WO2013001295A1

WO2013001295A1 - Neisserial compositions and expression constructs

Info

Publication number: WO2013001295A1
Application number: PCT/GB2012/051505
Authority: WO
Inventors: Ian Feavers; Rory CARE; Holly SANDERS
Original assignee: Health Protection Agency
Priority date: 2011-06-28
Filing date: 2012-06-27
Publication date: 2013-01-03
Also published as: GB201110980D0

Abstract

The present invention provides Outer Membrane Vesicles (OMVs) that contain an elevated concentration of Outer Membrane Protein (OMP) such as FetA. Also provided is a method for producing said OMVs, and corresponding expression constructs characterised in that the expresssion constructs comprise a promoter comprising a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of any one of SEQ ID NOs. 1-21.

Description

Neisserial Compositions and Expression Constructs

Neisseria meningitidis (N. meningitidis) is the causative agent of meningococcal meningitis and meningococcal septicaemia, and is of particular importance as a worldwide health problem. Neisseria gonorrhoeae (N. gonorrhoeae) is the causative agent of gonorrhoea.

Neisserial species naturally produce outer-membrane vesicles (OMVs), and there have been a number of attempts to generate an OMV-based vaccine in the hope that it might overcome the disadvantages seen in previous capsular polysaccharide based vaccines. For example, Bjune et al. (Lancet (1991 ) 338: pp1093-1096) describe a vaccine preparation consisting of OMVs from group B N. meningitidis (aka Norwegian vaccine), and demonstrate that the vaccine was able to induce a protective efficacy against meningococcal disease of 57.2% in a clinical trial in Norway. A similar vaccine has been produced in Cuba (Sierra et al., NIPH Ann (1991 ) Dec; 14(2): pp195-207) and high levels of efficacy were observed in that country. However, a large study in Brazil showed poor efficacy of the Cuban vaccine, especially in young children (de Moraes et al., Lancet (1992) Oct 31 ; 340(8827): pp1074-1078).

To address the difficulties associated with achieving broad spectrum protection, researchers have attempted to "enrich" OMVs with particular antigens that might enhance the immunogenic potential of the OMV. For example, in WO-A- 00/2581 1 , OMVs isolated from N. meningitidis were combined with heterologous antigens, e.g. Tbp, or a genetically modified N. meningitidis expressing such antigens recombinantly and antigen enriched OMVs are derived therefrom. A similar approach was followed by researchers in WO-A-01/09350, which describes vaccine compositions comprising OMVs from N. meningitidis, M. catarrhalis and H. influenzae, where in certain embodiments these organisms have been genetically modified to over-express particular immunogenic moieties. A further OMV based vaccine composition is known as the Hexamen or Dutch vaccine (Cartwright et al, Vaccine 17 (1999), pp2612-2619). The Hexamen™ vaccine composition comprises N. meningitidis OMVs that include six different PorA proteins that are recombinantly produced using two vaccine strains of N. meningitidis, PL16215 and PL10124. Each strain is capsule negative and produces three different PorA proteins.

A problem associated with OMV-based vaccines is that natural OMV production by bacterial species is typically rate-limiting. By way of example, the rate of OMV production is typically low in many bacteria. Thus, in order to produce significant amounts of OMVs, downstream concentration protocols (eg. detergent extraction) need to be employed. Such protocols are an additional expense and can adversely alter the antigenic properties of the OMVs. A related problem with OMV-based vaccines is that the profile of proteins present in OMVs varies from culture-to-culture. Thus, the same bacterial strain may produce OMVs having a protein profile that differs significantly from batch-to-batch. This is undesirable as consistency is an important factor with vaccines.

A further problem associated with OMV-based vaccines is that natural OMV production by bacterial species is prone to culture condition limitations. By way of example, the expression of certain key OMV antigenic proteins (and their corresponding antigenic epitopes) is often suppressed during normal culture conditions. Said suppression means that the resulting OMVs possess sub- optimal or ineffective concentrations of key OMV proteins.

There is therefore a need in the art for the provision of OMV preparations that address one or more of the above-identified problems.

The present invention addresses said problem(s). A first aspect of the present invention provides a promoter, which comprises a nucleic acid sequence, wherein said nucleic acid sequence has at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 1 . Said promoter is a high-expression promoter that has been engineered by the present inventors and includes a defined -35 region (eg. ATGGTT) and a defined -10 region (eg. TATAAT). In use, when inserted upstream (ie. 5') of an OMV antigenic protein, said promoter drives high expression of said OMV antigenic protein. Accordingly, the resulting OMVs possess an optimal (enhanced) concentration of said antigenic protein (and its associated antigenic epitope(s)).

In one embodiment, the promoter of the invention is inserted upstream of a FetA coding region. For example, in one embodiment, the promoter of the invention effectively substitutes for a wild-type fetA promoter and, in use, is able to drive high expression of the fetA gene within a bacterial host cell.

As shown in Figure 1 , the natural fetA gene promoter sequence includes a 'Poly- C tract'. This repeat region of cytosine bases between the -35 and -10 regions leads to variable expression. Without wishing to be bound by any theory, the present inventors believe that, during DNA replication, the number of bases in this repeat sequence can change, thereby changing the spacing between the -35 and -10 regions.

