WO2013011072A1 - Carbapenemase et traitement antibactérien - Google Patents

Carbapenemase et traitement antibactérien Download PDF

Info

Publication number
WO2013011072A1
WO2013011072A1 PCT/EP2012/064122 EP2012064122W WO2013011072A1 WO 2013011072 A1 WO2013011072 A1 WO 2013011072A1 EP 2012064122 W EP2012064122 W EP 2012064122W WO 2013011072 A1 WO2013011072 A1 WO 2013011072A1
Authority
WO
WIPO (PCT)
Prior art keywords
carbapenemase
ndm
activity
seq
nucleic acid
Prior art date
Application number
PCT/EP2012/064122
Other languages
English (en)
Inventor
Patrice Nordmann
Laurent Poirel
Original Assignee
INSERM (Institut National de la Santé et de la Recherche Médicale)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSERM (Institut National de la Santé et de la Recherche Médicale) filed Critical INSERM (Institut National de la Santé et de la Recherche Médicale)
Publication of WO2013011072A1 publication Critical patent/WO2013011072A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/02—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amides (3.5.2)
    • C12Y305/02006—Beta-lactamase (3.5.2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism

Definitions

  • the present invention relates to carbapenemases and methods using said carbapenemases such as screening methods, predictive methods and therapeutic uses.
  • carbapenemases are responsible of mechanism of resistance against ⁇ -lactams by hydrolyze of the ⁇ -lactam ring of this antibiotic class. Production of these carbapenemases among Gram negatives currently represents one of the most challenging traits in antibiotic resistance.
  • carbapenemases described but the discovery of new members of this enzyme family permits to develop new strategies of diagnosis of emerging antibiotic resistance determinants.
  • NDM-1 New Delhi metallo-beta- lactamase- 1
  • the inventors identified a variant of NDM-1 with a leucine for methionine substitution at position 154 conferring an increased spectrum substrate specificity towards several carbapenems and an increased hydrolytic activity towards several extended- spectrum cephalosporins.
  • This Metl54Leu substitution is the consequence of the 460 A>C base pair change in the sequence of NDM-1 gene i.e. a substitution of A by C at position 460 of the nucleotide sequence.
  • the present invention relates to a carbapenemase comprising or consisting of the amino acid sequence defined by SEQ ID NO: l and a nucleic acid sequence encoding said carbapenemase.
  • the invention also relates to a method for screening an antibacterial substance comprising the step of determining the ability of a candidate substance to inhibit the activity of a purified carbapenemase of the invention.
  • the invention further relates to a method for the detection of the NDM-4 carbapenemase of the invention in a biological sample, comprising the step of detecting the presence of the substitution of Leu by Met at position 154 as indicated in SEQ ID NO: l .
  • the invention further relates to a method for the detection of the gene of the NDM-4 carbapenemase of the invention in a biological sample, comprising the step of detecting the presence of the substitution of A by C at position 460 as indicated in SEQ ID NO:2.
  • the invention relates to a method for determining whether a microorganism is resistant to a ⁇ -lactam compound comprising the step of detecting in said microorganism the presence of a nucleic acid encoding a carbapenemase of the invention wherein the presence of said nucleic acid is indicative that said microorganism is resistant to ⁇ -lactams.
  • purified and “isolated” it is meant, when referring to a polypeptide or a nucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macro molecules of the same type.
  • purified as used herein preferably means at least 75% by weight, more preferably at least 85% by weight, more preferably still at least 95 %) by weight, and most preferably at least 98%> by weight, of biological macromolecules of the same type are present.
  • nucleic acid molecule which encodes a particular polypeptide refers to a nucleic acid molecule which is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include some additional bases or moieties which do not deleteriously affect the basic characteristics of the composition.
  • Two amino acid sequences are "substantially homologous” or “substantially similar” when greater than 80 %, preferably greater than 85 %, preferably greater than 90 % of the amino acids are identical, or greater than about 90 %, preferably greater than 95 %, are similar (functionally identical).
  • the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of sequence comparison algorithms such as BLAST, FASTA, etc.
  • the term "subject" refers to a human or another mammal (e.g., primate, dog, cat, goat, horse, pig, mouse, rat, rabbit, and the like), that can be infected with a strain.
  • the subject is a human.
  • the subject can be a patient being infected with a bacteria that is resistant or has intermediate susceptibility to ⁇ -lactams (including carbapenems) or who can be just a carrier of such a strain.
  • treating refers to reversing, alleviating, inhibiting the progress of the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
  • “Pharmaceutically” or “pharmaceutically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially human, as appropriate.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
  • ⁇ -lactam has its general meaning in the art and refers to a broad class of antibiotics that include penicillin derivatives, cephalosporins, monobactams, carbapenems, and ⁇ -lactam molecules action as ⁇ -lactamase inhibitors.
  • Said family of antibiotics is characterised by a ⁇ -lactam nucleus (see the formula below) in its molecular structure:
  • ⁇ -lactam compounds include, but are not limited to, imipenem, meropenem, ertapenem, faropenem, doripenem and panipenem.
  • carbapenemase has its general meaning in the art and refers to a class of enzymes produced by some bacteria belonging to the ⁇ -lactamase family. Said enzymes may be responsible for resistance to ⁇ -lactam antibiotics like oxyiminocephalosporins, cephamycins and carbapenems by hydrolyzing ⁇ -lactam cycle of said antibiotics.
  • biological sample may refer to a sample derived from a subject, for example bodily fluids such as blood or urine, or throat swabs, nasal swabs, dermal swabs, sputum, feces or bronchial aspirates.
  • the biological sample may also mean cultures of bacteria from various environments. Typically the bacterial cultures may be prepared from biological samples by plating and growing the bacteria.
  • NDM-4 hydro lyses all ⁇ -lactams except aztreonam.
  • NDM-4 differs from NDM-1 by a single amino acid substitution (Metl54Leu).
  • the present invention relates to carbapenemase having the amino acid sequence of NDM-1 with the amino acid substitution Metl54Leu. More particularly the present invention relates to a NDM-4 carbapenemase comprising or consisting of the amino acid sequence defined by SEQ ID NO: l .
  • the invention in another embodiment, relates to a carbapenemase having at least 80% amino acid sequence identity with the amino acid sequence of SEQ ID NO: 1 providing that the amino acid at position 154 remains Leu, preferably at least 85% amino acid sequence identity with the amino acid sequence of SEQ ID NO: l and more preferably having at least 90% amino acid sequence identity with the amino acid sequence of SEQ ID NO: l . Accordingly, the present invention encompasses all naturally occurring NDM-4 sequence providing that the amino acid at position 154 remains Leu.
  • Table 1 Amino acid sequence of the premature protein NDM-4 (SEQ ID NO: 1).
  • a further object of the invention relates to a nucleic acid sequence encoding a carbapenemase of the invention.
  • NDM-1 gene according to the invention leads to a mutation of the Met at residue 154 of the protein sequence (i.e. NDM-4), in particular a mutation of NDM-1 gene according to the invention is 460A>C, i.e. a substitution of A by C at position 460 of the nucleotide sequence (as described in SEQ ID NO:2 below).
  • the invention relates to a nucleic acid sequence encoding the NDM-4 carbapenemase defined by SEQ ID NO:2.
  • atggaattgc ccaatattat gcacccggtc gcgaagctga gcaccgcatt agccgctgca ttgatgctga gcgggtgcat gcccggtgaa atccgcccga cgattggcca gcaaatggaa actggcgacc aacggtttgg cgatctggttttccgccagc tcgcaccgaa tgtctggcag cacacttcct atctcgacat gccgggtttc ggggcagtcgtccaacgg tttgatcgtc agggatggcg gctgctgctgctgcaccgaa
  • NDM-4 Nucleic acid sequence of NDM-4 (SEQ ID NO:2).
  • a carbapenemase of the invention can be produced as a recombinant protein.
  • the one skilled in the art may insert the nucleic acid encoding the corresponding polypeptide (SEQ ID NO:2), e.g. into a suitable expression vector and then transform appropriate cells with the resulting recombinant vector.
  • SEQ ID NO:2 the nucleic acid encoding the corresponding polypeptide
  • Methods of genetic engineering for producing the polypeptides having a carbapenemase activity according to the invention under the form of recombinant polypeptides are well known from the one skilled in the art.
  • the recombinant vector preferably contains a nucleic acid that enables the vector to replicate in one or more selected host cells.
  • Selection genes will typically contain a selection gene, also termed a selectable marker.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
