WO2013016207A2 - Stable fungal cel6 enzyme variants - Google Patents
Stable fungal cel6 enzyme variants Download PDFInfo
- Publication number
- WO2013016207A2 WO2013016207A2 PCT/US2012/047637 US2012047637W WO2013016207A2 WO 2013016207 A2 WO2013016207 A2 WO 2013016207A2 US 2012047637 W US2012047637 W US 2012047637W WO 2013016207 A2 WO2013016207 A2 WO 2013016207A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- group
- seq
- polypeptide
- substitutions
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
- C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
- C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01091—Cellulose 1,4-beta-cellobiosidase (3.2.1.91)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P2203/00—Fermentation products obtained from optionally pretreated or hydrolyzed cellulosic or lignocellulosic material as the carbon source
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- Cel6 cellobiohydrolase II enzymes and their use to hydrolyze cellulose .
- the disclosure provide recombinant or substantially purified polypeptides comprising a sequence that is at least 67.7% identical to a sequence set forth in SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and having cellulase activity and increased thermostability compared to a polypeptide comprising SEQ ID NO: 4, 6, or 8.
- the recombinant or substantially purified polypeptides comprising a sequence that is at least 67.7% identical to a sequence set forth in SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and having cellulase activity and increased thermostability compared to a polypeptide comprising SEQ ID NO: 4, 6, or 8.
- the recombinant or substantially purified polypeptides comprising a sequence that is at least 67.7% identical to a sequence set forth in SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and having cellulase activity and increased thermostability compared to a poly
- substantially purified polypeptide comprises at least 67.7% identity (e.g., 67.7, 70, 80, 85, 90, 95, 98, 99, or 100% identity) to SEQ ID NO : 2 and having one or more amino acid substitutions at residues selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413, and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
- the polypeptide comprises one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and S413W.
- the polypeptide comprises a sequence as set forth in SEQ ID NO:4 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 in SEQ ID NO : 4.
- the polypeptide comprises SEQ ID NO : 4 and has one or more substitutions at a residue selected from N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437.
- the polypeptide comprises a sequence as set forth in SEQ ID NO : 6 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443 in SEQ ID NO : 6.
- the polypeptide comprises SEQ ID NO : 6 and has one or more substitutions at a residue selected from G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443.
- the polypeptide comprises a sequence as set forth in SEQ ID NO : 8 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues or N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 in SEQ ID NO : 8.
- residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues or N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 in SEQ ID NO : 8.
- the polypeptide comprises SEQ ID NO : 8 and has one or more substitutions at a residue selected from N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443.
- SEQ ID NO : 8 has one or more substitutions at a residue selected from N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443.
- the polypeptide comprise a sequence that is at least 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence as set forth in SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26, or 28.
- the polypeptide can further comprise a cellulose binding domain (CBD) operably linked to the polypeptide.
- CBD comprises a sequence as set forth in SEQ ID NO: 10.
- the disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO : 6 and having one or more substitutions at a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
- the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
- substitutions are selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
- the polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
- the disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO : 4 and having one or more substitutions at a residue selected from the group consisting of N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
- substitutions are selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W.
- the recombinant polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S347F, and S427W.
- the disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO : 8 and having one or more substitutions at a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
- the recombinant polypeptide the substitutions are selected from the group
- the polypeptide comprising SEQ ID NO: 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276G, L276A, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
- a recombinant polypeptide of the disclosure comprises SEQ ID NO : 2 having substitutions selected from the group consisting of: (a) one or more substitution at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof; and (b) a substitution at S413 and one or more substitutions at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof.
- a recombinant polypeptide of the disclosure comprises SEQ ID NO : 2 having substitutions selected from the group consisting of: (a) one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (b) S413F and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (c) S413P and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E,
- a recombinant polypeptide of the disclosure comprises SEQ ID NO : 4 having substitutions at a positions selected from the group consisting of: (a) one or more residue selected from the group consisting of N38, S54, V151, V154, C269, S316, S430 and any combination thereof; (b) M158 and one or more additional residues selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (c) Q300 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (d) S340 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; and (e) S437 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430.
- a recombinant polypeptide of the disclosure comprises SEQ ID NO : 4 having substitutions selected from the group consisting of: (a) one or more substitution selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (b) M158L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (c) Q300L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (d) S340P and one or more additional substitutions selected from the group consisting of:
- S437P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; and (h) S437W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P.
- a recombinant polypeptide of the disclosure comprises SEQ ID NO : 6 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, and T436.
- a recombinant polypeptide of the disclosure comprises SEQ ID NO: 6 having substitutions selected from the group consisting of: (a) a subsitution selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P; (b) Y443F and one or more additional
- substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (c) Y443P and one or more additional
- substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (d) Y443W and one or more additional
- substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P.
- a recombinant polypeptide of the disclosure comprises SEQ ID NO : 8 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, 1307, R323, S347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting N38, L54, V155, V158, Q162, L276, 1307, R323, S347, and T436.
- the recombinant polypeptide comprises SEQ ID NO : 8 having substitutions selected from the group consisting of: (a) a residue selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (b) Y443F and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (c) Y443P and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P
- substitutions in SEQ ID NO : 2 are as described above, but specifically exclude substitutions at S413.
- substitutions in SEQ ID NO : 4 are as described above, but
- substitutions in SEQ ID NO: 6 are as described above, but specifically exclude substitutions at Y443.
- substitutions in SEQ ID NO : 8 are as described above, but
- the resulting "modified" polypeptide comprises a polypeptide having cellulase activity and improved
- thermostability compared to a wild-type enzyme comprising SEQ ID NO: 4, 6, or 8.
- the disclosure also provides a polynucleotide encoding a polypeptide of any of the foregoing embodiments.
- the disclosure also provides a vector comprising a polynucleotide described above as well as host cells comprising a vector of the disclosure.
- the disclosure also provides a host cell that expresses a polypeptide described herein in any of the embodiments described above .
- the disclosure also provides enzymatic preparation comprising a polypeptide of the disclosure.
- the disclosure also provides a method of treating a biomass comprising cellulose, the method comprising contacting the biomass with a polypeptide described in any of the foregoing embodiments, an enzymatic preparation of the disclosure, or a host cell expressing a polypeptide of the disclosure.
- Figure 1 shows alignment of Cel6a amino acid sequences from H. insolens (SEQ ID NO: 6), H. jecorina (HJ) (SEQ ID NO : 4 ) , C. thermophilum (SEQ ID NO:8), and HJPlus (SEQ ID NO : 2 ) . Residues with double underlining are specific residues for mutation.
- Figure 2 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing HJPlus and the top five variants from the first generation random mutagenesis library.
- Figure 3 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing 1G6 and the top five variants from the second generation random mutagenesis library.
- Figure 4 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing 2B3 and the top five variants from the recombination library.
- Figure 5 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing HJPlus and the top variant from every generation of random mutagenesis and recombination.
- Figure 6 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing the top five variants from the NNK libraries.
- Figure 7 shows the half-life and T 50 values for HJPlus and the best variants from each generation of random mutagenesis and recombination.
- Figure 8 shows the residual activity of 3C6P and C246G at pH 4 (50 mM sodium citrate) , pH 5 (50 mM sodium acetate) , and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation ; the data were modeled with sigmoidal functions.
- Figure 9 shows the half-lives of C246G at 90°C at various pH values (pH 4 (50 mM sodium citrate) , pH 5 (50 mM sodium
- Figure 10 shows 2-hour activity of 3C6P and C246G at 80°C and 4-hour activity at 90°C (measured as cellobiose equivalents released) at various pH conditions (pH 4 (50 mM sodium citrate) , pH 5 (50 mM sodium acetate) , and pH 6 through 9 (50 mM sodium phosphate) ) .
- Figure 11 shows the effects of different mutations at residue C246 on the residual activity of the engineered Cel6s.
- Purified enzymes were inactivated at 50 mM sodium phosphate, pH 7.0 for 15 minutes before assayed for activities with 30 mg/mL of Avicel. The activity was measured as the amount of cellobiose released after 2-hour incubation at 50°C.
- Figure 12 shows the residual activity of H. jecorina
- Figure 13 shows the residual activity of H. insolens
- FIG 14 shows 2-hour activity of H. jecorina (HJ)
- Cellulose is the main structural component of most plant cell walls, making it the most abundant biopolymer on earth.
- Cellulose is a polysaccharide composed of glucosyl units linked together by ⁇ -1,4 glycosidic bonds.
- the ⁇ -linkage ensures that the subunits rotate 180° every two glucose subunits along the cellulose chain.
- the rotation makes the cellulose chains straight and highly symmetrical. X-ray diffraction and nuclear magnetic resonance studies have shown that cellulose chains form extensive
- thermostable fungal cellulases Unfortunately, the set of documented thermostable fungal cellulases is small. In the case of the processive cellobiohydrolase class II (CBH II) enzymes, fewer than 10 natural thermostable gene sequences are annotated in the CAZy database .
- CBH II processive cellobiohydrolase class II
- cellulases are used in biorefineries to break down cellulosic biomass into fermentable sugars, from which biofuels and higher-value chemicals can be derived.
- biofuels and higher-value chemicals can be derived.
- Thermostable cellulases are particularly interesting for biomass degradation for several reasons. Thermostable cellulases tend to be more stable during production, storage and over a range of temperatures and operating conditions. Thermostable enzymes are more resilient towards relatively harsh industrial treatments and conditions.
- Trichoderma reesei secretes an array of cellulose enzymes that work synergistically to degrade the cellulose to smaller oligomers and eventually to glucose.
- This fungus' collection of cellulases includes at least five endoglucanases (EGI-V) , two
- cellobiohydrolase Cel7a, Cel6a, and EGII comprise 60 ⁇ 5%, 20 ⁇ 6%, and 12 ⁇ 3% of total cellulase protein, respectively. All three cellulases consist of a cellulose-binding domain (CBD) and a catalytic domain connected by a glycosylated peptide linker. Cellobiose is the primary product of cellulose hydrolysis by cellobiohydrolases Cel6a and Cel7a. [ 0043 ] Recently, the creation of a collection of thermostable
- Cel6 Family 6 fungal cellobiohydrolases (Cel6) using structure-guided SCHEMA recombination was reported.
- thermophilum were divided into eight blocks and recombined to create new, chimeric Cel6a enzymes.
- the block boundaries were identified using computational tools that allowed the number of disrupted side-chain contacts to be minimized, relative to the average number of mutations in the resulting chimeric proteins.
- Based on activity and stability data obtained from the enzymes encoded by the 48 genes that were sampled (from the 6,561 possible chimeric sequences) linear regression models were built to determine how each sequence block contributes to the
- thermostability of a chimeric Cel6a enzyme The four stabilizing blocks were introduced in the cellobiohydrolase of H. jecorina to create the "HJPlus" chimera 12222332 (described in US Patent
- thermostability of HJPlus not only pushes the limit of enzyme stability but also allows the discovery of mutations that might not have appeared at lower temperatures because they are not beneficial at lower temperatures.
- the disclosure also provides a method that allows high throughput screening on microcrystalline cellulose, Avicel, to identify useful mutations.
- the disclosure also provides genetic constructs that encode the modified Cel6a enzymes and the methods for mutating, deriving, and producing the modified Cel6a enzymes from yeast and fungal expression strains.
- the disclosure also provides use of the modified Cel6a enzymes in the hydrolysis of cellulose or cellulosic biomass and the production of biofuels from fermentable sugars and alcohols, as well as other industrial applications of cellulases.
- novel polypeptides that have been engineered/modified to degrade cellulose are provided.
- Such polypeptides include Cel6a variants that have been altered to include amino acid substitutions at specified residues as well as properties that include increased thermostability compared to wild- type Cel6a enzymes.
- polypeptides of the disclosure contain one or more modified amino acids.
- modified amino acids are advantageous in, for example, (a) increasing polypeptide in vivo half-life, activity or thermostability, (b) reducing or increasing polypeptide antigenicity, and (c) increasing polypeptide storage stability.
- Amino acid(s) are modified, for example, co- translationally or post-translationally during recombinant production (e.g., N-linked glycosylation at N--X--S/T motifs during expression in mammalian cells) or modified by synthetic means.
- polypeptide, enzyme, polynucleotide, gene, or cell means a protein, polypeptide, enzyme, polynucleotide, gene, or cell, that has been altered or derived, or is in some way different or changed, from a parent protein, polypeptide, enzyme,
- a mutant or modified protein or enzyme is usually, although not necessarily, expressed from a mutant polynucleotide or gene .
- “conservative variations” of a particular sequence refers to the replacement of one amino acid, or series of amino acids, with essentially identical amino acid sequences.
- conservative variations refers to the replacement of one amino acid, or series of amino acids, with essentially identical amino acid sequences.
- One of skill will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a percentage of amino acids in an encoded sequence result in "conservative variations” where the alterations result in the deletion of an amino acid, addition of an amino acid, or substitution of an amino acid with a chemically similar amino acid.
- Conservative substitution tables providing functionally similar amino acids are well known in the art.
- one conservative substitution group includes Alanine (A) , Serine (S) , and Threonine (T) .
- Another conservative substitution group includes Aspartic acid (D) and Glutamic acid (E) .
- Another conservative substitution group includes Asparagine (N) and
- Glutamine Q
- R Arginine
- K Lysine
- I Isoleucine
- I Leucine
- M Methionine
- V Valine
- F Phenylalanine
- Y Tyrosine
- W Tryptophan
- “conservative amino acid substitutions” of a listed polypeptide sequence of the disclosure include substitutions of a percentage, typically less than 10%, of the amino acids of the polypeptide sequence, with a conservatively selected amino acid of the same conservative substitution group. Accordingly, a
- conservatively substituted variation of a polypeptide of the invention can contain 100, 75, 50, 25, or 10 substitutions with a conservatively substituted variation of the same conservative substitution group.
- enzyme activity is a measure of its ability to catalyze a reaction, i.e., to "function", and may be expressed as the rate at which the product of the reaction is produced.
- enzyme activity can be represented as the amount of product produced per unit of time or per unit of enzyme (e.g., concentration or weight), or in terms of affinity or dissociation constants.
- Cel6a activity refers to an activity exerted by a Cel6a, Cel6a polypeptide, or a polypeptide having Cel6a activity on a Cel6a polypeptide substrate, as determined in vitro, according to standard techniques (as described below) .
- Such Cel6a activity can be characterized as the rate of breakdown of cellulose or other organic polymeric sugar composition.
- Constant variants are proteins or enzymes in which a given amino acid residue has been changed without altering overall conformation and function of the protein or enzyme, including, but not limited to, replacement of an amino acid with one having similar properties, including polar or non-polar character, size, shape and charge. Amino acids other than those indicated as conserved may differ in a protein or enzyme so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and can be, for example, at least 30%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99%, as determined according to an alignment scheme.
- sequence similarity means the extent to which nucleotide or protein sequences are related. The extent of similarity between two sequences can be based on percent sequence identity and/or conservation.
- sequence identity herein means the extent to which two nucleotide or amino acid sequences are invariant.
- Sequence alignment means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity.
- polypeptide are those which substitute any amino acid not characterized as a conservative substitution. For example, any substitution which crosses the bounds of the six groups set forth above. These include substitutions of basic or acidic amino acids for neutral amino acids, (e.g., Asp, Glu, Asn, or Gin for Val, lie, Leu or Met) , aromatic amino acid for basic or acidic amino acids (e.g., Phe, Tyr or Trp for Asp, Asn, Glu or Gin) or any other substitution not replacing an amino acid with a like amino acid.
- basic or acidic amino acids for neutral amino acids, (e.g., Asp, Glu, Asn, or Gin for Val, lie, Leu or Met)
- aromatic amino acid for basic or acidic amino acids e.g., Phe, Tyr or Trp for Asp, Asn, Glu or Gin
- any other substitution not replacing an amino acid with a like amino acid e.g., Phe, Tyr or Trp for Asp, Asn, Glu or Gin
- Basic side chains include lysine (K) , arginine (R) , histidine (H) ; acidic side chains include aspartic acid (D) , glutamic acid (E) ; uncharged polar side chains include glycine (G) , asparagine (N) , glutamine (Q) , serine (S) , threonine (T) , tyrosine (Y) , cysteine (C) ; nonpolar side chains include alanine (A) , valine (V) , leucine (L) , isoleucine (I), proline (P) , phenylalanine (F) , methionine (M) , tryptophan (W) ; beta-branched side chains include threonine (T) , valine (V), isoleucine (I); aromatic side chains include tyrosine (Y) , phenylalanine (F) , tryptophan (
- amino acid residues at specific positions in a polypeptide are “excluded” from conservative amino acid substitutions. Instead, these restricted or “specific” amino acids are generally chosen from a particular group of amino acids or a specific amino acid to be substituted at that position. These amino acid residues can be substituted at a designated position to obtain a modified or variant polypeptide. While some overlap may occur, the members substituted at these specific positions are not "conservative amino acid substitutions" as defined above. In general, these mutations represent non-conservative substitutions at the indicated position in the designated sequence. For example, as described more fully below the substitution at position 14 of, e.g., SEQ ID NO : 2 (see Figure 1), replaces Asn or Gly with Ser. This substitution is generally not considered a "conservative" substitution. Similar substitutions are made throughout the various sequences at the indicated positions in order to modify the activity of the polypeptide.
- a “mutation” means any process or mechanism resulting in a mutant protein, enzyme, polynucleotide, gene, or cell. This includes any mutation in which a protein, enzyme, polynucleotide, or gene sequence is altered, and any detectable change in a cell arising from such a mutation. Typically, a mutation occurs in a polynucleotide or gene sequence, by point mutations, deletions, or insertions of single or multiple nucleotide residues.
- a mutation includes polynucleotide alterations arising within a protein- encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences.
- a mutation in a gene can be "silent", i.e., not reflected in an amino acid alteration upon expression, leading to a "sequence-conservative" variant of the gene. This generally arises when one amino acid corresponds to more than one codon .
- a "parent" protein, enzyme, polynucleotide, gene, or cell is any protein, enzyme, polynucleotide, gene, or cell, from which any other protein, enzyme, polynucleotide, gene, or cell, is derived or made, using any methods, tools or techniques, and whether or not the parent is itself native or mutant.
- a parent polynucleotide or gene encodes for a parent protein or enzyme.
- Exemplary parent polynucleotides and polypeptides include, for example, SEQ ID NO: 3, 5, and 7 and SEQ ID NO: 4, 6, and 8, respectively .
- a “protein” or “polypeptide”, which terms are used interchangeably herein, comprises one or more chains of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds.
- An “enzyme” means any substance, composed wholly or largely of protein, that catalyzes or promotes, more or less specifically, one or more chemical or biochemical reactions.
- a “native” or “wild-type” protein, enzyme, polynucleotide, gene, or cell, means a protein, enzyme,
- polynucleotide, gene, or cell that occurs in nature proteins or protein sequences are presented that are not fully "native".
- the catalytic domains of the respective enzymes are native, but they further comprise a cellulose binding domain and linker from H. jecorina , which results in a protein that is not native to, for example, H. insolens and C. thermophilum .
- a polynucleotide, polypeptide, or other component is
- nucleic acid or polypeptide is “recombinant” when it is artificial or engineered, or derived from an artificial or engineered protein or nucleic acid.
- a polynucleotide that is inserted into a vector or any other heterologous location e.g., in a genome of a
- nucleotide sequences that normally flank the polynucleotide as it is found in nature is a recombinant polynucleotide.
- a protein expressed in vitro or in vivo from a recombinant polynucleotide is an example of a recombinant polypeptide.
- a polynucleotide sequence that does not appear in nature for example a variant of a naturally occurring gene, is recombinant. For example, an
- isolated nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid.
- isolated includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated.
- an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- the isolated nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical
- Sequence identity herein means the extent to which two nucleotide or amino acid sequences are invariant.
- Sequence alignment means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity. Numerous methods for aligning sequences and assessing similarity/identity are known in the art such as, for example, the Cluster Method, wherein similarity is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and
- substitution matrix e.g., BLOSUM62
- gap existence penalty e.g., BLOSUM62
- gap extension penalty e.g., BLOSUM62
- Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well- known in the art and described, e.g., in Dayhoff et al . (1978) "A model of evolutionary change in proteins” in “Atlas of Protein Sequence and Structure," Vol. 5, Suppl . 3 (ed. M. 0. Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, D.C. and Henikoffet al. (1992) Proc. Nat ⁇ . Acad. Sci.
