CN117070552A - Method for improving cold resistance of plants - Google Patents

Method for improving cold resistance of plants Download PDF

Info

Publication number
CN117070552A
CN117070552A CN202210502590.2A CN202210502590A CN117070552A CN 117070552 A CN117070552 A CN 117070552A CN 202210502590 A CN202210502590 A CN 202210502590A CN 117070552 A CN117070552 A CN 117070552A
Authority
CN
China
Prior art keywords
zat11
expression
lox3
plant
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210502590.2A
Other languages
Chinese (zh)
Inventor
张鹏
马秋香
井建玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Center for Excellence in Molecular Plant Sciences of CAS
Original Assignee
Center for Excellence in Molecular Plant Sciences of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Center for Excellence in Molecular Plant Sciences of CAS filed Critical Center for Excellence in Molecular Plant Sciences of CAS
Priority to CN202210502590.2A priority Critical patent/CN117070552A/en
Publication of CN117070552A publication Critical patent/CN117070552A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8266—Abscission; Dehiscence; Senescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y113/00—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11—Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C12Y113/11012—Linoleate 13S-lipoxygenase (1.13.11.12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Abstract

The present invention relates to a method for improving cold resistance of plants. In particular to a method for regulating cold resistance, membrane fluidity, aging response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of aging-related genes and JA (jasmonic acid) content of plants, which comprises the following steps: modulating the expression or activity of ZAT11 and/or LOX 3. The invention discovers the intrinsic mechanism of ZAT11 response to cold stress for the first time.