  • Expression and cloning vectors usually contain a promoter operably linked to the nucleic acid sequence encoding the polypeptide of interest to direct mR A synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the ⁇ -lactamase and lactose promoter systems (Chang et al., 1978; Goeddel et al, 1979), alkaline phosphatase, a tryptophan (trp) promoter system (Goeddel, 1980; EP 36,776), and hybrid promoters such as the tac promoter (deBoer et al, 1983). Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the polypeptide of interest.
  • S.D. Shine-Dalgarno
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding polypeptide of interest.
  • a recombinant vector having inserted therein a nucleic acid encoding a polypeptide of interest according to the invention having a carbapenemase activity may be transfected to bacterial cells in view of the recombinant polypeptide production, e.g. E. coli cells as shown in the examples herein. Then, the recombinant polypeptide of interest having a carbapenemase activity may be purified, e.g. by one or more chromatography steps, including chromatography steps selected from the group consisting of affinity chromatography, ion exchange chromatography and size exclusion chromatography.
  • the recombinant polypeptide of interest having a carbapenemase activity may be purified by performing a purification method comprises (a) a step of affinity chromatography, e.g. on a Ni2+-nitriloacetate-agarose resin, (b) a step of anion exchange chromatography with the eluate of step (a) and (c) a size exclusion chromatography with the eluate of step (b).
  • the purified recombinant polypeptide of interest having a carbapenemase activity may be subjected to a concentration step, e.g. by ultrafiltration, before being stored in an appropriate liquid solution, e;g. at a temperature of -20°C.
  • a recombinant polypeptide of interest having a carbapenemase activity may be produced by known methods of peptide synthesis.
  • the polypeptide sequence of interest, or portions thereof may be produced by direct peptide synthesis using solid-phase techniques. (See, e.g., Stewart et al, 1969; Merrifield, 1963).
  • In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, with an Applied Biosystems Peptide Synthesizer (Foster City, Calif.) using manufacturer's instructions.
  • Various portions of the polypeptide of interest may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length polypeptide of interest.
  • a further object of the invention relates to a method for screening an antibacterial substance comprising the step of determining the ability of a candidate substance to inhibit the activity of a purified carbapenemase of the invention.
  • said method comprises the steps of:
  • a candidate substance to be tested inhibits the catalytic activity of said carbapenemase if the activity of the said enzyme determined in presence of said candidate substance is lower than the activity of the said enzyme determined in absence of said candidate substance.
  • the catalytic activity of the carbapenemase of the invention is assessed using as a substrate a molecule of the class of ⁇ -lactams except aztreonam.
  • said molecule is selected from the group of ticarcillin, piperacillin-tazobactam, imipenem, meropenem, ceftazidime and cefepime and more preferably from the group of ticarcillin, piperacillin-tazobactam, imipenem and meropenem.
  • the catalytic activity of said carbapenemase is determined by detecting or quantifying the formation of a derivative of ⁇ -lactam molecule that results from the opening ⁇ -lactam ring as determined by detection of this opened derivative by UV spectrophotometry.
  • the candidate substances that are positively selected at step (v) of the method above are those that cause a decrease of the hydrolyze of the beta-lactam cycle of ⁇ - lactams that leads to less than 0.5 times the hydrolyze rate of the same enzyme in the absence of the candidate substance, more preferably a decrease that leads to less 0.3, 0.2, 0.1 , 0.05 or 0.025 times the hydrolyze rate of the same enzyme in the absence of the candidate substance.
  • the most active candidate substances that may be positively selected at step (v) of the method above may completely block the catalytic activity of said enzyme, which leads to an hydolyze rate of beta-lactam cycle which is undetectable, i.e. zero, or very close to zero.
  • this invention encompasses methods for the screening of candidate antibacterial substances that inhibit the activity of a carbapenemase as defined herein.
  • this invention also encompasses methods for the screening of candidate antibacterial substances that are based on the ability of said candidate substances to bind to a carbapenemase as defined herein, thus methods for the screening of potentially antibacterial substances.
  • the binding assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, which are well characterized in the art.
  • All binding assays for the screening of candidate antibacterial substances are common in that they comprise a step of contacting the candidate substance with a carbapenemase as defined herein, under conditions and for a time sufficient to allow these two components to interact.
  • These screening methods also comprise a step of detecting the formation of complexes between said carbapenemase and said candidate antibacterial substances.
  • screening for antibacterial substances includes the use of two partners, through measuring the binding between two partners, respectively a carbapenemase as defined herein and the candidate compound.
  • the interaction is binding and the complex formed between a carbapenemase as defined above and the candidate substance that is tested can be isolated or detected in the reaction mixture.
  • the carbapenemase as defined above or alternatively the antibacterial candidate substance is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments.
  • Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the carbapenemase of the invention and drying.
  • an immobilized antibody e.g., a monoclonal antibody, specific for the carbapenemase of the invention to be immobilized can be used to anchor it to a solid surface.
  • the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component.
  • the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected.
  • the detection of label immobilized on the surface indicates that complexing occurred.
  • complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex.
  • the binding of the antibacterial candidate substance to a carbapenemase of the invention may be performed through various assays, including traditional approaches, such as, e.g., cross-linking, co-immunoprecipitation, and co -purification through gradients or chromatographic columns.
  • protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers (Fields and Song, 1989; Chien et al, 1991) as disclosed by Chevray and Nathans, 1991.
  • Many transcriptional activators, such as yeast GAL4 consist of two physically discrete modular domains, one acting as the DNA-binding domain, the other one functioning as the transcription-activation domain.
  • the yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain.
  • the expression of a GALl-lacZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for .beta.- galactosidase.
  • MATCHMAKER.TM. A complete kit (MATCHMAKER.TM.) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions.
  • Another object of the invention consists of a method for the screening of antibacterial substances, wherein said method comprises the steps of:
  • the same method may also be defined as a method for the screening of antibacterial substances, wherein said method comprises the steps of:
  • the candidate substances which may be screened according to the screening method above, may be of any kind, including, without being limited to, natural or synthetic compounds or molecules of biological origin such as polypeptides.
  • Inhibitor substances positively selected at the end of the in vitro screening methods as described above are inhibitors of a carbapenemase of the invention. Accordingly, the activity of selected candidate can be studied by assaying the antibacterial activity of a combination of such compounds with a ⁇ -lactam compound against gram negative bacteria expressing a carbapenemase of the invention.
  • the ⁇ -lactam compounds which can be used in combination with said inhibitor substances are ⁇ -lactams which are hydrolyzed by the carbapenemases of the invention such as ticarcillin, piperacillin-tazobactam, imipenem, meropenem, ertapenem, ceftazidime and cefepime.
  • An example of bacterial strain expressing a carbapenemase of the invention is Pseudomonas stutzeri.
  • the antibacterial activity of a combination of an inhibitor substance with a ⁇ -lactam compound can be tested against this Gram-negative bacterial strain.
  • Inhibitor substances that have been positively selected at the end of any one of the in vitro screening methods of the invention may then be assayed for their ex vivo activity in combination with a ⁇ -lactam compound, in a further stage of their selection as a useful antibacterial active ingredient of a pharmaceutical composition.
  • ex vivo antibacterial activity it is intended herein the antibacterial activity of the combination of a positively selected candidate compound and a ⁇ -lactam compound against bacterial cells expressing a carbapenemase of the invention that are cultured in vitro.
  • any substance that has been shown to behave like an inhibitor of a carbapenemase after positive selection at the end of any one of the in vitro screening methods that are disclosed previously in the present specification, may be further assayed for his ex vivo antibacterial activity against bacterial cells expressing a carbapenemase of the invention.