- substitution matrix e.g., BLOSUM62
- the BLOSUM62 matrix (FIG. 10) is often used as a default scoring substitution matrix in sequence alignment protocols such as Gapped BLAST 2.0.
- the gap existence penalty is imposed for the introduction of a single amino acid gap in one of the aligned sequences, and the gap extension penalty is imposed for each additional empty amino acid position inserted into an already opened gap.
- the alignment is defined by the amino acids positions of each sequence at which the alignment begins and ends, and optionally by the insertion of a gap or multiple gaps in one or both sequences so as to arrive at the highest possible score.
- NCBI National Center for Biotechnology Information
- Optimal alignments can be prepared using, e.g., PSI-BLAST, available through the NCBI website and described by Altschul et al. (1997) Nucl. Acids Res. 25:3389-3402 (incorporated by reference herein) .
- position 16 corresponds to the position in the reference sequence with which the residue is paired in the alignment.
- the "position” is denoted by a number that sequentially identifies each amino acid in the reference sequence based on its position relative to the N- terminus. For example, in SEQ ID NO: 2, position 14 is N, position 15 is W, position 16 is S, etc.
- a residue in the test sequence that aligns with the W at position 16 is said to "correspond to position 16" of SEQ ID NO : 2.
- the amino acid residue number in a test sequence as determined by simply counting from the N-terminal will not necessarily be the same as the number of its corresponding position in the reference sequence.
- the amino acid residue number in a test sequence as determined by simply counting from the N-terminal will not necessarily be the same as the number of its corresponding position in the reference sequence.
- there will be no amino acid that corresponds to a position in the reference sequence at the site of deletion there will be no amino acid that corresponds to a position in the reference sequence at the site of deletion.
- there is an insertion in an aligned reference sequence that insertion will not correspond to any amino acid position in the reference sequence.
- truncations or fusions there can be stretches of amino acids in either the reference or aligned sequence that do not correspond to any amino acid in the corresponding sequence .
- cellulase activity means an enzyme that is capable of hydrolyzing cellulose.
- Cellulase refers to a class of enzymes produced by fungi, bacteria, and protozoans that catalyze the hydrolysis of cellulose.
- cellulases produced by other types of organisms such as plants and animals.
- the EC number for this group of enzymes is EC 3.2.1.4.
- exo-cellulases there are five general types of cellulases based on the type of reaction catalyzed: endo-cellulase ; exo-cellulase, within this category there are two main types of exo-cellulases (or cellobiohydrolases, abbreviate CBH) - one type working processively from the reducing end, and one type working processively from the non-reducing end of cellulose; cellobiase or beta-glucosidase hydrolyses; oxidative cellulases; and cellulose phosphorylases that depolymerize cellulose using phosphates instead of water.
- Most fungal cellulases have two-domains: a catalytic domain and a cellulose binding domain that are connected by a flexible linker.
- the cellulase activity is a Cel6a activity.
- the sequences described herein include, in some instances, both the cellulose binding domain and the catalytic domain or just the catalytic domain. In such instances where only the catalytic domain sequence is provided it will be recognized that a cellulose binding domain (CBD) such as that provided in SEQ ID NO: 10, may be functional linked (either as part of the coding sequence or fused later) to the catalytic domain either directly or through a linker.
- CBD cellulose binding domain
- a "modified” or “thermostable” Cel6a variant refers to a polypeptide as described in more detail below that comprises at least 67.7% identity (e.g., 67.7, 70, 80, 90, 95, 98, 99% identity) to SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26 or 28 and which has at least one specific mutation as set forth below.
- a specific mutation refers to a one or more
- SEQ ID NO : 2 includes the amino acid sequence HJplus .
- SEQ ID NO : 4 provides the amino acid sequence of wild-type Cel6a from Hypocrea jecorina (including a signal domain residues 1-24) and shares amino acid sequence identity to HJPlus
- SEQ ID NO:2 includes the amino acid sequence of Cel6a (including a signal domain residues 1-23) from Humicola insolens. This wild-type Cel6a shares % amino acid sequence identity to the Cel6a of Hypocrea jecorina (SEQ ID NO: 4) as well as the HJplus polypeptide of SEQ ID NO: 2.
- SEQ ID NO: 8 includes the amino acid sequence of wild-type Cel6a (including a signal domain residues 1-24) from Chaetomium thermophilum and shares amino acid sequence identity to SEQ ID NO: 2, 4, and 6.
- polypeptides of Figure 1 are closely related to one another and show a high degree of sequence identity.
- the sequences can be aligned based on the sequence homology.
- the alignment provided in Figure 1 identifies "equivalent positions" in the sequences.
- An equivalent position denotes a position which, on the basis of the alignment of the sequence of the parent polypeptides in question with the
- the disclosure provides a modified
- Cel6a enzyme comprising amino acid substitution (s) at one or more residues selected from N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 in HJPlus (SEQ ID NO:2), wherein the modified Cel6a comprises increased thermostability and cellulase activity.
- the disclosure encompasses a variant Cel6a enzyme, wherein said enzyme comprises specific amino acid substitution ( s ) at one or more of the residues N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W in HJPlus (SEQ ID NO: 2) . Accordingly, in various embodiments, isolated or
- polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 2 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W.
- the disclosure provides polypeptides that have at least 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, or 28, wherein the polypeptide comprises cellulase activity and has increased thermostability compared to SEQ ID NO: 2, 4, 6, or 8.
- the disclosure provides modified
- the residue position (s) can further be identified by reference to the residues of SEQ ID NO: 2 and Figure 1.
- the disclosure encompasses a variant Cel6a enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6), from which HJPlus is derived. Accordingly, in various embodiments, isolated or
- polypeptide of SEQ ID NO: 6 can lack the leader sequence and comprises amino acid 24-476 of SEQ ID NO : 6 and having the foregoing substitutions .
- the disclosure provides a modified
- the residue position (s) can further be identified by reference to the residues of SEQ ID NO: 2 and Figure 1.
- the invention encompasses a variant Cel6a enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4), from which HJPlus is derived.
- said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4), from which HJPlus is
- isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 4 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W.
- the polypeptide of SEQ ID NO: 4 can lack the leader sequence and comprises amino acid 25-471 of SEQ ID NO : 4 and having the foregoing substitutions .
- the disclosure provides a modified
- the residue position (s) can further be identified by reference to the residues of SEQ ID NO: 2 and Figure 1.
- the disclosure encompasses a variant Cel6a enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W in in Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8), from which HJPlus is derived.
- SEQ ID NO: 8 Chaetomium thermophilum
- isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 8 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W.
- the polypeptide of SEQ ID NO: 8 can lack the leader sequence and comprises amino acid 25-476 of SEQ ID NO : 8 and having the foregoing substitutions .
- the disclosure provides modified
- the disclosure encompasses a variant Family 6 cellulase, wherein said enzyme comprises amino acid substitution at one or more of the residues corresponding to N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W of SEQ ID NO : 2 (see, e.g., Figure 1) .
- Family 6 cellulases include, but are limited to, Humicola insolens Cel6a, Hypocrea jecorina Cel6a, Chaetomium thermophilum Cel6a, Phanerochaete chrysosporium Cel6a, Thermobifida fusca Cel6a and Cel6b,
- polypeptides comprising at least 67.7% or more (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identity to SEQ ID NO : 2 and having any combination of the following amino acids S14, F30, M30, A128, E131, L135, A246, G246, L246, S246, L277, R293, P317, W317, P406, F413, and/or W413 and having Cel6a activity is provided.
- polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO : 4 and having any combination of the following amino acids S38, F54, M54, A151, E154, L158, A269, G269, L269, S269, L300, R316, P340, W340, P430, F437, and/or W437 and having Cel6a activity is provided.
- polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO : 6 and having any combination of the following amino acids
- polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO : 8 and having any combination of the following amino acids
- the disclosure relates to a variant derived from an amino acid substitution at residue C246G in a thermostable cellulase of SEQ ID NO: 2, or C269G of SEQ ID NO: 4, or L276G of SEQ ID NO: 6, or L276G of SEQ ID NO : 8.
- the residue position corresponds to the position found in HJPlus of SEQ ID NO: 2.
- a polypeptide of the disclosure exhibits improved thermostability with respect to a corresponding parent polypeptide if it has a T 50 which is at least about 5°C, or at least about 9°C higher than that of the parent cellulase, or for example a cellobiohydrolase having a T 50 from about 5°C to about 30°C higher, or any amount therebetween, or a T 50 from about 9°C to about 30°C higher, or any amount therebetween, when compared to that of the parent cellobiohydrolase.
- the T 50 is the temperature at which the modified or the natural enzyme retains 50% of its residual activity after a pre-incubation for 15 minutes and is determined by the assay detailed in Examples below or as known in the art.
- thermostable Cel6a variant of the disclosure comprises an enzyme that has a thermostabililty higher than the wild-type enzyme of SEQ ID NO:4, 6, or 8 by at least 5°C.
- the wild-type enzyme has a T 50 of 70°C and a thermostabilized variant has an increase in T 50 of 5°C or above.
- the modified Cel6a enzymes may exhibit enhanced thermostabilities, characterized by a 20-fold increase in half-life at 75 °C and an increase of 7.9 °C in T 50 value as compared to HJPlus Cel6a of SEQ ID NO: 2, or wild-type enzymes comprising SEQ ID NO: 4, 6, or 8.
- the modified cellobiohydrolases or cellulases of the disclosure may have T 50 which is about 5°C to about 30°C higher than that of a corresponding parent cellobiohydrolase (e.g., SEQ ID NO:2, 4, 6 or 8), or any range therebetween, about 5°C to about 20°C higher, or any range therebetween, about 8°C to about 15°C higher, or any range therebetween, or from about 9°C to about 15°C higher, or any range therebetween.
- the modified cellulase may have a T 50 that is at least about 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30°C higher than that of the corresponding parent cellobiohydrolase.
- thermostable enzyme is derived from amino acid substitution ( s ) at one or more residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443 in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6) .
- the disclosure encompasses a variant Cel6a enzyme, wherein said thermostable enzyme comprises amino acid substitution (s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6) .
- said thermostable enzyme comprises amino acid substitution (s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6) .
- isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 6 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W are provided.
- the polypeptide of SEQ ID NO: 6 can lack the leader sequence and comprises amino acid 24-476 of SEQ ID NO : 6 and having the foregoing substitutions.
- the disclosure provides a thermostable enzyme derived from amino acid substitution (s) at one or more residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in a Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4) .
- the disclosure encompasses a thermostable variant enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4) .
- thermostable enyzmes comprising the amino acid sequence set forth in SEQ ID NO : 4 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W.
- the polypeptide of SEQ ID NO: 4 can lack the leader sequence and comprises amino acid 25-471 of SEQ ID NO : 4 and having the foregoing substitutions.
- the disclosure provides a thermostable enzyme derived from amino acid substitution (s) at one or more residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443 in Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8) .
- polypeptides are provided comprising the amino acid sequence set forth in SEQ ID NO : 8 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W.
- the polypeptide of SEQ ID NO: 8 can lack the leader sequence and comprises amino acid 25-476 of SEQ ID NO : 8 and having the foregoing substitutions .
- Additional Cel6a family members can be identified by sequence alignment using any of the sequences of SEQ ID NO: 2, 4, 6, or 8. These family members can then be modified at corespondinding amino acid positions as set forth abouve . The modified polypeptide may then be assayed for activity as described below at various temperatures and conditions to identify those modifications that introduce a favorable activity.
- SCHEMA has been used previously to create families of hundreds of active ⁇ - lactamase and cytochrome P450 enzyme chimeras.
- SCHEMA uses protein structure data to define boundaries of contiguous amino acid
- SCHEMA chimeras can be predicted based on sequence-stability data from a small sample of the sequences. Linear regression modeling of thermal inactivation data for 184 cytochrome P450 chimeras showed that SCHEMA blocks made additive contributions to
- thermostability More than 300 chimeras were predicted to be thermostable by this model, and all 44 that were tested were more stable than the most stable parent. It was estimated that as few as 35 thermostability measurements could be used to predict the most thermostable chimeras. Furthermore, the thermostable P450 chimeras displayed unique activity and specificity profiles, demonstrating that chimeragenesis can lead to additional useful enzyme properties.
- SCHEMA recombination of CBH II enzymes can generate chimeric cellulases that are active on phosphoric acid swollen cellulose (PASC) at high temperatures, over extended periods of time, and broad ranges of pH.
- PASC phosphoric acid swollen cellulose
- thermostable enzymes described above can be operaly linked to a cellulose binding domain (CBD) such as the CBD-linker polypeptide set forth in SEQ ID NO: 10.
- CBD cellulose binding domain
- “Fused,” “operably linked, “ and “operably associated” are used
- each domain or peptide segment when operably linked can provide a functional polypeptide having a desired activity.
- Domains or peptide segments can be connected through peptide linkers such that they are functional or can be fused through other intermediates or chemical bonds.
- two domains can be part of the same coding sequence, wherein the polynucleotides are in frame such that the polynucleotide when transcribed encodes a single mRNA that when translated comprises both domains as a single polypeptide.
- both domains can be separately expressed as individual polypeptides and fused to one another using chemical methods.
- the coding domains will be linked "in-frame" either directly of separated by a peptide linker and encoded by a single polynucleotide.
- Various coding sequences for peptide linkers and peptide are known in the art.
- a polypeptide of the disclosure comprise a substantially pure polypeptide.
- a "substantially pure polypeptide” refers to a composition in which the polypeptide species is the predominant species present (i.e., on a molar or weight basis it is more abundant than any other individual macromolecular species in the composition) , and is generally a substantially purified composition when the object species comprises at least about 50 percent of the macromolecular species present by mole or % weight.
- a substantially pure polypeptide composition will comprise about 60 % or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, and about 98% or more of all macromolecular species by mole or % weight present in the composition.
- the object species is purified to essential homogeneity (i.e., contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.
- polynucleotide and nucleic acids encoding the polypeptides described herein.
- Polynucleotide or nucleic acid sequence refers to a polymeric form of
- a polynucleotide refers to a sequence that is not immediately contiguous with either of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences.
- the nucleotides of the disclosure can be
- a polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
- the term polynucleotide encompasses genomic DNA or RNA (depending upon the organism, i.e., RNA genome of viruses) , as well as mRNA encoded by the genomic DNA, and cDNA.
- the polynucleotides may be operatively linked to one or more heterologous regulatory or control sequences that control gene expression to create a recombinant polynucleotide capable of expressing the polypeptide.
- Expression constructs containing a heterologous polynucleotide encoding the Cel6a variant can be introduced into appropriate host cells to express the polypeptide.
- the polynucleotides encode the polypeptides described herein but have about 80% or more sequence identity, about 85% or more sequence identity, about 90% or more sequence identity, about 91% or more sequence identity, about 92% or more sequence identity, about 93% or more sequence identity, about 94% or more sequence identity, about 95% or more sequence identity, about 96% or more sequence identity, about 97% or more sequence identity, about 98% or more sequence identity, or about 99% or more sequence identity at the nucleotide level to a reference polynucleotide encoding the Cel6a polypeptides of SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and encode a polypeptide having cellulase activity and thermostability that is greater than a wild-type Cel6a of SEQ ID NO: 4, 6, or 8.
- an isolated polynucleotide of the disclosure comprises at least 80% identity (e.g., 80, 85, 90, 95, 98, 99% identity) to SEQ ID NO:l, 3, 5, 7, 11, 13, 15, 17, 19, 21, 23, 25, or 27 and which encodes a polypeptide of SEQ ID NO: 2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and wherein the
- polypeptide comprises cellulase activity and has improved
- the disclosure provides a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, and 27.
- the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO: 6 and having one or more substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
- the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO: 4 and having one or more substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W.
- the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO: 8 and having one or more substitutions selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
- the isolated polynucleotides encoding the polypeptides may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the isolated polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides and nucleic acid sequences utilizing recombinant DNA methods are well known in the art.
- the polynucleotides are operatively linked to control sequences for the expression of the
- control sequence may be an appropriate promoter sequence, which can be obtained from genes encoding extracellular or intracellular polypeptides, either homologous or heterologous to the host cell.
- suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure include the promoters obtained from the E. coli lac operon, Bacillus subtilis xylA and xylB genes, Bacillus megatarium xylose utilization genes (e.g.,Rygus et al . , (1991) Appl.
- control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
- the terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used.
- control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell.
- the leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used.
- control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.
- the 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the secreted polypeptide.
- the 5' end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.
- Effective signal peptide coding regions for bacterial host cells can be the signal peptide coding regions obtained from the genes for Bacillus NC1B 11837 maltogenic amylase, Bacillus stearothermophilus alpha- amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase , Bacillus stearothermophilus neutral proteases
- the disclosure is further directed to a recombinant expression vector comprising a polynucleotide encoding the engineered Cel6a polypeptides, and one or more expression
- regulating regions such as a promoter and a terminator, a
- the recombinant expression vector may be any vector
- plasmid e.g., a plasmid or virus
- the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
- the vectors may be linear or closed circular plasmids .
- the expression vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
- the vector may contain any means for assuring self-replication .
- the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome (s) into which it has been integrated.
- a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
- the expression vector of the disclosure contains one or more selectable markers, which permit easy selection of transformed cells.
- a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
- Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers, which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Other useful markers will be apparent to the skilled artisan.
- the disclosure provides a host cell comprising a polynucleotide encoding a Cel6a polypeptide, the polynucleotide being operatively linked to one or more control sequences for expression of the polypeptide in the host cell.
- Host cells for use in expressing the polypeptides encoded by the expression vectors of the disclosure are well known in the art and include, but are not limited to, bacterial cells, such as E. coli and Bacillus megaterium; eukaryotic cells, such as yeast cells, CHO cells and the like, insect cells such as Drosophila S2 and
- Spodoptera Sf9 cells animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells; and plant cells.
- animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells
- plant cells Other suitable host cells will be apparent to the skilled artisan. Appropriate culture mediums and growth conditions for the above-described host cells are well known in the art.
- Cel6a polypeptides of the disclosure can be made by using methods well known in the art. Polynucleotides can be synthesized by recombinant techniques, such as that provided in Sambrook et al . , 2001, Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press; and Current Protocols in Molecular Biology, Ausubel . F. ed., Greene Pub. Associates, 1998, updates to 2007.
- Polynucleotides encoding the enzymes, or the primers for amplification can also be prepared by standard solid- phase methods, according to known synthetic methods, for example using phosphoramidite method described by Beaucage et al., (1981) Tet Lett 22:1859-69, or the method described by Matthes et al . , (1984) EMBO J. 3:801-05, e.g., as it is typically practiced in automated synthetic methods.
- essentially any nucleic acid can be obtained from any of a variety of commercial sources, such as The Midland Certified Reagent Company, Midland, TX, The Great American Gene Company, Ramona, CA, ExpressGen Inc. Chicago, IL, Operon Technologies Inc., Alameda, CA, and many others.
- Engineered enzymes expressed in a host cell can be recovered from the cells and or the culture medium using any one or more of the well known techniques for protein purification, including, among others, lysozyme treatment, sonication,
- Suitable solutions for lysing and the high efficiency extraction of proteins from bacteria, such as E. coli, are commercially available under the trade name CelLytic BTM from Sigma-Aldrich of St. Louis MO.
- Chromatographic techniques for isolation of the polypeptides include, among others, reverse phase chromatography high performance liquid chromatography, ion exchange
- polypeptide can be used in a variety of applications, such as, among others, biofuel generation, cellulose breakdown and the like.
- the disclosure also provides a recombinant yeast expressing a Cel6a polypeptide variant as described above.
- the recombinant organisms of the disclosure are useful for bioethanol production.
- the engineered strains can be evaluated for cellulose hydrolysis and ethanol production under different conditions such as resting and growth conditions in SDC medium. Both small and large-scale (shaker flask/one liter bioreactor) studies can be performed. In resting cell experiments, cells are grown aerobically using glucose as the carbon source. Cells are then washed and used in cellulose anaerobic hydrolysis. Enzyme activity, hydrolysis products, glucose, and ethanol will be monitored using methods described herein. In studies carried out in a fermentor, a mild agitation can be used to promote mixing of solid cellulose material with cells. Once optimized industrial yeast fermentation process may be used. Different cellulose concentrations can also be used. The rate of glucose generation will be estimated from the
- the disclosure provides yeast strains for direct fermentation of cellulose to ethanol, eliminating the need for use of purified cellulases.
- the methods and compositions of the disclosure provide abundant, low-cost, agriculture residue to be used as raw material for ethanol production.