Thus, in one embodiment, the promoter of the present invention comprises a maximum number of cytosine residues located between the extreme 5' nucleotide position of the -35 region and the extreme 3' nucleotide position of the -10 region - for example, at most 6, 5, 4 or 3 cytosine residues located within this region. In one embodiment, the promoter preferably comprises a maximum number of cytosine residues located between the extreme 3' nucleotide position of the -35 region and the extreme 5' nucleotide position of the -10 region - for example, at most 4 or 3 cytosine residues. In one embodiment, the promoter of the present invention comprises a maximu m number of contiguous cytosine residues at any one site located between the extreme 5' nucleotide position of the -35 region and the extreme 3' nucleotide position of the -10 region - for example, at most 3 or 2 cytosine residues, preferably no contiguous cytosine residues located within this region. In one embodiment, the promoter preferably comprises a maximum number of contiguous cytosine residues located at any one site between the extreme 3' nucleotide position of the -35 region and the extreme 5' nucleotide position of the -10 region - for example, at most 3 or 2 cytosine residues, preferably no contiguous cytosine residues located within this region.

In one embodiment (optionally in combination with the above-described, preferred maximum cytosine residue threshold feature), the promoter of the present invention comprises a maximum number of guanine residues located between the extreme 5' nucleotide position of the -35 region and the extreme 3' nucleotide position of the -10 region - for example, at most 9, 8, 7, 6, or 5 guanine residues located within this region. In one embodiment, the promoter preferably comprises a maximum number of guanine residues located between the extreme 3' nucleotide position of the -35 region and the extreme 5' nucleotide position of the -10 region - for example, at most 6, 5, 4 or 3 guanine residues. In one embodiment, the promoter of the present invention comprises a maximum number of contiguous guanine residues at any one site located between the extreme 5' nucleotide position of the -35 region and the extreme 3' nucleotide position of the -10 region - for example, at most 3 or 2 contiguous guanine residues located at any one site within this region; by way of further example, no triplet 'GGG' motif, and/ or at most two occurrences of the duplet 'GG' motif. In one embodiment, the promoter preferably comprises a maximum number of contiguous guanine residues located at any one site between the extreme 3' nucleotide position of the -35 region and the extreme 5' nucleotide position of the -10 region - for example, at most 3 or 2 contiguous guanine residues located at any one site within this region; by way of further example, no triplet 'GGG' motif, and/ or at most one occurrence of the duplet 'GG' motif.

In one embodiment, the promoter of the present invention comprises a nucleic acid sequence having at least 80% sequence identity to the nucleic acid sequence of any of SEQ ID NOs: 1 -21 .

In a second aspect, the present invention provides a nucleic acid sequence cassette comprising, in a 5' to 3' direction, the promoter sequence as hereinbefore described and an OMV nucleic acid sequence located 3' of said promoter sequence, wherein said OMV nucleic acid sequence:

a. comprises a fragment of a non-coding region of an OMV gene, wherein said non-coding region is defined as the contiguous nucleotide sequence that starts at the 5' nucleotide of a transcription start site of an OMV gene and ends at the last nucleotide immediately 5' to the first nucleotide of the start codon of said OMV coding region; and b. comprises at least 20 contiguous nucleotides.

In use, the above-described nucleic acid cassette further comprises a coding region of the OMV gene that is to be expressed. Said coding region is located in- frame and downstream (ie. 3') of said non-coding region. Thus, in use, the promoter of the invention is able to drive high expression of an OMV gene within a bacterial host cell. Reference to an OMV gene includes the fetA gene and embraces fetA variants such as F3-3, F1 -5, F5-1 , F3-6, as well as other OMV genes such as pork.

In one embodiment, the promoter is positioned within an OMV gene (eg. fetA) such that the extreme 5' nucleotide (eg. T = thymine) of the -10 region (eg. TATAAT) of the promoter is located approximately 10 nucleotides (eg. 15, 14, 13. 12, 1 1 , 10, 9, 8, 7, 6 nucleotides) upstream (ie. 5') of the transcription start site for the OMV protein in question (eg. FetA). By way of example, in one embodiment, said extreme 5' nucleotide of the -10 region of the promoter is located approximately 10 nucleotides (eg. 15, 14, 13. 12, 1 1 , 10, 9, 8, 7, 6 nucleotides) upstream (ie. 5') of the extreme 5' nucleotide of a nucleic acid sequence having at least 80% sequence identity to the nucleic acid sequence depicted by SEQ ID NO: 23 or 24.

In one embodiment, the promoter is positioned within an OMV gene (eg. porA) such that the extreme 5' nucleotide (eg. T = thymine) of the -10 region (eg. TATAAT) of the promoter is located approximately 10 nucleotides (eg. 15, 14, 13. 12, 1 1 , 10, 9, 8, 7, 6 nucleotides) upstream (ie. 5') of the transcription start site for the OMV protein in question (eg. PorA). By way of example, in one embodiment, said extreme 5' nucleotide of the -10 region of the promoter is located approximately 10 nucleotides (eg. 15, 14, 13. 12, 1 1 , 10, 9, 8, 7, 6 nucleotides) upstream (ie. 5') of the extreme 5' nucleotide of a nucleic acid sequence having at least 80% sequence identity to the nucleic acid sequence depicted by SEQ ID NO: 33.

