into such cells will cause the expression of a red pigment and, if stably incorporated, can be visually scored as a red sector. If a maize line carries dominant alleles for genes encoding for the enzymatic intermediates in the anthocyanin biosynthetic pathway (C2, Al , A2, Bzl and Bz2), but carries a recessive allele at the R locus, transformation of any cell from that line with R will result in red pigment formation. Exemplary lines include Wisconsin 22 which contains the rg-Stadler allele and TR1 12, a K55 derivative which has the genotype r-g, b, PI. Alternatively, any genotype of maize can be utilized if the CI and R alleles are introduced together.
[00163] It further is proposed that R gene regulatory regions may be employed in chimeric constructs in order to provide mechanisms for controlhng the expression of chimeric genes. More diversity of phenotypic expression is known at the R locus than at any other locus (Coe et al., 1988). It is contemplated that regulatory regions obtained from regions 5' to the structural R gene would be valuable in directing the expression of genes for, e.g., insect resistance, herbicide tolerance or other protein coding regions. For the purposes of the present invention, it is believed that any of the various R gene family members may be successfully employed (e.g., P, S, Lc, etc). However, the most preferred will generally be Sn (particularly Sn:bol3). Sn is a dominant member of the R gene complex and is functionally similar to the R and B loci in that Sn controls the tissue specific deposition of anthocyanin pigments in certain seedling and plant cells, therefore, it's phenotype is similar to R.
[00164] Other screenable markers provide for visible light emission as a screenable phenotype. A screenable marker contemplated for use in the present invention is firefly luciferase, encoded by the lux gene. The presence of the lux gene in transformed cells may be detected using, for example, X-ray film, scintillation counting, fluorescent spectrophotometry, low-light video cameras, photon counting cameras or multiwell luminometry. It also is envisioned that this system may be developed for populational screening for bioluminescence, such as on tissue culture plates, or even for whole plant screening. The gene which encodes green fluorescent protein (GFP) is contemplated as a particularly useful reporter gene (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al. , 1996; Tian et al., 1997; PCT Publication WO 97/41228). Expression of green fluorescent protein may be visualized in a cell or plant as fluorescence following illumination by particular wavelengths of light. Where use of a screenable marker gene such as lux or GFP is desired, the inventors contemplated that benefit may be realized by creating a gene fusion between the screenable marker gene and a selectable marker gene, for example, a GFP-NPTII gene fusion (PCT Publication WO 99/60129). This could allow, for example, selection of
transformed cells followed by screening of transgenic plants or seeds. In a similar manner, it is possible to utilize other readily available fluorescent proteins such as red fluorescent protein (CLONTECH, Palo Alto, CA).
VI. METHODS OF TRANSFORMATION
[00165] Suitable methods for plant transformation for use- with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts (Omirulleh et ai, 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus et ai , 1985), by electroporation (U.S. Patent No. 5,384,253, specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler et ai, 1990; U.S. Patent No. 5,302,523, and U.S. Patent No. 5,464,765, each specifically incorporated herein by reference in their entirety), by Agrobacterium-m&diaXed transformation (U.S. Patent No. 5,591 ,616 and U.S. Patent No. 5,563,055; each specifically incorporated herein by reference) and by acceleration of DNA coated particles (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,877; and U.S. Patent No. 5,538,880; each specifically incorporated herein by reference in their entirety), etc. Through the application of techniques such as these, maize cells as well as those of virtually any other plant species may be stably transformed, and these cells developed into transgenic plants. In certain embodiments, acceleration methods are preferred and include, for example, microprojectile bombardment and the like.
Electroporation
[00166] Where one wishes to introduce DNA by means of electroporation, it is contemplated that the method of Krzyzek et al. (U.S. Patent No. 5,384,253, incorporated herein by reference in its entirety) will be particularly advantageous. In this method, certain cell wall-degrading enzymes, such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells. Alternatively, recipient cells are made more susceptible to transformation by mechanical wounding.
[00167] To effect transformation by electroporation, one may employ either friable tissues, such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly. In this technique, one would partially degrade the cell walls of the chosen cells by exposing them to pectin-degrading enzymes (pectolyases) or mechanically wounding in a controlled manner. Examples of some
species which have been transformed by electroporation of intact cells include maize (U.S. Patent No. 5,384,253; D'Halluin et al., 1992), wheat (Zhou et al., 1993), and soybean (Christou et al, 1987).
[00168] One also may employ protoplasts for electroporation transformation of plants (Bates, 1994; Lazzeri, 1995). For example, the generation of transgenic soybean plants by electroporation of cotyledon-derived protoplasts is described by Dhir and Widholm in PCT Publication WO 92/17598 (specifically incorporated herein by reference). Other examples of species for which protoplast transformation has been described include barley (Lazerri, 1995), sorghum (Battraw and Hall, 1991), maize (Bhattacharjee et al, 1997), wheat (He et al., 1994) and tomato (Tsukada, 1989).
Microprojectile Bombardment
[00169] One method for delivering transforming DNA segments to plant cells in accordance with the invention is microprojectile bombardment (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; and PCT Publication WO 95/06128; each of which is specifically incorporated herein by reference in its entirety). In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. Hence, it is proposed that DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
[00170] For the bombardment, cells in suspension are concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
[00171] An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is the Biolistics Particle Delivery System (BioRad, Hercules, CA), which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with monocot plant cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher
frequency of transformation by reducing the damage inflicted on the recipient cells by projectiles that are too large.
[00172] Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species. Examples of species for which have been transformed by microprojectile bombardment include monocot species such as maize (PCT Publication WO 95/06128), barley (Ritala et al, 1994; Hensgens et al., 1993), wheat (U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety), rice (Hensgens et al , 1993), oat (Torbet et al, 1995; Torbet et al., 1998), rye (Hensgens et al.,
1993) , sugarcane (Bower et al. , 1992), and sorghum (Casa et al., 1993; Hagio et al., 1991); as well as a number of dicots including tobacco (Tomes et al., 1990; Buising and Benbow,
1994) , soybean (U.S. Patent No. 5,322,783, specifically incorporated herein by reference in its entirety), sunflower (Knittel et al. 1994), peanut (Singsit et al., 1997), cotton (McCabe and Martinell, 1993), tomato (Van Eck et al. 1995), and legumes in general (U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety).
Agrobacterium -mediated Transformation
[00173] Agrobacterium-med ated transfer is a preferred system that is widely applicable for introducing genes into plant. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described by Fraley et al. (1985), Rogers et al. ( 1987) and U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety.
[00174] Agrobacterium-mediated transformation is most efficient in dicotyledonous plants and is the preferable method for transformation of dicots, including Arabidopsis, tobacco, tomato, and potato. Indeed, while Agrobacterium-mediated transformation has been routinely used with dicotyledonous plants for a number of years, it has only recently become applicable to monocotyledonous plants. Advances in Agrobacterium-mediated transformation techniques have now made the technique applicable to nearly all monocotyledonous plants. For example, Agrobacterium- ediated transformation techniques have now been applied to rice (Hiei et al., 1997; Zhang et al, 1997; U.S. Patent No. 5,591 ,616, specifically incorporated herein by reference in its entirety), wheat (McCormac et al, 1998), barley (Tingay et al., 1997; McCormac et al., 1998), and maize (Ishida et al., 1996; U.S. Patent No. 5,981,840).
[00175] Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et
al., 1985). Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate the construction of vectors capable of expressing various polypeptide encoding genes. The vectors described (Rogers et al., 1987) have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide encoding genes and are suitable for present purposes. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations. In those plant strains where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.
[00176] A number of wild-type and disarmed strains of Agrobacterium tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri plasmids can be used for gene transfer into plants. Preferably, the Agrobacterium hosts contain disarmed Ti and Ri plasmids that do not contain the oncogenes which cause tumorigenesis or rhizogenesis, respectively, which are used as the vectors and contain the genes of interest that are subsequently introduced into plants. Preferred strains would include but are not limited to Agrobacterium tumefaciens strain C58, a nopaline-type strain that is used to mediate the transfer of DNA into a plant cell, octopine-type strains such as LBA4404 or succinamopine-type strains e.g., EHA101 or EHA105. The use of these strains for plant transformation has been reported and the methods are familiar to those of skill in the art.
[00177] Those of skill in the art are aware of the typical steps in the plant transformation process. The Agrobacterium can be prepared either by inoculating a liquid such as Luria Burtani (LB) media directly from a glycerol stock or streaking the Agrobacterium onto a solidified media from a glycerol stock, allowing the bacteria to grow under the appropriate selective conditions, generally from about 26° C - 30° C, more preferably about 28° C, and taking a single colony from the plate and inoculating a liquid culture medium containing the selective agents. Alternatively a loopful or slurry of Agrobacterium can be taken from the plate and resuspended in liquid and used for inoculation. Those of skill in the art are familiar with procedures for growth and suitable culture conditions for Agrobacterium as well as subsequent inoculation procedures. The density of the Agrobacterium culture used for inoculation and the ratio of Agrobacterium cells to explant can vary from one system to the next, and therefore optimization of these parameters for any transformation method is expected.
[00178] Typically, an Agrobacterium culture is inoculated from a streaked plate or glycerol stock and is grown overnight, and the bacterial cells are washed and resuspended in
a culture medium suitable for inoculation of the explant. Suitable inoculation media for the present invention include, but are not limited ½ MSPL (2.2 g/L GIBCO (Carlsbad, CA) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 1 15 g/L L-proline, 26 g/L D-glucose, 68.5 g/L sucrose, pH 5.4) or ½ MS VI (2.2 g/L GIBCO (Carlsbad, CA) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 1 15 g/L L-proline, 10 g/L D-glucose, and 10 g/L sucrose, pH 5.4). The inoculation media may be supplemented with a growth inhibiting agent (PCT Publication WO 01/09302). The range and concentration of the growth inhibition agent can vary and depends of the agent and plant system. Growth inhibiting agents including, but not limited to, silver nitrate, silver thiosulfate, or carbenicillin are the preferred growth inhibition agents. The growth inhibiting agent is added in the amount necessary to achieve the desired effect. Silver nitrate is preferably used in the inoculation media at a concentration of about ΙμΜ (micromolar) to 1 mM (millimolar), more preferably 5 μΜ - 100 μΜ. The concentration of carbenicillin used in the inoculation media is about 5 mg/L to 100 mg/L, more preferably about 50 mg/L. A compound which induces Agrobacterium virulence genes such as acetosyringone can also be added to the inoculation medium.