- the increased production of ethanol not only reduces pollution to the environment but also the need for imported petroleum as transportation fuel.
- the benefits from the invention include at least efficient, economical, and environmentally friendly conversion of biomass .
- the disclosure also provides purified enzymes (i.e., Cel6a thermostable variants) that can be used for industrial applications. Under such conditions, the enzymes are purified from a yeast or other microorganism engineered to express the enzymes.
- the enzymes are purified from a yeast or other microorganism engineered to express the enzymes.
- thermostable enzyme and the enzymes are then added to a reactor comprising cellulose to be degraded.
- Other cellulase enzymes include thermostable enzymes, thermostable enzymes, thermostable enzymes, and the enzymes.
- V128A/M135L_top GCAGC 1 AG 1 GC 1 GCGGC 1 GAGG 1 GCCAAG 111111 1 GGC 1 GGA 1 AC 43
- V131E/M135L_bottom GTATCCAG CCACAAAAAACTTG G CTCCTCAG CCACAG CACTAG CTG C 46
- SD-Ura media commercially available from MP Biomedicals, contains 20 g/L D-glucose, 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, and 0.8 g/L casamino acids withou uracil.
- YPD media 10 g/L Bacto yeast extract, 20 g/L Bacto peptone, and 20 g/L D-glucose.
- Tris-DTT buffer 390 g/L 1,4- dithiothreitol and 121.1 g/L of Tris base, pH 8.0.
- Buffer E 1.2 g/L Tris base, 92.4 g/L sucrose, and 0.2 g/L magnesium chloride, pH 7.4.
- Buffer A 20 mM Tris, 100 mM sodium chloride, and 10 mM
- Somogyi reagent 1 180 g/L Na 2 S0 4 , 15 g/L Rochelle salt, 30 g/L Na 2 C0 3 , and 20 g/L NaHC0 3 .
- Somogyi reagent 2 180 g/L Na2S04 and 12.8 g of anhydrous CUSO4.
- the overnight culture was used to inoculate 10 mL of YPD media per transformation to an OD 60 o of 0.1.
- the YPD culture was grown at 30 °C and 250 rpm until an OD 60 o of 1.5.
- 100 ⁇ L of Tris-DTT buffer per 10 mL of YPD culture was added and incubated at 30 °C and 250 rpm for 15 minutes.
- the cells were pelleted at 2,500 g for 3 minutes at 4°C, washed with 10 mL of ice-cold buffer E per 10 mL of culture, and again washed with 1 mL of ice-cold buffer E.
- the cell pellet was resuspended in 50 ⁇ L of ice-cold buffer E per transformation.
- 50 ⁇ L competent cells were mixed with 1 ⁇ g of DNA in less than 5 ⁇ L volume and transferred to an ice-cold 0.2-cm electroporation cuvette.
- the cells were electroporated at 0.54 kV and 25 ⁇ without a pulse controller and immediately rescued by adding 1 mL of warm (30°C) YPD media.
- the cells were incubated at 30°C and 250 rpm for 1 hour before plating on SD-Ura agar plates and grown at 30 °C for three days.
- the mixture was cooled immediately to 4°C and centrifuged at 1,000 g for 10 minutes at 4°C. 50 L of the supernatant was transferred for determination of the reducing end concentrations using the Nelson-Somogyi microtiter assay described below. 0.1 mM to 2 mM of cellobiose were used as standards.
- Plasmid DNA recovery from S. cerevisiae The plasmid DNA was recovered from S. cerevisiae using the ZymoprepTM II Yeast Plasmid Miniprep kit (Zymo Research) . An aliquot of 200 L of yeast cells from the library screen were pelleted at 2500 g for 2 minutes. The cell pellet was resuspended in 200 L of Solution 1 and 5 L of ZymolaseTM provided by the kit and incubated at 37 °C for 1 hour. 200 L of Solution 2 and 400 L of Solution 3 provided by the kit were added sequentially and thoroughly mixed. The mixture was centrifuged at 14,000 rpm for 10 minutes in a table-top microcentrifuge.
- the following purification steps using the Zymo columns were according to the manufacturer's instructions.
- the plasmid DNA was eluted with 6 L of Buffer EB provided by the kit.
- the plasmid DNA was amplified using E. coli XLl-blue cells and minipreped using QIAprep Spin Miniprep Kit (Qiagen) .
- the sequence of the plasmid DNA was determined using external sequencing facilities .
- cerevisiae cells were made competent using the Frozen-EZ Yeast Transformation IITM Kit (Zymo Research) for plasmid DNA
- a colony was used to start a 5 mL YPD culture and grown overnight at 30°C and 250 rpm. In the morning, the overnight culture was used to inoculate a new YPD culture to an OD 600 of 0.1. The YPD culture was grown until the OD 60 o of 1. The cells were pelleted, washed once with EZ 1 solution provided by the kit, and resuspended in EZ 2 solution provided by the kit. The cells were either transformed immediately or stored at -80°C for future use. 50 ⁇ L of the competent cells were diluted with 500 ⁇ L of EZ 3 solution provided by the kit.
- plasmid DNA in less than 5 ⁇ L volume
- 75 - 500 ⁇ L of diluted cells was mixed with 75 - 500 ⁇ L of diluted cells and incubated at 30°C for 45 minutes, vortexed every 15 minutes.
- 50 - 100 ⁇ L of transformed cells were spread per SD-Ura agar plate and incubated at 30°C for three days.
- Cel6a enzymes in the culture supernatants were purified using HP Ni-NTA Columns (GE Healthcare) in an
- AKTApurifierTM FPLC system (GE Healthcare)
- eluant fractions having elevated absorbance at 280 nm from the baseline were pooled.
- the enzyme solutions were washed three times using 50 mM sodium acetate, pH 5.0 to remove the imidazole from the elution buffer and concentrated to 500 ⁇ , using 20 mL spin columns with 10-kDa PES membranes (Sartorius Stedim Biotech) . PMSF and sodium azide were again supplemented to a final concentration of 100 ⁇ and 0.02%, respectively. Purified protein concentrations were determined using the absorbance at 280 nm and the extinction coefficient of the respective protein.
- Half-life measurement is defined as the time at which an enzyme loses 50% of its activity upon incubation at a specified temperature and other conditions (pH, buffer, etc.) . More thermostable enzymes exhibit longer half-lives upon
- T 50 value measurement is defined as the temperature at which an enzyme loses 50% of its activity during a 15-min heat inactivation period.
- 40 ⁇ , of 50 nq/ ⁇ , Cel6a enzymes in 50 mM sodium acetate buffer, pH 5.0 were aliquoted into the wells of a 96-well plate and incubated at an elevated temperature gradient in a PCR machine for 15-minutes. The temperature gradient was selected such that the T 50 value would fall in the middle.
- the enzymes were cooled to 4°C and 60 ⁇ , of well-agitated 50 mg/mL Avicel solution were added. The plate was subsequently incubated at 50 °C for 2 hours to measure the residual activity.
- the solution was cooled to 4°C and 50 ⁇ , of the supernatant was removed for reducing sugar determination along with cellobiose standards using Nelson-Somogyi assay as described above.
- the reducing sugar concentrations across the temperature gradient were determined using the cellobiose standards and plotted against temperature using SigmaPlot (Systat Sofware Inc) .
- the data points were fitted using 4-parameter sigmoidal curves, and the T 50 value was determined as the
- Thermostabilizing mutations discovered by random mutagenesis and screening were discovered by random mutagenesis and screening.
- HJPlus hls6 gene served as the template for error-prone PCR using forward primer alpha_HomeRe_Lt and reverse primer His_HomRe_Rt .
- the gene was flanked by the Nhel site and the Kpnl site in the plasmid pHJPlus .
- the primers were designed to have regions of homology 85 base-pairs upstream of the Nhel site and 65 base-pair downstream of the Kpnl site to allow homologous recombination to occur in yeast.
- the error rates of the libraries were adjusted using different concentrations of manganese chloride in the PCR reaction. Once the error-prone PCR libraries were expressed in yeast, five colonies were randomly selected for sequencing to determine the error-rates.
- Plasmid plG6 carrying the lG6 hls6 gene served as the template for error-prone PCR for the second generation of mutants.
- the error-prone PCR libraries were made and characterized as described for the first generation of mutants. Again, roughly 3000 colonies were randomly selected for the total activity evaluation at an elevated temperature in the high-throughput assay. The top 1% of the colonies with higher total activities at 75°C than 1G6 were selected for regrowth and re-evaluation with the activity assay. The total activities from culture supernatant of the top five variants from the rescreen are shown in Figure 3. Plasmid DNA from the top five variants was recovered, and the region of Cel6a gene was sequenced.
- the mutations of the top five clones are listed in Table 4. Clone 2B3 was identified as the best performing variant. It has a mutation that encodes the amino acid substitution. Other mutations discovered among the top five variants are N14S, M135L, S406P, S413P, and S413F.
- the following example illustrates a method for improving the total activity at elevated temperatures of a cellobiohydrolase by recombining potentially beneficial mutations and screening the resulting variants for higher stability. It also describes the biochemical properties of such improved cellobiohydrolase enzymes.
- Plasmid p2B3 carrying the 2B3 hls6 gene served as the template for the recombination of the mutations found in the first two generations of random mutagenesis.
- the amino acid substitutions included in the recombination library can be found in Table 5.
- Five PCR fragments were generated using the primers listed in Table 6. The fragments were isolated on 1% TAE agarose gels and purified using the QIAquick Gel Extraction Kit (Qiagen) . Fragments 1 and 2 were joined together via overlap extension PCR, while fragment 4 and 5 were joined together also via overlap extension PCR. The recombinant library PCR insert was subsequently made using fragment 1+2, 3, and 4+5 using overlap extension PCR.
- the recombinant library was expressed in yeast, and roughly 600 colonies were randomly selected for total activity evaluation at an elevated temperature in the high-throughput assay. The top 6% of the colonies with higher total activities at 75°C than 2B3 were selected for regrowth and re-evaluation with the activity assay. The total activities of 3-day culture supernatants of the top five variants from the rescreen are shown in Figure 4.
- Variant 3C6P was identified to be superior to 3C6F.
- the best variant 3C6P from the recombinant library contains the mutation S30F, V128A, M135L, Q277L, S317P,
- the amino acid positions are N14, S30, V128, V131, M135, Q277, S293, S317, S406, and S413 based on the sequence of HJPlus .
- Plasmid pHJPlus carrying the HJPlus hls6 gene served as the template for the NNK libraries at the beneficial positions described above.
- the primers used to construct the NNK libraries can be found in Table 8.
- the NNK libraries were expressed in yeast, and roughly 90 colonies per NNK library were randomly selected for total activity evaluation at an elevated temperature in the high-throughput assay.
- Colonies showing an increase of 10% or higher in total activity at 75°C than HJPlus were selected for regrowth and re-evaluation with the activity assay.
- the plasmid DNA of the top variants at each amino acid position from the rescreen were recovered, and the region of Cel6a gene was sequenced.
- the beneficial mutations identified from the random mutagenesis libraries were also found as the top variants in the NNK libraries.
- the top variants in the NNK libraries identified the same mutations as beneficial as the random mutagenesis libraries.
- the total activity from 3-day culture supernatant of the top five variants is shown in Figure 6, with the variants identified by the mutations they contain.
- two new beneficial mutations identified from the top five variants is shown in Figure 6, with the variants identified by the mutations they contain.
- two new beneficial mutations identified from 3-day culture supernatant of the top five variants is shown in Figure 6, with the variants identified by the mutations they contain.
- S317W SEQ ID NO: 11 and 12, polynucleotide and polypeptide, respectively
- S413W SEQ ID NO: 13 and 14, polynucleotide and polypeptide, respectively
- HJPlus the top variants from the NNK libraries (S317W and S413W) , and the best variant from each generation of the mutagenesis libraries (1F4, 1G6, 2B3, 3C6, and 3C6P) , as well as other top variants from the mutagenesis libraries (2F4, and 2G6) were expressed in yeast and purified using the AKTApurifierTM FPLC system as described in the methods section.
- the half-lives of the purified enzymes were determined at 75°C in 50 mM sodium acetate buffer, pH 5.0, and the thermal deactivation in 50 mM sodium acetate buffer, pH 5.0 over time was observed to follow a first- order rate equation.
- the half-life of the best variant, 3C6P, at 75°C increased approximately twenty-fold compared to HJPlus, from 9.5 minutes to 190 minutes.
- the T 50 values of the purified enzymes in 50 mM sodium acetate buffer, pH 5.0 were also determined.
- the T 50 values of HJPlus, the top two variants from the NNK libraries (S317W and S413W) , and the top variants from the mutagenesis libraries (1F4, 1G6, 2B3, 2F4, 2G6, 3C6, and 3C6P) were measured and summarized in Table 9.
- the top mutations contributed up to 2.4°C in the T 50 values.
- the T 50 value of 3C6P increased by 7.9°C, from 71.9 °C to 79.8 °C, from HJPlus.
- the improvements in total activities observed during the high throughput assay at 75 °C can be attributed to a significant increase in the thermostability of the variants.
- C246G retained a baseline activity after 15-minute incubation at 90°C, where 3C6P was completely inactivated in the same reaction condition. Further examination showed that the effect was pH-dependent . The baseline activity at 90°C was the most pronounced at pH 6 and pH 7, followed by pH 5 and pH 8, while 3C6P completely deactivated in the same conditions. At pH 7, the C246G variant retained 73% of the activity after 15-minute inactivation at 90°C (0.29 mM) compared to the residual activity at 70°C (0.40 mM) .
- the mutation glycine at position 269 and 276 does not stabilize the Cel6a from H. jecorina and H. insolens as it did in HJPlus, as measured by the residual activities after 15-minute thermal inactivation.
- This is in stark contrast to the C246G variant (in the background of 3C6P) , where the variant retained a high fraction of its residual activity, even as the temperature of thermal inactivation increased to 90 °C.
- this is believed to be due to the fact that both HJ C269G and HI L276G contained another free cysteine that is preventing the enzymes from being thermostabilized by the new mutation as it did in C246G.
- HJPlus beneficial mutations discovered in the background of HJPlus are applicable to other cellulases that share high sequence and/or structural homology with HJPlus, including H. jecoria, H. insolens, C. thermophilum, from which HJPlus is derived, as well as other Family 6 cellulases not listed here.
- Sequence homology is defined as high when it is 50% or more compared to the sequence of HJPlus.
- structural homology is defined as the ones that share the same structural topologies as HJPlus .
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The disclosure provides variant Cel6a enzymes having increased thermostabillity, methods of making and using such polypeptides.
Description
STABLE FUNGAL CEL6 ENZYME VARIANTS
CROSS REFERENCE TO RELATED APPLICATIONS
[0001 ] The application claims priority under 35 U.S.C. §119 to
U.S. Provisional Application Serial No. 61/510,914, filed, July 22, 2011, the disclosure of which is incorporated herein by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002 ] This invention was made with government support under
Grant No. W911NF-09-D-0001 awarded by the Army Research Office. The government has certain rights in the invention.
TECHNICAL FIELD
[0003] The disclosure provides thermostable variants of fungal
Cel6 (cellobiohydrolase II) enzymes and their use to hydrolyze cellulose .
BACKGROUND
[0004 ] The performance of cellulase mixtures in biomass conversion processes depends on many enzyme properties including stability, product inhibition, synergy among different cellulase components, productive binding versus nonproductive adsorption and pH dependence, in addition to the cellulose substrate physical state and composition. Given the multivariate nature of cellulose hydrolysis, it is desirable to have diverse cellulases to choose from in order to optimize enzyme formulations for different applications and feedstocks.
SUMMARY
[0005] The disclosure provide recombinant or substantially purified polypeptides comprising a sequence that is at least 67.7% identical to a sequence set forth in SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and having cellulase activity and increased thermostability compared to a polypeptide comprising SEQ ID NO: 4, 6, or 8. In one embodiment, the recombinant or
substantially purified polypeptide comprises at least 67.7% identity (e.g., 67.7, 70, 80, 85, 90, 95, 98, 99, or 100% identity) to SEQ ID NO : 2 and having one or more amino acid substitutions at residues selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413, and wherein the polypeptide has cellulase activity and comprises increased
thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In another embodiment, the polypeptide comprises one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and S413W. In yet another embodiment, the polypeptide comprises a sequence as set forth in SEQ ID NO:4 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 in SEQ ID NO : 4. In a further description, the polypeptide comprises SEQ ID NO : 4 and has one or more substitutions at a residue selected from N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437. In another embodiment, the polypeptide comprises a sequence as set forth in SEQ ID NO : 6 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443 in SEQ ID NO : 6. In a further description, the polypeptide comprises SEQ ID NO : 6 and has one or more substitutions at a residue selected from G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443. In yet another embodiment, the polypeptide comprises a sequence as set forth in SEQ ID NO : 8 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO : 2 correspond to residues or N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 in SEQ ID NO : 8. In a further
description, the polypeptide comprises SEQ ID NO : 8 and has one or more substitutions at a residue selected from N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443. In another
embodiment, the polypeptide comprise a sequence that is at least 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence as set forth in SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26, or 28. In another of the foregoing embodiments, the polypeptide can further comprise a cellulose binding domain (CBD) operably linked to the polypeptide. In one embodiment, the CBD comprises a sequence as set forth in SEQ ID NO: 10.
[ 0006 ] The disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO : 6 and having one or more substitutions at a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In a further embodiment, the
substitutions are selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W. In yet another embodiment, the polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
[ 0007 ] The disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO : 4 and having one or more substitutions at a residue selected from the group consisting of N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In one embodiment, the substitutions are selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W. In another embodiment, the recombinant polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S347F, and S427W.
[ 0008 ] The disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO : 8 and having one or more substitutions at a residue selected from the group consisting
of N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In one embodiment, the recombinant polypeptide the substitutions are selected from the group
consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W. In yet another embodiment, the polypeptide comprising SEQ ID NO: 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276G, L276A, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
[ 0009 ] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO : 2 having substitutions selected from the group consisting of: (a) one or more substitution at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof; and (b) a substitution at S413 and one or more substitutions at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof. In a further embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO : 2 having substitutions selected from the group consisting of: (a) one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (b) S413F and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (c) S413P and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; and (d) S413W and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P.
[ 0010 ] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO : 4 having substitutions at a positions selected from the group consisting of: (a) one or more residue selected from the group consisting of N38, S54, V151, V154, C269, S316, S430 and any combination thereof; (b) M158 and one or more additional residues selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (c) Q300 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (d) S340 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; and (e) S437 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430. In a further embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO : 4 having substitutions selected from the group consisting of: (a) one or more substitution selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (b) M158L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (c) Q300L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (d) S340P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (e) S340W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (f) S437F and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(g) S437P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; and (h) S437W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P.
[0011 ] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO : 6 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, and T436. In a further embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO: 6 having substitutions selected from the group consisting of: (a) a subsitution selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P; (b) Y443F and one or more additional
substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (c) Y443P and one or more additional
substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (d) Y443W and one or more additional
substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P.
[0012 ] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO : 8 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, 1307, R323, S347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting N38, L54, V155, V158, Q162, L276, 1307, R323, S347, and T436. In a further embodiment, the recombinant polypeptide comprises SEQ ID NO : 8 having substitutions selected from the group consisting of: (a) a residue selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (b) Y443F and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (c) Y443P and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G,
L276S, I307L, S347P, S347W, and T436P; and (d) Y443W and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P.
[0013] In various embodiments of the disclosure substitutions in SEQ ID NO : 2 are as described above, but specifically exclude substitutions at S413. In various embodiments of the disclosure substitutions in SEQ ID NO : 4 are as described above, but
specifically exclude substitutions at one or more positions selected from the group consisting of M158, Q300, S340, S437, and S437. In various embodiments of the disclosure substitutions in SEQ ID NO: 6 are as described above, but specifically exclude substitutions at Y443. In various embodiments of the disclosure substitutions in SEQ ID NO : 8 are as described above, but
specifically exclude substitutions at Y443.
[0014 ] In any of the foregoing embodiments comprising the subsitutions above, the resulting "modified" polypeptide comprises a polypeptide having cellulase activity and improved
thermostability compared to a wild-type enzyme comprising SEQ ID NO: 4, 6, or 8.
[0015] The disclosure also provides a polynucleotide encoding a polypeptide of any of the foregoing embodiments.
[0016] The disclosure also provides a vector comprising a polynucleotide described above as well as host cells comprising a vector of the disclosure.