In one embodiment, the nucleic acid sequence cassette comprises a nucleic acid sequence having at least 80% sequence identity to a contiguous nucleic acid sequence provided by, in a 5' to 3' direction, a nucleic acid promoter sequence selected from any one of SEQ ID NOs: 1 -21 , and an OMV nucleic acid sequence, wherein said OMV nucleic acid sequence comprises at least 10, at least 15, at least 20, at least 25, at least 30 contiguous nucleotides (starting from the transcription start site) of an OMV gene.

In one embodiment, the nucleic acid sequence cassette comprises a nucleic acid sequence having at least 80% sequence identity to a contiguous nucleic acid sequence provided by, in a 5' to 3' direction, a nucleic acid promoter sequence selected from any one of SEQ ID NOs: 1 -21 , and an OMV nucleic acid sequence (preferably comprising SEQ ID NO: 23). In one embodiment, the nucleic acid sequence cassette comprises a nucleic acid sequence having at least 80% sequence identity to a contiguous nucleic acid sequence provided by, in a 5' to 3' direction, a first nucleic acid promoter sequence selected from any one of SEQ ID NOs: 1 -21 , and an OMV nucleic acid sequence (preferably comprising SEQ ID NO: 24). In one embodiment, said OMV nucleic acid sequence comprises at least 10, at least 15, at least 20, at least 25, at least 30 contiguous nucleotides of SEQ ID NO: 24 (eg. starting from the transcription start site, namely nucleotide position 1 of SEQ ID NO: 24). Expression of OMV proteins such as FetA is typically suppressed during normal bacterial culturing conditions, which is undesirable. By way of example, the FetA protein is negatively-regulated by a protein known as Fur. As shown in Figure 1 , in the presence of iron the Fur protein binds to a consensus sequence between the FetA coding sequence and its native (ie. wild-type) promoter. The bound Fur protein then prevents transcription of the gene. Accordingly, under in vitro growth conditions, where conditions are often iron-replete, FetA expression is suppressed.

In one embodiment, the OMV nucleic acid sequence lacks a Fur-binding site. In one embodiment, the Fur-binding site comprises a nucleic acid sequence having at least 90% sequence identity (eg. at least 91 , at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99 or 100% identity) to SEQ ID NO: 22. In further embodiments, the Fur-binding site comprises a nucleic acid sequence having at least 80% sequence identity (eg. at least 91 , at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99 or 100% identity) to any one of SEQ ID NO: 34-37.

In one embodiment, the OMV nucleic acid sequence further comprises at least part of the coding region of said OMV nucleic acid sequence. In one embodiment, said coding region of said OMV nucleic acid sequence comprises at least 10, at least 15, at least 20, at least 25, at least 30 or at least 35 contiguous nucleotides of the OMV coding region (eg. starting from the 'A' of the ATG start codon).

In one embodiment, the OMV nucleic acid sequence further comprises a nucleic acid sequence having at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 25. In one embodiment, said coding region of said OMV nucleic acid sequence comprises at least 10, at least 15, at least 20, at least 25, at least 30 or at least 35 contiguous nucleotides of nucleic acid sequence depicted by SEQ ID NO: 25 (eg. starting from the 'A' of the ATG start codon).

According to a further aspect, the present invention provides a nucleic acid vector (eg. a plasmid) comprising the hereinbefore described promoter or nucleic acid sequence cassette.

In one embodiment, the vector comprises an origin of replication that is active in the bacterial host cell of choice in which amplification is to be effected. For example, if expression is to be effected in E. coli, the origin of replication is an origin of replication that is capable of effecting vector replication in an E. coli, host cell.

In one embodiment (or the same embodiment), the vector comprises one or more (eg. two) nucleic acid sequences having homology/ identity with a corresponding target OMV gene present in a target bacterial cell (ie. the same or highly homologous OMV gene present in a bacterial cell into which the vector is to be inserted). Said homologous nucleic acid sequence(s) provide the structural feature(s), which, following insertion of the vector into the target cell, allows the vector to integrate into the target OMV gene of choice. In one embodiment, the OMV (eg. fetA) nucleic acid sequence (eg. part of the nucleic acid sequence located within the region starting at the transcription start site and running downstream thereof (ie. 3' thereof)) provides said one or more homologous recombination sequences (aka recombination sites). In one embodiment, a nucleic acid sequence naturally located (immediately) upstream or downstream of the OMV gene (eg. fetA) of choice may be employed to provide one or more homologous recombination sequences - one example here is part of the thdF gene.

The vector may further include nucleic acid encoding a selectable marker such as an antibiotic resistance gene (eg. a kanamycin resistance gene). In one embodiment, the vector is a plasmid as illustrated in Figure 2. Said plasmid may optionally exclude any or all of the indicated thdF sequence and/ or the FetA coding region portion of the fetA sequence.

A further aspect of the present invention provides a method for transforming a bacterial host cell, said method comprising inserting the hereinbefore described vector into said bacterial host cell, and wherein OMV (eg. FetA) expression within said bacterial host cell is controlled by the hereinbefore described promoter. In one embodiment, the vector insertion and relative positioning is illustrated in Figure 3 (based on the vector as illustrated in Figure 2).