Description

Method for improving cold resistance of plants
Technical Field
The invention relates to a method for regulating cold resistance of plants, in particular to application of ZAT11 and/or LOX3 serving as targets in regulating cold resistance of plants.
Background
Cassava (Manihot esculenta, crantz) is a food crop from south america, primarily for storing roots of starch. Today, cassava grows in tropical areas of south america, africa and asia, and it is estimated that 8 billions of people rely on cassava as the primary source of energy. In parts of saharan africa, cassava is particularly important for food safety. Tapioca root starch is also used in the pharmaceutical, textile, paper and biofuel industries. Cassava demand has been strong since 2000 and yield has continued to increase year by year, but potential yields are affected by biotic and abiotic stresses. Cassava is a high-yield crop of C3 and C4 plants, can fully utilize light energy to carry out high-efficiency photosynthesis to accumulate starch, and has strong drought resistance in severe environments. Cassava, which is a tropical root crop, can accommodate various environmental stimuli, but is extremely cold sensitive. Low temperature and freezing conditions are the most important limiting factors for their geographical location and productivity. The stress adaptation mechanism of the cassava is researched, and the improvement of the stress resistance of the cassava has important significance for improving the yield of the cassava. Exposure of cassava leaves to light or dark low temperatures inhibits maximum photosynthetic rates and apparent quantum yields. Some studies report physiological, biochemical and molecular changes in cassava response to cold. For example, the transcriptome response of cassava to low temperatures and the enhanced ROS scavenging capacity were studied to improve the resistance of cassava to low temperature stress.
So far, little research has been done on endogenous gene regulation of the cold reaction of cassava. With the development of genome sequencing technology and the completion of cassava genome sequencing, opportunities are provided for genome annotation, classification and comparative genome research. In 2012, researchers studied the transcriptome changes of cassava at low temperature treatment and found a series of low temperature differential expressed genes. The biological functions of these differentially expressed genes are diverse and include signaling, transcription factors, ROS scavenging enzymes, photosynthesis-related genes, and the like.
Disclosure of Invention
The cassava is rich in starch, is sensitive to low temperature, and causes serious influence on the cassava industry due to low temperature and cold damage, but the internal regulation mechanism is not clear. According to the invention, through analysis of a cold stress transcriptome, the obviously induced C2H2 transcription factor MeZAT11 is identified, the gene is interfered by a genetic engineering means, and the cold resistance of the interfered cassava plants is obviously improved. Further analyzing the regulatory elements downstream of the MeZAT11, the gene MeLOX3 related to plasma membrane fluidity is found to be regulated by the regulatory elements; and the regulation and control of MeZAT11 on MeLOX3 are verified by utilizing single and double fluorescence of yeast. The invention not only obtains new germplasm resisting cold, but also analyzes the internal mechanism of the cassava ZAT11 responding to cold stress.
In a first aspect, the present invention provides a method for modulating cold resistance, membrane fluidity, senescence response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of senescence-associated genes, JA content in a plant, comprising the steps of: modulating expression or activity of ZAT11 and/or LOX3 in plants.
In one or more embodiments, the chlorophyll content is the content of chlorophyll a or chlorophyll b.
In one or more embodiments, the plant is a euphorbiaceae plant, preferably a cassava plant, more preferably a cassava plant.
In one or more embodiments, ZAT11 and/or LOX3 are derived from a euphorbiaceae plant, preferably from a cassava plant, more preferably from cassava.
In one or more embodiments, the chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR.
In one or more embodiments, the senescence-associated genes comprise SAG39, ICL1 or ICL2, preferably ICL1.
In one or more embodiments, ZAT11 and/or LOX3 expression or activity is down-regulated, plant cold resistance is enhanced, senescence is delayed, membrane fluidity is up-regulated, active oxygen accumulation is reduced, chlorophyll a content is increased, chlorophyll b content is increased, NYC1 down-regulated, PPH down-regulated, RCCR down-regulated, ICL1 down-regulated, JA content is increased.
In one or more embodiments, ZAT11 and/or LOX3 expression or activity is up-regulated, plants have reduced cold tolerance, increased senescence, down-regulated membrane fluidity, increased active oxygen accumulation, reduced chlorophyll a content, reduced chlorophyll b content, NYC1 up-regulated, PPH up-regulated, RCCR up-regulated, ICL1 up-regulated, reduced JA content.
In one or more embodiments, the up-regulating expression or activity of ZAT11 and/or LOX3 in a plant comprises:
(1) Transferring ZAT11 and/or LOX3 genes into plants to obtain transformed plants; and/or
(2) The ZAT11 and/or LOX3 genes or promoters encoding proteins are contacted with plants.
In one or more embodiments, the ZAT11 and/or LOX3 genes comprise cDNA sequences, genomic sequences, or a combination thereof.
In one or more embodiments, the amino acid sequence of ZAT11 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 1; (b) A polypeptide derived from (a) having the polypeptide function of (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the sequence shown in SEQ ID NO. 1; or (c) a polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).
In one or more embodiments, the amino acid sequence of LOX3 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 2; (b) A polypeptide derived from (a) having the polypeptide function of (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the sequence shown in SEQ ID NO. 2; or (c) a polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).
In one or more embodiments, the method of up-regulating expression of ZAT11 and/or LOX3 in a plant comprises:
(1) Provided is an Agrobacterium harboring a nucleic acid construct containing ZAT11 and/or LOX3 genes,
(2) Contacting a cell or tissue or organ of a plant with the agrobacterium of step (1), thereby transferring the nucleic acid construct into the plant tissue or organ.
In one or more embodiments, the nucleic acid construct is an expression vector or an integration vector.
In one or more embodiments, the method of upregulating expression of ZAT11 and/or LOX3 activity in a plant further comprises: (3) Selecting a plant tissue, organ or seed into which the ZAT11 and/or LOX3 gene has been transferred; and (4) regenerating the plant tissue, organ or seed of step (3) into a plant.
In one or more embodiments, the down-regulating the activity or activity of ZAT11 and/or LOX3 comprises: inhibitors down-regulating ZAT11 and/or LOX3 gene transcription, protein expression or protein activity are transferred into plants.
In one or more embodiments, the inhibitor comprises an inhibitory molecule that specifically interferes with ZAT11 and/or LOX3 gene transcription and/or expression, or down regulates ZAT11 and/or LOX3 activity.
In one or more embodiments, the inhibitory molecules have ZAT11 and/or LOX3 genes or transcripts or expressed proteins thereof as the inhibitory targets. Preferably, the inhibitory molecules have SEQ ID NO. 1 and/or SEQ ID NO. 2 or a coding sequence (DNA or RNA) thereof as the inhibitory target.
In one or more embodiments, the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, sgRNA, a specific antibody or ligand, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). Preferably, the inhibitory molecule is a dsRNA or construct thereof with ZAT11 and/or LOX3 genes or transcripts thereof as inhibitory targets.
In one or more embodiments, the inhibitor is an agent, e.g., sgRNA, that knocks out or knocks down the ZAT11 and/or LOX3 genes using a technique selected from ZFN, TALEN, and CRISPR. In one or more embodiments, the inhibitor further comprises a Cas enzyme (e.g., cas 9), a coding sequence thereof, and/or a nucleic acid construct that expresses the Cas enzyme.
In one or more embodiments, the method of down-regulating ZAT11 and/or LOX3 expression in a plant comprises:
(i) Providing agrobacterium carrying a nucleic acid construct that can interfere with ZAT11 and/or LOX3 gene expression, the nucleic acid construct containing or producing the inhibitor;
(ii) Contacting a cell or tissue or organ of a plant with the agrobacterium of step (i), thereby transferring the nucleic acid construct into the plant tissue or organ.
In one or more embodiments, the nucleic acid construct is an expression vector or an integration vector.
In one or more embodiments, the method of down-regulating ZAT11 and/or LOX3 expression in a plant further comprises:
(iii) Selecting a plant tissue, organ or seed into which the nucleic acid construct has been transferred; and
(iv) Regenerating the plant tissue, organ or seed of step (iii).
In another aspect, the invention provides a method of modulating lipoxygenase 3 (LOX 3), comprising the steps of: modulating the expression or activity of ZAT 11.
In one or more embodiments, the expression or activity of ZAT11 is up-regulated and the expression or activity of lipoxygenase 3 is up-regulated.
In one or more embodiments, the ZAT11 expression or activity is down-regulated and the lipoxygenase 3 expression or activity is down-regulated.
In one or more embodiments, the up-regulating expression or activity of ZAT11 in a plant comprises:
(1) Transferring ZAT11 gene into plant to obtain transformed plant; and/or
(2) The ZAT11 gene or promoter encoding the protein is contacted with the plant.
In one or more embodiments, the ZAT11 gene comprises a cDNA sequence, a genomic sequence, or a combination thereof.
In one or more embodiments, the amino acid sequence of ZAT11 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 1; (b) A polypeptide derived from (a) having the polypeptide function of (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the sequence shown in SEQ ID NO. 1; or (c) a polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).
In one or more embodiments, the amino acid sequence of LOX3 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 2; (b) A polypeptide derived from (a) having the polypeptide function of (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the sequence shown in SEQ ID NO. 2; or (c) a polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).
In one or more embodiments, the method of up-regulating ZAT11 expression in a plant comprises:
(1) An Agrobacterium harboring a nucleic acid construct containing the ZAT11 gene is provided,
(2) Contacting a cell or tissue or organ of a plant with the agrobacterium of step (1), thereby transferring the nucleic acid construct into the plant tissue or organ.
In one or more embodiments, the nucleic acid construct is an expression vector or an integration vector.
In one or more embodiments, the method of upregulating expression of ZAT11 activity in a plant further comprises: (3) Selecting plant tissues, organs or seeds into which the ZAT11 gene is transferred; and (4) regenerating the plant tissue, organ or seed of step (3) into a plant.
In one or more embodiments, the down-regulating the activity or activity of ZAT11 comprises: inhibitors down-regulating ZAT11 gene transcription, protein expression or protein activity are transferred into plants.
In one or more embodiments, the inhibitors include inhibitory molecules that specifically interfere with ZAT11 gene transcription and/or expression, or down-regulate ZAT11 activity.
In one or more embodiments, the inhibitory molecule has the ZAT11 gene or a transcript or expressed protein thereof as an inhibitory target. Preferably, the inhibitory molecule has SEQ ID NO. 1 or a coding sequence (DNA or RNA) thereof as an inhibitory target.
In one or more embodiments, the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, sgRNA, a specific antibody or ligand, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). Preferably, the inhibitory molecule is a dsRNA or construct thereof that targets the ZAT11 gene or transcript thereof for inhibition.
In one or more embodiments, the inhibitor is an agent that knocks out or knocks down the ZAT11 gene, e.g., sgRNA, using a technique selected from ZFN, TALEN, and CRISPR. In one or more embodiments, the inhibitor further comprises a Cas enzyme (e.g., cas 9), a coding sequence thereof, and/or a nucleic acid construct that expresses the Cas enzyme.
In one or more embodiments, the method of down-regulating ZAT11 expression in a plant comprises:
(i) Providing an agrobacterium carrying a nucleic acid construct that can interfere with ZAT11 gene expression, the nucleic acid construct containing or producing the inhibitor;
(ii) Contacting a cell or tissue or organ of a plant with the agrobacterium of step (i), thereby transferring the nucleic acid construct into the plant tissue or organ.
In one or more embodiments, the nucleic acid construct is an expression vector or an integration vector.
In one or more embodiments, the method of down-regulating ZAT11 expression in a plant further comprises:
(iii) Selecting a plant tissue, organ or seed into which the nucleic acid construct has been transferred; and