[00179] In a preferred embodiment, the Agrobacterium used for inoculation are pre- induced in a medium such as a buffered media with appropriate salts containing acetosyringone, a carbohydrate, and selective antibiotics. In a preferred embodiment, the Agrobacterium cultures used for transformation are pre-induced by culturing at about 28°C in AB-glucose minimal medium (Chilton et al, 1974; Lichtenstein and Draper, 1986) supplemented with acetosyringone at about 200μΜ and glucose at about 2%. The concentration of selective antibiotics for Agrobacterium in the pre-induction medium is about half the concentration normally used in selection. The density of the Agrobacterium cells used is about 107 - 1010 cfu/ml of Agrobacterium. More preferably, the density of Agrobacterium cells used is about 5 X 10 8 - 4 x 10 9 cfu/me. Prior to inoculation the Agrobacterium can be washed in a suitable media such as ½ MS.
[00180] The next stage of the transformation process is the inoculation. In this stage the explants and Agrobacterium cell suspensions are mixed together. The mixture of Agrobacterium and explant(s) can also occur prior to or after a wounding step. By wounding as used herein is meant any method to disrupt the plant cells thereby allowing the Agrobacterium to interact with the plant cells. Those of skill in the art are aware of the numerous methods for wounding. These methods would include, but are not limited to,
particle bombardment of plant tissues, sonicating, vacuum infiltrating, shearing, piercing, poking, cutting, or tearing plant tissues with a scalpel, needle or other device. The duration and condition of the inoculation and Agrobacterium cell density will vary depending on the plant transformation system. The inoculation is generally performed at a temperature of about 15°C - 30°C, preferably 23°C - 28°C from less than one minute to about 3 hours. The inoculation can also be done using a vacuum infiltration system.
[00181] After inoculation, any excess Agrobacterium suspension can be removed and the Agrobacterium and target plant material are co-cultured. The co-culture refers to the time post-inoculation and prior to transfer to a delay or selection medium. Any number of plant tissue culture media can be used for the co-culture step. For the present invention, a reduced salt media such as half-strength MS-based co-culture media is used and the media lacks complex media additives including but not limited to undefined additives such as casein hydolysate, and B5 vitamins and organic additives. Plant tissues after inoculation with Agrobacterium can be cultured in a liquid media. More preferably, plant tissues after inoculation with Agrobacterium are cultured on a semi-solid culture medium solidified with a gelling agent such as agarose, more preferably a low EEO agarose. The co-culture duration is from about one hour to 72 hours, preferably less than 36 hours, more preferably about 6 hours to 35 hours. The co-culture media can contain one or more Agrobacterium growth inhibiting agent(s) or combination of growth inhibiting agents such as silver nitrate, silver thiosulfate, or carbenicillin. The concentration of silver nitrate or silver thiosulfate is preferably about 1 μΜ to 1 mM, more preferably about 5 μΜ to 100 μΜ, even more preferably about 10 μΜ to 50 μΜ, most preferably about 20 μΜ. The concentration of carbenicillin in the co-culture medium is preferably about 5 mg/L to 100 mg/L more preferably 10 mg L to 50 mg/L, even more preferably about 50 mg/L. The co-culture is typically performed for about one to three days more preferably for less than 24 hours at a temperature of about 18° C - 30° C, more preferably about 23° C - 25° C. The co-culture can be performed in the light or in light-limiting conditions. Preferably, the co-culture is performed in light-limiting conditions. By light-limiting conditions as used herein is meant any conditions which limit light during the co-culture period including but not limited to covering a culture dish containing the plant; 'Agrobacterium mixture with a cloth, foil , or placing the culture dishes in a black bag, or placing the cultured cells in a dark room. Lighting conditions can be optimized for each plant system as is known to those of skill in the art.
[00182] After co-culture with Agrobacterium, the explants can be placed directly onto selective media. The explants can be sub-cultured onto selective media in successive steps or stages. For example, the first selective media can contain a low amount of selective agent, and the next sub-culture can contain a higher concentration of selective agent or vice versa. The explants can also be placed directly on a Fixed concentration of selective agent. Alternatively, after co-culture with Agrobacterium, the explants can be placed on media without the selective agent. Those of skill in the art are aware of the numerous modifications in selective regimes, media, and growth conditions that can be varied depending on the plant system and the selective agent. In the preferred embodiment, after incubation on nonselective media containing the antibiotics to inhibit Agrobacterium growth without selective agents, the explants are cultured on selective growth media. Typical selective agents include but are not limited to antibiotics such as geneticin (G418), kanamycin, paromomycin, herbicides such as glyphosate or phosephinothericine, or other growth inhibitory compounds such as amino acid analogues, e.g., 5 methyltryptophan. Additional appropriate media components can be added to the selection or delay medium to inhibit Agrobacterium growth. Such media components can include, but are not limited to antibiotics such as carbenicillin or cefotaxime.
[00183] After the co-culture step, and preferably before the explants are placed on selective or delay media, cells can be analyzed for efficiency of DNA delivery by a transient assay that can be used to detect the presence of one or more gene(s) contained on the transformation vector, including, but not limited to a screenable marker gene such as the gene that codes for β-glucuronidase (GUS). The total number of blue spots (indicating GUS expression) for a selected number of explants is used as a positive correlation of DNA transfer efficiency. The efficiency of T-DNA delivery and the effect of various culture condition manipulations on T-DNA delivery can be tested in transient analyses as described. A reduction in the T-DNA transfer process can result in a decrease in copy number and complexity of integration as complex integration patterns can originate from co-integration of separate T-DNAs (DeNeve et al., 1997). The effect of culture conditions of the target tissue can be tested by transient analyses and more preferably, in stably transformed plants. Any number of methods are suitable for plant analyses, including but not limited to, histochemical assays, biological assays, and molecular analyses.
[00184] After effecting delivery of exogenous DNA to recipient cells, the next steps generally concern identifying the transformed cells for further culturing and plant
regeneration. As mentioned herein, in order to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene as, or in addition to, the expressible gene of interest. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait.
Other Transformation Methods
[00185] Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, e.g., Potrykus et al, 1985; Lorz et al, 1985; Omirulleh et al, 1993; Fromm et al, 1986; Uchimiya et al, 1986; Callis et al, 1987; Marcotte et al, 1988).
[00186] Application of these systems to different plant strains depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts have been described (Toriyama et al, 1986; Yamada et al, 1986; Abdullah et al, 1986; Omirulleh et al, 1993 and U.S. Patent No. 5,508, 184; each specifically incorporated herein by reference in its entirety). Examples of the use of direct uptake transformation of cereal protoplasts include transformation of rice (Ghosh- Biswas et al, 1994), sorghum (Battraw and Hall, 1991), barley (Lazerri, 1995), oat (Zheng and Edwards, 1990) and maize (Omirulleh et al, 1993).
[00187] To transform plant strains that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilized. For example, regeneration of cereals from immature embryos or explants can be effected as described (Vasil, 1989). Also, silicon carbide fiber-mediated transformation may be used with or without protoplasting (Kaeppler, 1990; aeppler et al, 1992; U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety). Transformation with this technique is accomplished by agitating silicon carbide fibers together with cells in a DNA solution. DNA passively enters as the cells are punctured. This technique has been used successfully with, for example, the monocot cereals maize (PCT Publication WO 95/06128, specifically incorporated herein by reference in its entirety).
VII. SELECTION
[00188] It is believed that DNA is introduced into only a small percentage of target cells in any one experiment. In order to provide an efficient system for identification of those
cells receiving DNA and integrating it into their genomes one may employ a means for selecting those cells that are stably transformed. One exemplary embodiment of such a method is to introduce into the host cell, a marker gene which confers resistance to some normally inhibitory agent, such as an antibiotic or herbicide. Examples of antibiotics which may be used include the aminoglycoside antibiotics neomycin, kanamycin, G418 and paromomycin, or the antibiotic hygromycin. Resistance to the aminoglycoside antibiotics is conferred by aminoglycoside phosphostransferase enzymes such as neomycin phosphotransferase Π (NPT II) or NPT I, whereas resistance to hygromycin is conferred by hygromycin phosphotransferase.
[00189] Potentially transformed cells then are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance-conferring gene has been integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA. Using the techniques disclosed herein, greater than 40% of bombarded embryos may yield transformants.
[00190] One example of a herbicide which is useful for selection of transformed cell lines in the practice of the invention is the broad spectrum herbicide glyphosate. Glyphosate inhibits the action of the enzyme EPSPS, which is active in the aromatic amino acid biosynthetic pathway. Inhibition of this enzyme leads to starvation for the amino acids phenylalanine, tyrosine, and tryptophan and secondary metabolites derived thereof. U.S. Patent No. 4,535,060 describes the isolation of EPSPS mutations which confer glyphosate resistance on the Salmonella typhimurium gene for EPSPS, aw A. The EPSPS gene was cloned from Zea mays and mutations similar to those found in a glyphosate resistant aroA gene were introduced in vitro. Mutant genes encoding glyphosate resistant EPSPS enzymes are described in, for example, PCT Publication WO 97/04103. The best characterized mutant EPSPS gene conferring glyphosate resistance comprises amino acid changes at residues 102 and 106, although it is anticipated that other mutations will also be useful (PCT Publication WO 97/04103). Furthermore, a naturally occurring glyphosate resistant EPSPS may be used, e.g., the CP4 gene isolated from Agrobacterium encodes a glyphosate resistant EPSPS (U.S. Patent No. 5,627,061).
[00191] To use the Z?ar-bialaphos or the EPSPS-glyphosate selective systems, tissue is cultured for 0 - 28 days on nonselective medium and subsequently transferred to medium containing from 1 -3 mg/1 bialaphos or 1 -3 mM glyphosate as appropriate. While ranges of 1 - 3 mg/1 bialaphos or 1-3 mM glyphosate will typically be preferred, it is believed that ranges of 0.1-50 mg 1 bialaphos or 0.1-50 mM glyphosate will find utility in the practice of the
invention. Bialaphos and glyphosate are provided as examples of agents suitable for selection of transformants, but the technique of this invention is not limited to them.
[00192] Another herbicide which constitutes a desirable selection agent is the broad spectrum herbicide bialaphos. Bialaphos is a tripeptide antibiotic produced by Streptomyces hygroscopicus and is composed of phosphinothricin (PPT), an analogue of L-glutamic acid, and two L-alanine residues. Upon removal of the L-alanine residues by intracellular peptidases, the PPT is released and is a potent inhibitor of glutamine synthetase (GS), a pivotal enzyme involved in ammonia assimilation and nitrogen metabolism (Ogawa et ai, 1973). Synthetic PPT, the active ingredient in the herbicide Liberty™ also is effective as a selection agent. Inhibition of GS in plants by PPT causes the rapid accumulation of ammonia and death of the plant cells.
[00193] The organism producing bialaphos and other species of the genus Streptomyces also synthesizes an enzyme phosphinothricin acetyl transferase (PAT) which is encoded by the bar gene in Streptomyces hygroscopicus and the pat gene in Streptomyces viridochromogenes. The use of the herbicide resistance gene encoding phosphinothricin acetyl transferase (PAT) is referred to in DE 3642 829 A, wherein the gene is isolated from Streptomyces viridochromogenes. In the bacterial source organism, this enzyme acetylates the free amino group of PPT preventing auto-toxicity (Thompson et ai, 1987). The bar gene has been cloned (Murakami et ai, 1986; Thompson et ai, 1987) and expressed in transgenic tobacco, tomato, potato (De Block et ai, 1987) Brassica (De Block et ai , 1989) and maize (U.S. Patent No. 5,550,318). In previous reports, some transgenic plants which expressed the resistance gene were completely resistant to commercial formulations of PPT and bialaphos in greenhouses.
[00194] It further is contemplated that the herbicide dalapon, 2,2-dichloropropionic acid, may be useful for identification of transformed cells. The enzyme 2,2- dichloropropionic acid dehalogenase (deh) inactivates the herbicidal activity of 2,2- dichloropropionic acid and therefore confers herbicidal resistance on cells or plants expressing a gene encoding the dehalogenase enzyme (Buchanan-Wollaston et ai, 1992; U.S. Patent No. 5,780,708).
[00195] Alternatively, a gene encoding anthranilate synthase, which confers resistance to certain amino acid analogs, e.g., 5-methyltryptophan or 6-methyl anthranilate, may be useful as a selectable marker gene. The use of an anthranilate synthase gene as a selectable marker was described in U.S. Patent No. 5,508,468 and US Patent No. 6, 1 18,047.
[00196] An example of a screenable marker trait is the red pigment produced under the control of the R-locus in maize. This pigment may be detected by culturing cells on a solid support containing nutrient media capable of supporting growth at this stage and selecting cells from colonies (visible aggregates of cells) that are pigmented. These cells may be cultured further, either in suspension or on solid media. In a similar fashion, the introduction of the CI and B genes will result in pigmented cells and/or tissues.
[00197] The enzyme luciferase may be used as a screenable marker in the context of the present invention. In the presence of the substrate luciferin, cells expressing luciferase emit light which can be detected on photographic or x-ray film, in a luminometer (or liquid scintillation counter), by devices that enhance night vision, or by a highly light sensitive video camera, such as a photon counting camera. All of these assays are nondestructive and transformed cells may be cultured further following identification. The photon counting camera is especially valuable as it allows one to identify specific cells or groups of cells that are expressing luciferase and manipulate cells expressing in real time. Another screenable marker which may be used in a similar fashion is the gene coding for green fluorescent protein (GFP) or a gene coding for other fluorescing proteins such as DsRed® (Clontech, Palo Alto, CA).
[00198] It further is contemplated that combinations of screenable and selectable markers will be useful for identification of transformed cells. In some cell or tissue types a selection agent, such as bialaphos or glyphosate, may either not provide enough killing activity to clearly recognize transformed cells or may cause substantial nonselective inhibition of transformants and nontransformants alike, thus causing the selection technique to not be effective. It is proposed that selection with a growth inhibiting compound, such as bialaphos or glyphosate at concentrations below those that cause 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as luciferase or GFP would allow one to recover transformants from cell or tissue types that are not amenable to selection alone. It is proposed that combinations of selection and screening may enable one to identify transformants in a wider variety of cell and tissue types. This may be efficiently achieved using a gene fusion between a selectable marker gene and a screenable marker gene, for example, between an ΝΡΤΠ gene and a GFP gene (WO 99/60129).
Vni. REGENRATION AND SEED PRODUCTION
[00199] Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of
plants. In an exemplary embodiment, MS and N6 (Chu et al., 1975) media may be modified by including further substances such as growth regulators. Preferred growth regulators for plant regeneration include cytokins such as 6-benzylamino pierine, zeahin or the like, and abscisic acid. Media improvement in these and like ways has been found to facilitate the growth of cells at specific developmental stages. Tissue may be maintained on a basic media with auxin type growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration, then transferred to media conducive to maturation of embryoids. Cultures are transferred every 1 -4 weeks, preferably every 2-3 weeks on this medium. Shoot development will signal the time to transfer to medium lacking growth regulators.
[00200] The transformed cells, identified by selection or screening and cultured in an appropriate medium that supports regeneration, will then be allowed to mature into plants. Developing plantlets were transferred to soiless plant growth mix, and hardened off, e.g. , in an environmentally controlled chamber at about 85% relative humidity, 600 ppm CO2, and 25-250 microeinsteins m"2 s"1 of light, prior to transfer to a greenhouse or growth chamber for maturation. Plants are preferably matured either in a growth chamber or greenhouse. Plants are regenerated from about 6 wk to 10 months after a transformant is identified, depending on the initial tissue. During regeneration, cells are grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Cons. Regenerating plants are preferably grown at about 19 to 28°C. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing. Plants may be pollinated using conventional plant breeding methods known to those of skill in the art and seed produced.
[00201] Progeny may be recovered from transformed plants and tested for expression of the exogenous expressible gene. Note however, that seeds on transformed plants may occasionally require embryo rescue due to cessation of seed development and premature senescence of plants. To rescue developing embryos, they are excised from surface- disinfected seeds 10-20 days post-pollination and cultured. An embodiment of media used for culture at this stage comprises MS salts, 2% sucrose, and 5.5 g/1 agarose. In embryo rescue, large embryos (defined as greater than 3 mm in length) are germinated directly on an appropriate media. Embryos smaller than that may be cultured for 1 wk on media containing
the above ingredients along with 10"5M abscisic acid and then transferred to growth regulator-free medium for germination.
Characterization
[00202] To confirm the presence of the exogenous DNA or "transgene(s)" in the regenerating plants, a variety of assays, known in the art may be performed. Such assays include, for example, "molecular biological" assays, such as Southern and Northern blotting and PCR; "biochemical" assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
DNA Integration, RNA Expression and Inheritance
[00203] Genomic DNA may be isolated from callus cell lines or any plant parts to determine the presence of the exogenous gene through the use of techniques well known to those skilled in the art. Note, that intact sequences will not always be present, presumably due to rearrangement or deletion of sequences in the cell.
[00204] The presence of DNA elements introduced through the methods of this invention may be determined by polymerase chain reaction (PCR). Using this technique discreet fragments of DNA are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a gene is present in a stable transformant, but does not necessarily prove integration of the introduced gene into the host cell genome. Typically, DNA has been integrated into the genome of all transformants that demonstrate the presence of the gene through PCR analysis. In addition, it is not possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the genome, i.e., whether transformants are of independent origin. Using PCR techniques it is possible to clone fragments of the host genomic DNA adjacent to an introduced gene.
[00205] Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition, it is possible through Southern hybridization to demonstrate the presence of introduced genes in high molecular weight DNA, i.e., confirm that the introduced gene has been integrated into
the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a gene, but also demonstrates integration into the genome and characterizes each individual transformant.
[00206] It is contemplated that using the techniques of dot or slot blot hybridization, which are modifications of Southern hybridization techniques, one could obtain the same information that is derived from PCR, e.g., the presence of a gene.
[00207] Both PCR and Southern hybridization techniques can be used to demonstrate transmission of a transgene to progeny. In most instances the characteristic Southern hybridization pattern for a given transformant will segregate in progeny as one or more Mendelian genes (Spencer et al., 1992) indicating stable inheritance of the transgene.
[00208] Whereas DNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA will only be expressed in particular cells or tissue types and hence it will be necessary to prepare RNA for analysis from these tissues. PCR techniques, referred to as RT-PCR, also may be used for detection and quantitation of RNA produced from introduced genes. In this application of PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances PC techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species also can be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and will only demonstrate the presence or absence of an RNA species.
[00209] It is further contemplated that TAQMAN® technology (Applied Biosystems, Foster City, CA) may be used to quantitate both DNA and RNA in a transgenic cell.
Gene Expression
[00210] While Southern blotting and PCR may be used to detect the gene(s) in question, they do not provide information as to whether the gene is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced genes or evaluating the phenotypic changes brought about by their expression.
[00211] Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins. Unique
physical-chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography. The unique structures of individual proteins offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as Western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used.
[00212] Assay procedures also may be used to identify the expression of proteins by their functionality, especially the ability of enzymes to catalyze specific chemical reactions involving specific substrates and products. These reactions may be followed by providing and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be analyzed and may include assays for PAT enzymatic activity by following production of radiolabeled acetylated phosphinothricin from phosphinothricin and I4C-acetyl CoA or for anthranilate synthase activity by following an increase in fluorescence as anthranilate is produced, to name two.
[00213] Very frequently the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms, including but not limited to, analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of genes encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes which change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays.
Event specific transgene assay
[00214] Southern blotting, PCR and RT-PCR techniques can be used to identify the presence or absence of a given transgene but, depending upon experimental design, may not specifically and uniquely identify identical or related transgene constructs located at different
insertion points within the recipient genome. To more precisely characterize the presence of transgenic material in a transformed plant, one skilled in the art could identify the point of insertion of the transgene and, using the sequence of the recipient genome flanking the transgene, develop an assay that specifically and uniquely identifies a particular insertion event. Many methods can be used to determine the point of insertion such as, but not limited to, Genome Walker™ technology (CLO TECH, Palo Alto, CA), Vectorette™ technology (Sigma, St. Louis, MO), restriction site oligonucleotide PCR (Sarkar et ai, 1993; Weber et al, 1998), uneven PCR (Chen and Wu, 1997) and generation of genomic DNA clones containing the transgene of interest in a vector such as, but not limited to, lambda phage.
[00215] Once the sequence of the genomic DNA directly adjacent to the transgenic insert on either or both sides has been determined, one skilled in the art can develop an assay to specifically and uniquely identify the insertion event. For example, two oligonucleotide primers can be designed, one wholly contained within the transgene and one wholly contained within the flanking sequence, which can be used together with the PCR technique to generate a PCR product unique to the inserted transgene. In one embodiment, the two oligonucleotide primers for use in PCR could be designed such that one primer is complementary to sequences in both the transgene and adjacent flanking sequence such that the primer spans the junction of the insertion site while the second primer could be homologous to sequences contained wholly within the transgene. In another embodiment, the two oligonucleotide primers for use in PCR could be designed such that one primer is complementary to sequences in both the transgene and adjacent flanking sequence such that the primer spans the junction of the insertion site while the second primer could be homologous to sequences contained wholly within the genomic sequence adjacent to the insertion site. Confirmation of the PCR reaction may be monitored by, but not limited to, size analysis on gel electrophoresis, sequence analysis, hybridization of the PCR product to a specific radiolabeled DNA or RNA probe or to a molecular beacon (Tyagi and Kramer, 1996), or use of the primers in conjugation with a TAQMAN™ probe and technology (Applied Biosystems, Foster City, CA).
Site specific integration or excision of transgenes
[00216] It is specifically contemplated by the inventors that one could employ techniques for the site-specific integration or excision of transformation constructs prepared in accordance with the instant invention. An advantage of site-specific integration or excision is that it can be used to overcome problems associated with conventional
transformation techniques, in which transformation constructs typically randomly integrate into a host genome and multiple copies of a construct may integrate. This random insertion of introduced DNA into the genome of host cells can be detrimental to the cell if the foreign DNA inserts into an essential gene. In addition, the expression of a transgene may be influenced by "position effects" caused by the surrounding genomic DNA. Further, because of difficulties associated with plants possessing multiple transgene copies, including gene silencing, recombination and unpredictable inheritance, it is typically desirable to control the copy number of the inserted DNA, often only desiring the insertion of a single copy of the DNA sequence.
[00217] Site-specific integration can be achieved in plants by means of homologous recombination (see, for example, U.S. Patent No. 5,527,695, specifically incorporated herein by reference in its entirety). Homologous recombination is a reaction between any pair of DNA sequences having a similar sequence of nucleotides, where the two sequences interact (recombine) to form a new recombinant DNA species. The frequency of homologous recombination increases as the length of the shared nucleotide DNA sequences increases, and is higher with linearized plasmid molecules than with circularized plasmid molecules. Homologous recombination can occur between two DNA sequences that are less than identical, but the recombination frequency declines as the divergence between the two sequences increases.
[00218] Introduced DNA sequences can be targeted via homologous recombination by linking a DNA molecule of interest to sequences sharing homology with endogenous sequences of the host cell. Once the DNA enters the cell, the two homologous sequences can interact to insert the introduced DNA at the site where the homologous genomic DNA sequences were located. Therefore, the choice of homologous sequences contained on the introduced DNA will determine the site where the introduced DNA is integrated via homologous recombination. For example, if the DNA sequence of interest is linked to DNA sequences sharing homology to a single copy gene of a host plant cell, the DNA sequence of interest will be inserted via homologous recombination at only that single specific site. However, if the DNA sequence of interest is linked to DNA sequences sharing homology to a multicopy gene of the host eukaryotic cell, then the DNA sequence of interest can be inserted via homologous recombination at each of the specific sites where a copy of the gene is located.
[00219] DNA can be inserted into the host genome by a homologous recombination reaction involving either a single reciprocal recombination (resulting in the insertion of the
entire length of the introduced DNA) or through a double reciprocal recombination (resulting in the insertion of only the DNA located between the two recombination events). For example, if one wishes to insert a foreign gene into the genomic site where a selected gene is located, the introduced DNA should contain sequences homologous to the selected gene. A single homologous recombination event would then result in the entire introduced DNA sequence being inserted into the selected gene. Alternatively, a double recombination event can be achieved by flanking each end of the DNA sequence of interest (the sequence intended to be inserted into the genome) with DNA sequences homologous to the selected gene. A homologous recombination event involving each of the homologous flanking regions will result in the insertion of the foreign DNA. Thus only those DNA sequences located between the two regions sharing genomic homology become integrated into the genome.
[00220] Although introduced sequences can be targeted for insertion into a specific genomic site via homologous recombination, in higher eukaryotes homologous recombination is a relatively rare event compared to random insertion events. Thus random integration of transgenes is more common in plants. To maintain control over the copy number and the location of the inserted DNA, randomly inserted DNA sequences can be removed. One manner of removing these random insertions is to utilize a site-specific recombinase system (U.S. Patent No. 5,527,695).
[00221] A number of different site specific recombinase systems could be employed in accordance with the instant invention, including, but not limited to, the Cre/lox system of bacteriophage PI (U.S. Patent No. 5,658,772, specifically incorporated herein by reference in its entirety), the FLP/FRT system of yeast (Golic and Lindquist, 1989), the Gin recombinase of phage Mu (Maeser et al. , 1991 ), the Pin recombinase of E. coli (Enomoto et al , 1983), and the R/RS system of the pSRl plasmid (Araki et al. , 1992). The bacteriophage PI Cre/lox and the yeast FLP/FRT systems constitute two particularly useful systems for site specific integration or excision of transgenes. In these systems, a recombinase (Cre or FLP) will interact specifically with its respective site-specific recombination sequence (lox or FRT, respectively) to invert or excise the intervening sequences. The sequence for each of these two systems is relatively short (34 bp for lox and 47 bp for FRT) and therefore, convenient for use with transformation vectors.
[00222] The FLP/FRT recombinase system has been demonstrated to function efficiently in plant cells. Experiments on the performance of the FLP FRT system in both maize and rice protoplasts indicate that FRT site structure, and amount of the FLP protein present, affects excision activity. In general, short incomplete FRT sites leads to higher
accumulation of excision products than the complete full-length FRT sites. The systems can catalyze both intra- and intermolecular reactions in maize protoplasts, indicating its utility for DNA excision as well as integration reactions. The recombination reaction is reversible and this reversibility can compromise the efficiency of the reaction in each direction. Altering the structure of the site- specific recombination sequences is one approach to remedying this situation. The site-specific recombination sequence can be mutated in a manner that the product of the recombination reaction is no longer recognized as a substrate for the reverse reaction, thereby stabilizing the integration or excision event.
[00223] In the Cre-lox system, discovered in bacteriophage PI, recombination between lox sites occurs in the presence of the Cre recombinase (see, e.g., U.S. Patent No. 5,658,772, specifically incorporated herein by reference in its entirety). This system has been utilized to excise a gene located between two lox sites which had been introduced into a yeast genome (Sauer, 1 87). Cre was expressed from an inducible yeast GAL1 promoter and this Cre gene was located on an autonomously replicating yeast vector.
[00224] Since the lox site is an asymmetrical nucleotide sequence, lox sites on the same DNA molecule can have the same or opposite orientation with respect to each other. Recombination between lox sites in the same orientation results in a deletion of the DNA segment located between the two lox sites and a connection between the resulting ends of the original DNA molecule. The deleted DNA segment forms a circular molecule of DNA. The original DNA molecule and the resulting circular molecule each contain a single lox site. Recombination between lox sites in opposite orientations on the same DNA molecule result in an inversion of the nucleotide sequence of the DNA segment located between the two lox sites. In addition, reciprocal exchange of DNA segments proximate to lox sites located on two different DNA molecules can occur. All of these recombination events are catalyzed by the product of the Cre coding region.
Deletion of sequences located within the transgenic insert
[00225] During the transformation process it is often necessary to include ancillary sequences, such as selectable marker or reporter genes, for tracking the presence or absence of a desired trait gene transformed into the plant on the DNA construct. Such ancillary sequences often do not contribute to the desired trait or characteristic conferred by the phenotypic trait gene. Homologous recombination is a method by which introduced sequences may be selectively deleted in transgenic plants.
[00226] It is known that homologous recombination results in genetic rearrangements of transgenes in plants. Repeated DNA sequences have been shown to lead to deletion of a flanked sequence in various dicot species, e.g. Arabidopsis thaliana (Swoboda et al. , 1994; Jelesko et ai, 1999), Brassica nap s (Gal et ai, 1991 ; Swoboda et al, 1993) and Nicotiana tabacum (Peterhans et al, 1990; Zubko et al, 2000). One of the most widely held models for homologous recombination is the double-strand break repair (DSBR) model (Szostak et al , 1983).
[00227] Deletion of sequences by homologous recombination relies upon directly repeated DNA sequences positioned about the region to be excised in which the repeated DNA sequences direct excision utilizing native cellular recombination mechanisms. The first fertile transgenic plants are crossed to produce either hybrid or inbred progeny plants, and from those progeny plants, one or more second fertile transgenic plants are selected which contain a second DNA sequence that has been altered by recombination, preferably resulting in the deletion of the ancillary sequence. The first fertile plant can be either hemizygous or homozygous for the DNA sequence containing the directly repeated DNA which will drive the recombination event.
[00228] The directly repeated sequences are located 5' and 3' to the target sequence in the transgene. As a result of the recombination event, the transgene target sequence may be deleted, amplified or otherwise modified within the plant genome. In the preferred embodiment, a deletion of the target sequence flanked by the directly repeated sequence will result.
[00229] Alternatively, directly repeated DNA sequence mediated alterations of transgene insertions may be produced in somatic cells. Preferably, recombination occurs in a cultured cell, e.g., callus, and may be selected based on deletion of a negative selectable marker gene, e.g., the periA gene isolated from Burkholderia caryolphilli which encodes a phosphonate ester hydrolase enzyme that catalyzes the hydrolysis of glyceryl glyphosate to the toxic compound glyphosate (US Patent No. 5,254,801).
IX. BREEDING PLANTS OF THE INVENTION
[00230] In addition to direct transformation of a particular plant genotype with a construct prepared according to the current invention, transgenic plants may be made by crossing a plant having a construct of the invention to a second plant lacking the construct. For example, a selected coding region operably linked to a promoter can be introduced into a
particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the current invention not only encompasses a plant directly regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants. As used herein the term "progeny" denotes the offspring of any generation of a parent plant prepared in accordance with the instant invention, wherein the progeny comprises a construct prepared in accordance with the invention. "Crossing" a plant to provide a plant line having one or more added transgenes relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a transgene of the invention being introduced into a plant line by crossing a starting line with a donor plant line that comprises a transgene of the invention.
[00231] To achieve this one could, for example, perform the following steps:
(a) plant seeds of the first (starting line) and second (donor plant line that comprises a transgene of the invention) parent plants;
(b) grow the seeds of the first and second parent plants into plants that bear flowers;
(c) pollinate a flower from the first parent plant with pollen from the second parent plant; and
(d) harvest seeds produced on the parent plant bearing the fertilized flower. [00232] Backcrossing is herein defined as the process including the steps of:
(a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking the desired gene, DNA sequence or element;
(b) selecting one or more progeny plant containing the desired gene, DNA sequence or element;
(c) crossing the progeny plant to a plant of the second genotype;
(d) And
(e) repeating steps (b) and (c) for the purpose of transferring the desired gene, DNA sequence or element from a plant of a first genotype to a plant of a second genotype.
[00233] Introgression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion. A plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or
hybrid. Similarly a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
EXAMPLES
[00234] The methods described below are illustrative of methods to express a DNA sequence of interest in a transgenic photosynthetic organism "Chlamydomonas rienhardtii" . However, those of skill in the art will know other methods of achieving similar results with other constructs and organisms.
Materials and methods
DNA constructs
[00235] The plasmid for inducing RNAi-mediated silencing of the CAO (SEQ ID. No. 1) gene in Chlamydomonas reinhardtii strain CC-424 (arg2 cwl5 sr-u-2-60 mt-, Chlamydomonas Genetic Center) was constructed using the genomic-sense/cDNA-antisense strategy of Fuhrmann et al. (Fuhrmann et al. (2001) /. Cell Sci. 114: 3857 - 3863). A 1032 bp fragment (SEQ. ID. No 2) spanning the first two exons and introns of the CAO gene was amplified from Chlamydomonas strain CC-424 (considered wild-type for light harvesting) genomic DNA using forward and reverse primers CAOExl2GS_F (SEQ. ID. No 3 and CAOExl2GS_R (SEQ. ID. No 4) (Table El) respectively and cloned into the Ndel and BamHI sites of the PSL18 vector (Depege et al., (2003) Science 299: 1572 - 1575.; a gift from Dr. Patrice Hamel, The Ohio State University).
[00236] Genomic DNA isolation from CC-424 was carried out using the xantine buffer protocol (Tillett and Neilan, (2000); J. Phycol. 36: 251 - 258). The corresponding cDNA region spanning exons 1 and 2 (604 bp) of CAO was then obtained using RNA extracted from the CC-424 strain and cDNA synthesis (Promega). RNA extraction was performed using the manufacturer's protocol for trizol (Invitrogen) extraction. The 604 bp cDNA fragment was amplified using the forward and reverse primers CAOExl2CAS_F (SEQ. ID. No 5) and CAOExl2CAS_R (SEQ. ID. No 6) (Table El), respectively and cloned in an antisense direction into the PSL18 vector using the EcoRI and Bglll sites to generate the CAO-RNAi vector (Fig. 1). The resulting plasmid was sequenced using primers PSL18-F-seq (SEQ. ID. NO.7) and PSL18-R-seq (SEQ. ID. NO.8) shown in Table El.
[00237] The psaD promoter and terminator cassette of the PSL18 vector was used to drive RNAi. The pSL18 vector (backbone) also contains the paromomycin resistance gene driven by the Hsp70/RbcS2 fusion promoter (Sizova et al, (2001) Gene 277: 221 - 229),
placed in tandem with the PsaD promoter and terminator cassette (Depege et al., (2003) Science 299: 1572 - 1575). Hence transformants generated using the PSL18 vector can be selected based on resistance to paromomycin.
[00238] For the construction of the NAB l regulated CAO gene, the CAO gene was amplified with the N1BSCAO-F (SEQ. ED. NO. 9) forward and CAO-Rev (SEQ. ID. NO. 10) reverse primers using genomic DNA isolated from Chlamydomonas strain CC-2137 (Chlamydomonas Genetic Center) as template (Table El). The 13-bp NAB l binding site (NI BS) in this construct corresponds to the sequence 5 ' -GCCAGACCCCCGC-3 ' (SEQ. ID. NO. 15). Genomic DNA was extracted from Chlamydomonas using the xantine buffer protocol as described above. The Ndel and Xbal restriction sites were used in cloning of the amplified gene into the nuclear gene expression vector PSL18, to generate the PSL18-N1 BS- CAO vector, which is shown schematically in FIG. 1).
[00239] To generate control plasmids in which the CAO gene was not preceded by the NAB l binding site (PSL18-CAO), or had an altered NAB l binding site (PSL18-altNlBS- CAO), the CAO-F (SEQ. ID. NO. 1 1) or altNlBSCAO-F (SEQ. ID. NO. 12) forward primers were used respectively, in combination with the same reverse primer as above (Table El). All the resulting plasmids PSL18-CAO, PSL18-N1 BS-CAO and PSL18-altN lBS-CAO were sequenced using the PSL18-psaD-F (SEQ. ID. NO. 13) and CAO-seq primers (SEQ. ID. NO. 14) (Table El).
CAO-F ATCTTCATATGCTTCCTGCGTCGCTTCAAC SEQ. ID. NO. 1 1 altNlBSCAO-F ATCTTCATArGGGGCAAACACCGGCGGGCCTTCCTGC SEQ. ID. NO. 12 GTCGCTTCAACGCAAGG
PSL18-psaD-F GTTAGGTGTTTGCGCTCTTGAC SEQ. ID. NO.13
CAO-seq GGCGAGTGAGCATATTCGTCC SEQ. ID. NO.14
Generation and screening of the CAO-RNAi transformants
[00240] For the generation of the CAO-RNAi transgenic lines (CR), the cell wall-less CC-424 Chlamydomonas strain was transformed with the CAO-RNAi plasmid by glass bead- mediated nuclear transformation (Kindle, et al., (1990) Proc Natl Acad Sci USA. 87: 1228 - 1232). Briefly, the CC-424 cells, a CW-15 wall less mutant were grown in 100 mL of Tris- Acetate-Phosphate (TAP) media (Harris, 1989) containing 100 pg/mL L-arginine (Sigma) and harvested after 4-5 days of growth (mid-log phase) by low speed centrifugation. The cells were resuspended in 900 pL of TAP plus 40 mM sucrose and divided equally into 3 tubes containing 300 mg 500 micron acid washed sterile glass beads. After the addition of 100 pL of 20% PEG and 1 pg of Seal linearized CAO-RNAi plasmid, each tube was vortexed at maximum speed for 25 sec. The cells were then resuspended in 3 mL TAP plus arginine media and grown for 24 h on a lighted incubator-shaker. Following this, the cells were spread on to TAP agar plates containing 100 pg/mL L-arginine and 50 pg/mL paromomycin for selection of the transformants. After two weeks colonies began to appear and were transferred to fresh media containing the selection antibiotics. Transformants were further screened by pigment extraction and spectrophotometric analysis of Chi a b ratios which were expected to increase as a consequence of CAO gene silencing. For this, cells were grown in culture tubes containing 3 ml of High Salt (HS) + Arginine (100 pg/ml) for 5-6 days under continuous illumination of -50 pmol light m"2 s"1. The relative amounts of Chi a and b and the total Chi content was determined from 1 ml of culture (OD750nm = 1 ) using the method of Arnon (1949) Plant Physiol 24: 1-15.
[00241] In addition, real-time PCR analysis of selected CR transformants was completed to confirm the knockdown of the expression of the CAO gene (SEQ. ED. NO. 1). RNA from the CR transformants (CR-15, 28, 56, 68, 118 and 133) and CC-424 wild-type was extracted using Trizol according to manufacturer's instructions (TRI REAGENT®, Ambion, Catalog # AM9738). After treatment with DNase (Promega, Catalog # M610A), RNA was precipitated using 3M Na Acetate and 95% ethanol. The concentration and quality of RNA was assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc.) and only samples that had 260/280 and 260/230 ratios of above 1.8 were used for further analysis. DNase-treated RNA samples (1-2 μg) were reverse transcribed with an anchored oligo (dT) primer and 200 units superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) in a final reaction volume of 20 μΐ according to the manufacturer's instructions. To check whether reverse transcription (RT) and cDNA synthesis was successful, PCR was performed with the CQ_CBLP-F (SEQ. ID. NO. 16) and RT_CBLP-R primers (SEQ. ID". NO. 17) (Table E2) using 10 μΐ of the RT reaction as template. Real-time quantitative RT- PCR was carried out using an ABI - Step one plus machine using SYBRGreen PCR Master Mix Reagent Kit (Quanta Biosciences). The Chlamydomonas CBLP gene was used as reference . gene/intemal control and was amplified in parallel with the CAO target gene allowing gene expression normalization and providing quantification (Zhao et al, (2008) Plant J. 58: 157 - 164). All reactions were carried out with 10 ng RNA in a final reaction volume of 20 μΐ. The primers used for the amplification of the CBLP SEQ. ID. NOs. 17 18) and CAO (SEQ. ID. NO. 19 & 20) genes are shown in Table E2. The annealing temperature was set at 61 °C. Each sample was set up in quadruplicates to ensure the reproducibility of the results. The quantification of the relative transcript levels was performed using the comparative CT (threshold cycle) method (Livak et al., (2001) Methods 25: 402-408.
RT_CAO_R GGGTTGGACCAGTTGCTGC SEQ ED. NO.20
Generation of the NAB1 regulated CAO Chlamydomonas transformants
[00242] The PSL18-CAO, PSL18-N1BS-CAO and PSL18-altNlBS-CAO plasmids were used to generate the complemented wild-type strains (CAO), N1BS-CAO and altNlBS- CAO transgenic strains (see below). Plasmids were introduced into the CAO deletion strain cbs-3 (a kind gift of Dr. Ayumi Tanaka, Kyoto University) by particle gun bombardment in separate transformation events.
[00243] Briefly, the cbs-3 culture was grown in TAP media for -5-6 d, and harvested by centrifugation while still in log phase. The concentrated cells were spotted onto the center of a TAP agar plate (-0.4-0.5 mL) and dried in a sterile-transfer hood. Chlamydomonas nuclear transformation was carried out using a Bio-Rad PDS-1000/He system where DNA- coated gold particles were accelerated into cells of the host strain cbs-3 using pressurized helium. The gold particles (1.2 μΜ diameter, InBio Gold) were sterilized with ethanol and resuspended in water prior to binding of the DNA. A 50 μL· aliquot of 60 mg/mL sterile gold particles were mixed with 5 μΐ^ of plasmid DNA (1 mg/mL), 50 μΙ_, of 2.5 M CaCb, and 20 μΙ_ 0.1 M spermidine and incubated at room temperature for 20-30 min. The mixture was then centrifuged and precipitated 70% ethanol before a final resuspension in 45 μΐ- of 95% ethanol. 15 μΙ_ of the gold coated DNA mixture was pipetted on to a sterile macrocarrier (InBio Gold) and dried. The macrocarrier holder was installed into the chamber of the biolistic system about - 15 cm above the TAP agar plate containing the cells to be transformed and the chamber evacuated under 25 inches of Hg. The particles were then propelled into the target cells using 1 10 psi of helium pressure. The bombarded cells were then recovered overnight in 3 mL of TAP medium and spread onto 4-5 TAP plates containing 50 μg/mL ampicillin and 25 μg/mL paromomycin. The plates were incubated at 21 °C under dim light until small green, paromomycin resistant colonies began to appear, about two weeks. The colonies were transferred to fresh TAP plates containing 50 μξ/π ^ paromomycin to minimize spontaneous transformants or escapes. Following one week of growth on TAP plates containing the selection antibiotic, DNA was extracted from the transgenics via the Chelex-100 extraction method (Cao et al., (2009) Protoplasma 235: 107 - 1 10). Briefly, a small loop of cells was boiled in 50 μΐ^ of a 5% (w/v) solution of Chelex-100 resin (Bio-rad) for 10 min. The mixture was vortexed and spun down for 2 min to pellet the cell debris and
the supernatant containing the transgenic DNA was used as the template for PCR and subsequent sequence confirmation with the pSL18-psaD-F (SEQ. ED. NO.13) forward and CAO-Seq (SEQ. ID. NO.14) reverse primers shown in Table El. In addition to the complemented wild-type strains, the CC-2137 strain (Chlamydomonas Genetics Center) served as an additional control.
Chlorophyll Fluorescence Induction Measurements
[00244] Cell suspensions of the wild-type and transgenic Chlamydomonas were adjusted to yield a low Chi concentration of -2.5 μg Chl/mL in a standard cuvette, and placed in a kinetic fluorometer (FL-3500, Photon Systems Instruments). The built-in flash Chi fluorescence induction wizard was used to run the experiment with the duration of the actinic flash set to 100 s and the induction of Chi fluorescence during the flash was measured. The values of Chi fluorescence measured at each time point were normalized to the maximum achieved during the flash for a given sample, in order to compare the percentage of closed reaction centers across samples at any given time point (% saturation).
Non-denaturing gel electrophoresis
[00245] The CC-424 (WT), CR transformants 1 18 and 133, and the cbs-3 strain were grown in 100-200 mL of liquid High Salt (HS) media supplemented with 100-200 Mg/mL L- arginine under low light intensities (50 μπιοΐ light m"2 s"1) with continuous shaking at 225 rpm for 6 days. Cells were harvested by centrifugation at 3,000 x g for 5 min at 4 °C. The cell pellet was resuspended in buffer A (0.3M Sucrose, 25 mM HEPES, pH 7.5, I mM MgCl2) plus 20 μΙ7ηιΙ- of protease inhibitor cocktail (Roche), to yield a final Chi concentration of 1 mg/mL. Cells were then disrupted by sonication (Biologies, Inc, Model 300 V/T Ultrasonic Homogenizer) two times for 10s each time (pulse mode, 50% duty cycle, output power 5) on ice. The unbroken cells were pelleted by centrifugation at 3,000 x g for 2 min at 4 °C. The supernatant was centrifuged at 12,000 x g for 20 min and the resulting pellet was washed with buffer A. The sample was subjected to a second centrifugation step at 1 1 ,000 x g to collect thylakoids. Samples for electrophoresis were prepared by solubilization of thylakoid membranes isolated from the WT, CR-1 18, 133 and cbs-3 cells, with LiDodS04 as described previously (Delepelaire and Chua, (1 79) Proc. Natl. Acad. Sci. USA 76: 1 1 1 - 1 15). Briefly, 15 μg Chi equivalents of thylakoid membrane was solubilized in a buffer containing 50 mM Na2C03, 50 mM dithiothreitol, 12% sucrose and 2% lithium dodecyl sulfate to yield a final
Chi concentration of 1 mg mL and a Chl/LiDodS04 (wt/wt) ratio of 1 :20. The sample was shaken gently for 60s. Equal amounts of the sample buffer (62.5 mM Tris-HCl, pH 6.8 and 25% glycerol) were added to the solubilized thylakoids before loading. The samples were then loaded on to a Ready Tris-HCL Gel (Bio-rad 161-1225) and LiDodS04 and EDTA were added to the upper reservoir buffer (25 mM Tris, 192 mM glycine) to a final concentration of 0.1% and 1 mM respectively. Electrophoresis was performed at 4 °C in the dark for 2-2.5 h at 12 mA constant current.
Photosynthetic growth of CC-424, CR-118, 133 and cbs-3 in High Salt media
[00246] The ability of the CC-424, CR Chlamydomonas strains to grow photoautrophically in liquid High Salt (supplemented with 100 Mg/mL L-Arginine) was measured in a time dependent manner at either low light (LL, 50 μπιοΐ light m"2 s"1) or high light (HL, 500 μπιοΐ light m"2 s"1) conditions with constant shaking at 225 rpm. The optical density of the cultures was monitored on a daily basis at 750 nm using a Cary 300 Bio UV- Vis spectrophotometer.
Assaying oxygen evolution of CC-424 (WT), CR-118, 133 and cbs-3 cells as a function of light intensity
[00247] The oxygen evolving activity of log-phase cultures (0.4-0.7 OD750 nm) was assayed using a Clark-type oxygen electrode (Hansatech Instruments) (Roffey et al., (1994) Biochim Biophys Acta 1185: 257 - 270). Cells were resuspended in 20 mM HEPES buffer (pH 7.4) and the rate of oxygen evolution was measurement as a function of increasing light intensity (650 nm wavelength red light). The photon flux density table was set to maintain the following light intensities for 1.5 minutes each (50, 150, 300, 450, 600, 750 and 800 μΕ m"2 s"
1 of red light) in order to obtain light saturation curve of photosynthesis. The same experiment was repeated in the presence of 10 mM NaHCCh. Light saturation curves were normalized on the basis of Chi as well as cell number in order to remove any bias caused due to differences in pigment content. The CC-424 (WT), CR- 1 18 and CR-133 cells were grown at a light intensity of -50 μπιοΐ light m"2 s"1. The cbs-3 strain was grown at 500 μιτιοΐ light m"
2 s"1, since these cells grew better at higher light intensities.
Pigment determination by HPLC
[00248] Chlamydomonas cultures were grown in low and high light conditions as indicated for 6 days. 10 ml aliquots of culture were centrifuged and the photosynthetic
pigments extracted with 100% acetone in the dark for 20 min. After incubation, samples were centrifuged to pellet the cell debris and the supernatant was transferred to glass tube and dried under vacuum. The samples were then resuspended in 750 μΐ of acetonitrile: water: triethylamine (900:99: 1 , v/v/v) for HPLC analysis. Pigment separation and chromatographic analysis was performed on a Beckman HPLC equipped with UV-vis detector, using a C 18 reverse phase column at a flow rate of 1.5 mL/ min. Mobile phases were (A) acetonitrile/H20/triethylamine (900:99: 1 , v/v/v) and (B) ethyl acetate and the applied gradient program was 100% solvent A and 0% solvent B. The pigments were detected at 445 nm and phytoene at 282 nm.
Example 1: RNAi-mediated silencing of the CAO gene
[00249] As discussed previously, the enzyme Chi a oxygenase or CAO is responsible for the synthesis of Chi b via the oxidation of the methyl group on ring II of Chi a. The lack of Chi b, an abundantly found light harvesting pigment, specifically affects the assembly of the peripheral antenna complex (LHCII) associated with PSII in green algae. RNAi-mediated gene silencing was used to repress CAO gene expression and reduce cellular Chi b levels to confirm that this approach would be effective in reducing the size of the antenna complex.
[00250] To accomplish this a genomic-sense/cDNA-antisense construct spanning the first two exons and intron regions of the CAO gene was used to generate a RNAi expression vector specific for the CAO gene (FIG. 1). Transgenic colonies were first identified on the basis of antibiotic resistance and colony PCR verification. Pigment analysis led to the identification of eight independent CAO-RNAi transformants ("CR transformants") that displayed a range of Chi a/b ratios between 3.2-4.9 that were 1.5-2.2 fold higher than in the wild type (Chi a/b ratio = 2.2) with little or no change in the overall Chi content. These results are consistent with conclusion that the constructs were effective in exerting RNAi- mediated silencing of the CAO gene, and that this result leads to lower cellular Chi b levels (Table E3).
Table E3: Chi a/b ratios of independent CR transformants.
[00251] To determine the effects of reduced Chi b levels on PSII antenna size in these transgenics clones, the kinetics of PSII Chi fluorescence induction to its maximal level during an actinic flash was measured (FIG. 2). The rate at which the fluorescence rises is indicative of the rate of closure of PSII RCs and is an indirect indication of the antennae size or efficiency of light harvesting. ( elis, (1989) Phil. Trans. R. Soc. Lond. B 323: 397 - 409; Nedbal et al., (1999) J. Photochem. Photobiol. B. 48: 154 - 157). The CAO-RNAi (CR) transgenic clones had slower fluorescence induction kinetics than WT and reached only 75- 80% saturation when WT reached 90-92% saturation. (FIG. 2) This is potentially reflective of a smaller PSII antenna absorption cross-section in the CR mutants relative to WT. The Chi b less cbs-3 mutant did not light saturate under these measurement conditions.
Example 2: Characterization of the correlation of Chlorophyll fluorescence rise kinetics with Chi b content and size of the PSII antenna complex in wild type and CAO- RNAi (CR) transgenic clones.
[00252] The Chi b containing wild-type and CR strains reached their maximal fluorescence values (saturation) with a single flash, in contrast to the CAO knock out (cbs-3 strain) that did not reach saturation. Arbitrarily the percentage saturation or reaction center closure was calculated for all strains at a point where wild-type algae achieved 90% saturation. When this value was plotted against the respective Chi a/b ratio, for each clone, a linear inverse relationship (with Adj. R-Square = 0.96) was observed between time to reach 90% saturation for wild-type and the corresponding time for the transgenics and the Chi a/b ratio (FIG. 4). The CR transformants having higher Chi a/b ratios had slower fluorescence rise kinetics presumably due to a decrease in PSII antenna optical cross-section.
[00253] To confirm a reduction in antennae size in the CR transgenics, thylakoid membranes were isolated from the wild-type, two CAO-RNAi strains CR- 1 18 and CR- 133 and the cbs-3 mutant, and the LHC content was determined empirically using non-denaturing gels and densitometry (Delepelaire and Chua, (1979) Proc. Natl. Acad. Sci. USA 76: 1 1 1 - 1 15).
[00254] The results (FIG. 5) show a 20-30% reduction in the intensity of the CPII band (visualized by its Chi content) in the CR-1 18 and CR- 133 transgenics while the CPII band was absent in CAO knockout (cbs-3) (FIG. 5). This result is consistent with the hypothesis that a decrease in PSII-LHCII content is induced by the reduction in CAO expression mediated by the RNAi induced gene silencing in the CR transgenics.
[00255] To confirm that the change in cellular Chi b levels and PSII antenna absorption cross section seen in the CR transformants was due to RNAi-mediated silencing of the expression of the CAO gene, real-time RT-PCR analysis was performed using RNA extracted from the CC-424 (WT), selected CR transformants (CR- 15, 28, 56, 68, 1 18, and 133) and the cbs-3 mutant. The cbs-3 strain that lacks the CAO gene did not have any amplification in the real-time RT-PCR analysis and hence is not shown on the graph. On the other hand, the CR transformants show 60-80% reduction in CAO mRNA levels compared to WT confirming that the decrease in Chi b content and PSII antenna size was in fact due to silencing of the CAO gene (FIG. 3).
Example 3: Photosynthetic oxygen evolution in WT, CR-118, 133 and cbs-3 cells
[00256] It has previously been demonstrated that a reduction in the peripheral antenna size of PSn is sufficient to increase the light saturated rate (Pmax) and capacity of photosynthesis (Polle et al., (2000) Planta 211: 335 - 344). To determine whether this was the situation here, the oxygen evolving activity of wild-type, CR-1 18, 133 and cbs-3 cells were measured at different light intensities to yield a light-saturation curve in the presence or absence of saturating levels of CO2 added in the form of NaHCC«3 (10 mM).
[00257] The results are presented both in terms of per Chi (FIG. 6) and per cell basis FIG. 7). Typically, the rate of oxygen evolution increases until the saturation irradiance is reached after which no further increase is observed. In the results here, the photon-use efficiency of photosynthesis (initial slope of the curve at low light intensity) was not impacted in the CR transgenics. However, the decrease in Chi b levels (increase in Chi a/b ratios) and PSD antenna size, led to increases in the values of Pmax up to -2 fold when compared to wild-type on a cell number (FIG. 7) or per Chi basis respectively (FIG. 6).
[00258] Previous studies have demonstrated up to a 2.5-fold increase (on a per Chi basis) of Pmax in the Chi b-less cbs-3 mutant in which the PSII peripheral antenna is absent (Polle et al., (2001) Plant Cell Physiol. 42: 482 - 491). Since reductions in Chi b or total Chi could give a higher photosynthetic rate on a chlorophyll basis it was important to determine if photosynthesis rates also increased on a per cell basis.
[00259] When compared on a per cell basis the CR transformants showed up to a -1.6 fold increase in oxygen evolution compared to WT. The addition of 10 mM NaHCC to the oxygen evolution assay showed an increase in the photosynthetic rate for all the strains (FIG. 7). However, there was little increase in photosynthetic rate for the cbs-3 mutant in the presence of added bicarbonate possibly reflecting a reduced capacity to import actively bicarbonate associated with diminished ability to generate ATP reflective of a reduced capacity for state transitions. (Cardol et al., (2009) PNAS 106(37) 15979-15984)
Example 4: Photosynthetic growth of WT, CR-118, 133 and cbs-3 cells under low and high light intensities
[00260] 'To determine if the decrease in CAO expression and PSII antenna size had an impact on growth rate, the rate of photoautotrophic algal growth (cell density) in cultures grown at two different light intensities, 50 (LL) and 500 (HL) μπιοΐ light m"2 s"1 (FIG. 8) were measured.
[00261] The results showed that the culture productivities of the CR transgenics were similar to the CC-424 (WT) when grown under LL conditions, whereas the growth of the cbs- 3 mutant, in which Chi b is absent, was substantially reduced having less than 50% of WT growth. (FIG. 8) The complete lack of Chi b has been shown to lower the quantum yield of photosynthesis at low light intensities (Polle et al., (2002) International Journal of Hydrogen Energy 27: 1257 - 1264). Thus it is not unexpected that the cbs-3 strain grows less well (40% of WT growth) than wild type at LL.
[00262] At the high light intensity, (HL) the CR strains tested were most productive and had a -30-50% and 50-80% increase in growth rate compared to the WT and cbs-3 (Chi b less) mutant respectively. Relative to growth at low light intensity, (LL), the cbs-3 strain grew at rates approaching -75% of wild-type growth on a cellular basis.
Example 5: Initial characterization of transgenic strains carrying the NAB1 regulated CAO gene construct
[00263] In order to demonstrate that the NAB 1 binding domain interacted with the NAB 1 protein we generated NAB 1 binding domain mutants and assessed their ability to undergo light-dependent changes in chlorophyll b content. A gene construct in which the 13- bp LHCBM6 mRNA CDSCS or NAB 1 binding site (abbreviated here to NIBS) (SEQ. ID. NO. 15) was placed at the 5' end of the CAO gene, was introduced into the CAO knock out stain cbs-3 by particle gun bombardment mediated transformation to generate the N1 BS- CAO transgenic cell lines. As a control, the CAO knock out strain was complemented with the wild-type CAO gene lacking the 5' NIBS sequence to generate the complemented wild- type. A mutagenized NAB 1 binding site (different from LHCBM6 mRNA CDSCS by 4 bp) (5'-GGCAAACACCGGC-3 ' ; SEQ. ED. NO. 21) was also constructed and inserted into the 5' coding sequence of the CAO gene and transformed into the Chi b-less strain, cbs-3, to generate the altNlBS-CAO transgenic cell lines.
[00264] In all cases, the PsaD promoter was used to drive the expression of the gene construct so as to decouple any potential effects of the native CAO promoter. The resulting transgenic clones were selected initially on the basis of antibiotic resistance and then further screened by pigment extraction and quantification. Selected transgenic clones having Chi a/b ratios intermediate between wild-type (CC-2137) and Chi b-less cells were confirmed for the presence of the transgene by PCR (data not shown). The amplified region was verified by DNA sequence analysis.
[00265] To analyze the effect of the 5' NAB l binding site on the regulation of the CAO gene and Chi b synthesis during photoacclimation, the Chi a/b ratios of the individual transformants were determined by pigment extraction and HPLC analysis of cultures grown at LL (50 μπιοΐ photons m"2 s'1) or at HL (500 μπιοΐ photons m"2 s"1) for 6 days. Each strain was inoculated into fresh HS media using a 2% v/v culture inoculum to avoid self-shading and nutrient limitation. Chi a/b ratios were then monitored through two sets of alternating periods of low and high irradiance as shown in FIG. 9.
[00266] The complemented wild-type (CAO-4, 22) and CC-2137 strains showed similar trends with slight reductions (<2-6%) in Chi a/b ratios when grown under HL probably due to the effects of photoinhibition (Harper et al., (2004) Photosynth. Res. 79: 149 - 159). The N l BSCAO-4, 7 and 77 transgenics on the other hand showed the opposite trend with up to a - 16% increase in Chi a/b ratios when grown under HL conditions. This is indicative of a preferential decrease in Chi b synthesis in response to high irradiances due to NAB l regulation of CAO. By contrast, the altNl BS-CAO transgenics showed trends, i.e. a lack of change in chlorophyll b content with changes in light intensity, similar to the complemented wild-type and CC-2137 strains suggesting that NAB l binding to the CAO transcript was probably perturbed due to the alterations to the sequence of the binding site.
Example 6: Characterization of Chi fluorescence induction in transgenic strains carrying the NABl regulated CAO gene construct
[00267] To correlate the changes in Chi a/b ratio to possible alterations in PSII antenna size, test cells were subjected to flash fluorescence induction as described previously. After each light period, the percentage light saturation or reaction center closure was calculated for the transformants at a time point where the complemented wild type strain, CAO-4, achieved 90% saturation. The values obtained for each strain under low and high light were compared to yield a percentage decrease/increase in Chi fluorescence yield. The results shown in FIG. 10 show reversible changes in Chi fluorescence induction kinetics of up to -10% that were observed after each light cycle in the N 1 BS-CAO transgenics as compared to less than - 1-2% change in the CC-2137 wild-type control.
[00268] The results from these three independent transformants expressing the modified CAO gene confirm that Chi a/b ratios increase under high light acclimation resulting in reduced PSII antenna size. Conversely, a decrease in Chi a/b ratios under conditions of low irradiances are indicative of an increase in PSII antenna size. This interpretation is supported by the observation that flash Chi fluorescence induction kinetics of
low light grown cultures exhibited up to -10% increase in the level of light saturated Chi fluorescence compared to the complemented wild-type CAO-4, and a -10% reduction in Chi fluorescence yield relative to 90% light saturation yield for wild type when grown under high light conditions. This light-dependent change in antennae size in the transgenics is substantially greater than that observed in wild-type cells, and consistent with the hypothesis that the system is indeed working as predicted to automatically regulate PSIl antenna size in response to ambient light intensity.
Claims
1. A transgenic algae capable of modulating PSII antenna size in response to ambient light intensity;
wherein the transgenic algae exhibit an increase in Chi a/b ratios when grown under high light conditions, and a decrease in Chi a/b ratios when grown under low light conditions compared to wild type cells grown under identical conditions .
2. The transgenic algae of claim 1 , wherein the increase in Chi a/b ratio is at least 5 %
greater than observed with wild type cells.
3. The transgenic algae of claim 2, wherein the transgenic algae's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
4. The transgenic algae of any of claims 1 to 3, wherein the transgenic algae comprises a DNA construct comprising heterologous expression control sequences that are capable of binding to a redox sensitive modulator that is responsive to ambient light intensity.
5. The transgenic algae of claim 4, wherein the redox sensitive repressor is more active at low light intensity, than at high light intensity.
6. The transgenic algae of claims 4 or 5, wherein the redox sensitive modulator is NAB1.
7. The transgenic algae of any of claims 4 to 6, wherein the expression control sequences comprise a cold-shock domain consensus sequence (CSDDCS) motif.
8. The transgenic algae of any of claims 4 to 7, wherein the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence.
9. The transgenic algae of claim 8, wherein the promoter is selected from the group
consisting of psaD, actin, ubiquitin, and b-tubulin.
10. The transgenic algae of any of claims 4 to 9, wherein the expression control sequences are operatively coupled to a polynucleotide sequence encoding CAO.
11. The transgenic algae of claim 10, wherein the polynucleotide sequence encoding CAO is a heterologous nucleic acid sequence.
12. The transgenic algae of any of claims 1 to 11, wherein the transgenic algae is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and
Haematococcus pluvialis.
13. The transgenic algae of any of claims 1-12, wherein the transgenic algae comprises a heterologous redox sensitive modulator.
14. The transgenic algae of any of claims 1-12, wherein the heterologous redox sensitive modulator is NAB 1.
15. The transgenic algae of any of claims 1 to 13, wherein the transgenic algae exhibit
exhibits an increase in biomass production compared to wild type algae grown under identical conditions.
16. A method of producing an improved photosynthetic organism, comprising the steps of; a) stably transforming a photosynthetic organism with a heterologous polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif, that is capable of binding to a redox sensitive modulator that is responsive to ambient light intensity; b) selecting a transformant that is capable of modulating PSII antenna size in response to ambient light intensity.
17. The method of claim 16, wherein the heterologous polynucleotide sequences comprise targeting sequences specific for the photosynthetic organism's endogenous CAO gene.
18. The method of claim 17, wherein, the photosynthetic organism's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
19. The method of any of claims 16-18, wherein the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence.
20. The method of claim 19, wherein the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
21. The method of any of claims 16-20, wherein the expression control sequences are
operatively coupled to a polynucleotide sequence encoding CAO.
22. The method of any of claimsl6-21 , wherein the photosynthetic organism is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and
Haematococcus pluvialis.
23. The method of any of claims 16-22, wherein the selection is based on screening transgenic organisms that exhibit an increase in Chi a/b ratios when grown under high light conditions, and a decrease in Chi a/b ratios when grown under low light conditions.
24. The method of any of claims 16-22, wherein the selection is based on screening
photosynthetic organism that exhibit an increase in biomass production compared to wild type organisms grown under identical conditions.
25. The method of any of claims 16-24, wherein the photosynthetic organism comprises a heterologous redox sensitive modulator.
26. The method of claim 25, wherein the heterologous redox sensitive modulator is NABl.
27. A method of enhancing yields of photosynthetic productivity under conditions of high light intensity, and or high density growth, the method comprising;
i) providing a photosynthetic organism comprising a heterologous
polynucleotide sequence comprising expression control sequences comprising a cold- shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO; wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity; ii) cultivating the photosynthetic organism at high light intensity and / or high density.
28. A method of enhancing bio-oil, or bio-diesel production from a photosynthetic organism the method comprising; i) providing algae comprising a heterologous polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
ii) cultivating the algae at high light intensity and / or high density.