A further aspect of the present invention provides a bacterial host cell comprising a promoter as hereinbefore described or a nucleic acid sequence cassette as hereinbefore described, wherein the promoter:

a. is located 5' to an OMV protein coding region (eg. a FetA coding region) within the host cell;

b. is located in-frame with said OMV protein coding region (eg. the FetA coding region) within the host cell; and

c. controls expression of the OMV protein (eg. FetA) within the host cell. In one embodiment, the bacterial host cell may be any bacterial host cell. For example, the bacterial host cell may be a neisserial host cell such as a N. meningitidis host cell. Alternatively, the bacterial host may be a commensal Neisseria, such as N. lactamica, which closely resembles N. meningitidis and is also a common inhabitant of the human nasopharynx. However, unlike N. meningitidis, commensal neisseria such as N. lactamica lack the key genes required for invasive disease and as such are limited to a commensal existence in the nasopharynx.

A further aspect of the present invention provides two or more bacterial host cells as hereinbefore described, wherein each of said two or more host cells contains a promoter as hereinbefore described that controls different OMV protein (eg. different FetA variants) coding region nucleic acid sequences, and wherein the promoter

a. is located 5' to the OMV protein coding region within each host cell; b. is located in-frame with said OMV protein coding region within each host cell; and

controls expression of said OMV protein within each host cell.

In one embodiment, the different OMV proteins are selected from FetA variants such as F3-3, F1 -5, F5-1 , F3-6, and other OMV proteins such as PorA.

A further aspect of the invention provides a method for producing Neisserial outer membrane proteins, said method comprising culturing one or more Neisserial host cells as hereinbefore described in a culture medium, and harvesting outer membrane vesicles that are produced by said host cells from the culture medium.

In one embodiment, said method further comprises formulating the outer membrane vesicles to provide a meningitis antigenic composition or vaccine. In a further aspect of the present invention, there is provided use of a promoter as hereinbefore described or use of a nucleic acid sequence cassette as hereinbefore described or use of a vector as hereinbefore described, for expressing an OMV gene (eg. a FetA) gene in a host cell bacterium.

In a further aspect of the present invention, there is provided use of a bacterial host cell as hereinbefore described, for producing outer membrane vesicles.

In a further aspect of the present invention, there is provided use of a bacterial host cell as hereinbefore described, for producing an antigenic composition or meningitis vaccine.

In a further aspect of the present invention, there is provided outer membrane vesicles obtainable by a method as hereinbefore described. In one embodiment, the OMVs of the present invention are characterized by the presence of an elevated OMV protein (eg. FetA) concentration vis-a-vis naturally-produced OMVs. By way of example, an OMV protein (eg. FetA) concentration within an OMV of the present invention typically constitutes at least 6% (eg. at least 7%, at least 8%, at least 9%, at least 10%, at least 1 1 % or at least 12%) of the total amount of protein present in an OMV.

In a further aspect of the present invention, there is provided outer membrane vesicles as hereinbefore described, for use as an antigenic composition or as a meningitis vaccine. In one embodiment, said OMV-containing composition may further include one or more additional antigenic peptide (eg. a N. meningitidis antigenic peptide, for example a non-OMV peptide).

Percentage identity/ homology

Reference throughout this specification to at least 80% sequence identity/ homology includes (and is used interchangeably with) any one of at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and 100% identity/ homology. Sequence identity/ homology

Any of a variety of sequence alignment methods can be used to determine percent identity, including, without limitation, global methods, local methods and hybrid methods, such as, e.g., segment approach methods. Protocols to determine percent identity are routine procedures within the scope of one skilled in the. Global methods align sequences from the beginning to the end of the molecule and determine the best alignment by adding up scores of individual residue pairs and by imposing gap penalties. Non-limiting methods include, e.g., CLUSTAL W, see, e.g., Julie D. Thompson et al., CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position- Specific Gap Penalties and Weight Matrix Choice, 22(22) Nucleic Acids Research 4673-4680 (1994); and iterative refinement, see, e.g., Osamu Gotoh, Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments, 264(4) J. oL Biol. 823-838 (1996). Local methods align sequences by identifying one or more conserved motifs shared by all of the input sequences. Non-limiting methods include, e.g., Match-box, see, e.g., Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CAB OS 501 - 509 (1992); Gibbs sampling, see, e.g., C. E. Lawrence et al., Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment, 262(5131 ) Science 208-214 (1993); Aiign-M, see, e.g., Ivo Van Waile et al., Aiign- - A New Algorithm for Multiple Alignment of Highly Divergent Sequences, 20(9) Bioinformatics:1428-1435 (2004): Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-19, 1992. Description of the Figures

Figure 1 illustrates blocking of FetA transcription by Fur in the presence of iron (Fe). The Poly-C repeat tract in the fetA promoter also leads to variable expression.

Figure 2 illustrates a plasmid containing a promoter of the present invention, which is located upstream of 514bp of a meningococcal fetA gene. A kanamycin resistance marker is also present. A nucleic acid sequence having high homology with the upstream gene, thdF, was included to provide an optional homologous recombination site.

Figure 3 illustrates insertion of a promoter of the present invention upstream of the meningococcal fetA gene. The fetA sequence in the plasmid is recombined with the genomic fetA sequence, resulting in insertion of the vector DNA and displacement of the native fetA promoter. The modified genomic DNA contains a complete fetA coding sequence (as wild-type) preceded by the modified promoter. Figure 4 illustrates Serum Bactericidal Assay (SBA) titres of sera from mice immunized with OMVs from a strain modified to express FetA under a promoter of the present invention. See Example 7.