(iv) Regenerating the plant tissue, organ or seed of step (iii).
In another aspect, the present invention provides a method of down-regulating the expression or activity of ZAT11 and/or LOX3, enhancing cold resistance, delaying senescence, up-regulating membrane fluidity, reducing active oxygen accumulation, increasing chlorophyll a content, increasing chlorophyll b content, down-regulating the expression or activity of chlorophyll degradation genes, down-regulating the expression or activity of senescence-associated genes in a plant, comprising the steps of: the plants are treated with JA or an analogue or derivative thereof.
In one or more embodiments, the derivative of JA is an alkyl jasmonate, preferably methyl jasmonate.
In one or more embodiments, the chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR.
In one or more embodiments, the senescence-associated genes comprise SAG39, ICL1 or ICL2, preferably ICL1.
In one or more embodiments, the plant is a euphorbiaceae plant, preferably a cassava plant, more preferably a cassava plant.
In one or more embodiments, the concentration of JA or an analog or derivative thereof is at least 1 μm, such as at least 5, 10, 15, or 20 μm, preferably about 5-50 μm.
In one or more embodiments, the treatment is for at least 1 hour, such as at least 3, 6, 9, or 12 hours, preferably at least 6 hours.
In one or more embodiments, the treatment comprises treating the root, stem, leaf, flower, fruit, or seed of the plant.
In another aspect, the invention provides the use of ZAT11 and/or LOX3 as targets in modulating plant cold resistance, modulating membrane fluidity, senescence response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degrading genes, expression or activity of senescence-associated genes, JA content.
In one or more embodiments, the plant is a euphorbiaceae plant, preferably a cassava plant, more preferably a cassava plant.
In one or more embodiments, ZAT11 and/or LOX3 are derived from a euphorbiaceae plant, preferably from a cassava plant, more preferably from cassava.
In one or more embodiments, the chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR.
In one or more embodiments, the senescence-associated genes comprise SAG39, ICL1 or ICL2, preferably ICL1.
In another aspect the present invention provides the use of a substance selected from the group consisting of: ZAT11 and/or LOX3 genes or encoded proteins, or promoters or inhibitors thereof.
In one or more embodiments, the chlorophyll content is the content of chlorophyll a or chlorophyll b.
In one or more embodiments, the plant is a euphorbiaceae plant, preferably a cassava plant, more preferably a cassava plant.
In one or more embodiments, the chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR.
In one or more embodiments, the senescence-associated genes comprise SAG39, ICL1 or ICL2, preferably ICL1.
In one or more embodiments, ZAT11 and/or LOX3 are derived from a euphorbiaceae plant, preferably from a cassava plant, more preferably from cassava.
In one or more embodiments, the agent is an accelerator of the expression or activity of ZAT11 and/or LOX3, whereby the plant has reduced cold resistance, increased senescence, reduced membrane fluidity, increased active oxygen accumulation, reduced chlorophyll a content, reduced chlorophyll b content, upregulated NYC1, upregulated PPH, upregulated RCCR, upregulated ICL1, reduced JA content.
In one or more embodiments, the promoter is selected from the group consisting of: small molecule compounds, nucleic acid molecules, or combinations thereof. Preferably, the nucleic acid molecule is a nucleic acid construct comprising ZAT11 and/or LOX3 coding sequences. The nucleic acid construct is an expression vector or an integration vector.
In one or more embodiments, the ZAT11 and/or LOX3 genes comprise cDNA sequences, genomic sequences, or a combination thereof.
In one or more embodiments, the amino acid sequence of ZAT11 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 1; (b) A polypeptide derived from (a) having the polypeptide function of (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the sequence shown in SEQ ID NO. 1; or (c) a polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).
In one or more embodiments, the amino acid sequence of LOX3 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 2; (b) A polypeptide derived from (a) having the polypeptide function of (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues to the sequence shown in SEQ ID NO. 2; or (c) a polypeptide derived from (a) having more than 90% (preferably 93%; more preferably 95% or 98%) homology to the polypeptide sequence of (a) and having the function of the polypeptide of (a).
In one or more embodiments, the agent is an inhibitor of the expression or activity of ZAT11 and/or LOX3, whereby the plant has increased cold resistance, delayed senescence, up-regulation of membrane fluidity, reduced active oxygen accumulation, increased chlorophyll a content, increased chlorophyll b content, down-regulation of NYC1, PPH down-regulation, RCCR down-regulation, ICL1 down-regulation, increased JA content.
In one or more embodiments, the inhibitor comprises an inhibitory molecule that specifically interferes with ZAT11 and/or LOX3 gene transcription and/or expression, or down regulates ZAT11 and/or LOX3 activity.
In one or more embodiments, the inhibitory molecules have ZAT11 and/or LOX3 genes or transcripts or expressed proteins thereof as the inhibitory targets. Preferably, the inhibitory molecules have SEQ ID NO. 1 and/or SEQ ID NO. 2 or a coding sequence (DNA or RNA) thereof as the inhibitory target.
In one or more embodiments, the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, sgRNA, a specific antibody or ligand, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). Preferably, the inhibitory molecule is a dsRNA or construct thereof with ZAT11 and/or LOX3 genes or transcripts thereof as inhibitory targets.
In one or more embodiments, the inhibitor is an agent, e.g., sgRNA, that knocks out or knocks down the ZAT11 and/or LOX3 genes using a technique selected from ZFN, TALEN, and CRISPR. In one or more embodiments, the inhibitor further comprises a Cas enzyme (e.g., cas 9), a coding sequence thereof, and/or a nucleic acid construct that expresses the Cas enzyme. The nucleic acid construct is an expression vector or an integration vector.
In another aspect, the present invention provides a polynucleotide that inhibits ZAT11 and/or LOX3 gene expression, or a nucleic acid construct comprising the polynucleotide, the polynucleotide having: (1) The sequence shown in SEQ ID NO. 3 or its corresponding RNA sequence, or a sequence having at least 90% sequence identity thereto,
(2) siRNA from (1), or
(3) Comprises a structure shown in a formula I:
Seq forward direction -X-Seq Reverse direction The compound of the formula I,
in formula I, seq Forward direction For the sequence shown in (1) or (2), seq Reverse direction Is equal to Seq Forward direction A reverse complement polynucleotide;
x is a spacer sequence located between the forward and reverse directions of the Seq, and the spacer sequence is identical to the Seq Forward direction And Seq Reverse direction Is not complementary.
In one or more embodiments, the siRNA is 10-35bp in length, preferably 15-30bp.
In one or more embodiments, the nucleic acid construct is a vector.
Drawings
Fig. 1: identification of MeZAT11-RNAi transgenic plant molecules. (A) Southern blot identification of MeZAT11-RNAi transgenic cassava. Probes were synthesized using hygromycin phosphotransferase gene. Genomic DNA was digested with EcoRI and HindIII, respectively. (B) MeZAT11 Gene expression levels in leaves of transgenic material. Each group was set up with 3 experimental replicates, meain as an internal reference. Error bars represent standard deviation SD.
Fig. 2: cold-sensitive phenotype of MeZAT11-RNAi transgenic plants. (A) MeZAT11-RNAi cassava phenotype before and after cold treatment at 4 ℃. (B) Electrolyte leaching rate (EL) of MeZAT11-RNAi cassava leaf before and after cold treatment. (C) MDA (malondialdehyde) content in MeZAT11-RNAi cassava leaf before and after cold treatment.
Fig. 3: meZAT11-RNAi phenotype under photoperiod. (A) Cassava pot Miao Biaoxing after two days in incubator adaptation. (B) Phenotype and DAB staining before and after cold treatment of the isolated leaves of the tissue culture seedlings.
Fig. 4: leaf phenotype and chlorophyll content of the MeZAT11-RNAi lines ex vivo under light treatment. (A) in vitro leaf phenotype of MeZAT11-RNAi lines under light treatment. And (3) carrying out normal photoperiod and shading treatment for 3 days, placing the isolated leaves in a sealing bag, and adding water for moisturizing. (B) Content of chlorophyll a and b in leaves of the MeZAT11-RNAi line ex vivo under light treatment. Each set is provided with 3 experimental replicates and the error bars represent standard deviation SD.
Fig. 5: expression of chlorophyll synthesis and degradation related genes and senescence related genes in MeZAT11-RNAi lines. (A-K) are respectively: CAO, chlorophyll a oxidase; CHLG, chlorophyll synthase. NYC1, chlorophyll b reductase; CAR, chlorophyll a reductase; CLH2, chlorophyllase 2; PAO, pheophytin a oxygenase; PPH, pheophytin hydrolase; RCCR, red chlorophyll degradation product reductase; SAG39, senescence-specific cysteine protease 39; ICL1, isocitrate lyase 1; ICL2, isocitrate lyase 2. Each group was set with 3 replicates, meActin as reference gene and error bars as standard deviation SD.
Fig. 6: and (3) the variation condition of the MeZAT11-RNAi strain in the natural cooling process of the field. And (A) climate change trend in the natural cooling process of the field. Min TEMP, minimum temperature. 10o'clock TEMP,10 air temperature. Max TEMP, highest temperature. (B) 11 months wild-type and transgenic leaf phenotype. (C) Percentage of 11 month leaf loss of MeZAT11-RNAi strain to wild-type. (D) wild type and transgenic lines terminal bud phenotype for 10-12 months. The yellow scale is 21cm.
Fig. 7: analysis of expression patterns of genes related to lipid metabolism in MeZAT11-RNAi lines. (A-F) expression of genes related to lipid metabolism in wild-type and transgenic lines. Among them, SSI2, stearoyl-ACP desaturase. FAB1, fatty acid synthetase 1.FAD2, fatty acid dehydrogenase 2.FAD6, fatty acid dehydrogenase 6.LOX3, lipoxygenase 3.LOX6, lipoxygenase 6. Each group was set up with 3 experimental replicates, meain as an internal reference. Error bars represent standard deviation SD.
Fig. 8: analysis of expression pattern of lipoxygenase gene Melox3 in cassava wild-type treatment at 4 ℃. (A-B) expression of lipoxygenase Gene MeLOX3 in wild-type leaves and roots at 4℃in cold treatment. Each group was set up with 3 experimental replicates, meain as an internal reference. Error bars represent standard deviation SD.
Fig. 9: related gene expression conditions in the natural cooling process. (A-C) are the expression of COR47, meLOX3 and MeZAT11 genes during natural cooling. Each group was set up with 3 experimental replicates, meain as an internal reference. Error bars represent standard deviation SD.
Fig. 10: yeast single-hybrid verification of the regulatory relationship of MeZAT11 and MeLOX 3. (A) Yeast single heterogenies verify the relationship of MeZAT11 to the MeLOX3 promoter binding element AGAGAG. pMeLOX3e, meLOX3 promoter binding element. (B) Yeast single heterogenies verify the relationship of MeZAT11 to the truncated MeLOX3 promoter. pMeLOX3t, truncated MeLOX3 promoter. pGADT7 was the negative control.
Fig. 11: the fluorescence reporting system verifies the regulatory relationship of MeZAT11 to MeLOX 3. (A-B) fluorescence reporting System of MeZAT11 and MeLOX3 promoters. MYB1 and GT are positive control, 35s no-load is negative control, and 35s and MeLOX3 promoter are background expression. (C-D) double fluorescence reporting System of MeZAT11 and MeLOX3 promoters. 62sk was negative control with the Melox3 promoter. pMeLOX3w, full length MeLOX3 promoter. pMeLOX3t, truncated MeLOX3 promoter. Each set was set up with 3 experimental replicates.
Fig. 12: quantitative expression analysis of MeZAT11 in wild-type and transgenic cassava under MeJA treatment. Each group was set up with 3 experimental replicates, meain as an internal reference. Error bars represent standard deviation SD.
Detailed Description
The invention selects the zinc finger protein MeZAT11 with the differential expression of C2H2 type to study the function. Through cloning Manes.04G031100 from cassava variety TMS60444, the protein is highly similar to ZAT proteins of other tropical varieties, and it is found that MeZAT11 is induced at low temperature in cassava, and tolerance to cold stress is affected by regulating lipoxygenase genes, and hormone and senescence-associated genes are coordinated to participate in the cold domestication process of cassava.
Accordingly, the present invention provides a method for regulating cold resistance, membrane fluidity, senescence response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of senescence-associated genes, JA content of plants, comprising the steps of: modulating the expression or activity of ZAT11 and/or LOX 3. The plant described herein may be any plant, preferably a model plant (e.g. arabidopsis thaliana, tobacco) or a plant of the order euphorbiales, e.g. a plant of the family euphorbiaceae, preferably a plant of the genus cassava, more preferably cassava.
The ZAT11 and/or LOX3 genes may be derived from any plant. A preferred ZAT11 is derived from cassava and is NCBI XP-021610903.1, which has an ID of Manes.04G031100 in the cassava genome. A preferred LOX3 is derived from cassava and is NCBI XP-021610445.1, which has an ID in the cassava genome of Manes.04G145800.1.