[0017 ] The disclosure also provides a host cell that expresses a polypeptide described herein in any of the embodiments described above .
[0018 ] The disclosure also provides enzymatic preparation comprising a polypeptide of the disclosure.
[0019] The disclosure also provides a method of treating a biomass comprising cellulose, the method comprising contacting the biomass with a polypeptide described in any of the foregoing embodiments, an enzymatic preparation of the disclosure, or a host cell expressing a polypeptide of the disclosure.
BRIEF DESCRIPTION OF THE FIGURES
[0020] Figure 1 shows alignment of Cel6a amino acid sequences from H. insolens (SEQ ID NO: 6), H. jecorina (HJ) (SEQ ID NO : 4 ) , C. thermophilum (SEQ ID NO:8), and HJPlus (SEQ ID NO : 2 ) . Residues with double underlining are specific residues for mutation.
[0021] Figure 2 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing HJPlus and the top five variants from the first generation random mutagenesis library.
[0022] Figure 3 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing 1G6 and the top five variants from the second generation random mutagenesis library.
[0023] Figure 4 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing 2B3 and the top five variants from the recombination library.
[0024] Figure 5 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing HJPlus and the top variant from every generation of random mutagenesis and recombination.
[0025] Figure 6 shows the total activity at 75°C (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing the top five variants from the NNK libraries.
[0026] Figure 7 shows the half-life and T50 values for HJPlus and the best variants from each generation of random mutagenesis and recombination.
[0027] Figure 8 shows the residual activity of 3C6P and C246G at pH 4 (50 mM sodium citrate) , pH 5 (50 mM sodium acetate) , and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation ; the data were modeled with sigmoidal functions.
[0028] Figure 9 shows the half-lives of C246G at 90°C at various pH values (pH 4 (50 mM sodium citrate) , pH 5 (50 mM sodium
acetate) , and pH 6 through 9 (50 mM sodium phosphate) ) .
[0029] Figure 10 shows 2-hour activity of 3C6P and C246G at 80°C and 4-hour activity at 90°C (measured as cellobiose equivalents
released) at various pH conditions (pH 4 (50 mM sodium citrate) , pH 5 (50 mM sodium acetate) , and pH 6 through 9 (50 mM sodium phosphate) ) .
[0030] Figure 11 shows the effects of different mutations at residue C246 on the residual activity of the engineered Cel6s.
Purified enzymes were inactivated at 50 mM sodium phosphate, pH 7.0 for 15 minutes before assayed for activities with 30 mg/mL of Avicel. The activity was measured as the amount of cellobiose released after 2-hour incubation at 50°C.
[0031] Figure 12 shows the residual activity of H. jecorina
Cel6a and HJ C269G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate) , and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation ; the data were modeled with
sigmoidal functions.
[0032] Figure 13 shows the residual activity of H. insolens
Cel6a and HI L276G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate) , and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation; the data were modeled with
sigmoidal functions.
[0033] Figure 14 shows 2-hour activity of H. jecorina (HJ)
Cel6a, HJ with S54F mutation, HJ with S316R mutation, and HJ with S430P mutation at 50°C and 60°C (measured as cellobiose equivalents released) at 50 mM sodium acetate buffer, pH 5.0.
DETAILED DESCRIPTION
[0034] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a Cel6 enzyme" includes a plurality of such enzymes and reference to "the protein" includes reference to one or more proteins, and so forth.
[0035] Also, the use of "or" means "and/or" unless stated otherwise. Similarly, "comprise," "comprises," "comprising"
"include," "includes," and "including" are interchangeable and not intended to be limiting.
[0036] It is to be further understood that where descriptions of various embodiments use the term "comprising, " those skilled in the art would understand that in some specific instances, an
embodiment can be alternatively described using language
"consisting essentially of" or "consisting of."
[ 0037 ] Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.
[ 0038 ] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Thus, as used throughout the instant application, the following terms shall have the following meanings.
[ 0039 ] Cellulose is the main structural component of most plant cell walls, making it the most abundant biopolymer on earth.
Cellulose is a polysaccharide composed of glucosyl units linked together by β-1,4 glycosidic bonds. The β-linkage ensures that the subunits rotate 180° every two glucose subunits along the cellulose chain. The rotation makes the cellulose chains straight and highly symmetrical. X-ray diffraction and nuclear magnetic resonance studies have shown that cellulose chains form extensive
intramolecular and intermolecular hydrogen bonds between the hydroxyl groups and the oxygen in the pyranose ring, producing crystalline elementary fibrils with strong tensile strength and low accessibility. The extensive hydrogen bonding makes cellulose a very recalcitrant material, with a half-life of over four million years from spontaneous hydrolysis at 25°C. Despite this
recalcitrance, nature has provided several enzyme solutions capable of hydrolyzing cellulose into a form that can be utilized by microorganisms as a source of carbon and energy.
[ 0040 ] Recent studies have documented the superior performance of cellulases from thermophilic fungi relative to their mesophilic counterparts in laboratory scale biomass conversion processes, where enhanced stability leads to retention of activity over longer periods of time at both moderate and elevated temperatures. Fungal cellulases are attractive because they are highly active and can be expressed in fungal hosts such as Hypocrea jecorina (anamorph Trichoderma reesei) at levels up to 40 g/L in the supernatant.
Unfortunately, the set of documented thermostable fungal cellulases
is small. In the case of the processive cellobiohydrolase class II (CBH II) enzymes, fewer than 10 natural thermostable gene sequences are annotated in the CAZy database .
[ 0041 ] Fungal cellulases are important in industrial
applications, from cotton softening in the textile industries to biofuel production in biorefineries . Specifically, cellulases are used in biorefineries to break down cellulosic biomass into fermentable sugars, from which biofuels and higher-value chemicals can be derived. For cellulosic biomass to become a feasible feedstock for transportation fuels and chemicals, the cost of production needs to be competitive with the current technology of producing them from fossil fuels. Thermostable cellulases are particularly interesting for biomass degradation for several reasons. Thermostable cellulases tend to be more stable during production, storage and over a range of temperatures and operating conditions. Thermostable enzymes are more resilient towards relatively harsh industrial treatments and conditions. They also can be used to hydrolyze cellulose at higher temperatures, where the enzymes can access the substrate and catalyze their reactions at a higher rate - assuming that the reaction temperature is lower than the denaturing temperature for the enzyme. The risk of contamination by microorganisms is also reduced at elevated temperatures, as is the viscosity of hydrolysis mixtures, which lowers process costs.
[ 0042 ] The mesophilic fungus Hypocrea jecorina (anamorph
Trichoderma reesei) secretes an array of cellulose enzymes that work synergistically to degrade the cellulose to smaller oligomers and eventually to glucose. This fungus' collection of cellulases includes at least five endoglucanases (EGI-V) , two
cellobiohydrolases (Cel6a, Cel7a) , β-glucosidases, and
hemicellulases . In Hypocrea jecorina, cellobiohydrolase Cel7a, Cel6a, and EGII comprise 60 ± 5%, 20 ± 6%, and 12 ± 3% of total cellulase protein, respectively. All three cellulases consist of a cellulose-binding domain (CBD) and a catalytic domain connected by a glycosylated peptide linker. Cellobiose is the primary product of cellulose hydrolysis by cellobiohydrolases Cel6a and Cel7a.
[ 0043 ] Recently, the creation of a collection of thermostable
Family 6 fungal cellobiohydrolases (Cel6) using structure-guided SCHEMA recombination was reported. The genes encoding the Cel6a from Humicola insolens, Hypocrea jecorina, and Chaetomium
thermophilum were divided into eight blocks and recombined to create new, chimeric Cel6a enzymes. The block boundaries were identified using computational tools that allowed the number of disrupted side-chain contacts to be minimized, relative to the average number of mutations in the resulting chimeric proteins. Based on activity and stability data obtained from the enzymes encoded by the 48 genes that were sampled (from the 6,561 possible chimeric sequences) , linear regression models were built to determine how each sequence block contributes to the
thermostability of a chimeric Cel6a enzyme. The four stabilizing blocks were introduced in the cellobiohydrolase of H. jecorina to create the "HJPlus" chimera 12222332 (described in US Patent
Publication No. 2010/0304464-A1, incorporated herein by reference), which is stable for more than 12 hours at 63°C and is also secreted at relatively high levels in S. cerevisiae. In this disclosure, HJPlus was used as the platform for further protein engineering efforts to improve the enzyme properties relevant to optimizing cellulose hydrolysis, most notably thermostability, substrate binding, and cellulose activity. Further improving the
thermostability of HJPlus not only pushes the limit of enzyme stability but also allows the discovery of mutations that might not have appeared at lower temperatures because they are not beneficial at lower temperatures. The disclosure also provides a method that allows high throughput screening on microcrystalline cellulose, Avicel, to identify useful mutations.
[ 0044 ] The disclosure provides modified Family 6 cellulases
(Cel6a) that exhibit enhanced activity, thermostability, substrate binding, and/or expression in S. cerevisiae. The disclosure also provides genetic constructs that encode the modified Cel6a enzymes and the methods for mutating, deriving, and producing the modified Cel6a enzymes from yeast and fungal expression strains. The disclosure also provides use of the modified Cel6a enzymes in the hydrolysis of cellulose or cellulosic biomass and the production of
biofuels from fermentable sugars and alcohols, as well as other industrial applications of cellulases.
[ 0045 ] As will be described in more detail below, the
disclosure is based, at least in part, on the generation and expression of novel enzymes that catalyze the degredation of cellulose. In one embodiment, novel polypeptides that have been engineered/modified to degrade cellulose are provided. Such polypeptides include Cel6a variants that have been altered to include amino acid substitutions at specified residues as well as properties that include increased thermostability compared to wild- type Cel6a enzymes.
[ 0046 ] While these variants will be described in more detail below, it is understood that polypeptides of the disclosure contain one or more modified amino acids. The presence of modified amino acids are advantageous in, for example, (a) increasing polypeptide in vivo half-life, activity or thermostability, (b) reducing or increasing polypeptide antigenicity, and (c) increasing polypeptide storage stability. Amino acid(s) are modified, for example, co- translationally or post-translationally during recombinant production (e.g., N-linked glycosylation at N--X--S/T motifs during expression in mammalian cells) or modified by synthetic means.
Accordingly, A "mutant", "variant" or "modified" protein,
polypeptide, enzyme, polynucleotide, gene, or cell, means a protein, polypeptide, enzyme, polynucleotide, gene, or cell, that has been altered or derived, or is in some way different or changed, from a parent protein, polypeptide, enzyme,
polynucleotide, gene, or cell. A mutant or modified protein or enzyme is usually, although not necessarily, expressed from a mutant polynucleotide or gene .
[ 0047 ] "Conservative amino acid substitution" or, simply,
"conservative variations" of a particular sequence refers to the replacement of one amino acid, or series of amino acids, with essentially identical amino acid sequences. One of skill will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a percentage of amino acids in an encoded sequence result in "conservative variations" where the alterations result in the deletion of an
amino acid, addition of an amino acid, or substitution of an amino acid with a chemically similar amino acid.
[ 0048 ] Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, one conservative substitution group includes Alanine (A) , Serine (S) , and Threonine (T) . Another conservative substitution group includes Aspartic acid (D) and Glutamic acid (E) . Another conservative substitution group includes Asparagine (N) and
Glutamine (Q) . Yet another conservative substitution group includes Arginine (R) and Lysine (K) . Another conservative substitution group includes Isoleucine, (I) Leucine (L) , Methionine (M) , and Valine (V) . Another conservative substitution group includes Phenylalanine (F) , Tyrosine (Y) , and Tryptophan (W) .
[ 0049 ] Thus, "conservative amino acid substitutions" of a listed polypeptide sequence of the disclosure include substitutions of a percentage, typically less than 10%, of the amino acids of the polypeptide sequence, with a conservatively selected amino acid of the same conservative substitution group. Accordingly, a
conservatively substituted variation of a polypeptide of the invention can contain 100, 75, 50, 25, or 10 substitutions with a conservatively substituted variation of the same conservative substitution group.
[ 0050 ] It is understood that the addition of sequences which do not alter the encoded activity of a nucleic acid molecule, such as the addition of a non-functional or non-coding sequence, is a conservative variation of the basic nucleic acid. The "activity" of an enzyme is a measure of its ability to catalyze a reaction, i.e., to "function", and may be expressed as the rate at which the product of the reaction is produced. For example, enzyme activity can be represented as the amount of product produced per unit of time or per unit of enzyme (e.g., concentration or weight), or in terms of affinity or dissociation constants. As used
interchangeably herein a "Cel6a activity", "biological activity of Cel6a" or "functional activity of Cel6a", refers to an activity exerted by a Cel6a, Cel6a polypeptide, or a polypeptide having Cel6a activity on a Cel6a polypeptide substrate, as determined in vitro, according to standard techniques (as described below) . Such
Cel6a activity can be characterized as the rate of breakdown of cellulose or other organic polymeric sugar composition.
[0051 ] "Conservative variants" are proteins or enzymes in which a given amino acid residue has been changed without altering overall conformation and function of the protein or enzyme, including, but not limited to, replacement of an amino acid with one having similar properties, including polar or non-polar character, size, shape and charge. Amino acids other than those indicated as conserved may differ in a protein or enzyme so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and can be, for example, at least 30%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99%, as determined according to an alignment scheme. As referred to herein, "sequence similarity" means the extent to which nucleotide or protein sequences are related. The extent of similarity between two sequences can be based on percent sequence identity and/or conservation. "Sequence identity" herein means the extent to which two nucleotide or amino acid sequences are invariant. "Sequence alignment" means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity. Numerous methods for aligning sequences and assessing similarity/identity are known in the art such as, for example, the Cluster Method, wherein similarity is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and
Pearson, 1985; Pearson and Lipman, 1988) . When using all of these programs, the preferred settings are those that results in the highest sequence similarity. For example, an commonly used on-line algorithm can be found at http : ( // ) web . expasy . org/sim/ and the default parameters used (e.g., gap open penalty of 12, gap extension penalty of 4 and the comparison Matrix being BLOSUM62) . Using the immediately foregoing algorithm "SIM" (Huang et al . , Advances in Applied Mathematics, vol. 12 (1991), pp. 337-357), the percent identity between SEQ ID NO : 2 and SEQ ID NO : 6 is 67.7%.
[0052 ] Non-conservative modifications of a particular
polypeptide are those which substitute any amino acid not
characterized as a conservative substitution. For example, any substitution which crosses the bounds of the six groups set forth above. These include substitutions of basic or acidic amino acids for neutral amino acids, (e.g., Asp, Glu, Asn, or Gin for Val, lie, Leu or Met) , aromatic amino acid for basic or acidic amino acids (e.g., Phe, Tyr or Trp for Asp, Asn, Glu or Gin) or any other substitution not replacing an amino acid with a like amino acid. Basic side chains include lysine (K) , arginine (R) , histidine (H) ; acidic side chains include aspartic acid (D) , glutamic acid (E) ; uncharged polar side chains include glycine (G) , asparagine (N) , glutamine (Q) , serine (S) , threonine (T) , tyrosine (Y) , cysteine (C) ; nonpolar side chains include alanine (A) , valine (V) , leucine (L) , isoleucine (I), proline (P) , phenylalanine (F) , methionine (M) , tryptophan (W) ; beta-branched side chains include threonine (T) , valine (V), isoleucine (I); aromatic side chains include tyrosine (Y) , phenylalanine (F) , tryptophan (W) , histidine (H) .
[ 0053 ] Accordingly, some amino acid residues at specific positions in a polypeptide are "excluded" from conservative amino acid substitutions. Instead, these restricted or "specific" amino acids are generally chosen from a particular group of amino acids or a specific amino acid to be substituted at that position. These amino acid residues can be substituted at a designated position to obtain a modified or variant polypeptide. While some overlap may occur, the members substituted at these specific positions are not "conservative amino acid substitutions" as defined above. In general, these mutations represent non-conservative substitutions at the indicated position in the designated sequence. For example, as described more fully below the substitution at position 14 of, e.g., SEQ ID NO : 2 (see Figure 1), replaces Asn or Gly with Ser. This substitution is generally not considered a "conservative" substitution. Similar substitutions are made throughout the various sequences at the indicated positions in order to modify the activity of the polypeptide.
[ 0054 ] A "mutation" means any process or mechanism resulting in a mutant protein, enzyme, polynucleotide, gene, or cell. This includes any mutation in which a protein, enzyme, polynucleotide, or gene sequence is altered, and any detectable change in a cell
arising from such a mutation. Typically, a mutation occurs in a polynucleotide or gene sequence, by point mutations, deletions, or insertions of single or multiple nucleotide residues. A mutation includes polynucleotide alterations arising within a protein- encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A mutation in a gene can be "silent", i.e., not reflected in an amino acid alteration upon expression, leading to a "sequence-conservative" variant of the gene. This generally arises when one amino acid corresponds to more than one codon .
[ 0055 ] A "parent" protein, enzyme, polynucleotide, gene, or cell, is any protein, enzyme, polynucleotide, gene, or cell, from which any other protein, enzyme, polynucleotide, gene, or cell, is derived or made, using any methods, tools or techniques, and whether or not the parent is itself native or mutant. A parent polynucleotide or gene encodes for a parent protein or enzyme.
Exemplary parent polynucleotides and polypeptides include, for example, SEQ ID NO: 3, 5, and 7 and SEQ ID NO: 4, 6, and 8, respectively .
[ 0056 ] A "protein" or "polypeptide", which terms are used interchangeably herein, comprises one or more chains of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds. An "enzyme" means any substance, composed wholly or largely of protein, that catalyzes or promotes, more or less specifically, one or more chemical or biochemical reactions. A "native" or "wild-type" protein, enzyme, polynucleotide, gene, or cell, means a protein, enzyme,
polynucleotide, gene, or cell that occurs in nature. In some embodiments of the disclosure proteins or protein sequences are presented that are not fully "native". For example, in certain aspect of the disclosure the catalytic domains of the respective enzymes are native, but they further comprise a cellulose binding domain and linker from H. jecorina , which results in a protein that is not native to, for example, H. insolens and C. thermophilum .
[ 0057 ] A polynucleotide, polypeptide, or other component is
"isolated" when it is partially or completely separated from
components with which it is normally associated (other proteins, nucleic acids, cells, synthetic reagents, etc.). A nucleic acid or polypeptide is "recombinant" when it is artificial or engineered, or derived from an artificial or engineered protein or nucleic acid. For example, a polynucleotide that is inserted into a vector or any other heterologous location, e.g., in a genome of a
recombinant organism, such that it is not associated with
nucleotide sequences that normally flank the polynucleotide as it is found in nature is a recombinant polynucleotide. A protein expressed in vitro or in vivo from a recombinant polynucleotide is an example of a recombinant polypeptide. Likewise, a polynucleotide sequence that does not appear in nature, for example a variant of a naturally occurring gene, is recombinant. For example, an
"isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. For example, with regards to genomic DNA, the term "isolated" includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated. Typically, an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical
precursors or other chemicals when chemically synthesized.
[ 0058 ] "Sequence identity" herein means the extent to which two nucleotide or amino acid sequences are invariant. "Sequence alignment" means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity. Numerous methods for aligning sequences and assessing
similarity/identity are known in the art such as, for example, the Cluster Method, wherein similarity is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and
Pearson, 1985; Pearson and Lipman, 1988) . When using all of these programs, the preferred settings are those that results in the highest sequence similarity. For example, the "identity" or
"percent identity" with respect to a particular pair of aligned amino acid sequences can refer to the percent amino acid sequence identity that is obtained by ClustalW analysis (version W 1.8 available from European Bioinformatics Institute, Cambridge, UK) , counting the number of identical matches in the alignment and dividing such number of identical matches by the greater of (i) the length of the aligned sequences, and (ii) 96, and using the following default ClustalW parameters to achieve slow/accurate pairwise alignments--Gap Open Penalty: 10; Gap Extension Penalty: 0.10; Protein weight matrix: Gonnet series; DNA weight matrix: IUB; Toggle Slow/Fast pairwise alignments=SLOW or FULL Alignment.