Examples

Example 1 - construction of the promoter (eg. so it can be inserted into a vector)

The native PorA promoter was amplified from N. meningitidis H44/76 genomic DNA by PCR using primers PCR1 F (5' - GGATCCATCAGGACAAGGCGACG - 3') and PCR1 R (5' - CGTAAATAGTCTATAAACAAGATCT - 3'), adding a BamHI restriction site to the 5' end and an Xbal site to the 3' end. The product was cloned into a pCR2.1 TOPO vector to give plasmid pCR2.1 TOPO PorA PCR1 .

In a separate reaction, the 5' end of the porA gene, including part of the promoter, was amplified using from N. meningitidis H44/76 genomic DNA by PCR using primers PCR2F (5' - AGATCTATAATTGAAGACGTATCGG - 3') and PCR2R (5' - GTCCTGCTTTTAGTCACTAATTCGAA - 3'), adding a Bglll site to the 5' end and a Hindlll site to the 3' end. The product was cloned into a pCR2.1 TOPO vector to give plasmid pCR2.1 TOPO PorA PCR2. pCR2.1 TOPO PorA PCR1 was digested with restriction enzymes BamHI and Xbal, and the PorAPCRI fragment was purified. This fragment was cloned into pUC19 between the BamHI and Xbal sites to give pUC19PCR1 .

In a separate reaction, primers PorBlinkl F (5' - TCTAG AAAAATG GTTTTTTCAG ACAG G AA - 3') and PorBlinkI R (5' - AGATCTTCCTGTCTGAAAAAACCATTTTT - 3') were annealed to give a PorA linker with an Xbal overhang at the 5' end and a Bglll overhang at the 3' end. pCR2.1 TOPO PorA PCR2 was digested with restriction enzymes Bglll and Hindlll, and the PorAPCR2 fragment was purified. The PorAPCR2 fragment and PorA linker were cloned into pUC19PorApro, between the Xbal and BamHI restriction sites, to give plasmid pUC19 PorA pro. Using the plasmid pUC19 PorA pro as a template, primers A14-20F and PorA PCR2R were used to amplify the porA promoter including -35, spacer, -10 and the truncated PorA of PCR2. Products with 14-20bp spacers were generated. The PCR products were cloned into pCR2.1 TOPO to give plasmids pCR2.1 TOPO PorA PCR2+linker(14-20). The additional A added to the 3' end of the PCR reaction during Amplitaq amplification resulted in an extra T in cloning to make up a functional Xbal site.

Primer Sequences:

A14F CTAG AAAAATG GTTTTTTCAG G AA

A15F CTAG AAAAATG GTTTTTTCAAG G AA

A16F CTAG AAAAATG GTTTTTTCACAG G AA

A17F CTAG AAAAATG GTTTTTTCAACAG G AA

A19F CTAG AAAAATG GTTTTTTCACGACAG GAA

A20F CTAG AAAAATG GTTTTTTC AC G G AC AG GAA pCR2.1 TOPO PorA PCR2+linker(14-20) was digested with restriction enzymes Xbal and Hindlll, and the PCR2+linker fragment was purified. The PCR2+linker fragment was cloned into pUC19 PorA pro, between the Xbal and Hindlll sites, to give plasmids pUC19 PCR1 +2 link (14-20bp).

Example 2 - construction of the vector (eg. so it is ready for transformation)

A Kanamycin resistance marker was amplified by PCR from the plasmid Tn5 using primers KanaKpnl (5' - GGTACCACTCCAGCATGAGATCC - 3') and KanaBamHI (5' - GGATCCACATGGCGATAGCTAGAC - 3'), adding a Kpnl restriction site to the 3' end and a BamHI site to the 5' end. The product was cloned into pCR2.1 TOPO vector to give plasmid pCR2.1 TOPO Kan. pCR2.1 TOPO Kan was digested with restriction enzymes BamHI and Kpnl. The Kanamycin fragment was purified and cloned into pUC19 between the BamHI and Kpnl sites to give pUC19Kan. In a separate reaction, the 5' end of the meningococcal fetA gene was amplified from H44/76 genomic DNA using primers FetApartialF (5' - CATGAAGACGTATCGGTTTGGATTTACTTCCC - 3') and FetApartial R (5' - TTATCCAAGCTTTGAGCAGGTCTTGGGC - 3'), introducing a Bbs\ site preceding the gene and Hind\\\ site following the gene. The product was cloned into a pCR2.1 TOPO vector to give plasmid FetApartialTOPO.

FetApartialTOPO was digested with restriction enzymes Bbsl and Hindlll. The FetApartial fragment was cloned into pUC19 PCR1 +2 link (17bp) between the Bbsl and Hindlll sites to give plasmid pUC19FetApartial. pUC19Kan was digested with restriction enzymes Bsal and BamHI. The Kanamycin resistance fragment was purified and cloned into pUC19FetApartial, between the Bsal and BamHI sites to give plasmid pUC19FetApartialKan.