As used herein, "cold resistance" or "resistance to low temperature stress" refers to the ability of a plant to inhibit physiological, biochemical and molecular changes in the plant itself, such as reduced maximum photosynthetic rate, reduced apparent quantum yield, due to low temperature or freezing conditions. Conditions caused by low temperature or freezing include, but are not limited to: blade green loss, blade tip or blade edge discoloration (e.g., from green to pale yellow), blade base discoloration, and in severe cases, blade withering or yellowing, and shedding. In addition, the phenomenon of short spider and slow growth can also occur at low temperature or freezing, and the root system is abnormal in development, poor in grouting and the like.
As used herein, "membrane fluidity" refers to the biological membrane being in a two-dimensional viscous fluid state over a physiological temperature range.
As used herein, "senescence response" refers to the inability of a plant to maintain green, to appear yellowish, or the presence of multiple response elements in the plant that cause senescence in the plant. The senescence response described herein is generally caused by light, with active oxygen bursts to activate the senescence response mechanism.
As used herein, "active oxygen accumulation" refers to the accumulation of significant amounts of active oxygen in plant cells under conditions of environmental stress or the like, resulting in severe damage to proteins, membrane lipids, DNA, and other cellular components. As is well known to those skilled in the art, when the active oxygen exceeds a threshold value, peroxidation of membrane lipid is directly initiated or aggravated, one side of the membrane is subjected to phase separation, the lipid composition is changed, the membrane lipid is converted from a liquid crystal state to a gel state, and the mobility of the membrane is reduced; on the other hand, the peroxidation product Malondialdehyde (MDA) and its analogues also directly cause phytotoxicity, and MDA can attack amino groups of proteins, resulting in intra-and inter-chain crosslinking of polypeptide chains, creating membrane interstices.
Chlorophyll as described herein includes, but is not limited to, chlorophyll a, chlorophyll b. Preferably, the expression or activity of ZAT11 and/or LOX3 is down-regulated and the chlorophyll content is increased. More preferably, the expression or activity of ZAT11 and/or LOX3 is down-regulated, the chlorophyll a content is increased, the chlorophyll b content is increased.
Chlorophyll degradation genes described herein include, but are not limited to: NYC1, PPH, RCCR. In exemplary embodiments, chlorophyll degradation gene expression level changes include, but are not limited to: and the NYC1 expression quantity is down-regulated, the PPH expression quantity is down-regulated, and the RCCR expression quantity is down-regulated.
The senescence-associated genes SAG39, ICL1, ICL2 described herein. Preferably, the senescence-associated gene comprises ICL1. In exemplary embodiments, the senescence-associated gene expression level changes include, but are not limited to, ICL1 expression level down-regulation.
The JA content herein refers to the content of jasmonic acid. It is known to those skilled in the art that jasmonic acid is a derivative of fatty acid, is a plant hormone existing in all higher plants, is commonly existing in tissues and organs such as flowers, stems, leaves, roots and the like of plants, plays an important role in the growth and development process of plants, and has physiological effects of inhibiting plant growth, germination, promoting aging, improving resistance and the like. The inventors found that ZAT11 and/or LOX3 expression or activity was down-regulated and JA content was increased.
Furthermore, a method for down-regulating ZAT11 and/or LOX3 expression or activity comprises (i) providing an Agrobacterium harboring a nucleic acid construct that can interfere with ZAT11 and/or LOX3 expression, said nucleic acid construct containing or producing said inhibitor; (ii) Contacting a cell or tissue or organ of a plant with the agrobacterium of step (i), thereby transferring the nucleic acid construct into the plant tissue or organ; (iii) Selecting a plant tissue, organ or seed into which the nucleic acid construct has been transferred; and (iv) regenerating the plant tissue, organ or seed of step (iii).
As used herein, "modulating" includes "up-regulating" and "down-regulating". Thus, the methods described herein comprise upregulating ZAT11 and/or LOX3 expression or activity, thereby affecting reduced cold tolerance, increased senescence, decreased membrane fluidity, increased active oxygen accumulation, decreased chlorophyll a content, decreased chlorophyll b content, NYC1 upregulation, PPH upregulation, RCCR upregulation, ICL1 upregulation, decreased JA content in plants. The methods further comprise down-regulating the expression or activity of ZAT11 and/or LOX3, thereby affecting plant cold resistance enhancement, senescence delay, membrane fluidity up-regulation, active oxygen accumulation reduction, chlorophyll a content increase, chlorophyll b content increase, NYC1 down-regulation, PPH down-regulation, RCCR down-regulation, ICL1 down-regulation, JA content increase.
Any substance that increases the activity of ZAT11 and/or LOX3, increases its stability, promotes its expression, increases its useful duration of action, or promotes its transcription and translation of genes can be used in the present invention as a "promoter" of the ZAT11 and/or LOX3 genes for modulating agronomic traits in plants. Such as vectors that increase ZAT11 and/or LOX3 expression or activity.
Alternatively, to up-regulate the activity of ZAT11 and/or LOX3, an accelerator of ZAT11 and/or LOX3 may be contacted with the plant. Promoters for ZAT11 and/or LOX3 include, but are not limited to, small molecule compounds, nucleic acid molecules, or combinations thereof. Preferably, the nucleic acid molecule is a nucleic acid construct comprising ZAT11 and/or LOX3 coding sequences. The nucleic acid construct is an expression vector or an integration vector.
In another aspect, any agent that decreases the activity of ZAT11 and/or LOX3, decreases its stability, inhibits its expression, decreases its effective duration of action, or decreases its transcription and translation may be used in the present invention as an inhibitor of ZAT11 and/or LOX 3. The inhibitor can be used for regulating cold resistance, membrane fluidity, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation gene, and expression or activity of senescence-associated gene of plants.
The present invention also provides a method for regulating the expression or activity of ZAT11 and/or LOX3, plant cold resistance, membrane fluidity, senescence response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of senescence-associated genes in a plant, comprising the steps of: the plants are treated with JA or an analogue or derivative thereof. Herein, the derivative of JA includes alkyl jasmonates, preferably methyl jasmonate (MeJA).
The invention also provides application of ZAT11 and/or LOX3 serving as targets in regulating cold resistance of plants, regulating membrane fluidity, aging response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of aging-related genes and JA content.
Illustratively, to down-regulate the expression or activity of ZAT11 and/or LOX3, an inhibitory molecule that specifically interferes with the transcription and/or expression of ZAT11 and/or LOX3, or down-regulates the activity of ZAT11 and/or LOX3 proteins, may be transferred into a cell or plant such that the cell or plant does not express or reduce the ZAT11 and/or LOX3 genes. The inhibition molecules take ZAT11 and/or LOX3 genes or transcripts or expression proteins thereof as inhibition targets. Thus, the inhibitory molecule may have the protein shown in SEQ ID NO. 1 or 2 or a coding sequence thereof as an inhibitory target. The inhibitory molecule may be a small molecule compound known to be capable of inhibiting ZAT11 and/or LOX3 activity, an antibody or ligand of ZAT11 and/or LOX3 protein or binding fragment thereof, or antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, or sgRNA interfering with ZAT11 and/or LOX3 gene expression. In an exemplary embodiment, the invention uses dsRNA with the nucleotide sequence of SEQ ID NO. 3 as an inhibitory target.
In addition, in order to down-regulate ZAT11 and/or LOX3 gene expression or activity, a gene knockout vector may be transferred in a cell. Thus, the inhibitor may be an agent, such as sgRNA, that knocks out or knocks down the ZAT11 and/or LOX3 genes using a technique selected from ZFN, TALEN, and CRISPR. ZFN, TALEN and CRISPR/Cas9 technologies suitable for use in the present invention are well known in the art. The technologies realize the knockout of target genes through the combined action of DNA recognition domains and endonuclease. In these embodiments, the inhibitor further comprises a Cas enzyme (e.g., cas 9), a coding sequence thereof, and/or a nucleic acid construct that expresses the Cas enzyme.
The invention also provides the use of a substance selected from the group consisting of: ZAT11 and/or LOX3 genes or encoded proteins, or promoters or inhibitors thereof.
The present invention also provides a polynucleotide that inhibits the expression of ZAT11 and/or LOX3 genes or a nucleic acid construct comprising the polynucleotide, the polynucleotide having: (1) the sequence shown in SEQ ID NO. 3 or its corresponding DNA sequence, or a sequence having at least 90% sequence identity thereto, (2) an siRNA derived from (1), or (3) comprising the structure shown in formula I:
Seq forward direction -X-Seq Reverse direction The compound of the formula I,
in formula I, seq Forward direction For the sequence shown in (1) or (2), seq Reverse direction Is equal to Seq Forward direction A reverse complement polynucleotide; x is a spacer sequence located between the forward and reverse directions of the Seq, and the spacer sequence is identical to the Seq Forward direction And Seq Reverse direction Is not complementary. X may be a spacer sequence commonly used in the art for dsRNA hairpin structures, such as a contiguous U.
The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide. A "polynucleotide encoding a polypeptide" may be a polynucleotide that includes a polynucleotide encoding the polypeptide, or may also include additional coding and/or non-coding sequences.
The application also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The application relates in particular to polynucleotides which hybridize under stringent conditions to the polynucleotides of the application. In the present application, "stringent conditions" means (1) hybridization and elution at a lower ionic strength and a higher temperature, such as 0.2 XSSC, 0.1% SDS,60 ℃; or (2) adding denaturing agents such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll,42℃and the like during hybridization; or (3) hybridization only occurs when the identity between the two sequences is at least 90% or more, more preferably 95% or more. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO. 1 or 2.
It is to be understood that although the genes provided in the examples of the present application are derived from cassava, gene sequences derived from other similar plants, in particular plants belonging to the same family or genus as cassava, which have a certain homology (e.g.over 70%, such as 80%,85%, 90%, 95%, even 98% sequence identity) with the sequences of the present application, preferably as shown in SEQ ID NO:1 or 2, are included within the scope of the present application, as long as the person skilled in the art, after reading the present application, can easily isolate the sequences from other plants according to the information provided in the present application. Methods and tools for aligning sequence identity are also well known in the art, such as BLAST.
The full-length nucleotide sequence or a fragment thereof of the present invention can be usually obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, primers can be designed according to the nucleotide sequences disclosed in the present invention, particularly the open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available DNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order. Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. It is usually cloned into a vector, transferred into a cell, and then isolated from the proliferated host cell by a conventional method to obtain the relevant sequence. Furthermore, the sequences concerned can be synthesized by artificial synthesis. At present, it is already possible to obtain the DNA sequences encoding the proteins of the invention (or fragments or derivatives thereof) entirely by chemical synthesis. In addition, mutations can be introduced into the protein sequences of the invention by chemical synthesis.