[ 0059 ] Two sequences are "optimally aligned" when they are aligned for similarity scoring using a defined amino acid
substitution matrix (e.g., BLOSUM62), gap existence penalty and gap extension penalty so as to arrive at the highest score possible for that pair of sequences. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well- known in the art and described, e.g., in Dayhoff et al . (1978) "A model of evolutionary change in proteins" in "Atlas of Protein Sequence and Structure," Vol. 5, Suppl . 3 (ed. M. 0. Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, D.C. and Henikoffet al. (1992) Proc. Nat Ί . Acad. Sci. USA 89: 10915-10919 (each of which is incorporated by reference) . The BLOSUM62 matrix (FIG. 10) is often used as a default scoring substitution matrix in sequence alignment protocols such as Gapped BLAST 2.0. The gap existence penalty is imposed for the introduction of a single amino acid gap in one of the aligned sequences, and the gap extension penalty is imposed for each additional empty amino acid position inserted into an already opened gap. The alignment is defined by the amino acids positions of each sequence at which the alignment begins and ends, and optionally by the insertion of a gap or multiple gaps in one or
both sequences so as to arrive at the highest possible score. While optimal alignment and scoring can be accomplished manually, the process is facilitated by the use of a computer-implemented alignment algorithm, e.g., gapped BLAST 2.0, described in Altschul et al. (1997) Nucl . Acids Res. 25: 3389-3402 (incorporated by reference herein) , and made available to the public at the National Center for Biotechnology Information (NCBI) Website
(www.ncbi.nlm.nih.gov). Optimal alignments, including multiple alignments, can be prepared using, e.g., PSI-BLAST, available through the NCBI website and described by Altschul et al. (1997) Nucl. Acids Res. 25:3389-3402 (incorporated by reference herein) .
[ 0060 ] With respect to an amino acid sequence that is optimally aligned with a reference sequence, an amino acid residue
"corresponds to" the position in the reference sequence with which the residue is paired in the alignment. The "position" is denoted by a number that sequentially identifies each amino acid in the reference sequence based on its position relative to the N- terminus. For example, in SEQ ID NO: 2, position 14 is N, position 15 is W, position 16 is S, etc. When a test sequence is optimally aligned with SEQ ID NO: 2, a residue in the test sequence that aligns with the W at position 16 is said to "correspond to position 16" of SEQ ID NO : 2. Owing to deletions, insertion, truncations, fusions, etc., that must be taken into account when determining an optimal alignment, in general the amino acid residue number in a test sequence as determined by simply counting from the N-terminal will not necessarily be the same as the number of its corresponding position in the reference sequence. For example, in a case where there is a deletion in an aligned test sequence, there will be no amino acid that corresponds to a position in the reference sequence at the site of deletion. Where there is an insertion in an aligned reference sequence, that insertion will not correspond to any amino acid position in the reference sequence. In the case of truncations or fusions there can be stretches of amino acids in either the reference or aligned sequence that do not correspond to any amino acid in the corresponding sequence .
[ 0061 ] By "cellulase activity" means an enzyme that is capable of hydrolyzing cellulose. Cellulase refers to a class of enzymes
produced by fungi, bacteria, and protozoans that catalyze the hydrolysis of cellulose. However, there are also cellulases produced by other types of organisms such as plants and animals. The EC number for this group of enzymes is EC 3.2.1.4. There are five general types of cellulases based on the type of reaction catalyzed: endo-cellulase ; exo-cellulase, within this category there are two main types of exo-cellulases (or cellobiohydrolases, abbreviate CBH) - one type working processively from the reducing end, and one type working processively from the non-reducing end of cellulose; cellobiase or beta-glucosidase hydrolyses; oxidative cellulases; and cellulose phosphorylases that depolymerize cellulose using phosphates instead of water. Most fungal cellulases have two-domains: a catalytic domain and a cellulose binding domain that are connected by a flexible linker. In specific embodiments of the disclosure the cellulase activity is a Cel6a activity. The sequences described herein include, in some instances, both the cellulose binding domain and the catalytic domain or just the catalytic domain. In such instances where only the catalytic domain sequence is provided it will be recognized that a cellulose binding domain (CBD) such as that provided in SEQ ID NO: 10, may be functional linked (either as part of the coding sequence or fused later) to the catalytic domain either directly or through a linker.
[ 0062 ] As used herein a "modified" or "thermostable" Cel6a variant refers to a polypeptide as described in more detail below that comprises at least 67.7% identity (e.g., 67.7, 70, 80, 90, 95, 98, 99% identity) to SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26 or 28 and which has at least one specific mutation as set forth below. A specific mutation refers to a one or more
substitutions at N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 in HJPlus (SEQ ID NO : 2 ) ; N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO:4); G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443 in Cel6a enzyme from Hu icola insolens (SEQ ID NO: 6); or N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443 in Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8), and wherein the
modified or thermostable variant comprises increased thermostability or activity compared to a wild-type protein of SEQ ID NO: 4, 6, or 8.
[ 0063 ] Referring to the sequence comparison of various Cel6a polypeptides in Figure 1, SEQ ID NO : 2 includes the amino acid sequence HJplus . SEQ ID NO : 4 provides the amino acid sequence of wild-type Cel6a from Hypocrea jecorina (including a signal domain residues 1-24) and shares amino acid sequence identity to HJPlus
(SEQ ID NO:2). SEQ ID NO : 6 includes the amino acid sequence of Cel6a (including a signal domain residues 1-23) from Humicola insolens. This wild-type Cel6a shares % amino acid sequence identity to the Cel6a of Hypocrea jecorina (SEQ ID NO: 4) as well as the HJplus polypeptide of SEQ ID NO: 2. SEQ ID NO : 8 includes the amino acid sequence of wild-type Cel6a (including a signal domain residues 1-24) from Chaetomium thermophilum and shares amino acid sequence identity to SEQ ID NO: 2, 4, and 6.
[ 0064 ] The polypeptides of Figure 1 (SEQ ID Nos:2, 4, 6, and 8) are closely related to one another and show a high degree of sequence identity. The sequences can be aligned based on the sequence homology. The alignment provided in Figure 1 identifies "equivalent positions" in the sequences. An equivalent position denotes a position which, on the basis of the alignment of the sequence of the parent polypeptides in question with the
"reference" Cel6a amino acid sequence in question (e.g. SEQ ID NO: 2) so as to achieve j uxtapositioning of amino acid residues which are common to both, corresponds most closely to a particular position in the reference sequence in question. This process can cause gaps or insertions to appear in the sequences. In the alignment of Figures 1, equivalent positions are shown lined up vertically with one another. For example, position 14 in SEQ ID NO: 2 is equivalent to position 38, 37, and 38 in SEQ ID NO: 4, 6, and 8, respectively.
[ 0065 ] In one embodiment, the disclosure provides a modified
Cel6a enzyme comprising amino acid substitution (s) at one or more residues selected from N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 in HJPlus (SEQ ID NO:2), wherein the modified Cel6a comprises increased thermostability and cellulase
activity. In one specific embodiment, the disclosure encompasses a variant Cel6a enzyme, wherein said enzyme comprises specific amino acid substitution ( s ) at one or more of the residues N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W in HJPlus (SEQ ID NO: 2) . Accordingly, in various embodiments, isolated or
recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 2 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W. In another embodiment, the disclosure provides polypeptides that have at least 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, or 28, wherein the polypeptide comprises cellulase activity and has increased thermostability compared to SEQ ID NO: 2, 4, 6, or 8.
[ 0066 ] In one embodiment, the disclosure provides modified
Cel6a enzymes derived from amino acid substitution ( s ) at one or more residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443 in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6), from which HJPlus is derived), wherein the modified Cel6a comprises increased thermostability and cellulase activity. The residue position (s) can further be identified by reference to the residues of SEQ ID NO: 2 and Figure 1. In one specific embodiment, the disclosure encompasses a variant Cel6a enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6), from which HJPlus is derived. Accordingly, in various embodiments, isolated or
recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 6 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443,
wherein at least one or more of these specific residues have subsitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO: 6 can lack the leader sequence and comprises amino acid 24-476 of SEQ ID NO : 6 and having the foregoing substitutions .
[ 0067 ] In one embodiment, the disclosure provides a modified
Cel6a enzymes derived from amino acid substitution ( s ) at one or more residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO:4), from which HJPlus is derived), wherein the modified Cel6a comprises increased thermostability and cellulase activity. The residue position (s) can further be identified by reference to the residues of SEQ ID NO: 2 and Figure 1. In one specific embodiment, the invention encompasses a variant Cel6a enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4), from which HJPlus is derived. Accordingly, in various embodiments, isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 4 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO: 4 can lack the leader sequence and comprises amino acid 25-471 of SEQ ID NO : 4 and having the foregoing substitutions .
[ 0068 ] In one embodiment, the disclosure provides a modified
Cel6a enzymes derived from amino acid substitution ( s ) at one or more residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443 in Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8), from which HJPlus is derived), wherein the modified Cel6a
comprises increased thermostability and cellulase activity. The residue position (s) can further be identified by reference to the residues of SEQ ID NO: 2 and Figure 1. In one specific embodiment, the disclosure encompasses a variant Cel6a enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W in in Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8), from which HJPlus is derived. Accordingly, in various embodiments, isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO : 8 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO: 8 can lack the leader sequence and comprises amino acid 25-476 of SEQ ID NO : 8 and having the foregoing substitutions .
[ 0069 ] In one embodiment, the disclosure provides modified
Family 6 cellulases derived from amino acid substitution at one or more residues corresponding to N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 of SEQ ID NO : 2. The residue position (s) in related Cel6a's can be identified by reference to Figure 1. In one specific embodiment, the disclosure encompasses a variant Family 6 cellulase, wherein said enzyme comprises amino acid substitution at one or more of the residues corresponding to N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W of SEQ ID NO : 2 (see, e.g., Figure 1) . Examples of Family 6 cellulases include, but are limited to, Humicola insolens Cel6a, Hypocrea jecorina Cel6a, Chaetomium thermophilum Cel6a, Phanerochaete chrysosporium Cel6a, Thermobifida fusca Cel6a and Cel6b,
Cellulomonas fimi Cel6a and Cel6b, Talaromyces emersonii CBHII, Penicillium decumbens Cel6a, or variants derived from wild-type Family 6 cellulases mentioned above.
[0070 ] In other embodiments of the disclosure polypeptides comprising at least 67.7% or more (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identity to SEQ ID NO : 2 and having any combination of the following amino acids S14, F30, M30, A128, E131, L135, A246, G246, L246, S246, L277, R293, P317, W317, P406, F413, and/or W413 and having Cel6a activity is provided.
[0071 ] In other embodiments of the disclosure polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO : 4 and having any combination of the following amino acids S38, F54, M54, A151, E154, L158, A269, G269, L269, S269, L300, R316, P340, W340, P430, F437, and/or W437 and having Cel6a activity is provided.
[0072 ] In other embodiments of the disclosure polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO : 6 and having any combination of the following amino acids
537, F53, M53, A155, E158, L162, A276, G276, S276, L307, R323, P347, W347, P436, F443, and/or W443 and having Cel6a activity is provided .
[0073] In other embodiments of the disclosure polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO : 8 and having any combination of the following amino acids
538, F54, M54, A155, E158, L162, A276, G276, S276, L307, P347, W347, P436, F443, and/or W443 and having Cel6a activity is
provided .
[0074 ] In one embodiment, the disclosure relates to a variant derived from an amino acid substitution at residue C246G in a thermostable cellulase of SEQ ID NO: 2, or C269G of SEQ ID NO: 4, or L276G of SEQ ID NO: 6, or L276G of SEQ ID NO : 8. The residue position corresponds to the position found in HJPlus of SEQ ID NO: 2.
[0075] For the purposes of the disclosure, a polypeptide of the disclosure exhibits improved thermostability with respect to a corresponding parent polypeptide if it has a T50 which is at least about 5°C, or at least about 9°C higher than that of the parent cellulase, or for example a cellobiohydrolase having a T50 from about 5°C to about 30°C higher, or any amount therebetween, or a T50 from about 9°C to about 30°C higher, or any amount therebetween, when compared to that of the parent cellobiohydrolase. The T50 is
the temperature at which the modified or the natural enzyme retains 50% of its residual activity after a pre-incubation for 15 minutes and is determined by the assay detailed in Examples below or as known in the art.
[ 0076 ] A thermostable Cel6a variant of the disclosure comprises an enzyme that has a thermostabililty higher than the wild-type enzyme of SEQ ID NO:4, 6, or 8 by at least 5°C. In one embodiment, the wild-type enzyme has a T50 of 70°C and a thermostabilized variant has an increase in T50 of 5°C or above. In various embodiments described herein, the modified Cel6a enzymes may exhibit enhanced thermostabilities, characterized by a 20-fold increase in half-life at 75 °C and an increase of 7.9 °C in T50 value as compared to HJPlus Cel6a of SEQ ID NO: 2, or wild-type enzymes comprising SEQ ID NO: 4, 6, or 8.
[ 0077 ] The modified cellobiohydrolases or cellulases of the disclosure may have T50 which is about 5°C to about 30°C higher than that of a corresponding parent cellobiohydrolase (e.g., SEQ ID NO:2, 4, 6 or 8), or any range therebetween, about 5°C to about 20°C higher, or any range therebetween, about 8°C to about 15°C higher, or any range therebetween, or from about 9°C to about 15°C higher, or any range therebetween. For example, the modified cellulase may have a T50 that is at least about 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30°C higher than that of the corresponding parent cellobiohydrolase.
[ 0078 ] The disclosure provides Cel6a variants, mutants and chimeras having increased thermostability compared to a wild-type protein consisting of SEQ ID NO: 4, 6 or 8. In one embodiment, the thermostable enzyme is derived from amino acid substitution ( s ) at one or more residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443 in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6) . In another embodiment, the disclosure encompasses a variant Cel6a enzyme, wherein said thermostable enzyme comprises amino acid substitution (s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in Cel6a enzyme from Humicola insolens (SEQ ID NO: 6) . In various embodiments, isolated or recombinant polypeptides are provided comprising the amino acid
sequence set forth in SEQ ID NO : 6 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W are provided. In any of the foregoing embodiments, the polypeptide of SEQ ID NO: 6 can lack the leader sequence and comprises amino acid 24-476 of SEQ ID NO : 6 and having the foregoing substitutions. In one embodiment, the disclosure provides a thermostable enzyme derived from amino acid substitution (s) at one or more residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in a Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4) . In one specific embodiment, the disclosure encompasses a thermostable variant enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Cel6a enzyme from Hypocrea jecorina (SEQ ID NO: 4) .
Accordingly, in various embodiments, isolated or recombinant thermostable enyzmes are provided comprising the amino acid sequence set forth in SEQ ID NO : 4 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO: 4 can lack the leader sequence and comprises amino acid 25-471 of SEQ ID NO : 4 and having the foregoing substitutions. In one embodiment, the disclosure provides a thermostable enzyme derived from amino acid substitution (s) at one or more residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443 in Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8) . In one embodiment, the disclosure encompasses a thermostable variant enzyme, wherein said enzyme comprises amino acid substitution (s) at one or more of the
residues N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W in a Cel6a enzyme from Chaetomium thermophilum (SEQ ID NO: 8) . Accordingly, in various embodiments, isolated or recombinant thermostable
polypeptides are provided comprising the amino acid sequence set forth in SEQ ID NO : 8 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and/or Y443, wherein at least one or more of these specific residues have subsitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO: 8 can lack the leader sequence and comprises amino acid 25-476 of SEQ ID NO : 8 and having the foregoing substitutions .
[ 0079 ] Additional Cel6a family members can be identified by sequence alignment using any of the sequences of SEQ ID NO: 2, 4, 6, or 8. These family members can then be modified at corespondinding amino acid positions as set forth abouve . The modified polypeptide may then be assayed for activity as described below at various temperatures and conditions to identify those modifications that introduce a favorable activity.
[ 0080 ] The variants identified herein can also be used to generate chimeric cellobiohydrolases . For example, SCHEMA has been used previously to create families of hundreds of active β- lactamase and cytochrome P450 enzyme chimeras. SCHEMA uses protein structure data to define boundaries of contiguous amino acid
"blocks" which minimize <£>, the library average number of amino acid sidechain contacts that are broken when the blocks are swapped among different parents. It has been shown that the probability that a β-lactamase chimera was folded and active was inversely related to the value of E for that sequence. The RASPP
(Recombination as Shortest Path Problem) algorithm was used to identify the block boundaries that minimized <E> relative to the library average number of mutations, <m> . More than 20% of the -500 unique chimeras characterized from a β-lactamase collection comprised of 8 blocks from 3 parents (38 = 6,561 possible
sequences) were catalytically active. A similar approach produced a 3-parent, 8-block cytochrome P450 chimera family containing more than 2,300 novel, catalytically active enzymes. Chimeras from these two collections were characterized by high numbers of mutations, 66 and 72 amino acids on average from the closest parent, respectively. SCHEMA/RASPP thus enabled design of chimera families having significant sequence diversity and an appreciable fraction of functional members.
[ 0081 ] It has also been shown that the thermostabilities of
SCHEMA chimeras can be predicted based on sequence-stability data from a small sample of the sequences. Linear regression modeling of thermal inactivation data for 184 cytochrome P450 chimeras showed that SCHEMA blocks made additive contributions to
thermostability. More than 300 chimeras were predicted to be thermostable by this model, and all 44 that were tested were more stable than the most stable parent. It was estimated that as few as 35 thermostability measurements could be used to predict the most thermostable chimeras. Furthermore, the thermostable P450 chimeras displayed unique activity and specificity profiles, demonstrating that chimeragenesis can lead to additional useful enzyme properties. Here SCHEMA recombination of CBH II enzymes can generate chimeric cellulases that are active on phosphoric acid swollen cellulose (PASC) at high temperatures, over extended periods of time, and broad ranges of pH.
[ 0082 ] Descriptions of SCHEMA directed recombination and synthesis of chimeric polypeptides are described in the examples herein, as well as in Otey et al . , (2006), PLoS Biol. 4(5):ell2; Meyer et al . , (2003) Protein Sci . , 12:1686-1693; U.S. Patent
Application No. 12/024,515, filed February 1, 2008; and U.S. Patent Application No. 12/027,885, filed February 7, 2008; such references incorporated herein by reference in their entirety.
[ 0083 ] In other embodiments, the thermostable enzymes described above can be operaly linked to a cellulose binding domain (CBD) such as the CBD-linker polypeptide set forth in SEQ ID NO: 10. "Fused," "operably linked, " and "operably associated" are used
interchangeably herein to broadly refer to a chemical or physical coupling of two otherwise distinct domains or peptide segments,
wherein each domain or peptide segment when operably linked can provide a functional polypeptide having a desired activity.
Domains or peptide segments can be connected through peptide linkers such that they are functional or can be fused through other intermediates or chemical bonds. For example, two domains can be part of the same coding sequence, wherein the polynucleotides are in frame such that the polynucleotide when transcribed encodes a single mRNA that when translated comprises both domains as a single polypeptide. Alternatively, both domains can be separately expressed as individual polypeptides and fused to one another using chemical methods. Typically, the coding domains will be linked "in-frame" either directly of separated by a peptide linker and encoded by a single polynucleotide. Various coding sequences for peptide linkers and peptide are known in the art.
[ 0084 ] In some embodiments, a polypeptide of the disclosure comprise a substantially pure polypeptide. A "substantially pure polypeptide" refers to a composition in which the polypeptide species is the predominant species present (i.e., on a molar or weight basis it is more abundant than any other individual macromolecular species in the composition) , and is generally a substantially purified composition when the object species comprises at least about 50 percent of the macromolecular species present by mole or % weight. Generally, a substantially pure polypeptide composition will comprise about 60 % or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, and about 98% or more of all macromolecular species by mole or % weight present in the composition. In some embodiments, the object species is purified to essential homogeneity (i.e., contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species. Solvent species, small molecules
(<500 Daltons) , and elemental ion species are not considered macromolecular species.
[ 0085 ] The disclosure also provides polynucleotide and nucleic acids encoding the polypeptides described herein. "Polynucleotide" or "nucleic acid sequence" refers to a polymeric form of
nucleotides. In some instances a polynucleotide refers to a
sequence that is not immediately contiguous with either of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences. The nucleotides of the disclosure can be
ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. A polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. The term polynucleotide encompasses genomic DNA or RNA (depending upon the organism, i.e., RNA genome of viruses) , as well as mRNA encoded by the genomic DNA, and cDNA.
[ 0086 ] The polynucleotides may be operatively linked to one or more heterologous regulatory or control sequences that control gene expression to create a recombinant polynucleotide capable of expressing the polypeptide. Expression constructs containing a heterologous polynucleotide encoding the Cel6a variant can be introduced into appropriate host cells to express the polypeptide.
[ 0087 ] Given the knowledge of specific sequences of the Cel6a enzymes (see, e.g., SEQ ID NOs:l, 3, 5, and 7), the polynucleotide sequences will be apparent form the amino acid sequence of the disclosure to one of skill in the art. The knowledge of the codons corresponding to various amino acids coupled with the knowledge of the amino acid sequence of the polypeptides allows those skilled in the art to make different polynucleotides encoding the polypeptides of the disclosure. Thus, the disclosure contemplates each and every possible variation of the polynucleotides that could be made by selecting combinations based on possible codon choices, and all
such variations are to be considered specifically disclosed for any of the polypeptides described herein.
[ 0088 ] In some embodiments, the polynucleotides encode the polypeptides described herein but have about 80% or more sequence identity, about 85% or more sequence identity, about 90% or more sequence identity, about 91% or more sequence identity, about 92% or more sequence identity, about 93% or more sequence identity, about 94% or more sequence identity, about 95% or more sequence identity, about 96% or more sequence identity, about 97% or more sequence identity, about 98% or more sequence identity, or about 99% or more sequence identity at the nucleotide level to a reference polynucleotide encoding the Cel6a polypeptides of SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and encode a polypeptide having cellulase activity and thermostability that is greater than a wild-type Cel6a of SEQ ID NO: 4, 6, or 8.
[ 0089 ] In one embodiment, an isolated polynucleotide of the disclosure comprises at least 80% identity (e.g., 80, 85, 90, 95, 98, 99% identity) to SEQ ID NO:l, 3, 5, 7, 11, 13, 15, 17, 19, 21, 23, 25, or 27 and which encodes a polypeptide of SEQ ID NO: 2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and wherein the
polypeptide comprises cellulase activity and has improved
thermostability compared to a polypeptide comprising SEQ ID NO: 4, 6, or 8. In another embodiment, the disclosure provides a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, and 27. In yet another embodiment, the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO: 6 and having one or more substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W. In yet another embodiment, the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO: 4 and having one or more substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W. In yet another embodiment, the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO: 8 and having one or more
substitutions selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
[ 0090 ] In some embodiments, the isolated polynucleotides encoding the polypeptides may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the isolated polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides and nucleic acid sequences utilizing recombinant DNA methods are well known in the art.
Guidance is provided in Sambrook et al . , 2001, Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press; and Current Protocols in Molecular Biology, Ausubel. F. ed., Greene Pub. Associates, 1998, updates to 2007.
[ 0091 ] In some embodiments, the polynucleotides are operatively linked to control sequences for the expression of the
polynucleotides and/or polypeptides. In some embodiments, the control sequence may be an appropriate promoter sequence, which can be obtained from genes encoding extracellular or intracellular polypeptides, either homologous or heterologous to the host cell. For bacterial host cells, suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure, include the promoters obtained from the E. coli lac operon, Bacillus subtilis xylA and xylB genes, Bacillus megatarium xylose utilization genes (e.g.,Rygus et al . , (1991) Appl.
Microbiol. Biotechnol . 35:594-599; Meinhardt et al . , (1989) Appl. Microbiol. Biotechnol. 30:343-350), prokaryotic beta-lactamase gene
(Villa-Kamaroff et al . , (1978) Proc . Natl Acad. Sci . USA 75: 3727- 3731), as well as the tac promoter (DeBoer et al . , (1983) Proc. Natl Acad. Sci. USA 80: 21-25) . Various suitable promoters are described in "Useful proteins from recombinant bacteria" in
Scientific American, 1980, 242:74-94; and in Sambrook et al . , supra .
[ 0092 ] In some embodiments, the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence
encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used.
[ 0093 ] In some embodiments, the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used.
[ 0094 ] In some embodiments, the control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Effective signal peptide coding regions for bacterial host cells can be the signal peptide coding regions obtained from the genes for Bacillus NC1B 11837 maltogenic amylase, Bacillus stearothermophilus alpha- amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase , Bacillus stearothermophilus neutral proteases
(nprT, nprS, nprM) , and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, (1993) Microbiol Rev 57: 109-137.
[ 0095 ] The disclosure is further directed to a recombinant expression vector comprising a polynucleotide encoding the engineered Cel6a polypeptides, and one or more expression
regulating regions such as a promoter and a terminator, a
replication origin, etc., depending on the type of hosts into which they are to be introduced. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
[ 0096 ] The recombinant expression vector may be any vector
(e.g., a plasmid or virus), which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the polynucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids .
[ 0097 ] The expression vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication . Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome (s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.
[ 0098 ] In some embodiments, the expression vector of the disclosure contains one or more selectable markers, which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers, which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Other useful markers will be apparent to the skilled artisan.
[ 0099 ] In another embodiment, the disclosure provides a host cell comprising a polynucleotide encoding a Cel6a polypeptide, the polynucleotide being operatively linked to one or more control sequences for expression of the polypeptide in the host cell. Host cells for use in expressing the polypeptides encoded by the expression vectors of the disclosure are well known in the art and include, but are not limited to, bacterial cells, such as E. coli and Bacillus megaterium; eukaryotic cells, such as yeast cells, CHO
cells and the like, insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells; and plant cells. Other suitable host cells will be apparent to the skilled artisan. Appropriate culture mediums and growth conditions for the above-described host cells are well known in the art.
[00100 ] The Cel6a polypeptides of the disclosure can be made by using methods well known in the art. Polynucleotides can be synthesized by recombinant techniques, such as that provided in Sambrook et al . , 2001, Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press; and Current Protocols in Molecular Biology, Ausubel . F. ed., Greene Pub. Associates, 1998, updates to 2007. Polynucleotides encoding the enzymes, or the primers for amplification can also be prepared by standard solid- phase methods, according to known synthetic methods, for example using phosphoramidite method described by Beaucage et al., (1981) Tet Lett 22:1859-69, or the method described by Matthes et al . , (1984) EMBO J. 3:801-05, e.g., as it is typically practiced in automated synthetic methods. In addition, essentially any nucleic acid can be obtained from any of a variety of commercial sources, such as The Midland Certified Reagent Company, Midland, TX, The Great American Gene Company, Ramona, CA, ExpressGen Inc. Chicago, IL, Operon Technologies Inc., Alameda, CA, and many others.
[ 00101 ] Engineered enzymes expressed in a host cell can be recovered from the cells and or the culture medium using any one or more of the well known techniques for protein purification, including, among others, lysozyme treatment, sonication,
filtration, desalting, ultra-centrifugation, chromatography, and affinity separation (e.g., substrate bound antibodies). Suitable solutions for lysing and the high efficiency extraction of proteins from bacteria, such as E. coli, are commercially available under the trade name CelLytic BTM from Sigma-Aldrich of St. Louis MO.
[ 00102 ] Chromatographic techniques for isolation of the polypeptides include, among others, reverse phase chromatography high performance liquid chromatography, ion exchange
chromatography, gel electrophoresis, and affinity chromatography. Conditions for purifying a particular enzyme will depend, in part,
on factors such as net charge, hydrophobicity, hydrophilicity, molecular weight, molecular shape, etc., and will be apparent to those having skill in the art.
[00103] As discussed above, the polypeptide can be used in a variety of applications, such as, among others, biofuel generation, cellulose breakdown and the like.
[00104 ] The disclosure also provides a recombinant yeast expressing a Cel6a polypeptide variant as described above. The recombinant organisms of the disclosure are useful for bioethanol production. The engineered strains can be evaluated for cellulose hydrolysis and ethanol production under different conditions such as resting and growth conditions in SDC medium. Both small and large-scale (shaker flask/one liter bioreactor) studies can be performed. In resting cell experiments, cells are grown aerobically using glucose as the carbon source. Cells are then washed and used in cellulose anaerobic hydrolysis. Enzyme activity, hydrolysis products, glucose, and ethanol will be monitored using methods described herein. In studies carried out in a fermentor, a mild agitation can be used to promote mixing of solid cellulose material with cells. Once optimized industrial yeast fermentation process may be used. Different cellulose concentrations can also be used. The rate of glucose generation will be estimated from the
experiments and compared to those without the modified Cel6a polypeptides. In studies under growing conditions, the cells will be provided cellulose as the sole carbon source, and other nutrients necessary for growth. Anaerobic conditions are
maintained. Cell biomass, enzyme activities, glucose and ethanol are measured.
[00105] The disclosure provides yeast strains for direct fermentation of cellulose to ethanol, eliminating the need for use of purified cellulases. The methods and compositions of the disclosure provide abundant, low-cost, agriculture residue to be used as raw material for ethanol production. The increased production of ethanol not only reduces pollution to the environment but also the need for imported petroleum as transportation fuel. Collectively, the benefits from the invention include at least
efficient, economical, and environmentally friendly conversion of biomass .
[ 00106 ] The disclosure also provides purified enzymes (i.e., Cel6a thermostable variants) that can be used for industrial applications. Under such conditions, the enzymes are purified from a yeast or other microorganism engineered to express the
thermostable enzyme and the enzymes are then added to a reactor comprising cellulose to be degraded. Other cellulase enzymes
(e.g., Cel7a) can be added to the reactor.
[ 00107 ] The following examples are meant to further explain, but not limited the foregoing disclosure or the appended claims.
EXAMPLES
[ 00108 ] Strains, plasmids , and oligonucleotides. Strains, plasmid, oligonucleotide, nucleotide and amino acid sequences described herein listed in Tables 1, 2, 3, and 4 below.
[ 00109 ] Table 1 . Genotypes of strains disclosed herein
[ 00110 ] Table 2 . Plasmids disclosed herein
[ 00111 ] Table 3: Oligonucleotide sequences (shown from 5' to 3') disclosed herein.
V128A_top GCAGC 1 AG 1 GC 1 GCGGC 1 AG 1 GCCAAG 1111 Al 1 GGCI GGAI AC 35
V128A_bottom GTATCCAG CCACATAAAACTTG G CACCTCAG CCG CAG CACTAG CTG C 36
V131E_top GCAGC 1 AG 1 CI 1 GC 1 AGGAGCCAA 111 IAIGIGGCI GA 1 AC 37
V131E_bottom GTATCCAG CCACATAAAACTTG G CTCCTCAG CCACAG CACTAG CTG C 38
M135L_top GCAGC 1 AG 1 GC 1 1 GGCI GAGG 1 GCCAAG 11111 IGIGGCIGGAIAC 39
M135L_bottom GTATCCAG CCACAAAAAACTTG G CACCTCAG CCACAG CACTAG CTG C 40
V128A/V131E_top GCAGC 1 AG 1 GC 1 GCGGC 1 GAGGAGCCAAG 1111 A 1 1 GGC 1 GGA 1 AC 41
V128A/V131E_bottom GTATCCAG CCACATAAAACTTG G CTCCTCAG CCG CAG CACTAG CTG C 42
V128A/M135L_top GCAGC 1 AG 1 GC 1 GCGGC 1 GAGG 1 GCCAAG 111111 1 GGC 1 GGA 1 AC 43
V128A/M135L_bottom GTATCCAG CCACAAAAAACTTG G CACCTCAG CCG CAG CACTAG CTG C 44
V131E/M135L_top GCAGC IA IGCIGIGGCI GAG AGCCAAG I I I I I IGIGGCIGGAIAC 45
V131E/M135L_bottom GTATCCAG CCACAAAAAACTTG G CTCCTCAG CCACAG CACTAG CTG C 46
128/131/135_top GCAGC 1 AG 1 GC 1 GCGGC 1 GAGGAGCCAAG 111111 1 GGC 1 GGAI AC 47
128/131/135_bottom GTATCCAG CCACAAAAAACTTG G CTCCTCAG CCG CAG CACTAG CTG C 48
WT128/131/135_top GCAGC 1 AG 1 GC 1 1 GGC 1 GAGG 1 GCCAAG 1111 Al G 1 GGCI GGAI AC 49
WT128/131/135_bottom GTATCCAG CCACATAAAACTTG G CACCTCAG CCACAG CACTAG CTG C 50
S293 _top CAAAAATG CCTCAAG ACCTAG AG CG CTG 51
S293R_bottom CAGCGCICIAG ICI IGAGGCAI 111 IG 52
WT293_top CAAAAATGCCTCAAGTCCTAGAGCGCTG 53
WT293_bottom CAGCGCICIAGGACI I AGGCAI 111 IG 54
S406P_top GATGGAACGAGTGATCCTTCTGCTCCAAG 55
S406P_bottom CTTGGAGCAGAAGGATCACTCGTTCCATC 56
WT406_top GATGGAACGAGTGATTCTTCTGCTCCAAG 57
WT406_bottom CTTGGAGCAGAAGAATCACTCGTTCCATC 58
N14NNK Lt GGCCAATGTGGTGGCCAGNNKTGGTCGGGTCCGAC 59
N14Rt CTG G CCACC ACATTG G CC 60
S30NNK Lt CCGGAAGCACATGCGTCTACNNKAACGACTATTACTCCCAGTG 61
S30 Rt GTAG ACG CATGTG CTTCCG G 62
V128NNK Lt CGTG CCG CAG CTAGTG CTN N KG CTG AG GTG CCAAG 63
V128 Rt AG CACTAG CTG CG G CACG 64
V131NNK Lt GCAGC 1 AG 1 GC 1 1 GGC 1 AGNNKCCAA 111 IAI I GCI 65
V131 Rt CTCAG CCACAG CACTAG CTG C 66
M135NNK Lt 1 GGCI GAGG 1 GCCAAG 1111 NNKI GGCI GGAI AC 11 IGG 67
M135 Rt AAAACTTG G CACCTCAG CCAC 68
Q277NNK Lt GTTG G GTTG G CCAG CAAATN N KG ATCCCG CTG CG CAG 69
Q277 Rt ATTTG CTG G CCAACCCAAC 70
S293NNK Lt GCAAATGTTTACAAAAATGCCTCANNKCCTAGAGCGCTGAGG 71
S293 Rt IGAGGCAI 111 IGIAAACAI 1 IGC 72
S317NNK Lt CTTG GTCAATAGCG AGTCCTCCAN N KTACACAAG CCCTAACCC 73
S317Rt GGAGGACTCGCTATTGACCAAG 74
S406NNK Lt GGAGAGTCAGATGGAACGAGTGATNNKTCTGCTCCAAGGTTCG 75
S406 Rt ATCACTCGTTCCATCTGACTCTCC 76
S413NNK Lt GATTCTTCTGCTCCAAGGTTCGATNNKCATTGCGCATTACCAG 77
S413Rt ATCGAACCTTGGAGCAGAAGAATC 78
W99Y Lt CTTTG AAG GTGTTCAG CTGTATG CTAATAACTATTATAG ATCTG AG 79
W99Y Rt CTCAG ATCTATAATAGTTATTAG CATACAG CTG AACACCTTCAAAG 80
N102PLt CAG CTGTG G G CTAATCC ATATTATAG ATCTG AG GTACATAC 81
N102PRt GTATGTACCTCAGATCTATAATATGGATTAGCCCACAGCTG 82
R122A Lt GACCCCGCGTTGGCTGCCGCAGCTAGTG 83
R122A Rt CACTAG CTG CG G CAG CCAACG CG G G GTC 84
A124K Lt G CGTTG CGTG CCAAAG CTAGTG CTG CG G 85
A124K Rt CCG CAG CACTAG CTTTG G CACG CAACG C 86
M146L Lt GACAAAACCCCCTTATTGGAACAAACGTTGGC 87
M146L Rt GCCAACG I 1 I G I 1 CAA 1 AAGGGG 1 1 1 I G I C 88
I153A Lt CAAACGTTGGCTGATGCTCGTACTGCGAATAAAAAC 89
I153A Rt 1 1 1 1 1 A 1 1 GCA 1 ACGAGCA 1 AGCCAACG I M G 90
Y186L Lt GAGCAACGGGGAGTTGAGCATTGCGGATG 91
Y186L Rt CATCCG CAATG CTCAACTCCCCGTTG CTC 92
C246G Lt CAG AGTG CTTATCTTG AG G GTATCAATTATG CAGTCAC 93
C246G Rt GTGACTGCATAATTGATACCCTCAAGATAAGCACTCTG 94
V251L Lt GTGCATCAATTATGCATTGACCCAGTTGAATTTG 95
V251L Rt CAAATTCAACTG G GTCAATG CATAATTG ATG CAC 96
S292G Lt GTTTACAAAAATG CCG GTAGTCCTAG AG CG CTG 97
S292G Rt CAGCG 1 1 AGGA 1 ACCGGCA 1 1 1 1 1 1 AAAC 98
L297V Lt CTCAAGTCCTAG AG CG GTTAG G G GTCTTG CAAC 99
L297V Rt GTTG CAAG ACCCCTAACCG CTCTAG G ACTTG AG 100
P321W Lt CCACCGTACACAAGCTGGAACCCAAACTACGATG 101
P321W Rt CATCGTAGTTTGGGTTCCAGCTTGTGTACGGTGG 102
F334L Lt G CATTACATAG AAG CATTG G CTCCTTTG CTTCG 103
F334L Rt CG AAG CAAAG G AG CCAATG CTTCTATGTAATG C 104
P358G Lt G AAACG G CAAG CAG G GTACAG G G C AG CTAG AATG 105
G358G Rt CATTCTAG CTG CCCTGTACCCTG CTTG CCGTTTC 106
G360R Lt CAAG CAG CCG ACAAG ACAG CTAG AATG G G G 107
G360R Rt CCCC ATTCTAG CTGTCTTGTCG G CTG CTTG 108
Q361R Lt CAG CCG ACAG G G AG ACTAG AATG G G G G C 109
Q361R Rt G CCCCCATTCTAGTCTCCCTGTCG G CTG 110
T373A Lt G CAATGTCAAG G GTG CTG GTTTCG GTGTTAG AC 111
T373A Rt GTCTAACACCGAAACCAGCACCCTTGACATTGC 112
[00112] Media, buffers, and reagents. SD-Ura media: commercially available from MP Biomedicals, contains 20 g/L D-glucose, 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, and 0.8 g/L casamino acids withou uracil. YPD media: 10 g/L Bacto yeast extract, 20 g/L Bacto peptone, and 20 g/L D-glucose. Tris-DTT buffer: 390 g/L 1,4- dithiothreitol and 121.1 g/L of Tris base, pH 8.0. Buffer E: 1.2 g/L Tris base, 92.4 g/L sucrose, and 0.2 g/L magnesium chloride, pH 7.4. Buffer A: 20 mM Tris, 100 mM sodium chloride, and 10 mM
imidazole, pH 8.0. Buffer B: 20 mM Tris, 100 mM sodium chloride, and 300 mM imidazole, pH 8.0. Somogyi reagent 1: 180 g/L Na2S04, 15 g/L Rochelle salt, 30 g/L Na2C03, and 20 g/L NaHC03. Somogyi reagent 2: 180 g/L Na2S04 and 12.8 g of anhydrous CUSO4. Nelson reagent: 50 g/L (NH4)2Mo04, 1.5 N H2S04, and 6 g/L NaH2As04; incubate at 37 °C for 16 - 24 hours for the formation of the chromogenic compound.
[00113] High-efficiency S. cerevisiae transformation. The transformation protocol published by Chao et al . (Nat Protoc, 1(2) :755-768, 2006) was adapted and scaled down to generate libraries with 104 colonies. A colony was used to start a 5 mL YPD culture and grown overnight at 30°C and 250 rpm. In the morning, the overnight culture was used to inoculate 10 mL of YPD media per transformation to an OD60o of 0.1. The YPD culture was grown at 30 °C and 250 rpm until an OD60o of 1.5. Once the cells reached the desired absorbance, 100 μL of Tris-DTT buffer per 10 mL of YPD culture was added and incubated at 30 °C and 250 rpm for 15 minutes. The cells were pelleted at 2,500 g for 3 minutes at 4°C, washed with 10 mL of ice-cold buffer E per 10 mL of culture, and again washed with 1 mL of ice-cold buffer E. The cell pellet was resuspended in 50 μL of ice-cold buffer E per transformation. For each transformation, 50 μL competent cells were mixed with 1 μg of DNA in less than 5 μL volume and transferred to an ice-cold 0.2-cm electroporation cuvette. The cells were electroporated at 0.54 kV and 25 μΈ without a pulse controller and immediately rescued by adding 1 mL of warm (30°C) YPD media. The cells were incubated at 30°C and 250 rpm for 1 hour before plating on SD-Ura agar plates and grown at 30 °C for three days.
[00114] Heterologous expression in S. cerevisiae in 96-well plates. To express random mutagenesis libraries in S. cerevisiae, the high-efficiency competent cells were used. The competent cells were transformed with 0.5 μg of the linearized vector and 0.5 μg of the error-prone cel6a PCR insert via electroporation and plated on SD-Ura agar plates. The linearized vector and the PCR insert shared regions of homology upstream and downstream of the cel6a gene and were expected to be joined together by homology recombination in S. cerevisiae. Colonies containing mutant Cel6a were randomly selected and inoculated in 50 μL/well of SD-Ura media in 96-well plates. The culture was grown overnight at 30°C, 250 rpm with 80% humidity in orbital shakers. Once the culture in SD-Ura media reached
saturation, it was expanded with 350 μL/well of YPD media and grown at 30°C, 250 rpm with 80% humidity for an additional of 48 hours. Both the SD-Ura media and the YPD media in 96-well plates were supplemented with 25 μg/mL of kanamycin to prevent bacterial
contamination. The culture was harvested by centrifugation at 5,000 x g, 4°C for 10 minutes, and the supernatant was used for activity assays without further treatment.
[00115] High-throughput Cel6a activity assay on Avicel . Cel6a enzymes in the culture supernatants were purified by binding to the substrate and washing with 50 mM sodium acetate, pH 5.0, to remove the media. Substrate plates were prepared by pipetting 60 μΐ, of well-agitated 50 mg/mL Avicel solution into 96-well PCR plates. 100 μΐ· of 3-day culture supernatant were added to the substrate plates and incubated at 4°C for 1.5 hours. Avicel and the bound enzymes were pelleted via centrifugation at 1,000 x g, 4°C and washed three times with 180 μΐ, of 50 mM sodium acetate, pH 5.0. After the wash step, Avicel and the bound enzymes were resuspended in 75 μΐ, of 50 mM sodium acetate, pH 5.0 and incubated at 75°C for two hours.
After the 2-hour incubation, the mixture was cooled immediately to 4°C and centrifuged at 1,000 g for 10 minutes at 4°C. 50 L of the supernatant was transferred for determination of the reducing end concentrations using the Nelson-Somogyi microtiter assay described below. 0.1 mM to 2 mM of cellobiose were used as standards.
[00116] Detection of reducing sugars. For reducing sugar in the range of 0.15 mM to 2 mM, the Nelson-Somogyi assay was used.
Typically, 50 μΐ, of sugar solution was mixed with 40 μΐ, of Somogyi reagent 1 and 10 μΐ, of Somogyi reagent 2 and boiled at 95°C for 15 minutes. The reaction was subsequently cooled to 4°C and mixed with 50 μΐ, of Nelson reagent. The reagents were mixed thoroughly to ensure the evolution of C02 was completed and the maximum color development was achieved. After centrifuging the reagents briefly to remove the C02 in the solution, the absorbance of the sugar solution at 520 nm was obtained using a SpectraMax microplate reader with or without cellobiose solution as standard.
[00117] Plasmid DNA recovery from S. cerevisiae . The plasmid DNA was recovered from S. cerevisiae using the Zymoprep™ II Yeast Plasmid Miniprep kit (Zymo Research) . An aliquot of 200 L of yeast cells from the library screen were pelleted at 2500 g for 2 minutes. The cell pellet was resuspended in 200 L of Solution 1 and 5 L of Zymolase™ provided by the kit and incubated at 37 °C for 1 hour. 200 L of Solution 2 and 400 L of Solution 3 provided by
the kit were added sequentially and thoroughly mixed. The mixture was centrifuged at 14,000 rpm for 10 minutes in a table-top microcentrifuge. The following purification steps using the Zymo columns were according to the manufacturer's instructions. The plasmid DNA was eluted with 6 L of Buffer EB provided by the kit. The plasmid DNA was amplified using E. coli XLl-blue cells and minipreped using QIAprep Spin Miniprep Kit (Qiagen) . The sequence of the plasmid DNA was determined using external sequencing facilities .
[00118] Low-efficiency S. cerevisiae transformation. S.
cerevisiae cells were made competent using the Frozen-EZ Yeast Transformation II™ Kit (Zymo Research) for plasmid DNA
transformation. A colony was used to start a 5 mL YPD culture and grown overnight at 30°C and 250 rpm. In the morning, the overnight culture was used to inoculate a new YPD culture to an OD600 of 0.1. The YPD culture was grown until the OD60o of 1. The cells were pelleted, washed once with EZ 1 solution provided by the kit, and resuspended in EZ 2 solution provided by the kit. The cells were either transformed immediately or stored at -80°C for future use. 50 μL of the competent cells were diluted with 500 μL of EZ 3 solution provided by the kit. 0.5 μg of plasmid DNA (in less than 5 μL volume) was mixed with 75 - 500 μL of diluted cells and incubated at 30°C for 45 minutes, vortexed every 15 minutes. 50 - 100 μL of transformed cells were spread per SD-Ura agar plate and incubated at 30°C for three days.
[00119] Heterologous expression in S. cerevisiae for enzyme purification. Fresh colonies on SD-Ura plates expressing the desired enzymes were inoculated into 5-10 mL SD-Ura medium and grown overnight at 30°C, 250 rpm. The overnight culture was diluted 1:10 with YPD medium in 300-mL Tunair flasks (Shelton Scientific) and grown at 30°C, 250 rpm for 48 hours. Cultures were centrifuged and sterile-filtered using 0.2 μπι polyethersulfone membranes, and PMSF (phenylmethylsulfonylfluoride) and sodium azide were
supplemented to a final concentration of 100 μΜ and 0.02%, respectively. Cel6a enzymes in the culture supernatants were purified using HP Ni-NTA Columns (GE Healthcare) in an
AKTApurifier™ FPLC system (GE Healthcare) , and eluant fractions
having elevated absorbance at 280 nm from the baseline were pooled. The enzyme solutions were washed three times using 50 mM sodium acetate, pH 5.0 to remove the imidazole from the elution buffer and concentrated to 500 μΐ, using 20 mL spin columns with 10-kDa PES membranes (Sartorius Stedim Biotech) . PMSF and sodium azide were again supplemented to a final concentration of 100 μΜ and 0.02%, respectively. Purified protein concentrations were determined using the absorbance at 280 nm and the extinction coefficient of the respective protein.
[00120] Half-life measurement. The half-life is defined as the time at which an enzyme loses 50% of its activity upon incubation at a specified temperature and other conditions (pH, buffer, etc.) . More thermostable enzymes exhibit longer half-lives upon
incubation. 40 μΐ, of 50 nq/μΐ, Cel6a enzyme in 50 mM sodium acetate buffer, pH 5.0 were aliquoted into eppendorf tubes and incubated at the specified temperature for a range of times in the tabletop thermal mixer. At each time point, an aliquot/tube of the enzyme was removed and cooled to 4°C on ice. The range of incubation time was selected such that the half-life would fall approximately in the middle. After the heat inactivation period and cooling, 60 μΐ, of well-agitated 50 mg/mL Avicel solution was added to the enzymes. The solution was subsequently incubated at 50°C for 2 hours, to obtain a measure the enzyme's residual activity. After the hydrolysis reaction, the solution was cooled to 4°C and 50 μΐ, of the supernatant was removed for reducing sugar determination along with cellobiose standards using the Nelson-Somogyi assay as described above. The reducing sugar concentrations over the range of heat inactivation periods were determined using the cellobiose standards, and the natural log of the residual activity at each time point was plotted as a function of time using Excel
(Microsoft) . The data points were fitted using a 1-parameter linear equation with the y-intercept set to zero, and the half-life of the enzyme was determined using the slope of the fitted equation.
[00121] T50 value measurement. T50 is defined as the temperature at which an enzyme loses 50% of its activity during a 15-min heat inactivation period. 40 μΐ, of 50 nq/μΐ, Cel6a enzymes in 50 mM sodium acetate buffer, pH 5.0 were aliquoted into the wells of a
96-well plate and incubated at an elevated temperature gradient in a PCR machine for 15-minutes. The temperature gradient was selected such that the T50 value would fall in the middle. After the heat inactivation period, the enzymes were cooled to 4°C and 60 μΐ, of well-agitated 50 mg/mL Avicel solution were added. The plate was subsequently incubated at 50 °C for 2 hours to measure the residual activity. After the hydrolysis reaction, the solution was cooled to 4°C and 50 μΐ, of the supernatant was removed for reducing sugar determination along with cellobiose standards using Nelson-Somogyi assay as described above. The reducing sugar concentrations across the temperature gradient were determined using the cellobiose standards and plotted against temperature using SigmaPlot (Systat Sofware Inc) . The data points were fitted using 4-parameter sigmoidal curves, and the T50 value was determined as the
temperature where 50% activity was lost.
EXAMPLE 1
Thermostabilizing mutations discovered by random mutagenesis and screening.
[00122] The following example illustrates a method for
discovering mutations that improve the total activity of Cel6 enzymes at elevated temperatures and also describes the biochemical properties of such improved enzymes.
[00123] Random mutagenesis. Plasmid pHJPlus carrying the
HJPlushls6 gene served as the template for error-prone PCR using forward primer alpha_HomeRe_Lt and reverse primer His_HomRe_Rt . The gene was flanked by the Nhel site and the Kpnl site in the plasmid pHJPlus . The primers were designed to have regions of homology 85 base-pairs upstream of the Nhel site and 65 base-pair downstream of the Kpnl site to allow homologous recombination to occur in yeast. The error rates of the libraries were adjusted using different concentrations of manganese chloride in the PCR reaction. Once the error-prone PCR libraries were expressed in yeast, five colonies were randomly selected for sequencing to determine the error-rates. Once the library with the desired mutation rate was identified, roughly 3000 colonies were randomly selected for total secreted cellobiohydrolase activity evaluation at an elevated temperature in the high-throughput assay. The top 1% of the colonies having higher total activities at 75°C than HJPlus were selected for regrowth and
re-evaluation with the activity assay. The total activities from culture supernatants of the top five variants from the rescreen are shown in Figure 2. The plasmid DNA of the top five variants was recovered, and the region of the Cel6a genes was sequenced. Clone 1G6 was identified as the best-performing variant, with a mutation that encodes for amino acid substitution S317P. Other amino acid substitutions discovered among the top five variants are S30F, V128A, V131E, S293R, and S413F.
[00124 ] Plasmid plG6 carrying the lG6hls6 gene served as the template for error-prone PCR for the second generation of mutants. The error-prone PCR libraries were made and characterized as described for the first generation of mutants. Again, roughly 3000 colonies were randomly selected for the total activity evaluation at an elevated temperature in the high-throughput assay. The top 1% of the colonies with higher total activities at 75°C than 1G6 were selected for regrowth and re-evaluation with the activity assay. The total activities from culture supernatant of the top five variants from the rescreen are shown in Figure 3. Plasmid DNA from the top five variants was recovered, and the region of Cel6a gene was sequenced. The mutations of the top five clones are listed in Table 4. Clone 2B3 was identified as the best performing variant. It has a mutation that encodes the amino acid substitution. Other mutations discovered among the top five variants are N14S, M135L, S406P, S413P, and S413F.
[00125] Table 4. List of amino acid substitutions the top five most active variants from generations one and two.
EXAMPLE 2
Enhanced stability by recombination of stabilizing mutations
[ 00126] The following example illustrates a method for improving the total activity at elevated temperatures of a cellobiohydrolase by recombining potentially beneficial mutations and screening the
resulting variants for higher stability. It also describes the biochemical properties of such improved cellobiohydrolase enzymes.
[00127] Plasmid p2B3 carrying the 2B3hls6 gene served as the template for the recombination of the mutations found in the first two generations of random mutagenesis. The amino acid substitutions included in the recombination library can be found in Table 5. Five PCR fragments were generated using the primers listed in Table 6. The fragments were isolated on 1% TAE agarose gels and purified using the QIAquick Gel Extraction Kit (Qiagen) . Fragments 1 and 2 were joined together via overlap extension PCR, while fragment 4 and 5 were joined together also via overlap extension PCR. The recombinant library PCR insert was subsequently made using fragment 1+2, 3, and 4+5 using overlap extension PCR.
[00128] Table 5. List of amino acid mutations included in the recombination library
[00129] Table 6. List of primers used to generate the
recombination library
[00130 ] The recombinant library was expressed in yeast, and roughly 600 colonies were randomly selected for total activity evaluation at an elevated temperature in the high-throughput assay. The top 6% of the colonies with higher total activities at 75°C than 2B3 were selected for regrowth and re-evaluation with the activity assay. The total activities of 3-day culture supernatants of the top five variants from the rescreen are shown in Figure 4.
Plasmid DNA was recovered from the top five variants, and the
region of Cel6a gene was sequenced. The mutations in the top five variants are listed in Table 7. Variant 3C6 was identified as the best performing variant from the high-throughput screen. Mutation S413F and S413P identified in the previous libraries as beneficial were combined in variant 3C6. The total activities of the variants, as well as that of HJPlus and the best variants from each
generation, are shown in Figure 5. Variant 3C6P was identified to be superior to 3C6F. The best variant 3C6P from the recombinant library contains the mutation S30F, V128A, M135L, Q277L, S317P,
S406P, and S413P in the background of HJPlus Cel6a (see, e.g., US Patent Publication No. 2010/0304464-A1, which is incorporated
herein by reference) .
[00131 ] Table 7. The mutations of the top five variants from the recombination library with respect to 2B3
EXAMPLE 3
Identifying stabilizing mutations by site-saturation mutagenesis at key positions
[ 00132 ] The following example illustrates a method for improving the total activity at elevated temperatures of a cellobiohydrolase and also describes the biochemical properties of such improved cellobiohydrolase enzymes.
[ 00133] The random mutagenesis libraries described above
identified 10 amino acid positions as important for improving the
total activity of the cellobiohydrolase at elevated temperatures. The amino acid positions are N14, S30, V128, V131, M135, Q277, S293, S317, S406, and S413 based on the sequence of HJPlus . Plasmid pHJPlus carrying the HJPlushls6 gene served as the template for the NNK libraries at the beneficial positions described above. The primers used to construct the NNK libraries can be found in Table 8. The NNK libraries were expressed in yeast, and roughly 90 colonies per NNK library were randomly selected for total activity evaluation at an elevated temperature in the high-throughput assay. Colonies showing an increase of 10% or higher in total activity at 75°C than HJPlus were selected for regrowth and re-evaluation with the activity assay. The plasmid DNA of the top variants at each amino acid position from the rescreen were recovered, and the region of Cel6a gene was sequenced. The beneficial mutations identified from the random mutagenesis libraries were also found as the top variants in the NNK libraries. In other words, the top variants in the NNK libraries identified the same mutations as beneficial as the random mutagenesis libraries. The total activity from 3-day culture supernatant of the top five variants is shown in Figure 6, with the variants identified by the mutations they contain. Among the top five variants, two new beneficial
substitutions were discovered: S317W (SEQ ID NO: 11 and 12, polynucleotide and polypeptide, respectively) and S413W (SEQ ID NO: 13 and 14, polynucleotide and polypeptide, respectively) .
[00134 ] Table 8. The primers used to construct the NNK libraries at the ten beneficial positions identified in the random
mutagenesis libraries
EXAMPLE 4
Biochemical analysis of the top variants
[ 00135] The following example describes the biochemical properties of the improved cellobiohydrolase enzymes discovered above .
[ 00136] HJPlus, the top variants from the NNK libraries (S317W and S413W) , and the best variant from each generation of the mutagenesis libraries (1F4, 1G6, 2B3, 3C6, and 3C6P) , as well as other top variants from the mutagenesis libraries (2F4, and 2G6) were expressed in yeast and purified using the AKTApurifier™ FPLC system as described in the methods section. The half-lives of the purified enzymes were determined at 75°C in 50 mM sodium acetate buffer, pH 5.0, and the thermal deactivation in 50 mM sodium acetate buffer, pH 5.0 over time was observed to follow a first- order rate equation. As shown in Figure 7, after three rounds of directed evolution, the half-life of the best variant, 3C6P, at 75°C increased approximately twenty-fold compared to HJPlus, from 9.5 minutes to 190 minutes.
[ 00137 ] The T50 values of the purified enzymes in 50 mM sodium acetate buffer, pH 5.0 were also determined. The T50 values of HJPlus, the top two variants from the NNK libraries (S317W and S413W) , and the top variants from the mutagenesis libraries (1F4, 1G6, 2B3, 2F4, 2G6, 3C6, and 3C6P) were measured and summarized in Table 9. The top mutations contributed up to 2.4°C in the T50 values. The T50 value of 3C6P increased by 7.9°C, from 71.9 °C to 79.8 °C, from HJPlus. The improvements in total activities observed during the high throughput assay at 75 °C can be attributed to a significant increase in the thermostability of the variants.
[ 00138 ] Table 9. The T50 values for HJPlus and the top variants from the NNK libraries, the random mutagenesis libraries, and the recombination library
3C6 76.9 ± 0.2 S30F, V128A, M135L, Q277L, S317P, 406P
3C6P S30F, V128A, M135L, Q277L, S317P, 406P,
79.8 ± 0.3 S413P
Example 5
Investigating the pH dependency of the top variants
[ 00139] The following example illustrates a method of
identifying residue site (s) for improvements and investigating the pH dependency of the variants at elevated temperatures.
[ 00140 ] At high temperatures, certain amino residues such as cysteine or asparagine are prone to chemical modification or destruction that can lead to irreversible thermal inactivation of the enzyme. To examine the effect of cysteine on the thermal inactivation of Family 6 cellulase, the mutation C246G was introduced into the top variant 3C6P, expressed it in yeast, and purified the Cel6 variant using the AKTApurifier™ FPLC system as described in the methods section. The residual activities of the purified C246G Cel6a enzyme after 15-minute inactivation at 70°C through 90°C was examined in 50 mM sodium acetate buffer, pH 5.0, and compared to that of 3C6P. Interestingly, C246G retained a baseline activity after 15-minute incubation at 90°C, where 3C6P was completely inactivated in the same reaction condition. Further examination showed that the effect was pH-dependent . The baseline activity at 90°C was the most pronounced at pH 6 and pH 7, followed by pH 5 and pH 8, while 3C6P completely deactivated in the same conditions. At pH 7, the C246G variant retained 73% of the activity after 15-minute inactivation at 90°C (0.29 mM) compared to the residual activity at 70°C (0.40 mM) . At pH 6 where C246G is the most active, the variant retained 51% of the activity after 15- minute inactivation at 90°C (0.26 mM) compared to the residual activity at 70°C (0.50 mM) . The residual activities of 3C6P and C246G between pH 4 and 9 after 15-minute inactivation at 70°C through 90°C are shown in Figure 8.
[ 00141 ] The half-life of C246G was determined as well, and the thermal deactivation was observed to follow a first-order rate equation. The half-life of C246G is the longest at pH 6, followed by pH 7, 8, 5, 9, and 4, demonstrating thermostability as well as stability at alkaline conditions. The half-life of C246G was up to 83 minutes at pH 6, while the half-life of 3C6P at 90°C is less
than 5 minutes at various pH . The half-lives of C246G at 90°C at various pH are summarized in Figure 9.
[ 00142 ] In addition to measuring the residual activity of C246G after thermal inactivation in the form of T50 values and half-lives at 90°C, the total activities of C246G at various temperatures were measured as well. Specifically, the total activities of 3C6P and C246G after 2 hours of incubation at 80°C and after 4 hours of incubation at 90°C were measured and compared across different pHs . As shown in Figure 10, 3C6P and C246G released the same
concentration of cellobiose equivalent across different pHs and at both 80°C and 90°C. The only exception is the activity of C246G at pH 4 where C246G exhibited slightly lower activity than 3C6P.
Combining our observation on the stability of the C246G variant, this shows that the mutation C246G can greatly enhances the stability of a thermostable Family 6 cellulase, without
compromising on the activity of the enzyme.
[ 00143 ] To investigate the mechanism behind the stabilizing effect of the C246G mutation, other amino acid substitution at residue 246 were tested. Three other variants having mutations at residue C246 in the background of 3C6P were constructed and purified: C246S, C246A, and C246L. The activities of the new variants were determined after inactivating them across a
temperature gradient between 70°C and 90°C for 15 minutes at pH 7.0. As shown in Figure 11, at pH 7.0 all four variants with mutations at residue C246 exhibited a similar residual activity profile as that of C246G; all four variants retained roughly 35% to 69% activity after heat inactivation.
Example 6
Effect of the pH-dependent mutation in the background of H. jecorina and H. insolens Cel6a
[ 00144 ] The following example described the biochemical
properties of the pH-dependent mutation in the background of H. jecorina Cel6a and of H. insolens.
[ 00145 ] Mutation glycine at position 246 (the numbering based on HJPlus) is introduced into the Cel6a enzyme from H. jecorina, which has a cysteine at position 269, and into the Cel6a enzyme from H. insolens, which has a leucine at position 276. The variants HJ C269G and HI L276G were expressed in yeast and purified using the AKTApurifier™ FPLC system as described in the methods section. The
residual activities of the purified HJ C269G and HI L276G after 15- minute inactivation was measured at pH 4 to 9 to examine whether the same retention of baseline activity is observed in other Family 6 cellulases. As shown in Figure 12 and 13, the mutation glycine at position 269 and 276 does not stabilize the Cel6a from H. jecorina and H. insolens as it did in HJPlus, as measured by the residual activities after 15-minute thermal inactivation. This is in stark contrast to the C246G variant (in the background of 3C6P) , where the variant retained a high fraction of its residual activity, even as the temperature of thermal inactivation increased to 90 °C. As demonstrated here, this is believed to be due to the fact that both HJ C269G and HI L276G contained another free cysteine that is preventing the enzymes from being thermostabilized by the new mutation as it did in C246G.
EXAMPLE 7
Effect of the beneficial mutations in the background of H. jecorina
Cel6a
[00146] The following example describes the biochemical
properties of the beneficial mutations in the background of H.
jecorina Cel6a.
[00147] Mutations S54F, S316R, and S430P were introduced into the Cel6a enzyme from H. jecorina and expressed in yeast. 4-day yeast culture supernatants were purified using the AKTApurifier™ FPLC system as described in the methods section. The T50 values of the purified enzymes in 50 mM sodium acetate buffer, pH 5.0 were determined and summarized in Table 10. The mutations contributed up to 1.7°C in the T50 values, from 60°C to 61.7°C. This shows that the mutations not only stabilize the HJPlus Cel6a enzyme but also the Cel6a enzyme from its closest parent, H. jecorina. The total activities of the enzymes after 2 hours of incubation at 50°C and 60 °C were measured in 50 mM NaOAc buffer, pH 5.0. As shown in Figure 14, the improvements in the T50 value translated to increases in total activity of the enzyme after 2 hours. The mutants
demonstrated an increase up to 13% in total activity at 50°C, from 0.23 mM of cellobiose equivalents to 0.26 mM, and an increase up to 19% in total activity at 60°C, from 0.26 mM to 0.31 mM. As
demonstrated here, it is believed that the beneficial mutations discovered in the background of HJPlus are applicable to other
cellulases that share high sequence and/or structural homology with HJPlus, including H. jecoria, H. insolens, C. thermophilum, from which HJPlus is derived, as well as other Family 6 cellulases not listed here. Sequence homology is defined as high when it is 50% or more compared to the sequence of HJPlus. In addition, structural homology is defined as the ones that share the same structural topologies as HJPlus .
[ 00148 ] Table 10. The T50 values for H. jecorina (HJ) Cel6a and the beneficial mutations in the background of H. jecorina Cel6a
[ 00149 ] The foregoing examples are provided to further expl but not limit the disclosure.
Claims
1. A recombinant polypeptide comprising at least 67.7% identity to SEQ ID NO : 2 and having one or more amino acid substitutions at residues selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413, and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
2. The recombinant polypeptide of claim 1, further comprising a cellulose binding domain (CBD) operably linked to the polypeptide.
3. The recombinant polypeptide of claim 2, wherein the CBD comprises a sequence as set forth in SEQ ID NO: 10.
4. The recombinant polypeptide of claim 1, wherein the
polypeptide comprises one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and S413W.
5. The recombinant polypeptide of claim 1, wherein the
polypeptide comprises a sequence as set forth in SEQ ID NO : 4 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO:2 correspond to residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 in SEQ ID NO: 4.
6. The recombinant polypeptide of claim 1, wherein the
polypeptide comprises a sequence as set forth in SEQ ID NO : 6 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO:2 correspond to residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443 in SEQ ID NO: 6.
7. The recombinant polypeptide of claim 1, wherein the
polypeptide comprises a sequence as set forth in SEQ ID NO : 8 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO:2 correspond to residues or N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 in SEQ ID NO: 8.
8. The recombinant polypeptide of claim 1, wherein the
polypeptide comprise a sequence that is at least 80% identicial to the sequence as set forth in SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26, or 28.
9. The recombinant polypeptide of claim 1 comprising the sequence of SEQ ID NO : 2 and having substitutions selected from the group consisting of:
(a) one or more substitution at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof; and
(b) a substitution at S413 and one or more substitutions at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof.
10. The recombinant polypeptide of claim 9, comprising SEQ ID NO : 2 and having substitutions selected from the group consisting of:
(a) one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P;
(b) S413F and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P;
(c) S413P and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; and
(d) S413W and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P.
11. The recombinant polypeptide of claim 1 comprising SEQ ID NO : 4 having substitutions at a positions selected from the group consisting of:
(a) one or more residue selected from the group consisting of N38, S54, V151, V154, C269, S316, S430 and any combination thereof;
(b) M158 and one or more additional residues selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430;
(c) Q300 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430;
(d) S340 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; and
(e) S437 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430.
12. The recombinant polypeptide of claim 11, comprising SEQ ID NO : 4 and having having substitutions selected from the group consisting of:
(a) one or more substitution selected from the group
consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(b) M158L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(c) Q300L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(d) S340P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(e) S340W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P;
(f) S437F and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (g) S437P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; and
(h) S437W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P.
13. The recombinant polypeptide of claim 1 comprising SEQ ID NO : 6 having substitutions at a positions selected from the group consisting of:
(a) a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, and T436; and
(b) Y443 and one or more additional residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, and T436.
14. The recombinant polypeptide of claim 11, comprising SEQ ID NO : 6 and having having substitutions selected from the group consisting of:
(a) a subsitution selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P;
(b) Y443F and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and
(c) Y443P and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and
(d) Y443W and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P.
15. The recombinant polypeptide of claim 1 comprising SEQ ID NO : 8 having substitutions at a positions selected from the group consisting of:
(a) a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, 1307, R323, S347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting N38, L54, V155, V158, Q162, L276, 1307, R323, S347, and T436.
16. The recombinant polypeptide of claim 11, comprising SEQ ID NO : 8 and having having substitutions selected from the group consisting of:
(a) a residue selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P;
(b) Y443F and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P;
(c) Y443P and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; and
(d) Y443W and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P.
17. A recombinant polypeptide comprising 80% identity to SEQ ID NO : 6 and having one or more substitutions at a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
18. The recombinant polypeptide of claim 17, wherein the
subsitutions are selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W
19. The recombinant polypeptide of claim 17, wherein the
polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, 1307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
20. A recombinant polypeptide comprising 80% identity to SEQ ID NO : 4 and having one or more substitutions at a residue selected from the group consisting of N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
21. The recombinant polypeptide of claim 21, wherein the
subsitutions are selected from the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W.
22. The recombinant polypeptide of claim 21, wherein the
polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S347F, and S427W.
23. A recombinant polypeptide comprising 80% identity to SEQ ID NO : 8 and having one or more substitutions at a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
24. The recombinant polypeptide of claim 23, wherein the
subsitutions are selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
25. The recombinant polypeptide of claim 23, wherein the
polypeptide comprising SEQ ID NO : 6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, 1307, R323, S347, T436, and Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
26. A recombinant polypeptide having a sequence that is 95% identical to a sequence selected from the group consisting of SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26, and 28, wherein the
polypeptide has cellulase activity and is more thermostable than wild-type enzymes having sequence as set forth in SEQ ID NO: 4, 6, or 8.
27. A polynucleotide encoding a polypeptide of claim 1.
28. A polynucleotide encoding a polypeptide of claim 17.
29. A polynucleotide encoding a polypeptide of claim 20.
30. A polynucleotide encoding a polypeptide of claim 23.
31. A vector comprising a polynucleotide of any one of claims 27, 28, 29, or 30.
32. A host cell that expresses a polypeptide of claim 1, 17, 20, or 23.
33. A host cell comprising the vector of claim 31.
34. An enzymatic preparation comprising a polypeptide of claim 1, 17, 20, or 23.
35. An enzymatic preparation comprising a polypeptide produced by a host cell of claim 32.
36. A method of treating a biomass comprising cellulose, the method comprising contacting the biomass with an enzymatic preparation of claim 34.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161510914P | 2011-07-22 | 2011-07-22 | |
| US61/510,914 | 2011-07-22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013016207A2 true WO2013016207A2 (en) | 2013-01-31 |
| WO2013016207A3 WO2013016207A3 (en) | 2013-06-06 |
Family
ID=47601727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/047637 Ceased WO2013016207A2 (en) | 2011-07-22 | 2012-07-20 | Stable fungal cel6 enzyme variants |
Country Status (2)
| Country | Link |
|---|---|
| US (2) | US9322007B2 (en) |
| WO (1) | WO2013016207A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105073987A (en) * | 2013-03-27 | 2015-11-18 | 本田技研工业株式会社 | Thermostable cellobiohydrolase |
Family Cites Families (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI841500A0 (en) * | 1984-04-13 | 1984-04-13 | Valtion Teknillinen | FOERFARANDE FOER UPPBYGNANDE AV CELLULOLYTISKA JAESTSTAMMAR. |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5198346A (en) | 1989-01-06 | 1993-03-30 | Protein Engineering Corp. | Generation and selection of novel DNA-binding proteins and polypeptides |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| US6335160B1 (en) | 1995-02-17 | 2002-01-01 | Maxygen, Inc. | Methods and compositions for polypeptide engineering |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US6117679A (en) | 1994-02-17 | 2000-09-12 | Maxygen, Inc. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| GB2306485B (en) | 1995-11-01 | 1998-12-09 | British Gas Plc | Enzyme mutant |
| US5741691A (en) | 1996-01-23 | 1998-04-21 | California Institute Of Technology | Para-nitrobenzyl esterases with enhanced activity in aqueous and nonaqueous media |
| DE69728880T2 (en) | 1996-03-19 | 2005-04-28 | Millennium Pharmaceuticals, Inc., Cambridge | KINASE FOR THE JOB-SPECIFIC PHOSPHORYLATION OF I-kappa B-alpha |
| US6096548A (en) | 1996-03-25 | 2000-08-01 | Maxygen, Inc. | Method for directing evolution of a virus |
| JP3376838B2 (en) | 1996-11-05 | 2003-02-10 | トヨタ自動車株式会社 | Prenyl diphosphate synthase |
| US6326204B1 (en) | 1997-01-17 | 2001-12-04 | Maxygen, Inc. | Evolution of whole cells and organisms by recursive sequence recombination |
| KR100570935B1 (en) | 1997-01-17 | 2006-04-13 | 맥시겐, 인크. | Improvement of whole cells and organisms by repetitive sequence recombination |
| WO1998041653A1 (en) | 1997-03-18 | 1998-09-24 | Novo Nordisk A/S | An in vitro method for construction of a dna library |
| US6153410A (en) | 1997-03-25 | 2000-11-28 | California Institute Of Technology | Recombination of polynucleotide sequences using random or defined primers |
| US6361988B1 (en) | 1997-03-25 | 2002-03-26 | California Institute Of Technology | ECB deacylase mutants |
| US6537746B2 (en) | 1997-12-08 | 2003-03-25 | Maxygen, Inc. | Method for creating polynucleotide and polypeptide sequences |
| US5945325A (en) | 1998-04-20 | 1999-08-31 | California Institute Of Technology | Thermally stable para-nitrobenzyl esterases |
| IL140100A0 (en) | 1998-06-29 | 2002-02-10 | Phylos Inc | Methods of generating highly diverse libraries |
| AU5134599A (en) | 1998-07-28 | 2000-02-21 | California Institute Of Technology | Expression of functional eukaryotic proteins |
| AU5337599A (en) | 1998-08-05 | 2000-02-28 | University Of Pittsburgh | Modelling organic compound reactivity in cytochrome p450 mediated reactions |
| FR2782323B1 (en) | 1998-08-12 | 2002-01-11 | Proteus | PROCESS FOR THE IN VITRO PRODUCTION OF RECOMBINANT POLYNUCLEOTIDE SEQUENCES, SEQUENCE BANKS AND SEQUENCES THUS OBTAINED |
| IL140441A0 (en) | 1998-09-29 | 2002-02-10 | Maxygen Inc | Shuffling of codon altered genes |
| GB9825421D0 (en) | 1998-11-19 | 1999-01-13 | Isis Innovation | Process for oxidising terpenes |
| ES2341217T3 (en) | 1999-01-19 | 2010-06-17 | Maxygen, Inc. | RECOMBINATION OF NUCLEIC ACIDS MEDIATED BY OLIGONUCLEOTIDES. |
| US6090604A (en) | 1999-02-24 | 2000-07-18 | Novo Nordisk Biotech, Inc. | Polypeptides having galactose oxidase activity and nucleic acids encoding same |
| US6524837B1 (en) | 1999-03-29 | 2003-02-25 | California Institute Of Technology | Hydantoinase variants with improved properties and their use for the production of amino acids |
| GB9914373D0 (en) | 1999-06-18 | 1999-08-18 | Isis Innovation | Process for oxidising aromatic compounds |
| WO2001061344A1 (en) | 2000-02-17 | 2001-08-23 | California Institute Of Technology | Computationally targeted evolutionary design |
| US20010051855A1 (en) | 2000-02-17 | 2001-12-13 | California Institute Of Technology | Computationally targeted evolutionary design |
| US6498026B2 (en) | 2000-02-25 | 2002-12-24 | Hercules Incorporated | Variant galactose oxidase, nucleic acid encoding same, and methods of using same |
| US7115403B1 (en) | 2000-05-16 | 2006-10-03 | The California Institute Of Technology | Directed evolution of galactose oxidase enzymes |
| EP1283877A2 (en) | 2000-05-23 | 2003-02-19 | California Institute Of Technology | Gene recombination and hybrid protein development |
| AU2002307340A1 (en) | 2001-04-16 | 2002-10-28 | California Institute Of Technology | Peroxide-driven cytochrome p450 oxygenase variants |
| US7226768B2 (en) | 2001-07-20 | 2007-06-05 | The California Institute Of Technology | Cytochrome P450 oxygenases |
| WO2003091835A2 (en) | 2001-10-26 | 2003-11-06 | California Institute Of Technology | Computationally targeted evolutionary design |
| DE60328715D1 (en) | 2002-12-20 | 2009-09-17 | Novozymes As | POLYPEPTIDES USING CELLOBIOHYDROLASE II ACTIVITY AND POLYNUCLEOTIDES THAT CODE |
| EP1639091B1 (en) | 2003-06-17 | 2012-12-05 | California University Of Technology | Regio- and enantioselective alkane hydroxylation with modified cytochrome p450 |
| US8603949B2 (en) | 2003-06-17 | 2013-12-10 | California Institute Of Technology | Libraries of optimized cytochrome P450 enzymes and the optimized P450 enzymes |
| US7435570B2 (en) | 2003-08-11 | 2008-10-14 | California Institute Of Technology | Thermostable peroxide-driven cytochrome P450 oxygenase variants and methods of use |
| DK2292747T3 (en) * | 2004-12-30 | 2017-04-24 | Danisco Us Inc | CBH2 CELLULASE VARIETIES OF HYPOCREA JECORINA |
| EP1899471A4 (en) | 2005-03-28 | 2009-11-25 | California Inst Of Techn | OXIDATION OF ALKANES BY MODIFIED HYDROXYLASES |
| US8715988B2 (en) | 2005-03-28 | 2014-05-06 | California Institute Of Technology | Alkane oxidation by modified hydroxylases |
| US20120171693A1 (en) | 2007-01-05 | 2012-07-05 | The California Institute Of Technology | Methods for Generating Novel Stabilized Proteins |
| US20080248545A1 (en) | 2007-02-02 | 2008-10-09 | The California Institute Of Technology | Methods for Generating Novel Stabilized Proteins |
| WO2008118545A2 (en) | 2007-02-08 | 2008-10-02 | The California Institute Of Technology | Methods for generating novel stabilized proteins |
| US20080268517A1 (en) | 2007-02-08 | 2008-10-30 | The California Institute Of Technology | Stable, functional chimeric cytochrome p450 holoenzymes |
| WO2008115844A2 (en) | 2007-03-16 | 2008-09-25 | The California Institute Of Technology | Stable, functional chimeric cytochrome p450 holoenzymes |
| US8802401B2 (en) | 2007-06-18 | 2014-08-12 | The California Institute Of Technology | Methods and compositions for preparation of selectively protected carbohydrates |
| EP2626421B1 (en) | 2008-12-10 | 2014-03-19 | Direvo Industrial Biotechnology GmbH | Improved enzymes for biomass conversion |
| CA2755029A1 (en) * | 2009-04-06 | 2010-10-14 | California Institute Of Technology | Polypeptides having cellulase activity |
| US20100304464A1 (en) * | 2009-04-06 | 2010-12-02 | California Institute Of Technology | Stable, functional chimeric cellobiohydrolases |
-
2012
- 2012-07-20 WO PCT/US2012/047637 patent/WO2013016207A2/en not_active Ceased
- 2012-07-20 US US13/554,736 patent/US9322007B2/en active Active
-
2016
- 2016-04-25 US US15/137,955 patent/US20160251642A1/en not_active Abandoned
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105073987A (en) * | 2013-03-27 | 2015-11-18 | 本田技研工业株式会社 | Thermostable cellobiohydrolase |
| EP2980212A4 (en) * | 2013-03-27 | 2016-11-30 | Honda Motor Co Ltd | THERMOSTABLE CELLOBIOHYDROLASE |
| US9963692B2 (en) | 2013-03-27 | 2018-05-08 | Honda Motor Co., Ltd. | Thermostable cellobiohydrolase |
| CN105073987B (en) * | 2013-03-27 | 2018-05-18 | 本田技研工业株式会社 | thermostable cellobiohydrolase |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150259657A1 (en) | 2015-09-17 |
| WO2013016207A3 (en) | 2013-06-06 |
| US20160251642A1 (en) | 2016-09-01 |
| US9322007B2 (en) | 2016-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2007244753B2 (en) | Thermostable cellulase and methods of use | |
| EP2534245B1 (en) | Optimized cellulase enzymes | |
| US20190316103A1 (en) | GH61 Polypeptide Variants and Polynucleotides Encoding Same | |
| EP2576626B1 (en) | Stable, functional chimeric cellobiohydrolase class i enzymes | |
| CN103237891B (en) | Polypeptide variants having cellulolytic enhancing activity and polynucleotides encoding the same | |
| EP2443235A2 (en) | ß-GLUCOSIDASE VARIANTS | |
| CN106167796A (en) | Compositions for saccharified cellulosic material | |
| CN108179139A (en) | Cellulose decomposition enzymatic compositions and application thereof | |
| Zhu et al. | Characterization of a family 5 glycoside hydrolase isolated from the outer membrane of cellulolytic Cytophaga hutchinsonii | |
| L Bergquist et al. | Selected enzymes from extreme thermophiles with applications in biotechnology | |
| CN104245926A (en) | GH61 polypeptide variants and polynucleotides encoding same | |
| JP6340647B2 (en) | Super thermostable cellobiohydrolase | |
| Karita et al. | Cellulose-binding domains confer an enhanced activity against insoluble cellulose to Ruminococcus albus endoglucanase IV | |
| WO1999057287A2 (en) | Beta-glucosidase coding sequences and protein from orpinomyces pc-2 | |
| EP2401369B1 (en) | Beta-glucosidase variant enzymes and related polynucleotides | |
| US9322007B2 (en) | Stable fungal Cel6 enzyme variants | |
| AU2013255931B2 (en) | Endoglucanases with improved properties | |
| US9080162B2 (en) | Cellulase variants | |
| Deng et al. | Cellulose hydrolysis ability of a Clostridium thermocellum cellulosome containing small-size scaffolding protein CipA | |
| Sangwijit | A Single Mutation in the Carbohydrate-Binding Module Enhances Cellulase Activity in Bacillus Amyloliquefaciens Mutant | |
| US20130084619A1 (en) | Modified cellulases with enhanced thermostability | |
| JP4257979B2 (en) | Improved heat-resistant endoglucanase and its gene | |
| JP2008193990A (en) | Improved thermostable cellulase | |
| WO2015076260A1 (en) | Heat-resistant xylanase | |
| JP4784874B2 (en) | Improved heat-resistant endoglucanase and its gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12816944 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12816944 Country of ref document: EP Kind code of ref document: A2 |