In a separate reaction, a Neisserial Uptake Sequence (NUS) linker was created by annealing primers NUSLinkerF (5' -

GTATCGGACTCCATGGCTCAAGCTTATGCCGTCTGAAAGCCTTTCAGACGG

3') and NUSIinkerR (5' AGCTATGCCGTCTGAAAGGCTTTCAGACGGCATAAGCTTGAGCCATGGAGT CCG - 3'), containing Hindlll overlaps at either end. pUC19FetApartialKan was digested with restriction enzyme Hindlll and the NUS linker was inserted into this site to give plasmid pUC19FetApartialKanNUS.

In a separate reaction, the 3' end of the ThdF gene was amplified from H44/76 genomic DNA with primers ThdFBspHI (5' - TCATGAATGCTGGTCGAAGCGA - 3') and ThdFtotaIR (5' - TTCGAACGATCCGTTTATTTTCCGAT - 3'), introducing a BspHI and BstBI site at the start and end of the gene, respectively. The product was cloned into a pCR2.1 TOPO vector to give plasmid ThdFendTOPO. ThdFendTOPO was digested with restriction enzymes BstBI and BspHI. The ThdFend fragment was purified and cloned into pUC19FetApartialKanNUS, between the BstBI and BspHI sites, to give plasmid pUC19FetAKanNUSThdF. Example 3 - transformation of the host cell

Neisseria meningitidis wildtype strains were inoculated from -80°C frozen stocks onto Columbia agar containing 5% horse blood. Colonies were allowed to grow overnight at 37°C in a 5% CO₂ atmosphere. Following overnight growth, colonies were resuspended in 1 ml Mueller Hinton (MH) Broth containing 8mM MgCI₂ to an ODesonm of 0.25-0.30. 1 g undigested plasmid DNA was added per ml cell suspension.

The mixture was incubated at 37°C with 150rpm rotational shaking for 4 hours.

Cells were then plated out onto MH agar containing MgC^ and 50 g/ml Kanamycin. Plates were incubated at 37°C in a 5% CO₂ atmosphere for 36 hours. Example 4 - growth of the transformed strain

Strains were grown in MH broth with and without 50 g/ml Kanamycin, or on the corresponding agar plates. Strains were also grown in Frantz medium and Tryptone Soya Broth. All strains containing the modified promoter showed consistently high levels of the upregulated protein. Other media could be used as required. The mutation was not lost following repeated growth and passages without antibiotic selection, and as such antibiotic selection is not required during growth. Example 5 - harvesting of the OMVs

Following growth in Frantz media (or MH broth), OMVs enriched in FetA were extracted using Sodium Deoxycholate extraction. Extracted OMVs contained consistent and increased levels of the FetA protein.

Native OMVs enriched in FetA could also be extracted using ultracentrifugation, or other methods for native OMV extraction.

Example 6 - formulating the OMV preparations for vaccine use

For vaccine use, OMVs were diluted in normal saline to the required concentration and dose level (for example, 25 g total protein in a 500μΙ dose). Optionally, OMVs were formulated with aluminium hydroxide adjuvant or Sigma Adjuvant System (Monophosphoryl Lipid A + Trehalose Dicorynomycolate in 2% oil).

Vaccines may be formulated with an adjuvant and/ or additional vaccine components.

Example 7 - administration of vaccine and patient outcome

OMVs enriched in FetA were administered to mice and rabbits in a two dose schedule with aluminium hydroxide adjuvant. This resulted in FetA-specific antibodies in animals receiving OMVs containing the upregulated FetA. Antibodies were also induced against other meningococcal outer membrane proteins present in the OMVs. FetA-specific antibodies induced by the vaccine were found to be bactericidal by serum bactericidal assay (SBA).

Figure 4 illustrates Serum Bactericidal Assay (SBA) titres of sera from mice immunized with OMVs from a strain modified to express FetA under a promoter of the present invention. Sera were tested with baby rabbit complement against the OMV parent strain (FetA-on) and a FetA-knockout strain (FetA-KO). Both strains were in an isogenic H44/76 background. Bars show mean SBA values for 5 serum pools (2 mice per pool) against the two target strains. Error bars show 95% confidence intervals for the mean. SBA titres were significantly higher (P = 0.013) against the strain expressing FetA (FetA-on) than against the strain not expressing FetA (FetA-KO), showing that antibodies specific for FetA are present in the sera and are contributing to bactericidal killing. SBAs are considered the best correlate of protection against meningococcal disease.

OMV preparations of the invention may be administered as a vaccine to other animal species or to humans. Said administrations may be in multiple doses at various dose levels (optionally with adjuvant) in order to induce FetA-specific bactericidal antibodies.