The invention also provides a recombinant vector comprising a polynucleotide of the invention. As a preferred mode, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one cleavage site. When it is desired to express the gene of interest of the present invention, the gene of interest is ligated into a suitable multiple cloning site or cleavage site, thereby operably linking the gene of interest to a promoter. As another preferred mode, the recombinant vector comprises (from 5 'to 3') the following: promoters (e.g., 35S promoters), genes of interest, and terminators. The recombinant vector may further comprise, if desired, an element selected from the group consisting of: a 3' polynucleotide acidification signal; an untranslated nucleic acid sequence; transport and targeting nucleic acid sequences; resistance selection markers (dihydrofolate reductase, neomycin resistance, hygromycin resistance, green fluorescent protein, etc.); an enhancer; or an operator. The vector may be an expression vector for expressing a gene, dsRNA, related enzyme, sgRNA, or the like, or an integration vector; the latter is used to integrate the nucleic acid sequence of the desired expression into the genome. Exemplary vectors are, for example, p1301s, pAbAi, pGADT7, p1300-GFP, pA7-GFP, pGreenII-62sk and pGreenII-0800.
Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. The expression vector may be a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In general, any plasmid or vector may be used as long as it is capable of replication and stability in a host.
One of ordinary skill in the art can construct expression vectors containing the genes of the present invention using well known methods. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. When the gene of the present invention is used to construct recombinant expression vectors, any one of enhanced, constitutive, tissue-specific or inducible promoters may be added before the transcription initiation nucleotide.
Vectors comprising the genes, expression cassettes or the invention may be used to transform an appropriate host cell to allow the host to express the protein. The host cell may be a prokaryotic cell such as E.coli, streptomyces, agrobacterium; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote (e.g., E.coli), caCl may be used 2 The treatment can also be carried out by electroporation. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate co-precipitation, conventional mechanical methods (e.g., microinjection, electroporation, liposome encapsulation, etc.). The transformed plants may also be transformed by Agrobacterium or gene gun, such as spraying, leaf disc, embryo transformation, flower bud soaking, etc. Plants can be regenerated from the transformed plant cells, tissues or organs by conventional methods to obtain transgenic plants. When expressed in higher eukaryotic cells, the polynucleotide will have enhanced transcription if inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase the transcription of a gene.
It will be clear to a person of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.
The polypeptides described herein may be expressed within a cell, or on a cell membrane, or secreted outside of a cell. If desired, the recombinant proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Such methods are well known to those skilled in the art. Examples of such methods include (but are not limited to): conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods.
The invention has the following beneficial effects:
in the cold stress process, a membrane senses cold signals, and the cold signals are transmitted into cells through various receptors and ion channels to induce the expression of MeZAT11, positively regulate and control MeLOX3 and influence unsaturated fatty acid oxidation. The unsaturated fatty acid of 16-18 carbon atoms such as linoleic acid LA, linolenic acid LeA and the like is oxidized to generate JA precursor substances OPDA and oxidation products MDA, JA feedback inhibits the expression of MeZAT11, and the MeZAT11 also regulates and controls chlorophyll degradation genes NYC1 and senescence-associated genes SAG, jointly regulates and controls the senescence process and participates in cold domestication of cassava.
Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein. The invention will be further illustrated by means of specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the invention. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.
Examples
Experimental materials
1. Plant material
Wild type cassava TMS60444; cultivar south China No. 8.
Tobacco of Benshi.
2. Strain
Coli (Escherichia coli): DH5 alpha, transT1 (Trans);
Agrobacterium tumefaciens (Agrobacterium tumefaciens): LBA4404 (RifrChlr), GV3101 (RifrTetr);
yeast strain: yeast screen library strain Y1H, Y H.
3. Plasmid(s)
Plant expression vector: blunt simple, pA7-GFP, p1300-GFP,1305-flag, psgR-cas9-At/Os, pCAMBIA-1301s, PBS (RNAi intermediate vector), pLL00r, pGreenII-62sk, pGreen-0800, pGEX-4T. Yeast expression vector: pGADT7, pGBKT7, pAbAi.
Experimental method
1. Vector construction
(1) MeZAT11-RNAi vector construction
PCR amplification of interfering sequence of MeZAT11 with cassava cDNA as template, joining PCR product (SEQ ID NO:3 and its reverse complement) to pMD18-T, joining sense strand gene to PBS vector through KpnI and ClaI cleavage site after sequencing verification, joining antisense strand to PBS vector through XhoI and BamHI cleavage site to form interfering vector PBS-MeZAT11, cutting with KpnI and BamHI, and inserting the whole fragment into p1301s vector.
Sense strand and antisense strand primers for RNAi
MeZAT11-RNAiF-F KpnI ATAGGTACCAAACTGAAGCACCCACTG(SEQ ID NO:4)
MeZAT11-RNAiF-R ClaI CGTATCGATGTCAAGTCATTCTCCACC(SEQ ID NO:5)
MeZAT11-RNAiR-F XhoI ATACTCGAGGTCAAGTCATTCTCCACC(SEQ ID NO:6)
MeZAT11-RNAiR-R BamHI TTAGGATCCAAACTGAAGCACCCACTG(SEQ ID NO:7)
Underlined are cleavage sites
(2) Yeast single hybrid vector construction
Yeast single hybrid vectors are classified into pAbAi vectors, in which full-length promoters or cis-acting elements on promoters are linked, and pGADT7 vectors, in which transcription factors are linked. A three-fold repeat cis-element with homology arms was synthesized and the pAbAi vector was double digested with HindIII and XhoI, and the cis-element fragment was ligated to the pAbAi vector by homologous recombination.
Designing a primer with a homology arm, and amplifying the full length of a CDS region of the gene by using cassava wild type cDNA as a template. NdeI and EcoRI double-digested pGADT7 vector, and the transcription factor fragment was ligated to pGADT7 vector by homologous recombination after recovery.
(3) Subcellular localization vector construction and transformation
The CDS sequence of MeZAT11 without stop codon was ligated to p1300-GFP and pA7-GFP vectors by SalI and SpeI double cleavage to obtain correct clones and transformed Agrobacterium.
(4) Double fluorescence system carrier construction
The full length of MeZAT11 CDS and the promoter of MeLOX3 were constructed on pGreenII-62sk and pGreenII-0800 vectors, respectively, by recombinant methods.
(5) Prokaryotic expression vector construction
The pGEX-4T prokaryotic expression vector is digested by restriction enzymes BamHI and SmaI, the target gene is amplified by a primer with a homology arm, and then the target gene is connected by homologous recombination enzyme, so that the correct recombinant plasmid is identified to transform the escherichia coli BL21.
2. Transformation
(1) Cassava suspension callus genetic transformation
Culturing the tissue culture seedling for 1 month, taking terminal buds or axillary buds to induce and obtain somatic embryos and friable embryogenic callus, and carrying out genetic transformation on the constructed vector to obtain a transgenic plant.
(2) Tobacco conversion
The p1300-GFP vector was transformed into Agrobacterium for tobacco transformation.
(3) Yeast transformation
pAbAi-MeLOX3 was co-transformed with pGADT7 into yeast Y1H.
(4) Cassava protoplast isolation and transformation
About 1g of fresh plant leaves is taken, minced and placed in a dish, and 20mL of enzymatic hydrolysate (9% w/v mannitol, 0.02M KCl,0.02M MES,1%w/v Cellulase R-10,0.4% w/v Macerozyme R-10, 0.1%BSA,0.01M CaCl2,0.035%v/v. Beta. -ME, pH 5.8) is added. The shaking table is adjusted to 70rpm, and enzymolysis is carried out for 5 hours in dark. The enzymatically hydrolyzed solution was filtered through a double layer nylon membrane, slowly accelerated at 4 ℃, centrifuged at 100g for 3min, the supernatant discarded, and resuspended in 10mL of pre-chilled W5 solution (154mM NaCl,125mM CaCl2,5mM KCl,2 mM MES,pH 5.8). Centrifuging for 3min, and repeating the above steps. After washing twice, the solution was resuspended in 2mL of W5, and left on ice for 30min, 20. Mu.L was taken and examined under a microscope.
The isolated cassava protoplasts were centrifuged at low speed for 3min and resuspended in 600. Mu.L-1 mL MMg solution (0.4% w/v mannitol, 15mM MgCl2,4mM MES,pH 5.6) to a protoplast density of 107 per mL. Split charging, 15 μg plasmid was added per 100 μl protoplast solution, gently mixed to prevent disruption. 110. Mu.L of freshly prepared PEG4000 (0.4% w/v PEG4000,0.2M mannitol, 0.1M CaCl2) was then added and gently mixed upside down. The mixture was allowed to stand at room temperature for 8 to 10 minutes, and the W5 solution (200+400+800. Mu.L) was added in portions, and allowed to stand for 1 to 2 minutes after each addition was completed. The supernatant was removed by centrifugation, resuspended in 1mL of W5 solution, and the supernatant was removed by centrifugation again. Resuspension was performed with 50. Mu.L-200. Mu.L WI solution (4 mM MES,9% mannitol, 20mM KCl, pH 5.8) and dark at room temperature for 16-24h.
3. Wild-type cryogenic treatment analysis
Cassava stress treatment conditions: and (3) subculturing tissue culture seedlings with good growth vigor, transplanting the tissue culture seedlings to a sugar-free culture system after 7-8d rooting, growing for 2-3 weeks, treating at 4 ℃ and sampling at 0h, 1h, 3h, 6h and 12h respectively.
4. Low-temperature treatment analysis of potted seedlings
Transplanting tissue culture seedlings with a month size into square small basins, growing for 1-2 months in a climatic chamber (6 h light/8 h dark, 28 ℃) and then transferring to a light incubator (60% light, 16h light/8 h dark, 70% humidity, 28 ℃) for two days at 28 ℃, then carrying out cold treatment, automatically cooling the incubator to 4 ℃, carrying out about 30min, and continuously carrying out cold treatment until phenotype appears; the isolated leaves of the tissue culture seedlings are subjected to cold treatment, cold domestication is carried out before the treatment, the temperature is gradually reduced, namely, 28 ℃ to 18 ℃ to 12 ℃ to 7 ℃ to 4 ℃ for each day and then 4 ℃ is maintained, and phenotype can appear in the gradual temperature reduction process.
5. Light treatment of in-vitro leaves of cassava tissue culture seedlings
Growing the cassava tissue culture seedlings in a CBM solid culture medium for about 1-2 months, taking leaves with consistent growth vigor, placing the leaves in a sealing bag, and adding ddH 2 O is moisturized, sealed and placed in an illumination incubator, a group of normal photoperiod and a group of shading treatment are carried out, and the phenotype is measured after obvious difference from a wild type control appears.
6. Chlorophyll content determination
Cutting leaf, weighing 1g, placing into centrifuge tube, adding 5mL of 95% ethanol to extract chlorophyll, and placing in dark place 12-24 h to extract pigment until leaf is white, and spectrophotometry to determine OD663nm and OD646nm;
the calculation formula is as follows:
Chl a＝12.7×OD663-2.69×OD646；
Chl b＝22.9×OD646-4.68×OD663；
Chl a+Chl b＝8.02×OD663+20.2×OD646。
the chlorophyll content unit is μg/mL, and is converted to mg/g.
7. Electrolyte permeability determination
Take 50mL centrifuge tube and number. Taking 20 small discs by using a puncher, adding 10mL of deionized water, vacuumizing for 2 times, and soaking for 30min, wherein the process is carried out at room temperature.
The electrolyte permeability value is measured by stirring or shaking up and down the soaking solution in each centrifuge tube before measurement. The electrolyte permeability of the soaking solution is measured, the soaking solution is boiled in boiling water for 10min, and the electrolyte permeability is measured after the soaking solution is cooled to room temperature. The calculation is carried out according to the following formula:
electrolyte leaching rate (%) =soaking solution electrolyte permeability value/electrolyte permeability value after boiling×100
8. Malondialdehyde (MDA) content determination
Blade shearing and grinding, weighing 1g, adding 10mL 10%TCA,4000g homogenate, centrifuging for 10min, and sucking 2mL of supernatant (control is 2mL ddH) 2 O), adding 2mL of 0.6% TBA solution, mixing, boiling in boiling water for 15min, and rapidly coolingAfter cooling, the mixture was centrifuged again. The supernatant was taken and absorbance was measured:
C(μmol/L)＝6.45×(OD532－OD600)－0.56×OD450
The MDA content is measured in. Mu. Mol/L and is finally converted into nmol/g.
DAB staining experiments
Adding 20mL DAB staining solution into a round dish to immerse the leaves, vacuumizing for 10min, placing under light, staining for 6-8h, fully staining when the solution changes color, pouring out the staining solution, adding 95% ethanol, decolorizing at 80deg.C for 10min, and replacing ethanol until the pigment is removed completely.
Example 1: acquisition and identification of transgenic plants
In order to explore the function of the MeZAT11 gene in cassava bodies, especially in the aspect of adverse stress, an RNAi transgenic cassava strain is created by using a conversion method of infecting cassava callus by agrobacterium tumefaciens, and the obtained MeZAT11-RNAi transgenic cassava strain is subjected to Southern blot identification (shown in figure 1) to verify the function, so that 2 RNAi transgenic strains are obtained through total identification. The expression level of the MeZAT11 gene in transgenic plants was examined by qRT-PCR (Ri-9, ri-12, ri-19, ri-22 each represent a different transgenic line).