  • any one of the screening methods that are described above may comprise a further step of assaying a combination with a positively selected inhibitor substance and a ⁇ -lactam compound for its ex vivo antibacterial activity.
  • said further step consists of preparing in vitro cultures of bacterial cells expressing a carbapenemase of the invention and then adding to said bacterial cultures the combination to be tested, before determining the ability of said candidate compound to block bacterial growth or even most preferably kill the cultured bacterial cells.
  • bacterial cells are plated in Petri dishes containing the appropriate culture medium, generally in agar gel, at a cell number ranging from 10 to 10 3 bacterial cells, including from 10 to 10 2 bacterial cells.
  • serials of bacterial cultures are prepared with increasing numbers of seeded bacterial cells.
  • the combination to be tested is then added to the bacterial cultures, preferably with a serial of amounts of said candidate compounds for each series of a given plated cell number of bacterial cultures.
  • the bacterial cultures are incubated in the appropriate culture conditions, most preferably starvation conditions, for instance in a cell incubator at the appropriate temperature, and for an appropriate time period, for instance a culture time period ranging from 1 day to 4 days, before counting the resulting CFUs (Colony Forming Units), either manually under a light microscope or binocular lenses, or atomically using an appropriate apparatus.
  • appropriate culture conditions most preferably starvation conditions, for instance in a cell incubator at the appropriate temperature, and for an appropriate time period, for instance a culture time period ranging from 1 day to 4 days, before counting the resulting CFUs (Colony Forming Units), either manually under a light microscope or binocular lenses, or atomically using an appropriate apparatus.
  • control cultures are simultaneously performed i.e; negative control cultures without the combination and positive control cultures with an antibiotic that is known to be toxic against the cultured bacterial cells (such as aztreonam or any ⁇ -lactam molecule that are not hydro lyzed by a carbapenemase of the invention).
  • an antibiotic that is known to be toxic against the cultured bacterial cells (such as aztreonam or any ⁇ -lactam molecule that are not hydro lyzed by a carbapenemase of the invention).
  • said candidate compound is positively selected at the end of the method if it reduces the number of CFUs, as compared with the number of CFUs found in the corresponding negative control cultures.
  • Another object of the present invention consists of a method for the ex vivo screening of a candidate antibacterial substance which comprises the steps of:
  • step b) assaying said candidate substance positively selected at the end of step a) for its ex vivo antibacterial activity.
  • Inhibitor substances that have been positively selected at the end of any one of the screening methods that are previously described in the present specification may then be assayed for their in vivo antibacterial activity in combination with a ⁇ -lactam compound, in a further stage of their selection as a useful antibacterial active ingredient of a pharmaceutical composition.
  • the compound is tested in combination with a ⁇ -lactam compound against bacterial cells expressing a carbapenemase of the invention.
  • any substance that has been shown to behave like an inhibitor of a carbapenemase after positive selection at the end of any one of the screening methods that are disclosed previously in the present specification, may be further assayed for his in vivo antibacterial activity. Consequently, any one of the screening methods that are described above may comprise a further step of assaying the combination of a positively selected inhibitor substance and a ⁇ -lactam substance for its in vivo antibacterial activity.
  • said further step consists of administering said combination to a mammal and then determining the antibacterial activity of said combination.
  • Mammals are preferably non human mammals, at least at the early stages of the assessment of the in vivo antibacterial effect of the combination tested. However, at further stages, human volunteers may be administered with said combination to confirm safety and pharmaceutical activity data previously obtained from non human mammals.
  • Non human mammals encompass rodents like mice, rats, rabbits, hamsters, guinea pigs.
  • Non human mammals also encompass primates like macaques and baboons.
  • Another object of the present invention consists of a method for the in vivo screening of a candidate antibacterial substance which comprises the steps of:
  • step b) assaying a candidate substance that has been positively selected at the end of step a) in combination with a ⁇ -lactam substance for its in vivo antibacterial activity.
  • serial of doses containing increasing amounts of the inhibitor substance are prepared in view of determining the antibacterial effective dose of said inhibitor substance (when used in combination with a ⁇ -lactam compound) in a mammal subjected to a bacterial infection, trypically a Gram (-) bacterial infection.
  • the ED50 dose is determined, which is the amount of the inhibitor substance that makes the combination effective against a bacterial strain expressing a carbapenemase of the invention in 50% of the animals tested.
  • the ED 50 value is determined for various distinct bacteria species, in order to assess the spectrum of the antibacterial activity.
  • serial of doses of the inhibitor substance tested ranging from 1 ng to 10 mg per kilogram of body weight of the mammal that is administered therewith.
  • ⁇ -lactam compound is used at the normal dose actually used in antibacterial treatment.
  • the daily amount of imipenem to be administered to an adult patient weighing 80 kg will typically ranges from lg to 4g.
  • the daily amount of meropenem, ertapenem, faropenem, doripenem or panipenem to be administered to an adult patient weighing 80 kg will typically be of about 1-
  • the inhibitor substance in combination with a ⁇ -lactam compound forms an antibacterial composition.
  • the antibacterial composition to be assayed may be used alone under the form of a solid or a liquid composition.
  • the solid composition is usually a particulate composition of said antibacterial composition, under the form of a powder.
  • the liquid composition is usually a physiologically compatible saline buffer, like Ringer's solution or Hank's solution, in which said antibacterial composition is dissolved or suspended.
  • said antibacterial composition is combined with one or more pharmaceutically acceptable excipients for preparing a pre-pharmaceutical composition that is further administered to a mammal for carrying out the in vivo assay.
  • the antibacterial composition selected through any one of the in vitro screening methods above may be formulated under the form of pre-pharmaceutical compositions.
  • the pre-pharmaceutical compositions can include, depending on the formulation desired, pharmaceutically acceptable, usually sterile, non-toxic carriers or diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration.
  • the diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological saline, Ringer's solutions, dextrose solution, and Hank's solution.
  • the test composition or formulation may also include other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers and the like.
  • compositions comprising such carriers can be formulated by well known conventional methods. These test compositions can be administered to the mammal at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical, intradermal, intranasal or intrabronchial administration. The dosage regimen will be determined by taking into account, notably, clinical factors. As is well known in the medical arts, dosages for any one mammal depends upon many factors, including the mammal's size, body surface area, age, the particular compound to be administered, sex, time and route of administration and general health.
  • the suitable pre-pharmaceutical compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. If the regimen is a continuous infusion, it should also be in the range of 1 ng to 10 mg units per kilogram of body weight per minute, respectively. Progress can be monitored by periodic assessment.
  • the pre-pharmaceutical compositions of the invention may be administered locally or systemically. Administration will generally be parenterally, e.g., intravenously. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, anti-oxidants, chelating agents, and inert gases and the like.
  • the antibacterial composition may be employed in powder or crystalline form, in liquid solution, or in suspension.
  • the injectable pre-pharmaceutical compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain various formulating agents.
  • the active ingredient may be in powder (lyophilized or non-lyophilized) form for reconstitution at the time of delivery with a suitable vehicle, such as sterile water.
  • the carrier is typically comprised of sterile water, saline, or another injectable liquid, e.g., peanut oil for intramuscular injections.
  • various buffering agents, preservatives and the like can be included.
  • Topical applications may be formulated in carriers such as hydrophobic or hydrophilic base formulations to provide ointments, creams, lotions, in aqueous, oleaginous, or alcoholic liquids to form paints or in dry diluents to form powders.
  • carriers such as hydrophobic or hydrophilic base formulations to provide ointments, creams, lotions, in aqueous, oleaginous, or alcoholic liquids to form paints or in dry diluents to form powders.
  • Oral pre-pharmaceutical compositions may take such forms as tablets, capsules, oral suspensions and oral solutions.
  • the oral compositions may utilize carriers such as conventional formulating agents and may include sustained release properties as well as rapid delivery forms.
  • the antibacterial composition is administered to a mammal which is the subject of a bacterial infection.
  • these animals have been injected with a composition containing bacteria prior to any administration of the inhibitor compound.
  • non human animals are administered with the inhibitor compound to be tested prior to being injected with a composition containing bacteria.
  • non human mammals are injected with a number of bacterial cells expressing a carbapenemase of the invention cells ranging from 1 x 10 2 to 1 x 10 12 cells, including from 1 x 10 6 to lx 10 9 cells.
  • bacterial cells expressing a carbapenemase of the invention cells in an in vzYro-generated dormant state are used for injection.
  • bacteria cells that are injected to the non human mammals are contained in a physiologically acceptable liquid solution, usually a saline solution like Ringer's solution or Hank's solution.
  • a physiologically acceptable liquid solution usually a saline solution like Ringer's solution or Hank's solution.
  • the inhibitor compound to be tested is administered subsequently to bacterial inoculation
  • said inhibitor compound is administered form 1 hour to 96 hours after bacterial injection, including from 6 hours to 48 hours after bacterial injection.
  • the inhibitor compound to be tested is administered prior to bacterial injection
  • said inhibitor compound is administered from 1 min to 3 hours prior to bacterial injection.
  • blood or tissue samples of the tested animals are collected at determined time periods after administration of said inhibitor compound and bacteria counts are performed, using standard techniques, such as staining fixed slices of the collected tissue samples or plating the collected blood samples and counting the bacterial colonies formed.
  • the values of the bacteria counts found for animals having been administered with increasing amounts of the inhibitor compound tested are compared with the value(s) of bacteria count(s) obtained from animals that have been injected with the same number of bacteria cells but which have not been administered with said inhibitor compound.
  • various ⁇ -lactam candidate compounds have been assayed with the screening method of the invention and have been positively selected as compounds having a great potential value for treating individuals who have been infected by a bacterial strain expressing a carbapenemase of the invention.
  • Another object of the invention relates to an inhibitor of a carbapenemase of the invention in association with a ⁇ -lactam compound for an antibacterial treatment.
  • the invention also relates to an antibacterial composition containing an inhibitor of a carbapenemase of the invention and a ⁇ -lactam compound for an antibacterial treatment.
  • This invention also pertains to a method for treating individuals infected by gram negative bacteria expressing a carbapenemase of the invention comprising a step of administering to the said individuals an effective amount of an antibacterial composition of the invention.
  • said antibacterial comprises one or more pharmaceutically acceptable excipient(s).
  • Such antibacterial compositions are under the form of dosage forms adapted for a daily administration of an amount of ⁇ -lactam of at least 1 mg and up to 10 g.
  • each component of antibacterial composition may be easily adapted by the one skilled in the art, depending notably on the age and of the weight individual to be treated.
  • the daily amount of each component of antibacterial composition may be administered to the patient through one or more uptakes, e.g. from one to six uptakes.
  • the present invention also relates to compositions or kits for the screening of antibacterial substances.
  • compositions or kits comprise a purified carbapenemase of the invention, preferably under the form of a recombinant protein.
  • said carbapenemase may be under a solid form or in a liquid form.
  • Solid forms encompass powder of said carbapenemase under a lyophilized form.
  • Liquid forms encompass standard liquid solutions known in the art to be suitable for protein long time storage.
  • said carbapenemase is contained in a container such as a bottle, e.g. a plastic or a glass container.
  • each container comprises an amount of said carbapenemase ranging from 1 ng to 10 mg, either in a solid or in a liquid form.
  • kits may comprise also one or more reagents, typically one or more substrate(s), necessary for assessing the enzyme activity of said carbapenemase.
  • kit may also comprise a container comprising an appropriate amount of the substrate.
  • a kit according to the invention comprises one or more of each of the containers described above.
  • kits or compositions of the invention may also comprise a ⁇ -lactam compound for assessing the activity of the inhibitors selected by the screening methods of the invention.
  • said ⁇ -lactam compound can be selected among the group of ticarcillin, piperacillin-tazobactam, imipenem, meropenem, ceftazidime and cefepime.
  • the invention also relates to a method for the detection of the NDM-4 carbapenemase of the invention, comprising the step of detecting the presence of a nucleic acid encoding a carbapenemase of the invention or a protein encoded by said nucleic acid.
  • the invention relates to a method for the detection of the NDM-4 carbapenemase of the invention in a biological sample, comprising the step of detecting the presence of the substitution of Leu by Met at position 154 as indicated in SEQ ID NO: l .
  • the invention also relates to a method for the detection of the NDM-4 carbapenemase of the invention in a biological sample, comprising the step of detecting the presence of Met at position 154 of SEQ ID NO: l .
  • Said substitution may be detected according to any appropriate method known in the art.
  • a biological sample such as a body fluid obtained from a subject, may be contacted with antibodies specific of NDM-4, i.e. antibodies that are capable of distinguishing between NDM-4 and the wild-type protein NDM-1 (or any other related protein such as NDM-2 which differs from NDM-1 by a single amino acid substitution (Pro28Ala)), to determine the presence or absence of a NDM-4 specified by the antibody.
  • Antibodies that specifically recognize NDM-4 also make part of the invention.
  • the antibodies are specific NDM-4, i.e. they do not cross-react with the wild-type NDM-1.
  • the antibodies of the present invention may be monoclonal or polyclonal antibodies, single chain or double chain, chimeric antibodies, humanized antibodies, or portions of an immunoglobulin molecule, including those portions known in the art as antigen binding fragments Fab, Fab', F(ab')2 and F(v). They can also be immuno conjugated, e.g. with a toxin, or labelled antibodies.
  • polyclonal antibodies may be used, monoclonal antibodies are preferred for they are more reproducible in the long run.
  • Polyclonal antibodies can be obtained from serum of an animal immunized against the appropriate antigen, which may be produced by genetic engineering for example according to standard methods well-known by one skilled in the art. Typically, such antibodies can be raised by administering NDM-4 subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum.
  • the antigens can be injected at a total volume of 100 ⁇ per site at six different sites. Each injected material may contain adjuvants with or without pulverized acrylamide gel containing the protein or polypeptide after SDS-polyacrylamide gel electrophoresis.
  • the rabbits are then bled two weeks after the first injection and periodically boosted with the same antigen three times every six weeks.
  • a sample of serum is then collected 10 days after each boost.
  • Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed by Harlow et al. (1988) which is hereby incorporated in the references.
  • a “monoclonal antibody” in its various grammatical forms refers to a population of antibody molecules that contains only one species of antibody combining site capable of immunoreacting with a particular epitope.
  • a monoclonal antibody thus typically displays a single binding affinity for any epitope with which it immunoreacts.
  • a monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different epitope, e.g. a bispecific monoclonal antibody.
  • a monoclonal antibody was produced by immortalization of a clonally pure immunoglobulin secreting cell line, a monoclonally pure population of antibody molecules can also be prepared by the methods of the present invention.
  • Monoclonal antibodies may be prepared by immunizing purified NDM-4 into a mammal, e.g. a mouse, rat, human and the like mammals.
  • the antibody-producing cells in the immunized mammal are isolated and fused with myeloma or heteromyeloma cells to produce hybrid cells (hybridoma).
  • the hybridoma cells producing the monoclonal antibodies are utilized as a source of the desired monoclonal antibody. This standard method of hybridoma culture is described in Kohler and Milstein (1975).
  • mAbs can be produced by hybridoma culture the invention is not to be so limited. Also contemplated is the use of mAbs produced by an expressing nucleic acid cloned from a hybridoma of this invention. That is, the nucleic acid expressing the molecules secreted by a hybridoma of this invention can be transferred into another cell line to produce a transformant.
  • the transformant is genotypically distinct from the original hybridoma but is also capable of producing antibody molecules of this invention, including immunologically active fragments of whole antibody molecules, corresponding to those secreted by the hybridoma. See, for example, U.S. Pat. No. 4,642,334 to Reading; PCT Publication No.; European Patent Publications No. 0239400 to Winter et al. and No. 0125023 to Cabilly et al.
  • Antibody generation techniques not involving immunisation are also contemplated such as for example using phage display technology to examine naive libraries (from non- immunised animals); see Barbas et al. (1992), and Waterhouse et al. (1993).
  • Antibodies raised against NDM-4 may be cross reactive with NDM-1. Accordingly a selection of antibodies specific for NDM-4is required. This may be achieved by depleting the pool of antibodies from those that are reactive with the NDM-1, for instance by submitting the raised antibodies to an affinity chromatography against NDM-1.
  • binding agents other than antibodies may be used for the purpose of the invention.
  • binding agents may be for instance aptamers, which are a class of molecule that represents an alternative to antibodies in term of molecular recognition.
  • Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.
  • ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990.
  • the random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence.
  • Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).
  • the present invention encompasses a kit comprising antibody or an aptamer for identifying the carbapenemase of the invention causing carbapenem resistance in bacteria and in particular antibody or an aptamer for detecting the presence of the presence of Leu at position 154 as previously mentioned.
  • the invention also relates to a method for the detection of the gene of the NDM-4 carbapenemase of the invention in a biological sample, comprising the step of detecting the presence of the substitution of A by C at position 460 as indicated in SEQ ID NO:2.
  • the invention also relates to a method for the detection of the gene of the NDM-4 carbapenemase of the invention in a biological sample, comprising the step of detecting the presence of C at position 460 of SEQ ID NO:2.
  • Said substitution may be detected by analyzing a NDM-4 nucleic acid molecule.
  • NDM-4 nucleic acid molecules include mRNA, genomic DNA and cDNA derived from mRNA.
  • DNA or RNA can be single stranded or double stranded. These may be utilized for detection by amplification and/or hybridization with a probe, for instance.
  • the nucleic acid sample may be obtained from any biological sample, such as a body fluid.
  • Body fluids include blood, plasma, serum, lymph, urine etc.
  • DNA may be extracted using any methods known in the art, such as described in Sambrook et al, 1989.
  • RNA may also be isolated, for instance from tissue biopsy, using standard methods well known to the one skilled in the art such as guanidium thiocyanate-phenol-chloroform extraction.
  • NDM-4 substitution i.e. the substitution of A by C at position 460
  • the isolated RNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that are specific for a mutated site or that enable amplification of a region containing the mutated site.
  • RT-PCR polymerase chain reaction
  • conditions for primer annealing may be chosen to ensure specific reverse transcription (where appropriate) and amplification; so that the appearance of an amplification product be a diagnostic of the presence of the particular NDM- 4 substitution.
  • RNA may be reverse-transcribed and amplified, or DNA may be amplified, after which a mutated site may be detected in the amplified sequence by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art.
  • a cDNA obtained from RNA may be cloned and sequenced to identify the substitution in NDM-4 sequence.
  • nucleic acid molecule may be tested for the presence or absence of a restriction site.
  • a base substitution mutation creates or abolishes the recognition site of a restriction enzyme, this allows a simple direct PCR test for the mutation.
  • RNA sequencing includes, but are not limited to, direct sequencing, restriction fragment length polymorphism (RFLP) analysis; hybridization with allele-specific oligonucleotides (ASO) that are short synthetic probes which hybridize only to a perfectly matched sequence under suitably stringent hybridization conditions; allele-specific PCR; PCR using mutagenic primers; ligase-PCR, HOT cleavage; denaturing gradient gel electrophoresis (DGGE), temperature denaturing gradient gel electrophoresis (TGGE), single-stranded conformational polymorphism (SSCP) and denaturing high performance liquid chromatography (Kuklin et al, 1997).
  • DGGE denaturing gradient gel electrophoresis
  • TGGE temperature denaturing gradient gel electrophoresis
  • SSCP single-stranded conformational polymorphism
  • Direct sequencing may be accomplished by any method, including without limitation chemical sequencing, using the Maxam-Gilbert method ; by enzymatic sequencing, using the Sanger method ; mass spectrometry sequencing ; sequencing using a chip-based technology; and real-time quantitative PCR.
  • DNA from a subject is first subjected to amplification by polymerase chain reaction (PCR) using specific amplification primers.
  • PCR polymerase chain reaction
  • RCA rolling circle amplification
  • InvaderTMassay or oligonucleotide ligation assay (OLA).
  • OLA may be used for revealing base substitution mutations.
  • two oligonucleotides are constructed that hybridize to adjacent sequences in the target nucleic acid, with the join sited at the position of the mutation.
  • DNA ligase will covalently join the two oligonucleotides only if they are perfectly hybridized.
  • useful nucleic acid molecules in particular oligonucleotide probes or primers, according to the present invention include those which specifically hybridize the regions where the mutations are located.
  • Oligonucleotide probes or primers may contain at least 10, 15, 20 or 30 nucleotides. Their length may be shorter than 400, 300, 200 or 100 nucleotides.
  • probes, primers, aptamers or antibodies of the invention may be labelled with a detectable molecule or substance, such as a fluorescent molecule, a radioactive molecule or any others labels known in the art.
  • Labels are known in the art that generally provide (either directly or indirectly) a signal.
  • labelled with regard to the probes, primers, aptamers or antibodies of the invention, is intended to encompass direct labelling of the probes, primers, aptamers or antibodies of the invention by coupling (i.e., physically linking) a detectable substance to the probes, primers, aptamers or antibodies of the invention, as well as indirect labelling of the probe,s primers, aptamers or antibodies of the invention by reactivity with another reagent that is directly labeled.
  • detectable substances include but are not limited to radioactive agents or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)).
  • indirect labeling examples include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • An antibody or aptamer of the invention may be labelled with a radioactive molecule by any method known in the art.
  • radioactive molecules include but are not limited radioactive atom for scintigraphic studies such as 1123, 1124, Inl 11, Rel86, Rel88.
  • the present invention encompasses a kit comprising a set of primer pairs for identifying the carbapenemase gene of the invention causing carbapenem resistance in bacteria and in particular a set of primer pairs for detecting the presence of the presence of C at position 460 as previously mentioned.
  • a further object of the invention relates to a method for determining whether a microorganism is resistant to a ⁇ -lactam compound comprising the step of detecting in said microorganism the presence of a nucleic acid encoding a carbapenemase of the invention wherein the presence of said nucleic acid is indicative that said microorganism is resistant to ⁇ - lactams.
  • the step of detecting the presence of a nucleic acid encoding a carbapenemase of the invention is carried out as previously described. More particularly, the present invention relates to a method for determining whether a microorganism is more resistant to a ⁇ -lactam compound comprising the step of detecting whether the nucleotide at position 460 in SEQ ID NO :6 is a or c wherein when said nucleotide is c then the microorganism is more resistant to a ⁇ -lactam compound.
  • the present invention relates to a method for determining whether a microorganism has an extended activity (e.g. an increased hydrolytic activity) to a ⁇ -lactam compound comprising the step of detecting whether the nucleotide at position 460 in SEQ ID NO:6 is a or c wherein when said nucleotide is c then the microorganism has an extended activity to a ⁇ - lactam compound.
  • the presence of said nucleic acid can be assayed by detecting the DNA sequence of a carbapenemase of the invention in the genome of the microorganism of interest or by detecting the expression of said nucleic acid, at mR A or protein level in a sample containing said microorganism.
  • nucleic acids of the microorganism may be subjected to amplification by polymerase chain reaction (PCR), using specific oligonucleotide primers that enable amplification of a region in the nucleic acid encoding for the carbapenemase of the invention.
  • PCR polymerase chain reaction
  • Said amplified sequences may be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art.
  • the presence of a gene encoding for a carbapenemase of the invention can be assayed using the pair of specific primers defined by the nucleic acid sequence CACCTCATGTTTGAATTCGCC (SEQ ID NO:3) for the sense primer and the nucleic acid sequence CTCTGTCACATCGAAATCGC (SEQ ID N0:4) for the antisense primer.
  • the expression of the nucleic acid encoding for a carbapenemase of the invention can be assayed by detecting the mRNA or protein encoded by said nucleic acid.
  • nucleic acid contained in the samples containing the microorganism of interest is first extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic-acid-binding resins following the manufacturer's instructions.
  • the extracted mRNA may be then detected by hybridization (e. g., Northern blot analysis).
  • the extracted mRNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that enable amplification of a region in the nucleic acid of a carbapenemase of the invention may be used.
  • RT-PCR polymerase chain reaction
  • Quantitative or semi-quantitative RT-PCR is preferred. Real-time quantitative or semi-quantitative RT-PCR is particularly advantageous.
  • Extracted mRNA may be reverse transcribed and amplified, after which amplified sequences may be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art.
  • LCR ligase chain reaction
  • TMA transcription mediated amplification
  • SDA strand displacement amplification
  • NASBA nucleic acid sequence based amplification
  • the invention also relates to a method for determining whether a microorganism is resistant or of intermediate susceptibility to a ⁇ -lactam compound (including carbapenems) comprising the step of detecting in said microorganism the presence of the carbapenemase encoded by said nucleic acid wherein the presence of said protein is indicative that said microorganism is resistant or of intermediate susceptibility to a ⁇ -lactam compound.
  • the step of detecting the presence of the carbapenemase of the invention is carried out as previously described. More particularly, the present invention relates to a method for determining whether a microorganism is more resistant to a ⁇ -lactam compound comprising the step of detecting whether the amino acid at position 154 in SEQ ID NO: 5 is M or L wherein when said amino acid is L then the microorganism is more resistant to a ⁇ -lactam compound.
  • the present invention relates to a method for determining whether a microorganism has an extended activity (e.g. an increased hydrolytic activity) to a ⁇ -lactam compound comprising the step of detecting whether the amino acid at position 154 in SEQ ID NO:5 is M or L wherein when said amino acid is L then the microorganism has an extended activity to a ⁇ -lactam compound.
  • an extended activity e.g. an increased hydrolytic activity
  • Such methods comprise contacting a sample susceptible of containing said nucleic acid (so, according to the invention, containing the microorganism of interest) with a binding partner capable of selectively interacting with the protein of interest present in the sample.
  • the binding partner is generally an antibody that may be polyclonal or monoclonal, preferably monoclonal.
  • the presence of the said protein can be detected using standard electrophoretic and immuno diagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays.
  • immunoassays such as competition, direct reaction, or sandwich type assays.
  • assays include, but are not limited to, Western blots; agglutination tests; enzyme-labelled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; Immunoelectrophoresis; immunoprecipitation, immuno cytochemistry, immunohistochemistry, etc.
  • the reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith.
  • an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against the proteins to be tested. A biological sample containing or suspected of containing the marker protein is then added to the coated wells.
  • the plate(s) can be washed to remove unbound moieties and a detectably labelled secondary binding molecule added.
  • the secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.
  • the method for determining whether a microorganism is resistant to a ⁇ -lactam compound according to the invention is particularly suitable for predicting the response to a ⁇ -lactam compound in bacterial infected patient, especially in a gram (-) bacterial infected patient.
  • an another further object of the invention relates to a method for predicting the response to a ⁇ -lactam compound of a bacterial infected patient comprising isolating the microorganism responsible for the infection and determining whether said microorganism is resistant to ⁇ -lactam compounds by performing the method as above described.
  • the patient could be treated with es or another class of antibiotics.
  • FIGURES are a diagrammatic representation of FIGURES.
  • FIG. 1 Schematic representation of structures surronding the NDM-4 gene.
  • EXAMPLE Material and Methods. Bacterial strains and plasmids. Identification of E. coli INE-1 was performed by using the API 20E system (bioMerieux, Marcy l'Etoile, France). E. coli 271 as used as a a positive control. E. coli TOP10 was used as host strain for cloning and E. coli J53 (resistant to azide) as host for conjugation assays. Antimicrobial agents and MIC determinations. The antimicrobial agents and their sources have been described elsewhere. Susceptibility testing was performed by disk diffusion assay (Sanofi-Diagnostic Pasteur, Marnes-la-Coquette, France), as previously described.
  • MICs minimal inhibitory concentrations
  • coli TOP 10 as described, using the PCRBlunt ® TOPO cloning kit (Invitrogen, Cergy-Pontoise, France) followed by selection on plates containing 50 ⁇ g/ml of amoxicillin and 30 ⁇ g/ml of kanamycin.
  • the PCR amplicon encompassing the entire sequence of the genes used for cloning was obtained with primers NDMa (5'- CACCTCATGTTTGAATTCGCC-3') (SEQ ID NO:3) and NDMb and the (5'- CTCTGTCACATCGAAATCGC 3') (SEQ ID NO :4).
  • Those amplicons did not include the original promoter region of the gene, in order to express those genes under the control of the same promoter provided by plasmid pCR-Blunt-TOPO. Corresponding recombinant strains were used for MIC determinations.
  • ⁇ -lactamase NDM-4 was purified by ion-exchange chromatography. Briefly, the bacterial suspension was pelleted, resuspended in 50 ml of 50 mM sodium HEPES buffer (pH 7.5) plus 50 ⁇ ZnS0 4 and then was sonicated, cleared by ultracentrifugation and treated with DNase. The extract was then dialyzed against 20 mM Bis- Tris-buffer (pH 6.8) and loaded onto a preequilibrated Q-sepharose column. The ⁇ -lactamase- containing fractions were eluted with a linear NaCl gradient (0 to 1 M).
  • Plasmid content, conjugation assays, and transformation Plasmid DNAs ofE. coli INE-1 was extracted by using the Kieser method. E. coli NCTC50192, harboring four plasmids of 154, 66, 48 and 7 kb, was used as the size marker for plasmids. Plasmid DNAs were analyzed by agarose gel electrophoresis as described previously Direct transfer of the B- lactam resistance markers into E. coli J53 was attempted by liquid mating out assays at 37°C Selection was performed on agar plates supplemented with cefoxitin (10 ⁇ g/ml) and azide (100 ⁇ g/ml). Transformation was also attempted to isolate plasmid-containing strains after selection onto cefoxitin-containing plates ( 10 ⁇ g/ml). Plasmid encoding the NDM determinant was typed as previously described.
  • E. coli INE-1 Characteristics of E. coli INE-1. Isolate E. coli INE-1 was resistant to all B-lactams, including imipenem, meropenem, and ertapenem. These isolates were also resistant to all aminoglycosides and fluoroquinolones, and susceptible to chloramphenicol, sulfonamides, tetracycline, tigecyclines and colistin. MBL detection tests was positive, and PCR screening for MBL encoding genes identified a novel ⁇ /aNDM-type that was defined as £/aNDM-4 (http://www.lahey.org/Studies/).
  • coli INE-1 expressed an ESBL CTX-M-15, a plasmid-mediated cephalosporinase CMY-6 and an aminoglycoside resistance gene ArmA, the latter resistance gene being located on the NDM-4 plasmid.
  • ArmA aminoglycoside resistance gene
  • coli TOP10 conferred as expected resistance or reduced susceptibility to all ⁇ -lactams except to aztreonam (Table A).
  • MIC value of imipenem was significantly higher that that reported for E. coli expressing NDM-1.
  • Specific activities of cultures of NDM-4 against carbapenems were significantly higher that those determined for NDM-1 performed in similar cultures growth (Table B).
  • NDM-4 was purified to near homogeneity (>95%) as determined by SDS-PAGE analysis, and the purification factor was estimated to be 40-fold.
  • Kinetic data showed that NDM-4 hydrolyzed at least imipenem, meropenem, cefotaxime and ceftazidime at higher levels as compared to NDM- 1 (Table C).
  • E. coli TOP 10 E. coli TOP 10 E. coli TOP 10 pTOPO-NDM- pTOPO-NDM-4

Abstract

La présente invention concerne une carbapenemase et des procédés utilisant ladite carbapenemase, notamment des procédés de dépistage, des procédés de prédiction et des utilisations thérapeutiques.
PCT/EP2012/064122 2011-07-20 2012-07-18 Carbapenemase et traitement antibactérien WO2013011072A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201161509656P 2011-07-20 2011-07-20
US61/509,656 2011-07-20
EP11305944 2011-07-20
EP11305944.8 2011-07-20
US201261599002P 2012-02-15 2012-02-15
US61/599,002 2012-02-15

Publications (1)

Publication Number Publication Date
WO2013011072A1 true WO2013011072A1 (fr) 2013-01-24

Family

ID=47557689

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/064122 WO2013011072A1 (fr) 2011-07-20 2012-07-18 Carbapenemase et traitement antibactérien

Country Status (1)

Country Link
WO (1) WO2013011072A1 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150361425A1 (en) * 2014-05-16 2015-12-17 Bruce L. Geller Antisense antibacterial compounds and methods
WO2016092096A1 (fr) * 2014-12-11 2016-06-16 ALERE TECHNOLOGIES GmbH Anticorps anti-carbapénémases et leurs utilisations
US20160250304A1 (en) * 2015-02-23 2016-09-01 Synthetic Biologics, Inc. Carbapenemases for use with antibiotics for the protection of the intestinal microbiome
WO2016162564A1 (fr) * 2015-04-10 2016-10-13 Coris Bioconcept Sprl Procédé et dispositif de détection d'entérobactéries productrices de carbapénémase
EP2948549A4 (fr) * 2013-05-21 2016-12-07 Ind And Acad Coop Found Myongji Univ Amorces et nécessaires pour pcr multiplexe de colonies en vue de la détection de gènes de la bêta-lactamase de classe a, b, c et d et leurs procédés d'utilisation
US20180156796A1 (en) * 2016-12-06 2018-06-07 Silver Lake Research Corporation Methods of Detection of Antibiotic-Resistant Bacteria
US10391098B2 (en) 2014-05-19 2019-08-27 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
WO2020072858A1 (fr) * 2018-10-04 2020-04-09 T2 Biosystems, Inc. Procédés et compositions pour la détection à haute sensibilité de marqueurs de pharmacorésistance
US10907158B2 (en) 2015-12-23 2021-02-02 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
US11293024B2 (en) 2014-12-31 2022-04-05 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0036776A2 (fr) 1980-03-24 1981-09-30 Genentech, Inc. Méthode pour la création d'un plasmide d'expression
EP0125023A1 (fr) 1983-04-08 1984-11-14 Genentech, Inc. Préparations d'immunoglobuline recombinante, méthodes pour leur préparation, séquences d'ADN, vecteurs d'expression et cellules d'hôtes recombinantes
US4642334A (en) 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
EP0239400A2 (fr) 1986-03-27 1987-09-30 Medical Research Council Anticorps recombinants et leurs procédés de production
WO2010130882A1 (fr) * 2009-05-15 2010-11-18 Licentia Ltd. Procédé et kit pour détecter des bactéries résistant aux antibiotiques
WO2011042454A1 (fr) * 2009-10-06 2011-04-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Carbapénémase et traitement antibactérien

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0036776A2 (fr) 1980-03-24 1981-09-30 Genentech, Inc. Méthode pour la création d'un plasmide d'expression
US4642334A (en) 1982-03-15 1987-02-10 Dnax Research Institute Of Molecular And Cellular Biology, Inc. Hybrid DNA prepared binding composition
EP0125023A1 (fr) 1983-04-08 1984-11-14 Genentech, Inc. Préparations d'immunoglobuline recombinante, méthodes pour leur préparation, séquences d'ADN, vecteurs d'expression et cellules d'hôtes recombinantes
EP0239400A2 (fr) 1986-03-27 1987-09-30 Medical Research Council Anticorps recombinants et leurs procédés de production
WO2010130882A1 (fr) * 2009-05-15 2010-11-18 Licentia Ltd. Procédé et kit pour détecter des bactéries résistant aux antibiotiques
WO2011042454A1 (fr) * 2009-10-06 2011-04-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Carbapénémase et traitement antibactérien

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
CHANG AC; NUNBERG JH; KAUFMAN RJ; ERLICH HA; SCHIMKE RT; COHEN SN, NATURE, vol. 275, no. 5681, 19 October 1978 (1978-10-19), pages 617 - 24
CHEVRAY; NATHANS, PROC. NATL. ACAD. SCI. USA, vol. 89, 1991, pages 5789 - 5793
CHIEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 9578 - 9582
D. YONG ET AL: "Characterization of a New Metallo- -Lactamase Gene, blaNDM-1, and a Novel Erythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiella pneumoniae Sequence Type 14 from India", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 53, no. 12, 1 December 2009 (2009-12-01), pages 5046 - 5054, XP055011856, ISSN: 0066-4804, DOI: 10.1128/AAC.00774-09 *
DEBOER LW; RUDE RE; KLONER RA; INGWALL JS; MAROKO PR; DAVIS MA; BRAUNWALD E, PROC NATL ACAD SCI U S A., vol. 80, 1983, pages 5784 - 8
FIELDS; SONG, NATURE (LONDON, vol. 340, 1989, pages 245 - 246
GOEDDEL DV; HEYNEKER HL; HOZUMI T; ARENTZEN R; ITAKURA K; YANSURA DG; ROSS MJ; MIOZZARI G; CREA R; SEEBURG PH, NATURE, vol. 281, 1979, pages 544 - 8
GOEDDEL DV; SHEPARD HM; YELVERTON E; LEUNG D; CREA R; SLOMA A; PESTKA S., NUCLEIC ACIDS RES., vol. 8, 1980, pages 4057 - 74
L. POIREL ET AL: "Emergence of Metallo- -Lactamase NDM-1-Producing Multidrug-Resistant Escherichia coli in Australia", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 54, no. 11, 1 November 2010 (2010-11-01), pages 4914 - 4916, XP055011883, ISSN: 0066-4804, DOI: 10.1128/AAC.00878-10 *
M. KAASE ET AL: "NDM-2 carbapenemase in Acinetobacter baumannii from Egypt", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 66, no. 6, 1 June 2011 (2011-06-01), pages 1260 - 1262, XP055011902, ISSN: 0305-7453, DOI: 10.1093/jac/dkr135 *
MERRIFIELD, J. AM. CHEM. SOC., vol. 85, 1963, pages 2149 - 2154
NORDMANN P; L. POIREL; T .WALSH; D. LIVERMORE: "The emerging NDM carbapenemases", TRENDS MICROBIOL, vol. 19, 2011, pages 588 - 595, XP028124149, DOI: doi:10.1016/j.tim.2011.09.005
NORDMANN, P.; L. POIREL; M. A. TOLEMAN; T. R. WALSH: "Does broad- spectrum B-lactam resistance due to NDM- herald the end of the antibiotic era for treatment of infections caused by Gram-negatives ?", J. ANTIMICROB. CHEMOTHER, vol. 66, 2011, pages 689 - 692
POIREL L; L. DORTET; S. BEMABEU; P. NORDMANN: "Genetic of the blaNDM-1 positive", ANTIMICROB. AGENTS CHEMOTHER, vol. 55, 2011, pages 503 - 507
POIREL, L.; E. LAGRUTTA; P. TAYLOR; J. PHAM; P. NORDMANN: "Emergence of metallo-p-lactamase NDM-1-producing multidrug-resistant Escherichia coli in Australia", ANTIMICROB. AGENTS CHEMOTHER, vol. 54, 2010, pages 4914 - 16, XP055011883, DOI: doi:10.1128/AAC.00878-10
POIREL, L.; T. R. WALSH; V. CUVILLIER; P. NORDMANN.: "Multiplex PCR for detection of acquired carbapenemase genes", DIAGN. MICROBIOL. INFECT. DIS., vol. 70, 2011, pages 119 - 123
RODRIGUEZ-MARTINEZ; J. M., P. NORDMANN; N. FORTINEAU; L. POIREL.: "VIM-19, a metallo-?-lactamase with increased carbapenemase activity from Escherichia coli and Klebsiella pneumoniae.", ANTIMICROB. AGENTS CHEMOTHER, vol. 54, 2010, pages 471 - 476
SAMBROOK J; FRITSCH EF; MANIATIS T.: "Molecular cloning: a laboratory manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
STEWART ET AL.: "Solid-Phase Peptide Synthesis", 1969, W.H. FREEMAN CO.
YONG D; TOLEMAN MA; GISKE CG; CHO HS; SUNDMAN K; LEE K; WALSH TR: "Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India", ANTIMICROB AGENTS CHEMOTHER, vol. 53, no. 12, December 2009 (2009-12-01), pages 5046 - 54

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2948549A4 (fr) * 2013-05-21 2016-12-07 Ind And Acad Coop Found Myongji Univ Amorces et nécessaires pour pcr multiplexe de colonies en vue de la détection de gènes de la bêta-lactamase de classe a, b, c et d et leurs procédés d'utilisation
US11021706B2 (en) 2014-05-16 2021-06-01 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
US9790495B2 (en) * 2014-05-16 2017-10-17 Oregon State University Antisense antibacterial compounds and methods
US20150361425A1 (en) * 2014-05-16 2015-12-17 Bruce L. Geller Antisense antibacterial compounds and methods
US10391098B2 (en) 2014-05-19 2019-08-27 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
WO2016092096A1 (fr) * 2014-12-11 2016-06-16 ALERE TECHNOLOGIES GmbH Anticorps anti-carbapénémases et leurs utilisations
US11293024B2 (en) 2014-12-31 2022-04-05 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
US10548955B2 (en) 2015-02-23 2020-02-04 Synthetic Biologics, Inc. Carbapenemases for use with antibiotics for the protection of the intestinal microbiome
EP3261662A4 (fr) * 2015-02-23 2018-11-07 Synthetic Biologics Inc. Carbapénémases à utiliser avec des antibiotiques pour la protection du microbiome intestinal
JP2018507204A (ja) * 2015-02-23 2018-03-15 シンセティック・バイオロジクス・インコーポレイテッド 腸内マイクロバイオームの保護のために抗生物質と共に使用するカルバペネマーゼ
CN107530406A (zh) * 2015-02-23 2018-01-02 合成生物制品有限公司 用于保护肠微生物群系的与抗生素一起使用的碳青霉烯酶
US11123413B2 (en) 2015-02-23 2021-09-21 Synthetic Biologies, Inc. Carbapenemases for use with antibiotics for the protection of the intestinal microbiome
AU2016222936B2 (en) * 2015-02-23 2022-01-06 Theriva Biologics, Inc. Carbapenemases for use with antibiotics for the protection of the intestinal microbiome
US20160250304A1 (en) * 2015-02-23 2016-09-01 Synthetic Biologics, Inc. Carbapenemases for use with antibiotics for the protection of the intestinal microbiome
WO2016162564A1 (fr) * 2015-04-10 2016-10-13 Coris Bioconcept Sprl Procédé et dispositif de détection d'entérobactéries productrices de carbapénémase
US10907158B2 (en) 2015-12-23 2021-02-02 Board Of Regents, The University Of Texas System Antisense antibacterial compounds and methods
US20180156796A1 (en) * 2016-12-06 2018-06-07 Silver Lake Research Corporation Methods of Detection of Antibiotic-Resistant Bacteria
WO2018106546A1 (fr) * 2016-12-06 2018-06-14 Silver Lake Research Corporation Procédés de détection de bactéries résistant aux antibiotiques
WO2020072858A1 (fr) * 2018-10-04 2020-04-09 T2 Biosystems, Inc. Procédés et compositions pour la détection à haute sensibilité de marqueurs de pharmacorésistance

Similar Documents

Publication Publication Date Title
WO2013011072A1 (fr) Carbapenemase et traitement antibactérien
Okamoto et al. A change in PBP1 is involved in amoxicillin resistance of clinical isolates of Helicobacter pylori
McGuinness et al. Focus: infectious diseases: vancomycin resistance in Staphylococcus aureus
Kocaoglu et al. Profiling of β-lactam selectivity for penicillin-binding proteins in Streptococcus pneumoniae D39
Ono et al. Mechanisms of resistance to imipenem and ampicillin in Enterococcus faecalis
Albarracin Orio et al. Compensatory evolution of pbp mutations restores the fitness cost imposed by β-lactam resistance in Streptococcus pneumoniae
Pereira et al. Fluorescence ratio imaging microscopy shows decreased access of vancomycin to cell wall synthetic sites in vancomycin-resistant Staphylococcus aureus
US20120219952A1 (en) Carbapenemase and antibacterial treatment
EP3132033B1 (fr) Bêta-lactamases présentant des propriétés améliorées pour traitement
Aspatwar et al. Carbonic anhydrase related protein VIII and its role in neurodegeneration and cancer
EP2129391B1 (fr) Procédé de diagnostic
Al-Bayssari et al. Detection of expanded-spectrum β-lactamases in Gram-negative bacteria in the 21st century
US20080027146A1 (en) Methods and compositions for detecting and modulating periodontal disorders and periodontal diseases
Kuroda et al. IS 256-mediated overexpression of the WalKR two-component system regulon contributes to reduced vancomycin susceptibility in a Staphylococcus aureus clinical isolate
Oracz et al. Loss of function TRPV6 variants are associated with chronic pancreatitis in nonalcoholic early-onset Polish and German patients
AU2006279733A1 (en) Antibodies and methods for predicting dental caries
JP2006508642A (ja) 脂肪の蓄積を減少させる方法と、関連疾患を治療するための方法
WO2017139679A1 (fr) Systèmes et compositions pour le diagnostic d'une infection fongique pathogène et leurs procédés d'utilisation
US20080199480A1 (en) Methods for Identifying Risk of Type II Diabetes and Treatments Thereof
Moon et al. Cefiderocol heteroresistance in Klebsiella pneumoniae is linked to mutations in the siderophore receptor cirA and β-lactamase activities
US20170073733A1 (en) Carbapenemase and antibacterial treatment
Petersen et al. Establishment of in vitro susceptibility testing methodologies and comparative activities of piperacillin in combination with the penem β-lactamase inhibitor BLI-489
Tenover et al. Does the presence of multiple β-lactamases in Gram-negative bacilli impact the results of antimicrobial susceptibility tests and extended-spectrum β-lactamase and carbapenemase confirmation methods?
Zhang et al. Characteristics of rare ST463 carbapenem-resistant Pseudomonas aeruginosa clinical isolates from blood
Yoshimura et al. Emerging resistance to beta-lactams in Pantoea ananatis isolated from an immunocompetent patient with bacteremia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12738100

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12738100

Country of ref document: EP

Kind code of ref document: A1