SEQ ID NOs

SEQ ID NO: 1 = ATG GTTTTTTCAG G AAG ATCTATAAT

SEQ ID NO: 2 = ATG GTTTTTTCAAGG AAG ATCTATAAT

SEQ ID NO: 3 = ATG GTTTTTTCACAAGG AAG ATCTATAAT

SEQ ID NO: 4 = ATG GTTTTTTCAACAGG AAG ATCTATAAT

SEQ ID NO: 5 = ATG GTTTTTTCAG ACAGG AAG ATCTATAAT

SEQ ID NO: 6 = ATG GTTTTTTCACG ACAG G AAG ATCTATAAT

SEQ ID NO: 7 = ATG GTTTTTTCACG G ACAG G AAG ATCTATAAT SEQ ID NO: 8 = ATG GTTTTTTCAG G AAG ATCTATAATTGAA

SEQ ID NO: 9 = ATG GTTTTTTCAAGG AAG ATCTATAATTGAA

SEQ ID NO: 10 = ATG GTTTTTTCACAAGG AAG ATCTATAATTGAA SEQ ID NO: 1 1 = ATG GTTTTTTCAACAGG AAG ATCTATAATTGAA SEQ ID NO: 12 = ATG GTTTTTTCAG ACAGG AAG ATCTATAATTGAA SEQ ID NO: 13 = ATG GTTTTTTCACG ACAG G AAG ATCTATAATTGAA SEQ ID NO: 14 = ATG GTTTTTTCACG G ACAG G AAG ATCTATAATTGAA SEQ ID NO: 15

ATATTTGTTCTAGAAAAATGGTTTTTTCAGGAAGATCTATAATTGAA

SEQ ID NO: 16

ATATTTGTTCTAGAAAAATGGTTTTTTCAAGGAAGATCTATAATTGAA

SEQ ID NO: 17

ATATTTGTTCTAGAAAAATGGTTTTTTCACAAGGAAGATCTATAATTGAA SEQ ID NO: 18

ATATTTGTTCTAGAAAAATGGTTTTTTCAACAGGAAGATCTATAATTGAA

SEQ ID NO: 19

ATATTTGTTCTAGAAAAATGGTTTTTTCAGACAGGAAGATCTATAATTGAA

SEQ ID NO: 20

ATATTTGTTCTAGAAAAATGGTTTTTTCACGACAGGAAGATCTATAATTGAA

SEQ ID NO: 21

ATATTTGTTCTAGAAAAATGGTTTTTTCACGGACAGGAAGATCTATAATTGAA

SEQ ID NO: 22 = ATTAATTATTTTTCTTATC

SEQ ID NO: 23 = GACGTAT

SEQ ID NO: 24

GACGTATCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGA

SEQ ID NO: 25 = ATGAATACCCCATTGTTCCGT SEQ ID NO: 26

ATATTTGTTCTAGAAAAATGGTTTTTTCAGGAAGATCTATAATTGAAGACGTA TCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGAATGAATACC CCATTGTTCCGT

SEQ ID NO: 27

ATATTTGTTCTAGAAAAATGGTTTTTTCAAGGAAGATCTATAATTGAAGACGT ATCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGAATGAATAC CCCATTGTTCCGT

SEQ ID NO: 28

ATATTTGTTCTAGAAAAATGGTTTTTTCACAAGGAAGATCTATAATTGAAGAC GTATCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGAATGAAT ACCCCATTGTTCCGT

SEQ ID NO: 29

ATATTTGTTCTAG AAAAATG GTTTTTTCAACAG G AAG ATCTATAATTG AAG AC GTATCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGAATGAAT ACCCCATTGTTCCGT

SEQ ID NO: 30

ATATTTGTTCTAG AAAAATG GTTTTTTCAGACAGG AAG ATCTATAATTG AAG A CGTATCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGAATGAA TACCCCATTGTTCCGT

SEQ ID NO: 31

ATATTTGTTCTAGAAAAATGGTTTTTTCACGACAGGAAGATCTATAATTGAAG AC GTATCG GTTTG G ATTTACTTCCCTTCATACTCAAG AG GACG ATTG AATG A ATACCCCATTGTTCCGT SEQ ID NO: 32

ATATTTGTTCTAGAAAAATGGTTTTTTCACGGACAGGAAGATCTATAATTGAA GACGTATCGGTTTGGATTTACTTCCCTTCATACTCAAGAGGACGATTGAATG AATACCCCATTGTTCCGT

SEQ ID NO: 33

GACGTATCGGGTGTTTGCCCGATGTTTTTAGGTTTTTATCAAATTTACAAAAG

GAAGCCGAT SEQ ID NO: 34 = TCGCAAATAAAAACGATAATCAGCTTTACACAAAT SEQ ID NO: 35 = TTAATATAAACAAAAATAATTATTATTTTTC SEQ ID NO: 36 = TTAATATAAACAAAAATAATTATTAATTATTTTTC

SEQ ID NO: 37 = ATTATTTTTCTTATC

Claims

1 . A promoter comprising a nucleic acid sequence, wherein said nucleic acid sequence has at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 1 .

2. The promoter according to Claim 1 , wherein said nucleic acid sequence has at least 80% sequence identity to any one of the nucleic acid sequences of SEQ ID NO: 2-7;

preferably wherein said nucleic acid sequence has at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 4 or 5.

3. The promoter according to Claim 1 or Claim 2, wherein said nucleic acid sequence has at least 80% sequence identity to any one of the nucleic acid sequences of SEQ ID NOs: 8-14;

preferably wherein said nucleic acid sequence has at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 1 1 or 12.

4. The promoter according to any preceding claim, wherein said nucleic acid sequence has at least 80% sequence identity to any one of the nucleic acid sequences of SEQ ID NOs: 15-21 ;

preferably wherein said nucleic acid sequence has at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 18 or 19.