Example 2: cold resistance analysis of transgenic cassava potted seedlings
In order to study the growth condition of transgenic cassava under abiotic stress treatment, the potted cassava seedlings with consistent growth vigor in a phytotron are moved to an illumination incubator, the temperature is 28 ℃ for two days, the wild cassava leaves are obviously wilted after 3 hours at the temperature of 4 ℃ to appear phenotypes (figure 2), the conductivity and the MDA content are measured, wherein the conductivity difference is not large, but the MDA content difference is obvious, the transgenic system is obviously lower than the wild type, and the MeZAT11-RNAi can improve the cold resistance of the cassava.
Example 3: cold resistance analysis of isolated leaves of transgenic cassava tissue culture seedlings
After two days of adaptation at 28℃during cold treatment, the wild type developed a yellowing phenotype (FIG. 3, A), possibly associated with light-induced senescence, and the MeZAT11 promoter was analyzed to find that it did contain multiple light-responsive elements. To verify if MeZAT11 responds to both cold and light,removing leaves of tissue culture seedling, placing in sealed bag, adding 1mL ddH 2 O is moisturized, placed in an illumination incubator for gradient cooling, continuously illuminated, treated for one day at 28-18-12-7-4 ℃ and the wild type is obviously yellow at 7 ℃ for 5 hours, and is dyed by DAB to observe H 2 O 2 Accumulation of wild type H 2 O 2 The content is significantly higher than that of the transgenic line (figure 3), the wild type uses active oxygen bursts to activate senescence response mechanisms, while the transgenic line has less active oxygen accumulation, senescence mechanisms are not activated, and leaves remain green.
Example 4: variation of leaf chlorophyll content of transgenic cassava under influence of cold and light
To observe the phenotype of MeZAT11 alone under light treatment, the leaves of tissue culture seedlings were subjected to light treatment, a set of normal photoperiod and a set of shading treatments, the wild type of the photoperiod treatment was found to be significantly yellow after 3d, but the degree of yellowing was slightly lower than the cold and light double stress (fig. 4), the shading treatments were not significantly different, and the chlorophyll content was determined, which indicated that the light treatment caused a decrease in the levels of wild type chlorophyll a and chlorophyll b (fig. 4), leaf senescence, while the transgenic lines remained green, delaying senescence. This indicates that RNAi plants show less chlorophyll decrease under cold treatment, indicating enhanced plant cold resistance.
Example 5: meZAT11 participates in chlorophyll degradation pathway
The qRT-PCR detects the expression levels of chlorophyll synthesis and degradation related genes and leaf senescence related genes (figure 5), and the result shows that the wild type yellowing is caused by chlorophyll degradation, chlorophyll degradation genes NYC1, PPH and RCCR are obviously lower than the wild type in a transgenic line, and the expression levels of senescence related genes ICL1 are obviously different, and the combination and mutual coordination cause the green holding of the transgenic line. Moreover, these four genes may be target genes for MeZAT11, since the promoters were analyzed to find that they do contain 1-3 binding sites, and their specific regulatory mechanisms need to be further verified.
Example 6: cold resistance analysis of transgenic cassava field seedlings
In the field test process in 2020, cassava leaves in the natural cooling process (figure 6) for 9-12 months are respectively sampled, cassava phenotypes of wild type and transgenic lines are observed, and the cassava leaves of the MeZAT11-RNAi line are found to have yellow spots in advance, namely cold stress is perceived in advance, and when the air temperature is reduced to about 10 ℃, the top buds stop growing, and in addition, the fallen leaf percentage result shows that the transgenic lines are obviously higher than the wild type, namely the transgenic lines are subjected to cold stress through early fallen leaves.
Example 7: meZAT11 direct regulation of lipoxygenase MeLOX3
Because of the significant difference in MDA content between the cold-treated wild-type and the transgenic cassava (FIG. 2), the expression of MDA pathway-related genes, including stearoyl-ACP desaturase (SSI 2), fatty acid synthase 1 (FAB 1), fatty Acid Dehydrogenase (FAD) and Lipoxygenase (LOX), was examined by qRT-PCR, wherein the expression level of lipoxygenase 3 was significantly lower than that of the wild-type prior to cold treatment (FIG. 7). From this, it was hypothesized that MeZAT11 may have a regulatory relationship with MeLOX3, and qRT-PCR detected MeLOX3 during cold treatment. The results of the gene expression at different time points show that the expression patterns of the MeLOX3 and the MeZAT11 are similar (figure 8), the expression is cold-induced, the expression quantity of the MeLOX3 is highest at 12h, but the expression patterns in roots are different and are obviously higher than those of leaves, and the positive regulation and control relationship possibly exists. qRT-PCR detects that the expression quantity (figure 9) of the COR47 gene in the cold domestication process shows corresponding change trend along with the change of air temperature, and the dynamic change process of the sample conforming to natural cooling is indicated. The expression of MeZAT11 and MeLOX3 bound in wild type (fig. 9) increased with increasing MeZAT11, but the increase in MeLOX3 was not large, probably because there were also other factors, and it was also demonstrated that MeZAT11 positively regulated MeLOX3.
The binding element AGAGAGAG of the MeLOX3 promoter was constructed separately by experimental verification using a single yeast impurity (FIG. 10), and tandem repeats were ligated to pAbAi vector and pABAi vector truncated to 500bp promoter upstream of ATG, and the single yeast impurity result indicated that MeZAT11 had a regulatory relationship with MeLOX 3. The transient expression was performed by injecting tobacco and using the full length truncated promoter of Melox3 (FIG. 11), respectively, and LUC fluorescence showed that although Melox3 had background expression, the fluorescence signal was enhanced after adding MeZAT11, indicating that there was a positive regulatory relationship. Further validation with a dual fluorescence reporting system (fig. 11) confirmed that MeZAT11 did activate MeLOX3 gene expression, i.e., meZAT11 was an upstream positive regulatory transcription factor of LOX 3.
Since MeZAT11 upregulates MeLOX3, and MeLOX3 is an enzyme in the JA synthesis pathway, then JA feedback regulates MeZAT 11? Cassava tissue culture seedlings were treated with 20. Mu.M MeJA, wild type and transgenic lines were sampled at 0, 1, 3, 6, 9, 12h, respectively, the expression level of MeZAT11 was examined, qRT-PCR results showed (FIG. 12), meJA inhibited the expression of MeZAT11, and the opposite in transgenic lines, indicating that JA feedback inhibited the expression of MeZAT 11.
SEQUENCE LISTING
<110> molecular plant science Excellent innovation center of China academy of sciences
<120> a method for improving cold resistance of plants
<130> 221636 1CNCN
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 162
<212> PRT
<213> Manihot esculenta
<400> 1
Met Lys Arg Glu Arg Glu Glu Ala Gly Gly Thr Glu Leu Ala Leu Asp
1 5 10 15
Met Ala Asn Cys Leu Met Leu Leu Ser Lys Val Gly Gln Thr Glu Ala
20 25 30
Pro Thr Gly Arg Leu Phe Ala Cys Lys Thr Cys Asn Arg Lys Phe Thr
35 40 45
Ser Phe Gln Ala Leu Gly Gly His Arg Ala Ser His Lys Lys Pro Lys
50 55 60
Leu Ile Gly Asp Asp Leu Leu Thr Ser Ser Pro Pro Lys Pro Lys Thr
65 70 75 80
His Glu Cys Ser Ile Cys Gly Leu Glu Phe Pro Val Gly Gln Ala Leu
85 90 95
Gly Gly His Met Arg Arg His Arg Gly Gly Ile Gly Lys Asn Met Asp
100 105 110
Asp Ala Arg Pro Leu Phe Pro Val Pro Val Met Lys Lys Ser Thr Ser
115 120 125
Lys Arg Val Leu Cys Leu Asp Leu Asn Leu Thr Pro Val Glu Asn Asp
130 135 140
Leu Thr Leu Gln Leu Gly Lys Ile Val Gln Thr Ser Val Phe Asn Cys
145 150 155 160
Tyr Ile
<210> 2
<211> 922
<212> PRT
<213> Manihot esculenta
<400> 2
Met Ser Leu Ala Lys Glu Ile Met Gly Ser Ser Leu Ile Asp Lys Ser
1 5 10 15
Ser Phe Ala Ser Met Ser Ser Lys Val Leu Phe Asn His Ser Phe His
20 25 30
Gln Lys Asn Gln Phe Leu Val Lys Pro Val Leu Val Pro Leu Gln His
35 40 45
Arg Arg Ile Asn Val Gln Arg Ala Ala Val Arg Gly Pro Val Ala Ala
50 55 60
Ile Ser Glu Asp Leu Ile Arg Ala Asn Ser Asn Lys Asp Thr Val Pro
65 70 75 80
Glu Lys Ala Val Thr Phe Lys Val Arg Ala Val Val Thr Val Arg Asn
85 90 95
Lys Asn Lys Glu Asp Leu Lys Glu Thr Ile Ala Lys His Trp Asp Ala
100 105 110
Phe Ala Asp Lys Ile Gly Arg Asn Val Val Leu Glu Leu Ile Ser Thr
115 120 125
Glu Val Asp Pro Lys Thr Asn Thr Pro Lys Arg Ser Lys Lys Ala Val
130 135 140
Leu Lys Asp Trp Ser Lys Lys Ser Asn Val Lys Ala Glu Lys Val His
145 150 155 160
Tyr Thr Ala Glu Phe Gln Val Asp Ser Asn Phe Gly Val Pro Gly Ala
165 170 175
Ile Thr Val Ser Asn Lys His Gln Lys Glu Phe Phe Leu Glu Thr Ile
180 185 190
Thr Leu Glu Gly Phe Ala Cys Gly Pro Val His Phe Pro Cys Asn Ser
195 200 205
Trp Val Gln Ser Ser Lys Asp His Pro Ala Lys Arg Ile Phe Phe Ser
210 215 220
Asn Glu Pro Tyr Leu Pro Ser Glu Thr Pro Ala Gly Leu Arg Val Leu
225 230 235 240
Arg Glu Lys Glu Leu Arg Asp Ile Arg Gly Asp Gly Lys Gly Glu Arg
245 250 255
Lys Leu Ser Asp Arg Ile Tyr Asp Phe Asp Val Tyr Asn Asp Leu Gly
260 265 270
Asn Pro Asp Lys Gly Val Ala Leu Ala Arg Pro Lys Leu Gly Gly Glu
275 280 285
Asn Ile Pro Tyr Pro Arg Arg Cys Arg Thr Gly Arg Arg Pro Thr Asp
290 295 300
Thr Asp Ile Asn Ala Glu Gly Arg Val Glu Lys Pro Leu Pro Met Tyr
305 310 315 320
Val Pro Arg Asp Glu Gln Phe Glu Glu Ser Lys Gln Lys Thr Phe Ser
325 330 335
Ala Gly Arg Leu Lys Ala Val Leu His Ser Leu Ile Pro Ser Leu Lys
340 345 350
Ala Thr Ile Ser Ala Glu Asn His Asp Phe Asn Ala Phe Ser Asp Ile
355 360 365
Asp Ile Leu Tyr Lys Glu Gly Leu Leu Leu Lys Val Gly Leu Gln Asp
370 375 380
Glu Ile Trp Arg Ser Leu Pro Leu Pro Lys Ala Val Thr Lys Ile Gln
385 390 395 400
Glu Ser Ser Glu Gly Leu Leu Arg Tyr Asp Thr Pro Lys Ile Ile Ser
405 410 415
Lys Asp Lys Phe Ala Trp Leu Arg Asp Asp Glu Phe Ala Arg Gln Ala
420 425 430
Ile Ser Gly Val Asn Pro Val Asn Ile Glu Ser Leu Lys Val Phe Pro
435 440 445
Pro Lys Ser Asn Leu Asp Pro Glu Ile Tyr Gly Pro Gln Glu Ser Ala
450 455 460
Leu Lys Glu Glu His Ile Ile Gly His Leu Asn Gly Met Ser Val Gln
465 470 475 480
Glu Ala Leu Glu Glu Asn Lys Leu Phe Val Val Asp Tyr His Asp Ile
485 490 495
Tyr Leu Pro Phe Leu Asp Arg Ile Asn Ala Leu Asp Gly Arg Lys Ala
500 505 510
Tyr Ala Thr Arg Thr Ile Phe Phe Leu Thr Pro Leu Gly Thr Leu Lys
515 520 525
Pro Ile Ala Ile Glu Leu Ser Leu Pro Pro Val Gly Pro Gly Ser Gln
530 535 540
Ser Lys Arg Val Val Thr Pro Pro Val Asp Ala Thr Ser Asn Trp Ile
545 550 555 560
Trp Gln Leu Ala Lys Ala His Val Cys Ser Asn Asp Ala Gly Val His
565 570 575
Gln Leu Val Asn His Trp Leu Arg Thr His Ala Cys Leu Glu Pro Phe
580 585 590
Ile Leu Ala Ala His Arg Gln Leu Ser Ala Val His Pro Ile Phe Lys
595 600 605
Leu Leu Asp Pro His Met Arg Tyr Thr Leu Glu Ile Asn Ala Leu Ala
610 615 620
Arg Gln Ser Leu Ile Asn Ala Asp Gly Val Ile Glu Ser Cys Phe Thr
625 630 635 640
Pro Gly Arg Tyr Cys Met Glu Ile Ser Ala Ala Ala Tyr Lys Asn Phe
645 650 655
Trp Arg Phe Asp Met Glu Gly Leu Pro Ala Asp Leu Ile Arg Arg Gly
660 665 670
Met Ala Val Pro Asp Pro Thr Gln Pro His Gly Leu Lys Leu Leu Ile
675 680 685
Glu Asp Tyr Pro Tyr Ala Gln Asp Gly Leu Leu Ile Trp Ser Ala Ile
690 695 700
Glu Asn Trp Val Arg Ser Tyr Val Asn Arg Tyr Tyr Pro Asn Ser Ser
705 710 715 720
Leu Val Cys Asn Asp Thr Glu Leu Gln Ala Trp Tyr Ala Glu Ser Val
725 730 735
Asn Val Gly His Ala Asp Leu Lys His Ala Glu Trp Trp Pro Thr Leu
740 745 750
Ala Asn Val His Asp Leu Val Ser Ile Leu Thr Thr Ile Ile Trp Leu
755 760 765
Ala Ser Ala Gln His Ala Ala Leu Asn Phe Gly Gln Tyr Pro Tyr Gly
770 775 780
Gly Tyr Val Pro Asn Arg Pro Pro Leu Ile Arg Arg Leu Ile Pro Glu
785 790 795 800
Glu Asn Gly Thr Glu Tyr Ala Ser Phe Leu Ala Asp Pro Gln Lys Tyr
805 810 815
Phe Leu Ser Ala Leu Pro Ser Leu Leu Gln Ala Thr Lys Phe Met Ala
820 825 830
Val Val Asp Thr Leu Ser Thr His Ser Pro Asp Glu Glu Tyr Ile Gly
835 840 845
Glu Arg Gln Gln Pro Ser Ile Trp Ser Gly Asp Ala Glu Ile Ile Asp
850 855 860
Ser Phe Tyr Glu Phe Ser Ala Glu Met Arg Arg Ile Glu Lys Glu Ile
865 870 875 880
Asp Arg Arg Asn Met Asp Pro Ser Leu Arg Asn Arg Cys Gly Ala Gly
885 890 895
Val Leu Pro Tyr Glu Leu Leu Ala Pro Ser Ser Ser Pro Gly Val Thr
900 905 910
Cys Arg Gly Val Pro Asn Ser Val Ser Ile
915 920
<210> 3
<211> 354
<212> DNA
<213> Artificial Sequence
<220>
<223> RNAi
<400> 3
ccaaactgaa gcacccactg gtcgtttatt tgcatgcaag acatgtaaca ggaaattcac 60
gtcgtttcaa gcattgggtg gccaccgagc gagtcacaag aagccgaaac tcataggaga 120
tgatttgcta accagttcgc ctccgaagcc caaaacccat gagtgctcca tttgtggcct 180
tgagtttccc gtcggacaag ctcttggagg tcacatgagg aggcacagag gaggaattgg 240
taaaaatatg gatgatgctc gacctctgtt tccggtgccg gttatgaaga aatcaacgag 300
taaaagagtt ttgtgcttgg atttgaactt gacgccggtg gagaatgact tgac 354
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 4
ataggtacca aactgaagca cccactg 27
<210> 5
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 5
cgtatcgatg tcaagtcatt ctccacc 27
<210> 6
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 6
atactcgagg tcaagtcatt ctccacc 27
<210> 7
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> primer
<400> 7
ttaggatcca aactgaagca cccactg 27