29. A method of enhancing beta-carotene, lutein, or zeaxanthin production from a photosynthetic organism, the method comprising; i) providing algae comprising a heterologous polynucleotide sequence comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO, wherein expression of the CAO is increased at low light intensity, compared to the expression of the CAO at high light intensity;
ii) cultivating the algae at high light intensity and / or high density.
30. The method of any of claims 27-29, wherein, the transgenic organism's endogenous chlorophyll a oxidase (CAO) gene has been disrupted or suppressed.
31. The method of any of claims 27-30, wherein the photosynthetic organism is an algae.
32. The method of any of claims 27 -31, wherein the expression control sequences further comprise a promoter operatively linked to the cold-shock domain consensus sequence.
33. The method of claim 32, wherein the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
34. The method of any of claims 27-33, wherein the polynucleotide sequence encoding CAO is a heterologous nucleic acid sequence.
35. The method of any of claims 31-34, wherein the algae is selected from the group consisting of Chlamydomas perigranulata, Chlamydomonas moewusii, Chlamydomonas rienhardtii, Chlamydomonas sp., Scenedesmus obliquus, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis.
36. The method of claim 35, wherein the algae exhibit an increase in Chi a/b ratios when grown under high light conditions of at least 5 %, and a decrease in Chi a/b ratios when grown under low light conditions of at least 5 % compared to wild type algae grown under identical conditions.
37. The method of any of claims 31-36, wherein the algae comprise a heterologous redox sensitive repressor.
38. The method of claims 37, wherein the heterologous redox sensitive repressor is NAB1.
39. An expression vector comprising expression control sequences comprising a cold-shock domain consensus sequence (CSDDCS) motif operatively coupled to a polynucleotide sequence encoding CAO.
40. The expression vector of claim 39, further comprising a promoter operatively linked to the cold-shock domain consensus sequence.
41. The expression vector of any of claims 39-40, wherein the promoter is selected from the group consisting of psaD, actin, ubiquitin, and b-tubulin.
42. The expression vector of any of claims 39-41, wherein the CSDDCS motif is selected from the group consisting of SEQ ID. No. 39, SEQ ID. No. 40, SEQ ID. No. 41, SEQ ID. No.
42, SEQ ID. No. 43, SEQ ID. No. 44, SEQ ID. No. 45, SEQ ID. No. 46, and SEQ ID. No. 47.
43. The expression vector of any of claims 39-42, wherein the CAO gene is selected from the group consisting of SEQ ID. No. 34, SEQ ID. No. 35, SEQ ID. No. 36, SEQ ID. No. 37, and SEQ ID. No. 38.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161510641P | 2011-07-22 | 2011-07-22 | |
| US61/510,641 | 2011-07-22 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2013016267A2 true WO2013016267A2 (en) | 2013-01-31 |
| WO2013016267A3 WO2013016267A3 (en) | 2013-04-25 |
| WO2013016267A9 WO2013016267A9 (en) | 2013-09-19 |
Family
ID=47601732
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/047815 Ceased WO2013016267A2 (en) | 2011-07-22 | 2012-07-23 | Plants and algae capable of modulating antenna size based on light intensity |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2013016267A2 (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014089533A2 (en) | 2012-12-06 | 2014-06-12 | Synthetic Genomics, Inc. | Algal mutants having a locked-in high light acclimated phenotype |
| US20140242676A1 (en) * | 2013-02-01 | 2014-08-28 | Los Alamos National Security, Llc | Artificial leaf-like microphotobioreactor and methods for making the same |
| WO2014197212A1 (en) * | 2013-06-04 | 2014-12-11 | Exxonmobil Research And Engineering Company | Method for discovering algal strains with reduced pigment to attain higher photosynthetic efficiency |
| WO2016077624A1 (en) | 2014-11-12 | 2016-05-19 | Nmc, Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
| WO2016168756A1 (en) | 2015-04-15 | 2016-10-20 | Synthetic Genomics, Inc. | Algal chloroplastic srp54 mutants |
| WO2016193959A3 (en) * | 2015-06-04 | 2017-04-20 | Nmc, Inc. | Improved productivity and bioproduct formation in phototropin knock/out mutants in microalgae |
| US10227619B2 (en) | 2015-07-14 | 2019-03-12 | Synthetic Genomics, Inc. | Microorganisms having increased lipid productivity |
| WO2019113463A1 (en) | 2017-12-08 | 2019-06-13 | Synthetic Genomics, Inc. | Improving algal lipid productivity via genetic modification of a tpr domain containing protein |
| WO2019133726A1 (en) | 2017-12-29 | 2019-07-04 | Synthetic Genomics, Inc. | Genetic modulation of photosynthetic organisms for improved growth |
| CN114032246A (en) * | 2021-10-26 | 2022-02-11 | 信阳师范学院 | Rice light-harvesting pigment chlorophyll a/b binding protein gene Lhcb3 and application thereof in rice light protection |
| CN114736937A (en) * | 2022-04-26 | 2022-07-12 | 太原理工大学 | A method for promoting the growth and lipid production of Scenedesmus obliquus by utilizing the plant hormone salicylic acid |
| WO2023183765A3 (en) * | 2022-03-21 | 2023-11-09 | Donald Danforth Plant Science Center | Geminivirus resistant plants |
| EP4488369A3 (en) * | 2016-04-13 | 2025-04-23 | Altria Client Services LLC | Tobacco plants exhibiting altered photosynthesis and methods of making and using the same |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7642405B2 (en) * | 2006-05-17 | 2010-01-05 | James Weifu Lee | Switchable photosystem-II designer algae for photobiological hydrogen production |
| US7745696B2 (en) * | 2006-06-12 | 2010-06-29 | The Regents Of The University Of California | Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae |
| CN101932706A (en) * | 2007-12-04 | 2010-12-29 | 俄亥俄州州立大学研究基金会 | Optimized molecular methods for biofuel production |
-
2012
- 2012-07-23 WO PCT/US2012/047815 patent/WO2013016267A2/en not_active Ceased
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014089533A2 (en) | 2012-12-06 | 2014-06-12 | Synthetic Genomics, Inc. | Algal mutants having a locked-in high light acclimated phenotype |
| US9982272B2 (en) | 2012-12-06 | 2018-05-29 | Synthetic Genomics, Inc. | Algal mutants having a locked-in high light acclimated phenotype |
| EP3401388A1 (en) | 2012-12-06 | 2018-11-14 | Synthetic Genomics, Inc. | Algal mutants having a locked-in high light acclimated phenotype |
| US20140242676A1 (en) * | 2013-02-01 | 2014-08-28 | Los Alamos National Security, Llc | Artificial leaf-like microphotobioreactor and methods for making the same |
| WO2014197212A1 (en) * | 2013-06-04 | 2014-12-11 | Exxonmobil Research And Engineering Company | Method for discovering algal strains with reduced pigment to attain higher photosynthetic efficiency |
| US10745708B2 (en) | 2014-11-12 | 2020-08-18 | Nmc, Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
| WO2016077624A1 (en) | 2014-11-12 | 2016-05-19 | Nmc, Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
| AU2015346281B2 (en) * | 2014-11-12 | 2021-12-02 | Nmc, Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
| US11111497B2 (en) | 2014-11-12 | 2021-09-07 | Nmc, Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
| WO2016168756A1 (en) | 2015-04-15 | 2016-10-20 | Synthetic Genomics, Inc. | Algal chloroplastic srp54 mutants |
| WO2016193959A3 (en) * | 2015-06-04 | 2017-04-20 | Nmc, Inc. | Improved productivity and bioproduct formation in phototropin knock/out mutants in microalgae |
| US10590398B2 (en) | 2015-06-04 | 2020-03-17 | Nmc, Inc. | Productivity and bioproduct formation in phototropin knock/out mutants in microalgae |
| US10563232B2 (en) | 2015-07-14 | 2020-02-18 | Synthetic Genomics, Inc. | Microorganisms having increased lipid productivity |
| US10227619B2 (en) | 2015-07-14 | 2019-03-12 | Synthetic Genomics, Inc. | Microorganisms having increased lipid productivity |
| US11332764B2 (en) | 2015-07-14 | 2022-05-17 | Viridos, Inc. | Microorganisms having increased lipid productivity |
| EP4488369A3 (en) * | 2016-04-13 | 2025-04-23 | Altria Client Services LLC | Tobacco plants exhibiting altered photosynthesis and methods of making and using the same |
| WO2019113463A1 (en) | 2017-12-08 | 2019-06-13 | Synthetic Genomics, Inc. | Improving algal lipid productivity via genetic modification of a tpr domain containing protein |
| WO2019133726A1 (en) | 2017-12-29 | 2019-07-04 | Synthetic Genomics, Inc. | Genetic modulation of photosynthetic organisms for improved growth |
| CN114032246A (en) * | 2021-10-26 | 2022-02-11 | 信阳师范学院 | Rice light-harvesting pigment chlorophyll a/b binding protein gene Lhcb3 and application thereof in rice light protection |
| CN114032246B (en) * | 2021-10-26 | 2023-08-29 | 信阳师范学院 | Rice Light Harvesting Pigment Chlorophyll a/b Binding Protein Gene Lhcb3 and Its Application in Rice Photoprotection |
| WO2023183765A3 (en) * | 2022-03-21 | 2023-11-09 | Donald Danforth Plant Science Center | Geminivirus resistant plants |
| CN114736937A (en) * | 2022-04-26 | 2022-07-12 | 太原理工大学 | A method for promoting the growth and lipid production of Scenedesmus obliquus by utilizing the plant hormone salicylic acid |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2013016267A9 (en) | 2013-09-19 |
| WO2013016267A3 (en) | 2013-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2013016267A9 (en) | Plants and algae capable of modulating antenna size based on light intensity | |
| US11459578B2 (en) | Carbon fixation systems in plants and algae | |
| WO2012125737A2 (en) | Methods for increasing carbon fixation | |
| ES2624276T3 (en) | A method for transient expression of nucleic acids in plants | |
| EP3090057B1 (en) | Plants with enhanced photosynthesis and methods of manufacture thereof | |
| US20140242676A1 (en) | Artificial leaf-like microphotobioreactor and methods for making the same | |
| AU2012396282B2 (en) | Tetraselmis promoters and terminators for use in eukaryotic cells | |
| US11111497B2 (en) | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same | |
| CN105164266A (en) | Methods for elevating fat/oil content in plants | |
| US20130145495A1 (en) | Enhanced carbon fixation in photosynthetic hosts | |
| US10041079B2 (en) | Compositions and methods for expressing genes in algae | |
| WO2017091309A2 (en) | Compositions and methods for enhanced plant growth and seed yield | |
| CN117070552A (en) | A method to improve cold resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12818346 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12818346 Country of ref document: EP Kind code of ref document: A2 |