5. A nucleic acid sequence cassette comprising, in a 5' to 3' direction, the promoter sequence according to any preceding claim and a Fetk nucleic acid sequence located 3' of said promoter sequence, wherein said Fetk nucleic acid sequence:

a. comprises a fragment of a Fetk non-coding region, wherein said non-coding region is defined as the contiguous nucleotide sequence that starts at the 5' nucleotide of a Fetk transcription start site and ends at the last nucleotide immediately 5' to the first nucleotide of the start codon of said Fetk coding region; and

b. comprises at least 20 contiguous nucleotides.

6. The nucleic acid sequence cassette according to Claim 5, wherein said Fetk nucleic acid sequence lacks a Fur-binding site;

preferably wherein said Fur-binding site consists of or comprises a nucleic acid sequence having the sequence as defined by SEQ ID NO: 22

7. The nucleic acid sequence cassette according to Claim 5 or Claim 6, wherein said Fetk nucleic acid sequence comprises a nucleic acid sequence and wherein said nucleic acid sequence has at least 80% sequence identity to the nucleic acid sequence of SEQ ID NO: 23.

8. The nucleic acid sequence cassette according to any of Claims 5-7, wherein said Fetk nucleic acid sequence consists of or comprises at least 20, at least 30 or at least 40 contiguous nucleotides and has at least 80% sequence identity to SEQ ID NO: 24.

9. The nucleic acid sequence cassette according to any of Claims 5-8, wherein said Fetk nucleic acid sequence consists of or comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 24.

10. The nucleic acid sequence cassette according to any of Claims 5-9, wherein said Fetk nucleic acid sequence further comprises a fragment of a Fetk coding region, wherein said coding region is defined as the contiguous nucleotide sequence that starts at the 5' nucleotide of the start codon of a Fetk coding region and ends at the 3' nucleotide of the stop codon said Fetk coding region.

1 1 . The nucleic acid sequence cassette according to Claim 10, wherein said fragment of the Fetk coding region consists of or comprises at least 10 or at least 20 contiguous nucleotides and has at least 80% sequence identity to SEQ ID NO: 25.

12. The nucleic acid sequence cassette according to Claim 10 or Claim 1 1 , wherein said Fetk nucleic acid sequence consists of or comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 25.

13. The nucleic acid sequence cassette according to any of Claims 5-12, wherein said nucleic acid sequence consists of or comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 26- 32;

preferably wherein said nucleic acid sequence consists of or comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 29 or SEQ ID NO: 30.

14. A nucleic acid vector comprising the promoter according to any of Claims 1 -4 or comprising the nucleic acid sequence according to any of Claims 5-13; preferably wherein said nucleic acid vector is a plasmid.

15. The nucleic acid sequence cassette according to any of 5-13 or the vector according to Claim 14, wherein said Fetk nucleic acid sequence contains one or two homologous recombination sequences, and wherein said homologous recombination sequence(s) provides a homologous recombination site(s) for in- frame insertion of the promoter according to any of Claims 1 -4 into a Fetk gene present in a bacterial host cell.

16. A method of transforming a bacterial host cell, said method comprising inserting the vector of Claim 14 or Claim 1 5 into said bacterial host cell, and wherein Fetk expression within said bacterial host cell is controlled by the promoter according to any of Claims 1 -4.

17. A bacterial host cell comprising a promoter according to any of Claims 1 -4 or a nucleic acid sequence cassette according to any of Claims 1 -13 or Claim 15, wherein said promoter:

a. is located 5' to a FetA coding region within the host cell;

b. is located in-frame with said FetA coding region within the host cell; and

c. controls expression of FetA within the host cell.

18. A bacterial host cell according to Claim 17, wherein said bacterial host cell is a Neisserial bacterium;

preferably wherein said bacterium is a N. meningitidis or a N. lactamica bacterium.

19. Two or more bacterial host cells according to Claim 18, wherein each of said two or more host cells contains different FetA coding region nucleic acid sequences, and wherein the promoter

a. is located 5' to the FetA coding region within each host cell;

b. is located in-frame with said FetA coding region within each host cell; and

c. controls expression of FetA within each host cell.

20. A method of producing Neisserial outer membrane proteins, said method comprising culturing a bacterial host cell according to Claim 18, and harvesting FetA-containing outer membrane vesicles that are produced by said bacterial host cell from the culture medium.

21 . The method according to Claim 20, wherein two or more Neisserial bacterial host cells according to Claim 19 are cultured, either in the same culture medium or in separate culture media, said method further comprising providing a composition comprising Neisserial FetA-containing outer membrane vesicles, wherein composition comprises first vesicles containing a first FetA protein and second vesicles containing a second FetA protein different from said first FetA protein.

22. The method according to Claim 20 or Claim 21 , further comprising formulation of the outer membrane vesicles to provide a meningitis antigenic composition or vaccine.

23. Use of a promoter according to any of Claims 1 -4 or a nucleic acid sequence cassette according to any of Claims 5-13 or Claim 15 a vector according to Claim 14, for expressing a FetA gene in a host cell bacterium.

24. Use of a bacterial host cell according to any of Claims 17-19, for producing FetA-containing outer membrane vesicles.

25. Use of a bacterial host cell according to any of Claims 17-19, for producing an antigenic composition or meningitis vaccine.

26. Outer membrane vesicles obtainable by a method according to any of Claims 20-22.

27. Outer membrane vesicles obtainable by a method according to any of Claims 20-22, for use as an antigenic composition or as a meningitis vaccine.