Claims (10)

1. A method of modulating cold resistance, modulating membrane fluidity, senescence response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of senescence-associated genes, JA content in a plant comprising the steps of: modulating expression or activity of ZAT11 and/or LOX3 in plants,
preferably, the method comprises the steps of,
chlorophyll content is the content of chlorophyll a or chlorophyll b, and/or
The plant is a plant of the family Euphorbiaceae, and/or
ZAT11 and/or LOX3 are derived from Euphorbiaceae plants, and/or
Chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR;
senescence-associated genes include SAG39, ICL1 or ICL2, preferably ICL1.
2. The method of claim 1, wherein ZAT11 and/or LOX3 expression or activity is down-regulated, whereby plant cold resistance is enhanced, senescence is delayed, membrane fluidity is up-regulated, active oxygen accumulation is reduced, chlorophyll a content is increased, chlorophyll b content is increased, NYC1 is down-regulated, PPH is down-regulated, RCCR is down-regulated, ICL1 is down-regulated, JA content is increased,
preferably, the method further has one or more features selected from the group consisting of:
the up-regulating expression or activity of ZAT11 and/or LOX3 in a plant comprises: (1) Transferring ZAT11 and/or LOX3 genes into plants to obtain transformed plants; and/or (2) contacting the ZAT11 and/or LOX3 genes or promoters encoding proteins with plants,
The amino acid sequence of ZAT11 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 1; (b) A polypeptide which is formed by substituting, deleting or adding one or more amino acid residues in the sequence shown in SEQ ID NO. 1 and has the function of the polypeptide (a) and is derived from the polypeptide (a); or (c) a polypeptide derived from (a) which has more than 90% homology with the polypeptide sequence of (a) and has the function of the polypeptide of (a),
the amino acid sequence of LOX3 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 2; (b) A polypeptide which is formed by substituting, deleting or adding one or more amino acid residues in the sequence shown in SEQ ID NO. 2 and has the function of the polypeptide (a) and is derived from the polypeptide (a); or (c) a polypeptide derived from (a) which has more than 90% homology with the polypeptide sequence of (a) and has the function of the polypeptide of (a),
the method for up-regulating the expression of ZAT11 and/or LOX3 in plants comprises: (1) Providing an agrobacterium carrying a nucleic acid construct comprising a ZAT11 and/or LOX3 gene, and (2) contacting a cell or tissue or organ of a plant with the agrobacterium of step (1), thereby transferring the nucleic acid construct into the plant tissue or organ; optionally further comprising: (3) Selecting a plant tissue, organ or seed into which the ZAT11 and/or LOX3 gene has been transferred, and (4) regenerating the plant tissue, organ or seed of step (3).
3. The method of claim 1, wherein ZAT11 and/or LOX3 expression or activity is up-regulated, whereby plant cold resistance is reduced, senescence is increased, membrane fluidity is down-regulated, active oxygen accumulation is increased, chlorophyll a content is reduced, chlorophyll b content is reduced, NYC1 is up-regulated, PPH is up-regulated, RCCR is up-regulated, ICL1 is up-regulated, JA content is reduced,
preferably, the method further has one or more features selected from the group consisting of:
the down-regulating the activity or activity of ZAT11 and/or LOX3 comprises: transferring an inhibitor for down-regulating ZAT11 and/or LOX3 gene transcription, protein expression or protein activity into a plant,
such inhibitors include inhibitory molecules that specifically interfere with the transcription and/or expression of ZAT11 and/or LOX3 genes, or down-regulate ZAT11 and/or LOX3 activity,
the inhibition molecules take ZAT11 and/or LOX3 genes or transcripts or expression proteins thereof as inhibition targets,
the inhibition molecule takes SEQ ID NO. 1 and/or SEQ ID NO. 2 or a coding sequence (DNA or RNA) thereof as an inhibition target,
the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, sgRNA, a specific antibody or ligand, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1),
The inhibition molecule is dsRNA or a construct thereof which takes ZAT11 and/or LOX3 genes or transcripts thereof as inhibition targets,
the inhibitor is an sgRNA knocked out or knocked down of ZAT11 and/or LOX3 genes using a technique selected from the group consisting of ZFN, TALEN and CRISPR,
the method for down-regulating ZAT11 and/or LOX3 expression in plants comprises: (i) Providing an agrobacterium carrying a nucleic acid construct that can interfere with the expression of the ZAT11 and/or LOX3 genes, the nucleic acid construct containing or producing the inhibitor, and (ii) contacting a cell or tissue or organ of a plant with the agrobacterium of step (i) thereby transferring the nucleic acid construct into the plant tissue or organ; optionally further comprising: (iii) Selecting a plant tissue, organ or seed into which the nucleic acid construct has been transferred; and (iv) regenerating the plant tissue, organ or seed of step (iii).
4. A method of modulating lipoxygenase 3 (LOX 3), comprising the steps of: modulating the expression or activity of ZAT11,
preferably, the method further has one or more features selected from the group consisting of:
up-regulating the expression or activity of ZAT11, up-regulating the expression or activity of lipoxygenase 3,
the up-regulation of ZAT11 expression or activity in plants comprises: (1) transferring ZAT11 gene into plant to obtain transformed plant; and/or (2) contacting the ZAT11 gene or a promoter encoding the protein with a plant,
The method for up-regulating the expression of ZAT11 in plants comprises the following steps: (1) Providing an agrobacterium carrying a nucleic acid construct comprising a ZAT11 gene, and (2) contacting a cell or tissue or organ of a plant with the agrobacterium of step (1), thereby transferring the nucleic acid construct into the plant tissue or organ; optionally further comprising: (3) Selecting a plant tissue, organ or seed into which the ZAT11 gene has been transferred, and (4) regenerating the plant tissue, organ or seed from step (3),
or preferably, the method further has one or more features selected from the group consisting of:
down-regulating the expression or activity of ZAT11, down-regulating the expression or activity of lipoxygenase 3,
the down-regulating of the surface activity or activity of ZAT11 includes: transferring the inhibitor for down regulating ZAT11 gene transcription, protein expression or protein activity into plant,
such inhibitors include inhibitory molecules that specifically interfere with the transcription and/or expression of the ZAT11 gene, or down-regulate ZAT11 activity,
the inhibition molecules take ZAT11 genes or transcripts or expression proteins thereof as inhibition targets,
the inhibition molecule takes SEQ ID NO. 1 or a coding sequence thereof as an inhibition target,
the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, sgRNA, a specific antibody or ligand, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1),
The inhibition molecule is dsRNA or a construct thereof which takes ZAT11 gene or transcripts thereof as an inhibition target,
the inhibitor is a sgRNA knocked out or knocked down of ZAT11 gene using a technique selected from the group consisting of ZFN, TALEN and CRISPR,
the method for down-regulating ZAT11 expression in plants comprises the following steps: (i) Providing an agrobacterium carrying a nucleic acid construct that can interfere with the expression of the ZAT11 gene, the nucleic acid construct comprising or producing the inhibitor, and (ii) contacting a cell or tissue or organ of a plant with the agrobacterium of step (i) thereby transferring the nucleic acid construct into the plant tissue or organ; optionally further comprising: (iii) Selecting a plant tissue, organ or seed into which the nucleic acid construct has been transferred; and (iv) regenerating the plant tissue, organ or seed of step (iii).
5. A method of down-regulating the expression or activity of ZAT11 and/or LOX3, enhancing cold resistance, delaying senescence in a plant, up-regulating membrane fluidity, reducing active oxygen accumulation, increasing chlorophyll a content, increasing chlorophyll b content, down-regulating the expression or activity of chlorophyll degradation genes, down-regulating the expression or activity of senescence-associated genes in a plant, comprising the steps of: treatment of plants with JA or an analogue or derivative thereof,
Preferably, the method further has any one or more features selected from the group consisting of:
the derivative of JA is an alkyl jasmonate, preferably methyl jasmonate,
chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR,
senescence-associated genes include SAG39, ICL1 or ICL2, preferably ICL1,
the plant is a plant of the family Euphorbiaceae, preferably of the genus cassava,
JA or an analogue or derivative thereof is at a concentration of at least 1 μm,
the treatment is carried out for at least 1 hour,
the treatment includes treating the root, stem, leaf, flower, fruit or seed of the plant.
Application of ZAT11 and/or LOX3 as targets in regulating cold resistance of plants, regulating membrane fluidity, aging response, active oxygen accumulation, chlorophyll content, expression or activity of chlorophyll degradation genes, expression or activity of aging-related genes, and JA content,
the plant is a plant of the family Euphorbiaceae,
ZAT11 and/or LOX3 are derived from euphorbiaceae,
chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR,
senescence-associated genes include SAG39, ICL1 or ICL2, preferably ICL1.
7. Use of a substance selected from the group consisting of: ZAT11 and/or LOX3 genes or encoded proteins, or promoters or inhibitors thereof,
Preferably, the method comprises the steps of,
chlorophyll content is the content of chlorophyll a or chlorophyll b,
the plant is a plant of the family Euphorbiaceae,
chlorophyll degrading genes include one or more selected from the group consisting of: NYC1, PPH, RCCR,
senescence-associated genes include SAG39, ICL1 or ICL2, preferably ICL1,
ZAT11 and/or LOX3 are derived from Euphorbiaceae plants.
8. The use according to claim 7, wherein the substance is an accelerator of the expression or activity of ZAT11 and/or LOX3, whereby the plant has reduced cold resistance, increased senescence, reduced membrane fluidity, increased active oxygen accumulation, reduced chlorophyll a content, reduced chlorophyll b content, upregulation of NYC1, upregulation of PPH, upregulation of RCCR, upregulation of ICL1, reduced JA content,
preferably, the use further has any one or more features selected from:
the accelerator is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, or a combination thereof,
the nucleic acid molecule is a nucleic acid construct comprising ZAT11 and/or LOX3 coding sequences,
the ZAT11 and/or LOX3 genes comprise cDNA sequences, genomic sequences, or combinations thereof,
the amino acid sequence of ZAT11 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 1; (b) A polypeptide which is formed by substituting, deleting or adding one or more amino acid residues in the sequence shown in SEQ ID NO. 1 and has the function of the polypeptide (a) and is derived from the polypeptide (a); or (c) a polypeptide derived from (a) which has more than 90% homology with the polypeptide sequence of (a) and has the function of the polypeptide of (a),
The amino acid sequence of LOX3 is selected from one or more of the following: (a) a polypeptide having the sequence shown in SEQ ID NO. 2; (b) A polypeptide which is formed by substituting, deleting or adding one or more amino acid residues in the sequence shown in SEQ ID NO. 2 and has the function of the polypeptide (a) and is derived from the polypeptide (a); or (c) a polypeptide derived from (a) which has more than 90% homology with the polypeptide sequence of (a) and has the function of the polypeptide of (a).
9. The use according to claim 7, wherein the substance is an inhibitor of the expression or activity of ZAT11 and/or LOX3, whereby the plant has an increased cold resistance, a delayed senescence, an upregulation of membrane fluidity, a reduced accumulation of active oxygen, an increased chlorophyll a content, an increased chlorophyll b content, a downregulation of NYC1, a downregulation of PPH, a downregulation of RCCR, a downregulation of ICL1, an increased JA content,
preferably, the use further has any one or more features selected from:
such inhibitors include inhibitory molecules that specifically interfere with the transcription and/or expression of ZAT11 and/or LOX3 genes, or down-regulate ZAT11 and/or LOX3 activity,
the inhibition molecules take ZAT11 and/or LOX3 genes or transcripts or expression proteins thereof as inhibition targets,
the inhibition molecule takes SEQ ID NO. 1 and/or SEQ ID NO. 2 or a coding sequence (DNA or RNA) thereof as an inhibition target,
The inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, sgRNA, a specific antibody or ligand, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1),
the inhibition molecule is dsRNA or a construct thereof which takes ZAT11 and/or LOX3 genes or transcripts thereof as inhibition targets,
the inhibitor is an sgRNA that knocks out or knocks down the ZAT11 and/or LOX3 genes using a technique selected from ZFN, TALEN, and CRISPR.
10. A polynucleotide that inhibits ZAT11 and/or LOX3 gene expression, or a nucleic acid construct comprising the polynucleotide, the polynucleotide having:
(1) The sequence shown in SEQ ID NO. 3 or its corresponding RNA sequence, or a sequence having at least 90% sequence identity thereto,
(2) siRNA from (1), or
(3) Comprises a structure shown in a formula I:
Seq forward direction -X-Seq Reverse direction The compound of the formula I,
in formula I, seq Forward direction For the sequence shown in (1) or (2), seq Reverse direction Is equal to Seq Forward direction A reverse complement polynucleotide;
x is a spacer sequence located between the forward and reverse directions of the Seq, and the spacer sequence is identical to the Seq Forward direction And Seq Reverse direction The non-complementary ones are not used,
preferably, the siRNA is 10-35bp in length,
preferably, the nucleic acid construct is a vector.
CN202210502590.2A 2022-05-09 2022-05-09 Method for improving cold resistance of plants Pending CN117070552A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210502590.2A CN117070552A (en) 2022-05-09 2022-05-09 Method for improving cold resistance of plants

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210502590.2A CN117070552A (en) 2022-05-09 2022-05-09 Method for improving cold resistance of plants

Publications (1)

Publication Number Publication Date
CN117070552A true CN117070552A (en) 2023-11-17

Family

ID=88715805

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210502590.2A Pending CN117070552A (en) 2022-05-09 2022-05-09 Method for improving cold resistance of plants

Country Status (1)

Country Link
CN (1) CN117070552A (en)

Similar Documents

Publication Publication Date Title
CN108864267B (en) Sweet potato carotenoid synthesis and salt-tolerant drought-resistant related protein IbARF5 as well as encoding gene and application thereof
CN112226455B (en) Rice grain length and grain weight related protein, and coding gene and application thereof
CN101280006B (en) Protein related to tolerance to Fe deficiency of plant, coding genes and application thereof
CN110872598A (en) Cotton drought-resistant related gene GhDT1 and application thereof
WO2013166996A1 (en) Gene improving the stress resistance of plants and use thereof
CN104710522A (en) Protein related to flowering time of plant, and coding gene and application thereof
CN115873086A (en) Tomato transcription factor SlWOX13 gene and protein and application thereof
US20150128304A1 (en) Plant Body Showing Improved Resistance Against Environmental Stress and Method for Producing Same
US10316325B1 (en) Nitrogen uptake in plants
CN111454972B (en) Hovenia dulcis cold-resistant gene PtrBADH and application thereof in plant cold-resistant genetic improvement
CN108165557B (en) Application of wheat TaZCTC 2 gene in regulating and controlling flowering time of plants
CN114591409B (en) Application of TaDTG6 protein in improving drought resistance of plants
CN114805510A (en) Gene for regulating and controlling anti-aluminum virus transcription factor STOP1 protein and application thereof
CN113481210B (en) Application of cotton GhDof1.7 gene in promotion of salt tolerance of plants
CN112898391B (en) Application of cold-resistant gene PtrERF9 of trifoliate orange in genetic improvement of cold resistance of plants
CN116120413A (en) SlHAT5 gene and application thereof in high temperature stress resistance of tomatoes
Li et al. Increasingly amplified stimulation mediated by TaNAC69‐B is crucial for the leaf senescence in wheat
Liu et al. Involvement of a novel NAP member LbNAP in flower senescence and dehydration stress in cut lily
CN110791506B (en) Nitcipk 11 gene of tangut bur, and expression protein and application thereof
CN117070552A (en) Method for improving cold resistance of plants
KR101855137B1 (en) ATPG8 Protein Providing Yield Increase and Delaying Senescence and Stress Tolerance of Plants, the Gene Encoding the Protein and Those Use
CN114717245B (en) MsbHLH35 gene and application of encoding protein thereof in regulation and control of alfalfa yield and stain resistance
KR102230148B1 (en) Compositions for Enhancing Cold Stress Tolerance and Transgenic Plants Using the Same
CN114438103B (en) Transcription factor OsNAC15 gene for regulating drought and salt stress tolerance of rice and application thereof
CN115044592B (en) Gene ZmADT2 for regulating and controlling maize plant type and resistance to tumor smut, and encoding protein and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination