WO2012166934A1 - Methods and compositions for the treatment of pain - Google Patents

Abstract

The present disclosure provides compositions and methods for use in the treatment of pain, wherein the compounds useful in such compositions and methods inhibit activity of transient receptor potential cation channel subfamily V member 1 (TRPV1) transcription factors, which in some embodiments may be administered in combination with a compound that modulates the activity of TRPV1.

Description

METHODS AND COMPOSITIONS FOR THE TREATMENT OF PAIN

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority benefit of United States Provisional Patent Application Serial No. 61/492,310, filed June 1, 2011, which application is incorporated herein by reference in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant No. NS038737 awarded by the National Institutes of Health. The government has certain rights in the invention.

INTRODUCTION

[0003] TRPV1 is a non- selective ion channel that can be activated by a wide variety of physical and chemical stimuli. This receptor is found mainly in nociceptive neurons of the peripheral nervous system, and is involved in the transmission and modulation of pain. Due to its involvement in nociception, the TRPV1 receptor is an important target for the development of compounds that may be useful in the treatment of pain. Compounds that modulate the activity of TRPV1 include agonists and antagonists. Antagonists of TRPV1 reduce pain by blocking or inhibiting the activity of the receptor itself. Agonists, in contrast, activate TRPV1 and, after prolonged exposure, lead to a decrease in its activity. This process, referred to as desensitization, leads to alleviation of pain. Accordingly, compounds that modulate TRPV1 activity, or combinations thereof, may have application in methods for treating and reducing pain in patients.

[0004] Recent studies have revealed that expression of the rat TRPV1 gene in neuronal cells is driven by a dual promoter system with multiple regulatory sites. Transcription factors including specificity protein 1 (Spl), Sp3, and Sp4 interact with the TRPV1 promoter system and play a key role in regulating the expression of the TRPV1 protein itself. Compounds that affect these transcription factors could inhibit expression of TRPV1 and could therefore find application in the treatment of pain as well. Such compounds could be used alone or in combination with other compounds, such as TRPV1 activity-modulating agents, for the treatment of pain. SUMMARY

[0005] The present disclosure provides compositions and methods for use in the treatment of pain, wherein the compounds useful in such compositions and methods inhibit activity of transient receptor potential cation channel subfamily V member 1 (TRPVl) transcription factors, which in some embodiments may be administered in combination with a compound that modulates the activity of TRPVl.

[0006] In some embodiments, the present disclosure relates to a method of treating pain, the method including administering to a subject in need of treatment a first compound that inhibits activity of a transient receptor potential cation channel subfamily V member 1 (TRPVl) transcription factor, and a second compound that that modulates TRPVl activity, wherein the administering is effective to treat pain in the subject. In some embodiments, the first compound and the second compound are co-formulated.

[0007] In some embodiments, the present disclosure relates to methods of treating pain, wherein the first compound is mithramycin or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure relates to methods of treating pain wherein the first compound is a mithramycin A-type derivative of mithramycin or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure relates to methods of treating pain wherein the first compound is a mithramycin A or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure relates to methods of treating pain wherein the first compound is a mithramycin SK- or SDK-type derivative of mithramycin or a pharmaceutically acceptable salt thereof. In some embodiments, the first compound is mithramycin SK or a pharmaceutically acceptable salt thereof. In some embodiments, the first compound is mithramycin SDK or a pharmaceutically acceptable salt thereof.

[0008] In some embodiments, the present disclosure relates to methods of treating pain wherein the first compound is diclofenac or a pharmaceutically acceptable salt thereof. In some embodiments, the first compound is tolfenamic acid or a pharmaceutically acceptable salt thereof.

[0009] In some embodiments, the present disclosure relates to methods of treating pain wherein the first compound is a nucleic acid agent that reduces expression of specificity protein 1 (Spl), Sp3, or Sp4. [0010] In some embodiments, the present disclosure relates to methods of treating pain wherein the second compound is curcumin or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure relates to methods of treating pain wherein the second compound is eugenol or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure relates to methods of treating pain wherein the second compound is capsaicin or a pharmaceutically acceptable salt thereof.

[0011] In some embodiments, the present disclosure relates to methods of treating pain wherein the first compound is mithramycin or a mithramycin derivative (e.g., mithramycin A-type compounds, e.g., mithramycin A or mithramycin SK- or SDK-type compounds, e.g.,

mithramycin SK or mithramycin SDK) or a pharmaceutically acceptable salt thereof, and the second compound is eugenol or a pharmaceutically acceptable salt thereof.

[0012] In some embodiments, the present disclosure relates to methods of treating pain wherein a compound or combination of compounds is administered by a drug delivery device comprising a substrate in or on which the first compound and/or second compound are disposed. In some embodiments, the first compound and/or the second compound are formulated for sustained release.

[0013] In some embodiments, a compound or combination of compounds is administered orally.

In some embodiments, oral administration involves orally administering a drug delivery device to a subject. In some embodiments, a compound or combination of compounds is administered locally to a tissue. In some embodiments, the local administration is to a wound site. In some embodiments, the wound site is a surgical wound site.

[0014] In some embodiments, the present disclosure relates to methods for treating pain, wherein a compound or combination of compounds is administered by implanting a drug delivery device into a subject.

[0015] In some embodiments, the present disclosure relates to methods for treating pain in a subject, the methods comprising administering a nucleic acid agent that reduces expression of Spl, Sp3, or Sp4 to a subject, wherein said administering is effective to treat pain in the subject.

[0016] In some embodiments, the nucleic acid compound that reduces expression of Spl, Sp3, or Sp4 is administered by a drug delivery device comprising a substrate in or on which the nucleic acid agent is disposed. In some embodiments, the nucleic acid agent is formulated for sustained release. [0017] In some embodiments, the present disclosure relates to a method for treating pain, the method comprising administering mithramycin or a mithramycin derivative (e.g., mithramycin A-type compounds, e.g., mithramycin A or mithramycin SK- or SDK-type compounds, e.g., mithramycin SK or mithramycin SDK) or a pharmaceutically acceptable salt thereof to a subject, wherein the administering is effective to treat pain.

[0018] In some embodiments, the mithramycin or mithramycin derivative is administered by a drug delivery device comprising a substrate in or on which the mithramycin or mithramycin derivative is disposed. In some embodiments, the mithramycin or mithramycin derivative is formulated for sustained release.

[0019] In some embodiments, the present disclosure relates to methods of identifying a test compound, the methods comprising contacting a cell that expresses a gene selected from an Spl, Sp3, or Sp4 gene with the test compound and detecting a level of expression of the gene, wherein a decrease in the level of expression of the gene in the presence of the test compound compared to a level of expression of the gene in the absence of the test compound indicates that the test compound has use in the treatment of pain. In some embodiments, the test compound is a compound that inhibits the activity of a cyclooxygenase 2 (COX-2), and contacting the cell with the test compound results in a desirable level of expression of the Spl, Sp3, or Sp4 gene.

[0020] In some embodiments, the present disclosure provides compositions that include a first compound that inhibits activity of a transient receptor potential cation channel subfamily V member 1 (TRPV1) transcription factor and a second compound that modulates TRPV1 activity.

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] FIG. 1 shows a composite ethidium bromide- stained agarose gel showing evidence of PCR amplified products directed by oligodeoxynucleotide primers spanning TRPV1 GC-box "a" and "b" (top) using template DNA provided as: control input chromatin DNA without immunoprecipitation (Inp), chromatin immunoprecipitated with antisera against transcription factors (Spl) or (Sp4), chromatin immunoprecipitated with non-immune (IgG), absence of chromatin template - primers only (Pr). Plus sign (+) denotes successful amplification of expected PCR product (arrow). There was no evidence in vivo of Sp3 binding (not shown). Each lane represents 1 of at least 3 independent ChIP assays. Molecular size ladder: kilobase (kb). [0022] FIGS. 2A-2D show a comparison of P2-promoter activity in DRG neurons + NGF (2A,2C) or +/- NGF-treated PC 12 cells (2B, 2D) directed by: empty pGL3 reporter plasmid (pGL-E); control reporter plasmid (0.4kb); 0.4kb reporter with deletion of GC-box "a" (Del-a); 0.4kb reporter with deletion of GC-box "b" (Del-b) or deletion of both GC-box "a & b". Deletion of GC-box "a" resulted in a complete loss of promoter activity when compared with the (0.4kb) P2-promoter control in DRG neurons and NGF treated PC12 cells. Deletion of GC-box "b" directed an inconsistent change in promoter activity in DRG neurons and NGF treated PC 12 cells. Concurrent loss of GC-box a & b resulted in the lowest measurable promoter activity. When identical experiments were repeated under conditions of human Spl cDNA (2A, 2B), or human Sp4 cDNA over-expression, P2-promoter activity continued to be lost following deletion of GC-box "a" or GC-box a & b. Loss of GC-box "b" under conditions of Spl (2A, 2B) or Sp4 (2C, 2D) over-expression showed a small decrease of P2-promoter activity that was most evident in NGF treated PC12 cells. Diagram (left) indicates location of GC-box deletions and start site of transcription for P2-promoter expressing firefly luciferase (Luc). Error bars SEM (n=3) quadruplicate measures. Significant differences: ANOVA (***) p<0.001; (**); (*) p<0.05.

[0023] FIG. 3 shows that a P2-promoter reporter plasmid (0.4kb) directs an ~8 fold increase in luciferase activity when compared with the empty reporter control (pGL-E). When construct 0.4kb is co-transfected with a plasmid expressing Spl, or Sp3, a significant increase in promoter activity is observed. However, co-transfection of Sp4 or a combination of Spl/Sp3, Spl/Sp4 or Sp3/Sp4 (equal ratios) failed to increase promoter activity beyond what was observed with the 0.4kb alone. Error bars SEM (n=3) triplicate measures. Significant differences: ANOVA (**) p<0.01, (*) p<0.05.

[0024] FIG. 4 shows that a P2-promoter reporter plasmid (0.4kb) directs an ~2 fold increase in luciferase activity when treated with NGF for 48 hours. Treatment with an inhibitor

(mithramycin A) of Spl function that disrupts GC-box / transcription factor binding blocked the NGF-dependent P2-promoter activity. When the experiment was repeated in the presence of co- transfected Spl, the expected increase in activity directed by Spl was dose-dependently inhibited by mithramycin A. Error bars SEM (n=3) triplicate measures. Significant differences: ANOVA (***) p<0.001, (*) p<0.05.

[0025] FIGS. 5A-5B show that co-transfection of Spl-siRNA with the 0.4kb P2-promoter

construct resulted in a significant decrease in promoter activity when compared with co- transfection of the scrambled (scr) siRNA control whereas Sp4-siRNA co-transfection failed to show a decrease (5A). In contrast, both Spl-siRNA and Sp4-siRNA co-transfection experiments showed a significant decrease in NGF treated PC 12 cells (5B). Primary cultures of NGF-treated dorsal root ganglion (DRG) neurons were transfected with either (pGL-E) empty luciferase reporter plasmid; (0.4kb + pBS) Luciferase reporter containing the P2-promoter plus empty siRNA vector pBS/U6; (0.4kb + siRNA-Spl) 0.4 kb plus siRNA construct containing the Spl directed hairpin encoding Spl nucleotides 881-901; (0.4kb + siRNA-Sp4) 0.4 kb plus siRNA construct containing the Sp4 directed hairpin encoding Sp4 nucleotides 1551- 1571. The presence of the scrambled siRNA control plasmid reduced the expected promoter activity of the 0.4kb reporter plasmid in DRG. Co-transfection of the Spl cDNA in PC12 cells (0.4kb + Spl) directed a further increase in P2-promoter activity that was significantly reversed by co- transfection of the Spl-siRNA construct. Error bars SEM (n=3) triplicate measures. Significant differences: ANOVA (*) p< 0.05; (***) p< 0.001.

[0026] FIGS. 6A-6D: FIG. 6A shows the measurement of endogenous levels of rat Spl mRNA in cultured DRG neurons following transfection with empty/PN3 vector (left). Additional expression of an equivalent amount of human form of Spl mRNA was achieved following transfection with hSpl/PN3. FIG. 6B shows that endogenous TRPV1 mRNA levels were increased following over-expression of hSpl in cultured DRG neurons (**) p < 0.005. FIG. 6C shows measurement of control levels of rat Sp4 mRNA in cultured DRG neurons following transfection with empty/PN3 vector (left). Additional expression of an equivalent amount of human form of Sp4 mRNA was also achieved following transfection with hSp4/PN3. FIG. 6D shows that endogenous TRPV1 mRNA levels increased following over-expression of hSp4 in cultured DRG neurons (*). Error bars SEM (n=3) triplicate measures. Two tailed unpaired t-test. Significance: (p <0.05). C_t threshold values were derived from quantitative RT-PCR

amplification of cultured rat DRG neuron RNA.

[0027] FIG. 7 A shows evidence of Spl mRNA knockdown following transfection of siSpl in cultured DRG neurons (*) p < 0.0001) (left). Apparent changes in Sp4 (middle) or TRPV1 mRNA (right) were not significant (ns).

[0028] FIG. 7B shows that transfection of siSp4 resulted in an apparent knockdown Spl, Sp4 and TRPV1 mRNA (n=2). Combined knockdown of Spl + Sp4 using an equal ratio (1:1) of siSpl/siSp4 resulted in the most consistent knockdown of endogenous TRPV1 mRNA. Error bars SEM (n=3) triplicate measures. Two tailed unpaired t-test. Significant differences: (***) p<0.0001. RQ values of siRNA treated DRGs are compared relative to the RQ values of scrambled controls which represent baseline amounts of Spl, Sp4 or TRPV1 mRNA following transfection of a scrambled siRNA or Spx control vector.

[0029] FIG. 8 shows that the TRPV1 P2-promoter contains two tandem GC-box binding sites adjacent to the start site of TRPV1 transcription (arrow). GC-box "a" was found to be essential for transcriptional activation and appears to be the primary regulatory site in the P2-promoter and is co-regulated by factors Spl and Sp4. Depending on the cellular environment and potential state of transcription factor abundance / modification, this model proposes factor Sp4 playing a dominant role in the activation of TRPV1 transcription amongst the Spl-like factors examined. One type of transcription factor activation may arise from the activity of exogenous products of inflammation, such as NGF. Spl, Sp4 and/or other members of the Spl-like family (Spx) may also bind to GC-box region "b" providing additional modulation and full transcriptional activation. Classically transcriptional regulation is dynamic and rapidly responds to intrinsic and extrinsic changes of the cellular milieu. It is envisioned that transcriptional control is directed by a combination of protein modifications and/or formation of a multi-protein transcription factor complexes to attract and activate RNA polymerase II (not shown). Differing "sizes" of transcription factors represent their relative contribution to activation of TRPV1 transcription.

[0030] FIG. 9 shows paw thickness (mm) measurements 3, 6 and 10 days following saline or CFA injected into the left hind paw of control (B6) or Sp4 +/- mice.

[0031] FIG. 10 shows paw withdrawal latency (seconds), indicating that Sp4 +/- mice fail to develop thermal hyperalgesia following CFA injection into the left hind paw (n=6).

[0032] FIG. 11 shows intracellular calcium concentration measurements taken from cells

isolated from control B6 and Sp4 +/- mice.

[0033] FIG. 12 shows the percentage of sensory neurons responding to capsaicin in control B6 and Sp4+/- mice.

[0034] FIG. 13 shows the percentage of sensory neurons responding to capsaicin in control B6 and Sp4+/- mice. The top (white) portion of each bar indicates neurons that were unresponsive to capsaicin treatment, and the bottom (shaded) portion of each bar indicates neurons that were responsive to capsaicin treatment. [0035] FIG. 14 shows quantitative RT-PCR measurements of transcription factors Spl, Sp4 and the capsaicin receptor- TRPV1 mRNA in primary cultures of DRG neurons following treatment of mithramycin A (50 nM) for 24 hours. RQ - relative quantification of mRNA content normalized to G6PDH gene expression. A value of 1 signifies control levels observed under 0.1% DMSO (vehicle control) exposure.

[0036] FIG. 15 shows the capsaicin response of individual neuronal cells treated with 0.1%

DMSO (vehicle control) or with 50 nM mithramycin A.

[0037] FIG. 16 shows pooled results of the neuronal cells treated with 0.1% DMSO (vehicle control) or with 50 nM mithramycin A.

[0038] FIG. 17 shows pooled percentage results for the number of sensory neurons responding to capsaicin under different conditions. Cells were treated with 0.1% DMSO (vehicle control) or 50 nM mithramycin A and subjected to capsaicin treatment. In the first and second bars from the left, the upper portion of the bar indicates cells that were unresponsive to capsaicin treatment, and the lower portion of the bar indicates cells that were responsive to capsaicin treatment. Cells exposed to 0.1% DMSO (vehicle control) are shown in the first bar from the left. Cells treated with 50 nM mithramycin A are shown in the second bar from the left. The percentage of cells responding to capsaicin treatment under each condition (0.1% DMSO (vehicle control) or 50 nM mithramycin A) is shown in the third and fourth bars from the left.

[0039] FIG. 18 shows the results from DRG neurons that were transfected with TRPV1

promoter-P2 under control conditions (DMSO alone) versus tolfenamic acid (50 μΜ) resulting in a decrease in promoter activity.

[0040] FIG. 19 shows the results from DRG neurons cultured in the absence (DMSO) versus presence of tolfenamic acid (TA). The presence of TA resulted in a decrease in endogenous mRNA content encoding Spl, Sp4 and TRPV1.

[0041] FIG. 20 shows a dose-dependent decrease of TRPV1 mRNA in cultured DRG neurons following increasing concentrations of tolfenamic acid.

[0042] FIG. 21 shows that NGF / Spl-dependent promoter activity in PC12 cells is decreased by diclofenac. DRG cultures were studied following 72 hr exposure to non-steroidal antiinflammatory drugs (NSAIDS) (n=3, triplicate measures) ANOVA ** p<0.001; *** p<0.0001.

[0043] FIG. 22 shows the number of sensory neurons responding to capsaicin treatment under different concentrations of eugenol. Cells were exposed to 0.1% DMSO (vehicle control), 300 μΜ eugenol, or 600 μΜ eugenol, and then subjected to capsaicin treatment. In the first three bars from the left, the upper portion of the bar indicates cells that were unresponsive to capsaicin treatment, and the lower portion of the bar indicates cells that were responsive to capsaicin treatment. The fourth, fifth, and sixth bars from the left indicate the percentage of neurons that responded to capsaicin treatment under the indicated concentrations of eugenol (or 0.1% DMSO vehicle control).

[0044] FIG. 23 shows the level of TRPV1 mRNA measured at 24 hours for cells treated with DMSO, or a concentration of mithramycin A ranging from 1 nM to 50 nM.

[0045] FIG. 24 shows capsaicin-induced calcium responses for individual cells treated with DMSO, 600 μΜ eugenol, or 1 mM eugenol for 45 minutes.

[0046] FIG. 25 shows a decrease in the magnitude of capsaicin-induced responses in cells treated with DMSO, 600 μΜ eugenol, or 1 mM eugenol for 45 minutes.

[0047] FIG. 26 shows the number of sensory neurons responding to capsaicin treatment under different concentrations of eugenol. Cells were exposed to 0.1% DMSO (vehicle control), 600 μΜ eugenol, or 1 mM eugenol for 45 minutes, and then subjected to capsaicin treatment. In the first three bars from the left, the upper portion of the bar indicates cells that were unresponsive to capsaicin treatment, and the lower portion of the bar indicates cells that were responsive to capsaicin treatment. The fourth, fifth, and sixth bars from the left indicate the percentage of neurons that responded to capsaicin treatment under the indicated concentrations of eugenol (or 0.1% DMSO vehicle control).

[0048] FIG. 27 shows a UV-Vis spectroscopy standard curve of the absorbance at 218 nm

measured as a function of eugenol concentration in micromoles in phosphate-buffered saline.

[0049] FIG. 28 shows an HPLC chromatogram for a sample of 300 μΜ eugenol, indicating a peak elution time of 26.7 minutes.

[0050] FIG. 29 shows an HPLC chromatogram for a supernatant sample taken from a solution of phosphate-buffered saline in which eugenol-containing polymeric delivery devices had been incubated with agitation at room temperature for 40 minutes. The peak elution time measured was 26.8 minutes, indicating that the identity of the compound was eugenol.

[0051] FIG. 30 shows an HPLC chromatogram for a sample containing 5 μΜ mithramycin A, indicating a peak elution time of 15.4 minutes. [0052] FIG. 31 shows an HPLC chromatogram for a supernatant sample taken from a solution of phosphate-buffered saline in which mithramycin A-containing polymeric delivery devices had been incubated at room temperature for 98 hours. The peak elution time measured was 15.5 minutes, indicating that the identity of the compound was mithramycin A.

[0053] FIG. 32A shows a Western blot of DRG protein extracts derived from control (wild type) mice (B6) versus knock down (Sp4 +/-) mice stained with an antisera directed against TRPVl (upper arrow) and an antisera against GAPDH (lower arrow) to serve as protein loading reference control.

[0054] FIG. 32B shows a bar graph of normalized intensity of TRPVl-like protein expression based on the expected TRPVl protein band of ~90kDa (upper arrow) using a C-terminal directed TRPVl antisera and quantitated with infrared fluorescent secondary antibodies. TRPVl-like protein expression was normalized using GAPDH (lower arrow) and the resultant ratio plotted as a normalized integrated intensity. Each bar represents the mean (+/- SEM) of four independent B6 and Sp4 +/- mice.

[0055] FIG. 33A shows a bar graph indicating the % of TRPVl positive immune- staining

sensory neurons in left Lumbar L4-5 Dorsal Root Ganglion tissue sections derived from B6 control mice six days after the left hind paw was injected with either saline (white bar) or the inflammatory agent Complete Freunds Adjuvant (CFA) (hatched bar). CFA injection of the left hind paw of B16 resulted in an increase in the number of larger (300-400; >400 sq microns) DRG neurons positively staining for TRPVl.

[0056] FIG. 33B shows a bar graph indicating the % of TRPVl immune - positive neurons in sensory neurons from left Lumbar L4-5 Dorsal Root Ganglion tissue sections derived from Sp4 +/- mice six days after the left hind paw was injected with either saline (white bar) or the inflammatory agent Complete Freunds Adjuvant (CFA) (hatched bar). Following CFA injection into the left hindpaw of Sp4 +/- mice, there was no increase in the number of larger TRPVl positive sensory neurons.

[0057] FIGS. 34A-F show scanning electron micrograph (SEM) images and corresponding pore size histograms of polycaprolactone (PCL)/gelatin thin films after five days incubation in PBS.

[0058] FIGS. 35A-B show graphs of the porosity and mass loss of PCL/gelatin thin films after incubation in PBS. [0059] FIGS. 36A-C show a schematic of an exemplary multilayer thin film device (A) and side- profile SEM images of microporous (B) and nanoporous thin film layers (C).

[0060] FIGS. 36D-G show additional configurations of exemplary multilayer thin film devices.

[0061] FIGS. 37A-E illustrate a thin film fabrication procedure.

[0062] FIGS. 37F-G show scanning electron microscope (SEM) images of a typical

nano structured PCL film.

[0063] FIG. 38A shows the wells of a non-porous PCL thin film that are filled with a compound.

[0064] FIG. 38B shows the dimensions of an exemplary multilayer thin film device.

[0065] FIGS. 39A-C show a furled thin film device (A), and an unfurled device (B), that has a thin form factor (C).

[0066] FIG. 40 illustrates the release kinetics of a small molecule (Rapamycin, molecular weight 914.172 Da) from a nanoporous thin film device (solid circles), non-porous device (solid squares) and from a PCL thin film with drug mixed into the polymer film (solid triangles). The nanoporous thin film device consisted of a supported nanostructured film (nanostructured pores of 20-40 nm and support layer pores of 1-3 microns). The non-porous film contained Rapamycin in a central reservoir. For PCL thin film, the small molecule is mixed within the polymer itself rather than contained in a reservoir.

[0067] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0068] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention. [0069] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

[0070] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "the protein" includes reference to one or more proteins, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0071] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

DEFINITIONS

[0072] The following terms have the following meanings unless otherwise indicated. Any

undefined terms have their art recognized meanings.

[0073] "Transient receptor potential cation channel subfamily V member 1" and "TRPV1" as used herein refers to a receptor for capsaicin and which is a non-selective cation channel structurally related to members of the transient receptor potential (TRP) family of ion channels. This receptor is also activated by increases in temperature in the noxious range, indicating it functions as a transducer of painful thermal stimuli in vivo. Nucleic acid and amino acid sequences of TRPV1 are known in the art, see, e.g., GenBank Accession Nos. NM_080706, NM_080705, NM_080704, NM_018727 (human). [0074] "Transient receptor potential cation channel subfamily V member 1 transcription factor" and "TRPVl TF" as used herein refers to the transcription factors Spl, Sp3 and Sp4.

[0075] "Spl" refers to "specificity protein 1", a transcription factor which, as shown herein, promotes expression of TRPVl. Nucleic acid and amino acid sequences of Spl are known in the art, see, e.g., GenBank Accession Nos. NM_138473; NM_003109; BC062539 (human);

NM_012655 (rat); and NM_013672 (mouse).

[0076] "Sp3" refers to "specificity protein 3", a transcription factor which, as shown herein, promotes expression of TRPVl. Nucleic acid and amino acid sequences of Sp3 are known in the art, see, e.g., GenBank Accession Nos. NM_003111.4; NM_001017371.4;, AY070137.1;

NM_001172712; (human); XM_002729171, XM_002726189 (rat); and NM_001018042; NM_001098425 (mouse).

[0077] "Sp4" refers to "specificity protein 4", a transcription factor which, as shown herein, promotes expression of TRPVl. Nucleic acid and amino acid sequences of Sp4 are known in the art, see, e.g., GenBank Accession Nos. NM_003112, EU446903, BC109301, BC109300, BC015512, (human); NM_012761 (rat); and NM_009239; NM_001166385, U62522 (mouse).

[0078] The term "inhibit activity" or "inhibitor" as used herein with reference to activity of a compound (e.g., as in the context of a compound that inhibits activity of a TRPVl transcription factor) means a reduction in activity, which may result from, for example, a reduction in expression (e.g., reduction in transcription or translation) of a gene product, an increase in degradation of a gene product, interference of interaction of a gene product with its binding partner (e.g., interference with binding of a receptor to its endogenous ligand, interference with binding of a transcription factor to is binding site in its target nucleic acid), and the like. For example, compounds that inhibit activity of a TRPVl transcription factor include compounds that decrease expression of a TRPVl transcription factor, compounds that promote degradation of a TRPVl transcription factor, and compounds that inhibit binding of a TRPVl transcription factor to a promoter sequence to facilitate TRPVl expression.

[0079] The term "activity-modulating agent" used herein means any agent that is capable of altering the normal activity of or otherwise interfering with the normal operation of a TRPVl receptor molecule. Activity-modulating agents include agents that act as agonists to the TRPVl receptor as well as agents that act as antagonists to the TRPVl receptor. [0080] The term "expression" used in the context of expression of a gene product refers to transcription and translation of the gene product from its encoding nucleic acid.

[0081] The term "activity-modulating agent" as used herein means any agent that is capable of altering the normal activity of or otherwise interfering with the normal operation of a TRPV1 receptor molecule. Activity-modulating agents include agents that act as agonists to the TRPV1 receptor as well as agents that act as antagonists to the TRPV1 receptor.

[0082] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Non-limiting examples of polynucleotides include linear and circular nucleic acids, messenger RNA (mRNA), cDNA, recombinant polynucleotides, vectors, probes, and primers.

[0083] "Derived from" in the context of a chemical compound is meant to indicate that the particular chemical compound is produced by an organism or found in nature and has been isolated and/or purified, and is not meant to be limiting as to the source or method in which the chemical compound is made.

[0084] "Isolated" refers to a compound of interest (e.g., eugenol) that, if naturally occurring, is in an environment different from that in which it may naturally occur. Where a compound is not naturally occurring, "isolated" indicates the compound has been separated from an environment in which it was made by synthetic means.

[0085] "Substantially pure" indicates that a compound makes up greater than about 50% of the total content of the composition. For example, a "substantially pure" chemical compound refers to compositions in which at least 75%, at least 85%, at least 90% or more of the total composition is the compound of interest (e.g. 95%, 98%, 99%, greater than 99%), of the total composition. The compound can make up greater than about 90%, or greater than about 95% of the total composition.

[0086] The term "binding" refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, and ionic and/or hydrogen-bond interactions, including interactions such as salt bridges and water bridges.

[0087] By "treatment" is meant that at least an amelioration of the symptoms associated with the condition afflicting the host is achieved, where amelioration refers to at least a reduction in the magnitude of a parameter, e.g., symptom, associated with the condition being treated. As such, treatment includes situations where the condition, or at least symptoms associated therewith, are reduced or avoided. Thus treatment includes: (i) prevention, that is, reducing the risk of development of pain, including causing a selected level of pain not to develop, e.g., preventing onset of pain to avoid surpassing an undesired pain threshold; (ii) inhibition, that is, arresting the development or further development of a painful state, e.g., mitigating or completely inhibiting pain.

[0088] The term "wound site" as used herein refers to a portion of a subject's body where a wound has been inflicted (e.g., by accident (e.g., trauma) or intentionally (e.g., by surgery)), and includes the area immediately adjacent to the inflicted wound. Wound sites, which include surgical wound sites, may be of any size or shape. Examples of surgical wounds include, but are not limited to, those resulting from midline incision, median sternotomy, posterolateral thoracotomy, anterolateral thoracotomy, and the like.

[0089] The term "sustained release" as used herein refers to a dosage form that is adapted to release a compound or combination of compounds at a predetermined rate for a specific period of time. This can be achieved by formulating a compound or mixture of compounds with components such as liposomes, polymers (e.g., hydrogels), and the like. Sustained release formulations may comprise mixtures of a compound with one or more polymers, and may also comprise formulations in which a compound is conjugated to one or more polymers.

[0090] "Alkyl" refers to monovalent saturated aliphatic hydrocarbyl groups having from 1 to 10 carbon atoms and preferably 1 to 6 carbon atoms. This term includes, by way of example, linear and branched hydrocarbyl groups such as methyl (CH₃-), ethyl (CH₃CH₂-), n-propyl

(CH₃CH₂CH₂-), isopropyl ((CH₃)₂CH-), n-butyl (CH₃CH₂CH₂CH₂-), isobutyl ((CH₃)₂CHCH₂-), sec-butyl ((CH₃)(CH₃CH₂)CH-), t-butyl ((CH₃)₃C-), n-pentyl (CH₃CH₂CH₂CH₂CH₂-), and neopentyl ((CH₃)₃CCH₂-).

[0091] The term "substituted alkyl" refers to an alkyl group as defined herein wherein one or more carbon atoms in the alkyl chain have been optionally replaced with a heteroatom such as -0-, -N-, -S-, -S(0)_n- (where n is 0 to 2), -NR- (where R is hydrogen or alkyl) and having from 1 to 5 substituents selected from the group consisting of alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, -S0₂-aryl, -S0₂-heteroaryl, and -NR^aR^b, wherein R and R may be the same or different and are chosen from hydrogen, optionally substituted alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl and heterocyclic.

[0092] "Alkylene" refers to divalent aliphatic hydrocarbyl groups preferably having from 1 to 6 and more preferably 1 to 3 carbon atoms that are either straight-chained or branched, and which are optionally interrupted with one or more groups selected from -0-, -NR¹⁰-, -NR¹⁰C(O)-, - C(0)NR¹⁰- and the like. This term includes, by way of example, methylene (-CH₂-), ethylene (-CH₂CH₂-), n-propylene (-CH₂CH₂CH₂-), iso-propylene (-CH₂CH(CH₃)-), (-C(CH₃)₂CH₂CH₂-), (-C(CH₃)₂CH₂C(0)-), (-C(CH₃)₂CH₂C(0)NH-), (-CH(CH₃)CH₂-), and the like.

[0093] "Substituted alkylene" refers to an alkylene group having from 1 to 3 hydrogens replaced with substituents as described for carbons in the definition of "substituted" below.

[0094] The term "alkane" refers to alkyl group and alkylene group, as defined herein.

[0095] The term "alkylaminoalkyl", "alkylaminoalkenyl" and "alkylaminoalkynyl" refers to the groups RNHR - where R is alkyl group as defined herein and R is alkylene, alkenylene or alkynylene group as defined herein.

[0096] The term "alkaryl" or "aralkyl" refers to the groups -alkylene- aryl and -substituted

alkylene-aryl where alkylene, substituted alkylene and aryl are defined herein.

[0097] "Alkoxy" refers to the group -O-alkyl, wherein alkyl is as defined herein. Alkoxy

includes, by way of example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, t-butoxy, sec- butoxy, n-pentoxy, and the like. The term "alkoxy" also refers to the groups alkenyl-O-, cycloalkyl-O-, cycloalkenyl-O-, and alkynyl-O-, where alkenyl, cycloalkyl, cycloalkenyl, and alkynyl are as defined herein.

[0098] The term "substituted alkoxy" refers to the groups substituted alkyl-O-, substituted

alkenyl-O-, substituted cycloalkyl-O-, substituted cycloalkenyl-O-, and substituted alkynyl-O- where substituted alkyl, substituted alkenyl, substituted cycloalkyl, substituted cycloalkenyl and substituted alkynyl are as defined herein.

[0099] The term "alkoxyamino" refers to the group -NH-alkoxy, wherein alkoxy is defined

herein. [00100] The term "haloalkoxy" refers to the groups alkyl-O- wherein one or more hydrogen atoms on the alkyl group have been substituted with a halo group and include, by way of examples, groups such as trifluoromethoxy, and the like.

[00101] The term "haloalkyl" refers to a substituted alkyl group as described above, wherein one or more hydrogen atoms on the alkyl group have been substituted with a halo group. Examples of such groups include, without limitation, fluoroalkyl groups, such as trifluoromethyl, difluoromethyl, trifluoroethyl and the like.

[00102] The term "alkylalkoxy" refers to the groups -alkylene-O-alkyl, alkylene-O-substituted alkyl, substituted alkylene-O-alkyl, and substituted alkylene-O-substituted alkyl wherein alkyl, substituted alkyl, alkylene and substituted alkylene are as defined herein.

[00103] The term "alkylthioalkoxy" refers to the group -alkylene-S-alkyl, alkylene- S- substituted alkyl, substituted alkylene-S-alkyl and substituted alkylene-S-substituted alkyl wherein alkyl, substituted alkyl, alkylene and substituted alkylene are as defined herein.

[00104] "Alkenyl" refers to straight chain or branched hydrocarbyl groups having from 2 to 6 carbon atoms and preferably 2 to 4 carbon atoms and having at least 1 and preferably from 1 to 2 sites of double bond unsaturation. This term includes, by way of example, bi- vinyl, allyl, and but-3-en-l-yl. Included within this term are the cis and trans isomers or mixtures of these isomers.

[00105] The term "substituted alkenyl" refers to an alkenyl group as defined herein having from 1 to 5 substituents, or from 1 to 3 substituents, selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO- substituted alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, -S0₂- substituted alkyl, -S0₂-aryl and - S0₂-heteroaryl.

[00106] "Alkynyl" refers to straight or branched monovalent hydrocarbyl groups having from 2 to 6 carbon atoms and preferably 2 to 3 carbon atoms and having at least 1 and preferably from 1 to 2 sites of triple bond unsaturation. Examples of such alkynyl groups include acetylenyl

(-C≡CH), and propargyl (-CH₂C≡CH). [00107] The term "substituted alkynyl" refers to an alkynyl group as defined herein having from 1 to 5 substituents, or from 1 to 3 substituents, selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO- substituted alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, -S0₂- substituted alkyl, -S0₂-aryl, and - S0₂-heteroaryl.

[00108] "Alkynyloxy" refers to the group -O-alkynyl, wherein alkynyl is as defined herein.

Alkynyloxy includes, by way of example, ethynyloxy, propynyloxy, and the like.

[00109] "Acyl" refers to the groups H-C(O)-, alkyl-C(O)-, substituted alkyl-C(O)-, alkenyl-C(O)-, substituted alkenyl-C(O)-, alkynyl-C(O)-, substituted alkynyl-C(O)-, cycloalkyl-C(O)-, substituted cycloalkyl-C(O)-, cycloalkenyl-C(O)-, substituted cycloalkenyl-C(O)-, aryl-C(O)-, substituted aryl-C(O)-, heteroaryl-C(O)-, substituted heteroaryl-C(O)-, heterocyclyl-C(O)-, and substituted heterocyclyl-C(O)-, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein. For example, acyl includes the "acetyl" group CH₃C(0)-.

[00110] "Acylamino" refers to the groups -NR²⁰C(O)alkyl, -NR²⁰C(O)substituted alkyl, N

R²⁰C(O)cycloalkyl, -NR²⁰C(O)substituted cycloalkyl, -NR²⁰C(O)cycloalkenyl,

-NR²⁰C(O)substituted cycloalkenyl, -NR²⁰C(O)alkenyl, -NR²⁰C(O)substituted alkenyl,

-NR²⁰C(O)alkynyl, -NR²⁰C(O)substituted alkynyl, -NR²⁰C(O)aryl, -NR²⁰C(O)substituted aryl, -NR²⁰C(O)heteroaryl, -NR²⁰C(O)substituted heteroaryl, -NR²⁰C(O)heterocyclic, and

-NR 20 C(0)substituted heterocyclic, wherein R 20 is hydrogen or alkyl and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[00111] "Aminocarbonyl" or the term "aminoacyl"_refers to the group -C(0)NR²¹R²², wherein R²¹ and R 22 independently are selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic and where R 21 and R 22 are optionally joined together with the nitrogen bound thereto to form a heterocyclic or substituted heterocyclic group, and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[00112] The term "alkoxycarbonylamino" refers to the group -NRC(0)OR where each R is

independently hydrogen, alkyl, substituted alkyl, aryl, heteroaryl, or heterocyclyl wherein alkyl, substituted alkyl, aryl, heteroaryl, and heterocyclyl are as defined herein.

[00113] The term "acyloxy" refers to the groups alkyl-C(0)0-, substituted alkyl-C(0)0-,

cycloalkyl-C(0)0-, substituted cycloalkyl-C(0)0-, aryl-C(0)0-, heteroaryl-C(0)0-, and heterocyclyl-C(0)0- wherein alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, aryl, heteroaryl, and heterocyclyl are as defined herein.

[00114] "Aminosulfonyl" refers to the group -S0₂NR²¹R²², wherein R²¹ and R²² independently are selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and where R 21 and R 22 are optionally joined together with the nitrogen bound thereto to form a heterocyclic or substituted heterocyclic group and alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic are as defined herein.

[00115] "Sulfonylamino" refers to the group -NR²¹S0₂R²², wherein R²¹ and R²² independently are selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic and where R 21 and R 22 are optionally joined together with the atoms bound thereto to form a heterocyclic or substituted heterocyclic group, and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[00116] "Aryl" or "Ar" refers to a monovalent aromatic carbocyclic group of from 6 to 14 carbon atoms having a single ring (e.g., phenyl) or multiple condensed rings (e.g., naphthyl or anthryl) which condensed rings may or may not be aromatic, provided that the point of attachment is through an atom of the aromatic aryl group. This term includes, by way of example, phenyl and naphthyl. Unless otherwise constrained by the definition for the aryl substituent, such aryl groups can optionally be substituted with from 1 to 5 substituents, or from 1 to 3 substituents, selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxylalkyl, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, -S0₂-substituted alkyl, -S0₂-aryl, -S0₂-heteroaryl and trihalomethyl.

[00117] "Aryloxy" refers to the group -O-aryl, wherein aryl is as defined herein, including, by way of example, phenoxy, naphthoxy, and the like, including optionally substituted aryl groups as also defined herein.

[00118] "Amino" refers to the group -NH₂.

[00119] The term "substituted amino" refers to the group -NRR where each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, cycloalkenyl, substituted cycloalkenyl, alkynyl, substituted alkynyl, aryl, heteroaryl, and heterocyclyl provided that at least one R is not hydrogen.

[00120] The term "azido" refers to the group -N₃.

[00121] "Carboxyl," "carboxy" or "carboxylate" refers to -C0₂H or salts thereof.

[00122] "Carboxyl ester" or "carboxy ester" or the terms "carboxyalkyl" or "carboxylalkyl" refers to the groups -C(0)0-alkyl, -C(0)0-substituted alkyl, -C(0)0-alkenyl, -C(0)0-substituted alkenyl, -C(0)0-alkynyl, -C(0)0-substituted alkynyl, -C(0)0-aryl, -C(0)0-substituted aryl, -C(0)0-cycloalkyl, -C(0)0-substituted cycloalkyl, -C(0)0-cycloalkenyl, -C(0)0-substituted cycloalkenyl, -C(0)0-heteroaryl, -C(0)0-substituted heteroaryl, -C(0)0-heterocyclic, and -C(0)0-substituted heterocyclic, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[00123] "(Carboxyl ester)oxy" or "carbonate" refers to the groups -0-C(0)0-alkyl,

-0-C(0)0-substituted alkyl, -0-C(0)0-alkenyl, -0-C(0)0-substituted alkenyl, -0-C(0)0- alkynyl, -0-C(0)0-substituted alkynyl, -0-C(0)0-aryl, -0-C(0)0-substituted aryl, -0-C(0)0- cycloalkyl, -0-C(0)0-substituted cycloalkyl, -0-C(0)0-cycloalkenyl, -0-C(0)0-substituted cycloalkenyl, -0-C(0)0-heteroaryl, -0-C(0)0-substituted heteroaryl, -0-C(0)0-heterocyclic, and -0-C(0)0-substituted heterocyclic, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[00124] "Cyano" or "nitrile" refers to the group -CN.

[00125] "Cycloalkyl" refers to cyclic alkyl groups of from 3 to 10 carbon atoms having single or multiple cyclic rings including fused, bridged, and spiro ring systems. Examples of suitable cycloalkyl groups include, for instance, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl and the like. Such cycloalkyl groups include, by way of example, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like, or multiple ring structures such as adamantanyl, and the like.

[00126] The term "substituted cycloalkyl" refers to cycloalkyl groups having from 1 to 5

substituents, or from 1 to 3 substituents, selected from alkyl, substituted alkyl, alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, -S0₂-substituted alkyl, -S0₂-aryl and -S0₂-heteroaryl. [00127] "Cycloalkenyl" refers to non-aromatic cyclic alkyl groups of from 3 to 10 carbon atoms having single or multiple rings and having at least one double bond and preferably from 1 to 2 double bonds.

[00128] The term "substituted cycloalkenyl" refers to cycloalkenyl groups having from 1 to 5 substituents, or from 1 to 3 substituents, selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, keto, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, - SO-heteroaryl, -S0₂-alkyl, -S0₂- substituted alkyl, -S0₂-aryl and -S0₂-heteroaryl.

[00129] "Cycloalkynyl" refers to non-aromatic cycloalkyl groups of from 5 to 10 carbon atoms having single or multiple rings and having at least one triple bond.

[00130] "Cycloalkoxy" refers to -O-cycloalkyl.

[00131] "Cycloalkenyloxy" refers to -O-cycloalkenyl.

[00132] "Halo" or "halogen" refers to fluoro, chloro, bromo, and iodo.

[00133] "Hydroxy" or "hydroxyl" refers to the group -OH.

[00134] "Heteroaryl" refers to an aromatic group of from 1 to 10 carbon atoms and 1 to 4

heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur within the ring. Such heteroaryl groups can have a single ring (e.g., pyridinyl, imidazolyl or furyl) or multiple condensed rings (e.g., indolizinyl, quinolinyl, benzimidazolyl or benzothienyl), wherein the condensed rings may or may not be aromatic and/or contain a heteroatom, provided that the point of attachment is through an atom of the aromatic heteroaryl group. In certain embodiments, the nitrogen and/or sulfur ring atom(s) of the heteroaryl group are optionally oxidized to provide for the N-oxide (N→0), sulfinyl, or sulfonyl moieties. This term includes, by way of example, pyridinyl, pyrrolyl, indolyl, thiophenyl, and furanyl. Unless otherwise constrained by the definition for the heteroaryl substituent, such heteroaryl groups can be optionally substituted with 1 to 5 substituents, or from 1 to 3 substituents, selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxylalkyl, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, -SO-alkyl, - SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, -S0₂- substituted alkyl, -S0₂-aryl and -S0₂-heteroaryl, and trihalomethyl.

[00135] The term "heteroaralkyl" refers to the groups -alkylene-heteroaryl where alkylene and heteroaryl are defined herein. This term includes, by way of example, pyridylmethyl, pyridylethyl, indolylmethyl, and the like.

[00136] "Heteroaryloxy" refers to -O-heteroaryl.

[00137] "Heterocycle," "heterocyclic," "heterocycloalkyl," and "heterocyclyl" refer to a saturated or unsaturated group having a single ring or multiple condensed rings, including fused bridged and spiro ring systems, and having from 3 to 15 ring atoms, including 1 to 4 hetero atoms. These ring atoms are selected from the group consisting of nitrogen, sulfur, or oxygen, wherein, in fused ring systems, one or more of the rings can be cycloalkyl, aryl, or heteroaryl, provided that the point of attachment is through the non-aromatic ring. In certain embodiments, the nitrogen and/or sulfur atom(s) of the heterocyclic group are optionally oxidized to provide for the N- oxide, -S(O)-, or -S0₂- moieties.

[00138] Examples of heterocycles and heteroaryls include, but are not limited to, azetidine,

pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, imidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4- tetrahydroisoquinoline, 4,5,6,7-tetrahydrobenzo[b]thiophene, thiazole, thiazolidine, thiophene, benzo[b]thiophene, morpholinyl, thiomorpholinyl (also referred to as thiamorpholinyl), 1,1- dioxothiomorpholinyl, piperidinyl, pyrrolidine, tetrahydrofuranyl, and the like.

[00139] Unless otherwise constrained by the definition for the heterocyclic substituent, such

heterocyclic groups can be optionally substituted with 1 to 5, or from 1 to 3 substituents, selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -S0₂-alkyl, - S0₂-substituted alkyl, -S0₂-aryl, -S0₂-heteroaryl, and fused heterocycle.

[00140] "Heterocyclyloxy" refers to the group -O-heterocyclyl.

[00141] The term "heterocyclylthio" refers to the group heterocyclic-S-.

[00142] The term "heterocyclene" refers to the diradical group formed from a heterocycle, as defined herein.

[00143] The term "hydroxyamino" refers to the group -NHOH.

[00144] "Nitro" refers to the group -N0₂.

[00145] "Oxo" refers to the atom (=0).

[00146] "Sulfonyl" refers to the group S0₂-alkyl, S0₂- substituted alkyl, S0₂-alkenyl, S0₂- substituted alkenyl, S0₂-cycloalkyl, S0₂- substituted cylcoalkyl, S0₂-cycloalkenyl, S0₂- substituted cylcoalkenyl, S0₂-aryl, S0₂-substituted aryl, S0₂-heteroaryl, S0₂- substituted heteroaryl, S0₂-heterocyclic, and S0₂- substituted heterocyclic, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein. Sulfonyl includes, by way of example, methyl-S0₂-, phenyl-S0₂-, and 4-methylphenyl-S0₂-.

[00147] "Sulfonyloxy" refers to the group -OS0₂-alkyl, OS0₂-substituted alkyl, OS0₂-alkenyl, OS0₂-substituted alkenyl, OS0₂-cycloalkyl, OS0₂-substituted cylcoalkyl, OS0₂-cycloalkenyl, OS0₂-substituted cylcoalkenyl, OS0₂-aryl, OS0₂-substituted aryl, OS0₂-heteroaryl, OS0₂- substituted heteroaryl, OS0₂-heterocyclic, and OS0₂ substituted heterocyclic, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein.

[00148] The term "aminocarbonyloxy" refers to the group -OC(0)NRR where each R is

independently hydrogen, alkyl, substituted alkyl, aryl, heteroaryl, or heterocyclic wherein alkyl, substituted alkyl, aryl, heteroaryl and heterocyclic are as defined herein.

[00149] "Thiol" refers to the group -SH.

[00150] "Thioxo" or the term "thioketo" refers to the atom (=S). [00151] "Alkylthio" or the term "thioalkoxy" refers to the group -S-alkyl, wherein alkyl is as defined herein. In certain embodiments, sulfur may be oxidized to -S(O)-. The sulfoxide may exist as one or more stereoisomers.

[00152] The term "substituted thioalkoxy" refers to the group -S -substituted alkyl.

[00153] The term "thioaryloxy" refers to the group aryl-S- wherein the aryl group is as defined herein including optionally substituted aryl groups also defined herein.

[00154] The term "thioheteroaryloxy" refers to the group heteroaryl-S- wherein the heteroaryl group is as defined herein including optionally substituted aryl groups as also defined herein.

[00155] The term "thioheterocyclooxy" refers to the group heterocyclyl-S- wherein the

heterocyclyl group is as defined herein including optionally substituted heterocyclyl groups as also defined herein.

[00156] In addition to the disclosure herein, the term "substituted," when used to modify a

specified group or radical, can also mean that one or more hydrogen atoms of the specified group or radical are each, independently of one another, replaced with the same or different substituent groups as defined below.

[00157] In addition to the groups disclosed with respect to the individual terms herein, substituent groups for substituting for one or more hydrogens (any two hydrogens on a single carbon can be replaced with =0, =NR 70 , =N-OR 70 , =N₂ or =S) on saturated carbon atoms in the specified group or radical are, unless otherwise specified, -R⁶⁰, halo, =0, -OR⁷⁰, -SR⁷⁰, -NR⁸⁰R⁸⁰, trihalomethyl, -CN, -OCN, -SCN, -NO, -N0₂, =N₂, -N₃, -S0₂R⁷⁰, -S0₂0 M⁺, -S0₂OR⁷⁰, -OS0₂R⁷⁰, -OS0₂0 M⁺, -OS0₂OR⁷⁰, -P(0)(0 )₂(M⁺)₂, -P(O)(OR⁷⁰)O M⁺, -P(0)(OR⁷⁰) ₂, -C(0)R⁷⁰, -C(S)R⁷⁰, -C(NR⁷⁰)R⁷⁰, -C(0)0 M⁺, -C(0)OR⁷⁰, -C(S)OR⁷⁰, -C(O)NR⁸⁰R⁸⁰, -C(NR⁷⁰)NR⁸⁰R⁸⁰,

-OC(0)R⁷⁰, -OC(S)R⁷⁰, -OC(0)0^"M⁺, -OC(0)OR⁷⁰, -OC(S)OR⁷⁰, -NR⁷⁰C(O)R⁷⁰, -NR⁷⁰C(S)R⁷⁰, -NR⁷⁰CO₂ M⁺, -NR⁷⁰CO₂R⁷⁰, -NR⁷⁰C(S)OR⁷⁰, -NR⁷⁰C(O)NR⁸⁰R⁸⁰, -NR⁷⁰C(NR⁷⁰)R⁷⁰ and -NR⁷⁰C(NR⁷⁰)NR⁸⁰R⁸⁰, where R⁶⁰ is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heteroalkyl, heterocycloalkylalkyl, cycloalkylalkyl, aryl, arylalkyl, heteroaryl and heteroarylalkyl, each R⁷⁰ is independently hydrogen or R⁶⁰; each R⁸⁰ is independently R⁷⁰ or alternatively, two R 80' s, taken together with the nitrogen atom to which they are bonded, form a 5-, 6- or 7-membered heterocycloalkyl which may optionally include from 1 to 4 of the same or different additional heteroatoms selected from the group consisting of O, N and S, of which N may have -H or Ci-C₃ alkyl substitution; and each M⁺ is a counter ion with a net single positive charge. Each M⁺ may independently be, for example, an alkali ion, such as K⁺, Na⁺, Li⁺; an ammonium ion, such as ⁺N(R⁶⁰)4; or an alkaline earth ion, such as [Ca²⁺]o.s, [Mg²⁺]o.s, or [Ba²⁺]o.s ("subscript 0.5 means e.g. that one of the counter ions for such divalent alkali earth ions can be an ionized form of a compound of the invention and the other a typical counter ion such as chloride, or two ionized compounds of the invention can serve as counter ions for such divalent alkali earth ions, or a doubly ionized compound of the invention can serve as the counter ion for such divalent alkali earth ions). As specific examples, -NR 80 R 80 is meant to include -NH₂, -NH-alkyl, N-pyrrolidinyl, N-piperazinyl, 4iV-methyl-piperazin-l-yl and N-morpholinyl.

[00158] In addition to the groups disclosed with respect to the individual terms herein, substituent groups for hydrogens on unsaturated carbon atoms in "substituted" alkene, alkyne, aryl and heteroaryl groups are, unless otherwise specified, -R⁶⁰, halo, -0^"M⁺, -OR⁷⁰, -SR⁷⁰, -STV1⁺, -NR⁸⁰R⁸⁰, trihalomethyl, -CF₃, -CN, -OCN, -SCN, -NO, -N0₂, -N₃, -S0₂R⁷⁰, -S0₃ M⁺, -S0₃R⁷⁰, -OS0₂R⁷⁰, -OS0₃ M⁺, -OS0₃R⁷⁰, -P0₃ ^"2(M⁺)₂, -P(O)(OR⁷⁰)O M⁺, -P(O)(OR⁷⁰)₂, -C(0)R⁷⁰, -C(S)R⁷⁰, -C(NR⁷⁰)R⁷⁰, -C0₂ M⁺, -C0₂R⁷⁰, -C(S)OR⁷⁰, -C(O)NR⁸⁰R⁸⁰, -C(NR⁷⁰)NR⁸⁰R⁸⁰, -OC(0)R⁷⁰, -OC(S)R⁷⁰, -OC0₂ M⁺, -OC0₂R⁷⁰, -OC(S)OR⁷⁰, -NR⁷⁰C(O)R⁷⁰, -NR⁷⁰C(S)R⁷⁰, -NR⁷⁰CO₂ M⁺, -NR⁷⁰CO₂R⁷⁰, -NR⁷⁰C(S)OR⁷⁰, -NR⁷⁰C(O)NR⁸⁰R⁸⁰, -NR⁷⁰C(NR⁷⁰)R⁷⁰ and -NR⁷⁰C(NR⁷⁰)NR⁸⁰R⁸⁰, where R⁶⁰, R⁷⁰, R⁸⁰ and M⁺ are as previously defined, provided that in case of substituted alkene or alkyne, the substituents are not -0^"M⁺, -OR⁷⁰, -SR⁷⁰, or -STV1⁺.

[00159] In addition to the disclosure herein, substituent groups for hydrogens on nitrogen atoms in "substituted" heteroalkyl and cycloheteroalkyl groups are, unless otherwise specified, -R⁶⁰, -0^"M⁺, -OR⁷⁰, -SR⁷⁰, -S^"M⁺, -NR⁸⁰R⁸⁰, trihalomethyl, -CF₃, -CN, -NO, -N0₂, -S(0)₂R⁷⁰, -S(0)₂0^"M⁺, -S(0)₂OR⁷⁰, -OS(0)₂R⁷⁰, -OS(0)₂0^"M⁺, -OS(0)₂OR⁷⁰, -P(0)(0^")₂(M⁺)₂,

-P(O)(OR⁷⁰)O^"M⁺, -P(O)(OR⁷⁰)(OR⁷⁰), -C(0)R⁷⁰, -C(S)R⁷⁰, -C(NR⁷⁰)R⁷⁰, -C(0)OR⁷⁰,

-C(S)OR⁷⁰, -C(O)NR⁸⁰R⁸⁰, -C(NR⁷⁰)NR⁸⁰R⁸⁰, -OC(0)R⁷⁰, -OC(S)R⁷⁰, -OC(0)OR⁷⁰,

-OC(S)OR⁷⁰, -NR⁷⁰C(O)R⁷⁰, -NR⁷⁰C(S)R⁷⁰, -NR⁷⁰C(O)OR⁷⁰, -NR⁷⁰C(S)OR⁷⁰,

-NR⁷⁰C(O)NR⁸⁰R⁸⁰, -NR⁷⁰C(NR⁷⁰)R⁷⁰ and -NR⁷⁰C(NR⁷⁰)NR⁸⁰R⁸⁰, where R⁶⁰, R⁷⁰, R⁸⁰ and M⁺ are as previously defined.

[00160] It should be noted that the prefix "poly" refers to two or more.

[00161] In addition to the disclosure herein, in a certain embodiment, a group that is substituted has 1, 2, 3, or 4 substituents, 1, 2, or 3 substituents, 1 or 2 substituents, or 1 substituent. [00162] It is understood that in all substituted groups defined above, polymers arrived at by defining substituents with further substituents to themselves (e.g., substituted aryl having a substituted aryl group as a substituent which is itself substituted with a substituted aryl group, which is further substituted by a substituted aryl group, etc.) are not intended for inclusion herein. In such cases, the maximum number of such substitutions is three. For example, serial substitutions of substituted aryl groups are limited to substituted aryl-(substituted aryl)- substituted aryl.

[00163] Unless indicated otherwise, the nomenclature of substituents that are not explicitly

defined herein are arrived at by naming the terminal portion of the functionality followed by the adjacent functionality toward the point of attachment. For example, the substituent

"arylalkyloxycarbonyl" refers to the group (aryl)-(alkyl)-0-C(0)-.

[00164] As to any of the groups disclosed herein which contain one or more substituents, it is understood, of course, that such groups do not contain any substitution or substitution patterns which are sterically impractical and/or synthetically non-feasible. In addition, the subject compounds include all stereochemical isomers arising from the substitution of these compounds.

[00165] The term "transgene" is used herein to describe genetic material which has been or is about to be artificially inserted into the genome of a mammal, particularly a mammalian cell of a living animal.

[00166] By "transgenic animal" is meant a non-human animal, usually a mammal, having a non- endogenous (i.e., heterologous or foreign) nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line DNA (i.e., in the genomic sequence of most or all of its cells). Heterologous nucleic acid is introduced into the germ line of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal according to methods well known in the art. A "transgene" is meant to refer to such heterologous nucleic acid, e.g., heterologous nucleic acid in the form of an expression construct (e.g., for the production of a "knock-in" transgenic animal) or a

heterologous nucleic acid that upon insertion within or adjacent a target gene results in a decrease in target gene expression (e.g., for production of a "knock-out" transgenic animal). Accordingly, when a DNA molecule is artificially introduced into the cells of an animal, a "transgenic animal" is produced. The DNA molecule is called a "transgene" and may contain one or many genes. By inserting a transgene into a fertilized oocyte or cells from the early embryo, the resulting transgenic animal may be able to transmit the foreign DNA stably in its germline.

[00167] A "knock-out" of a gene means an alteration in the sequence of the gene that results in a decrease of function of the target gene, and includes decrease in function such that target gene expression is undetectable or insignificant. Transgenic knock-out animals can be characterized as comprising a heterozygous knock-out of a target gene (i.e., with a knockout of a first allele and a second allele that is functional (e.g., wild-type)) or a homozygous knock-out of a target gene. "Knock-outs" as used herein also include conditional knock-outs (also referred to as "inducible" knock-outs), where alteration of the target gene can occur upon, for example, exposure of the animal to a substance that promotes target gene alteration, introduction of an enzyme that promotes recombination at the target gene site (e.g., Cre in the Cre-lox system), or other method for directing the target gene alteration postnatally.

[00168] "Homozygous" state means a genetic condition existing when the same alleles reside at corresponding loci on homologous chromosomes. In contrast, "heterozygous" state means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.

DETAILED DESCRIPTION

OVERVIEW

[00169] The present disclosure provides compositions and methods for use in the treatment of pain, wherein the compounds useful in such compositions and methods inhibit activity of transient receptor potential cation channel subfamily V member 1 (TRPVl) transcription factors, which in some embodiments may be administered in combination with a compound that modulates the activity of TRPVl.

COMPOUNDS

[00170] The present disclosure in general relates to administration of a compound that inhibits activity of a TRPVl transcription factor (e.g., one or more of Spl, Sp3 and Sp4). Such compounds, which may be referred to herein as "TPRVl transcription factor inhibitors," include small molecules and nucleic acid agents that inhibit expression of TRPVl transcription factors. Such compounds may inhibit expression of transcription factors that regulate the expression of the TRPVl receptor gene.

[00171] The present disclosure further provides methods involving administration of a second compound in combination with a TRPVl transcription factor inhibitor. Such second compounds provide for modulation of TRPVl activity, and may be referred to herein as "TRPVl modulators." The modulation of TRPVl activity encompasses any mechanism of action, provided the compound results in desensitization of a subject to whom the compound is administered to stimuli that normally activate TRPVl. Suitable TRPVl antagonists include compounds that block or dampen the normal activity of the receptor (i.e., activity in the absence of the compound). Suitable TRPVl agonists include compounds that activate the TRPVl receptor, but lead to a decrease or dampening of its activity over time through desensitization.

[00172] Of particular interest in the treatment of pain are compositions that comprise both a TRPVl transcription factor inhibitor as well as a TRPVl modulator.

[00173] The following compounds can be used to accomplish the methods of the present

disclosure.

TRPVl transcription factor inhibitors

[00174] The following are examples of compounds that find use as a TRPVl transcription factor inhibitor, and thus are contemplated by the compositions and methods of the present disclosure. The present disclosure relates to methods of treating pain using the following TRPVl transcription factor inhibitors alone (e.g,. as a monotherapy) or in combination with another compound (e.g., a TRPVl modulator). For example, the present disclosure also relates to methods of treating pain using one or more of a TRPVl transcription factor inhibitor in combination with one or more TRPVl activity modulators.

Mithramycin and Mithramycin Derivatives

[00175] In some embodiments, the TRPVl transcription factor inhibitor is mithramycin or a mithramycin derivative, such as a mithramycin A-type compound, such as mithramycin A, or a mithramycin SK- or SDK-type compound, such as mithramycin SK or mithramycin SDK. Mithramycin compounds having the following formula (I) may be used in the methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein

[00176] R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl;

[00177] R³⁰ is selected from hydroxyl and oxo;

[00178] R⁴⁰ is selected from hydroxyl and oxo; and

[00179] R⁵⁰ is selected from alkyl and substituted alkyl.

[00180] In formula I, R¹⁰ is selected from oligosaccharide, peptide, alkyl, substituted alkyl,

alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00181] In certain embodiments, R¹⁰ is an oligosaccharide. In certain embodiments, R¹⁰ is -D- olivose-D-oliose-D-mycarose.

[00182] In certain embodiments, R¹⁰ is a peptide. In certain embodiments, the peptide is a cyclic peptide.

[00183] In certain embodiments, R¹⁰ is alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, or substituted alkynyl. [00184] In certain embodiments, R is cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl.

[00185] In certain embodiments, R¹⁰ is polycycloalkyl, substituted polycycloalkyl, polyaryl, substituted polyaryl, polyheterocyclyl, substituted polyheterocyclyl, polyheteroaryl, substituted polyheteroaryl, or a chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl. It should be noted that the prefix "poly" refers to two or more.

[00186] In formula I, R²⁰ is selected from oligosaccharide, peptide, alkyl, substituted alkyl,

alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00187] In certain embodiments, R²⁰ is an oligosaccharide. In certain embodiments, R²⁰ is -D- olivose-D-olivose.

[00188] In certain embodiments, R²⁰ is a peptide. In certain embodiments, the peptide is a cyclic peptide.

[00189] In certain embodiments, R^1"20 is alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

[00190] In certain embodiments, R²⁰ is cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl.

[00191] In certain embodiments, R²⁰ is polycycloalkyl, substituted polycycloalkyl, polyaryl, substituted polyaryl, polyheterocyclyl, substituted polyheterocyclyl, polyheteroaryl, substituted polyheteroaryl, or a chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl. It should be noted that the prefix "poly" refers to two or more. In a chain of mixed rings, there is at least two mixed rings.

[00192] In formula I, R³⁰ is selected from hydroxyl and oxo. In certain embodiments, R³⁰ is hydroxyl. In certain embodiments, R 30 is oxo.

[00193] In formula I, R⁴⁰ is selected from hydroxyl and oxo. In certain embodiments, R⁴⁰ is hydroxyl. In certain embodiments, R⁴⁰ is oxo. [00194] In formula I, R is selected from alkyl and substituted alkyl. In certain embodiments, R⁵⁰ is alkyl. In certain embodiments, R⁵⁰ is methyl. In certain embodiments, R⁵⁰ is substituted alkyl. In certain embodiments, R⁵⁰ is -CH(OH)-CH₃.

[00195] Mithramycin compounds of the mithramycin A-type include those of formula (II), which compound may also be used in the compositions and methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein

[00196] R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00197] In formula II, R¹⁰ is selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00198] In certain embodiments, R¹⁰ is an oligosaccharide. In certain embodiments, R¹⁰ is -D- olivose-D-oliose-D-mycarose.

[00199] In certain embodiments, R¹⁰ is a peptide. In certain embodiments, the peptide is a cyclic peptide.

[00200] In certain embodiments, R¹⁰ is alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, or substituted alkynyl. [00201] In certain embodiments, R is cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl.

[00202] In certain embodiments, R¹⁰ is polycycloalkyl, substituted polycycloalkyl, polyaryl, substituted polyaryl, polyheterocyclyl, substituted polyheterocyclyl, polyheteroaryl, substituted polyheteroaryl, or a chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl. It should be noted that the prefix "poly" refers to two or more.

[00203] In formula II, R²⁰ is selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00204] In certain embodiments, R²⁰ is an oligosaccharide. In certain embodiments, R²⁰ is -D- olivose-D-olivose.

[00205] In certain embodiments, R²⁰ is a peptide. In certain embodiments, the peptide is a cyclic peptide.

[00206] In certain embodiments, R²⁰ is alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, or substituted alkynyl.

[00207] In certain embodiments, R²⁰ is cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl.

[00208] In certain embodiments, R²⁰ is polycycloalkyl, substituted polycycloalkyl, polyaryl, substituted polyaryl, polyheterocyclyl, substituted polyheterocyclyl, polyheteroaryl, substituted polyheteroaryl, or a chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl. It should be noted that the prefix "poly" refers to two or more. In a chain of mixed rings, there is at least two mixed rings.

[00209] In certain embodiments, the compound of formula II is of the formula:

or a pharmaceutically acceptable salt thereof.

[00210] Mithramycin compounds having the following formula (III) may be used in the methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein

[00211] R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl; and

[00212] R³⁰ is selected from hydroxyl and oxo.

[00213] In formula III, R¹⁰ is selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00214] In certain embodiments, R¹⁰ is an oligosaccharide. In certain embodiments, R¹⁰ is -D- olivose-D-oliose-D-mycarose.

[00215] In certain embodiments, R¹⁰ is a peptide. In certain embodiments, the peptide is a cyclic peptide.

[00216] In certain embodiments, R¹⁰ is alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, or substituted alkynyl.

[00217] In certain embodiments, R¹⁰ is cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl.

[00218] In certain embodiments, R¹⁰ is polycycloalkyl, substituted polycycloalkyl, polyaryl, substituted polyaryl, polyheterocyclyl, substituted polyheterocyclyl, polyheteroaryl, substituted polyheteroaryl, or a chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl. It should be noted that the prefix "poly" refers to two or more.

[00219] In formula (III), R²⁰ is selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

[00220] In certain embodiments, R²⁰ is an oligosaccharide. In certain embodiments, R²⁰ is -D- olivose-D-olivose.

[00221] In certain embodiments, R²⁰ is a peptide. In certain embodiments, the peptide is a cyclic peptide.

[00222] In certain embodiments, R^1"20 is alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

[00223] In certain embodiments, R²⁰ is cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl.

[00224] In certain embodiments, R²⁰ is polycycloalkyl, substituted polycycloalkyl, polyaryl, substituted polyaryl, polyheterocyclyl, substituted polyheterocyclyl, polyheteroaryl, substituted polyheteroaryl, or a chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl. It should be noted that the prefix "poly" refers to two or more. In a chain of mixed rings, there is at least two mixed rings.

[00225] In formula III, R³⁰ is selected from hydroxyl and oxo. In certain embodiments, R³⁰ is hydroxyl. In certain embodiments, R 30 is oxo.

[00226] In certain embodiments, the compound of formula (III) is of the formula:

or a pharmaceutically acceptable salt thereof. [00227] In certain embodiments, the compound of formula III is of the formula:

or a pharmaceutically acceptable salt thereof.

Diclofenac

[00228] Diclofenac compounds having the following formula (IV) may be used in the methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein

[00229] R¹ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

[00230] R² is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

[00231] R³ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro; and

[00232] R⁴ is selected from hydrogen and alkyl.

[00233] In formula (IV), R¹ is selected from hydrogen, alkyl, substituted alkyl, alkenyl,

substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00234] In certain embodiments, R¹ is hydrogen, alkyl, or substituted alkyl. In certain

embodiments, R¹ is hydrogen. In certain embodiments, R¹ is alkyl. In certain embodiments, R¹ is substituted alkyl.

[00235] In certain embodiments, R¹ is alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

In certain embodiments, R¹ is alkenyl. In certain embodiments, R¹ is substituted alkenyl. In certain embodiments, R¹ is alkynyl. In certain embodiments, R¹ is substituted alkynyl.

[00236] In certain embodiments, R¹ is alkoxy or substituted alkoxy. In certain embodiments, R¹ is alkoxy. In certain embodiments, R¹ is substituted alkoxy.

[00237] In certain embodiments, R¹ is acyl or substituted acyl. In certain embodiments, R¹ is acyl. In certain embodiments, R¹ is substituted acyl. [00238] In certain embodiments, R¹ is amino, substituted amino, or azido. In certain

embodiments, R¹ is amino. In certain embodiments, R¹ is substituted amino. In certain embodiments, R¹ is azido.

[00239] In certain embodiments, R¹ is carboxyl, cyano, halogen, hydroxyl, or nitro. In certain embodiments, R¹ is carboxyl. In certain embodiments, R¹ is cyano. In certain embodiments, R¹ is halogen. In certain embodiments, R¹ is fluoro. In certain embodiments, R¹ is chloro. In certain embodiments, R¹ is bromo. In certain embodiments, R¹ is hydroxyl. In certain embodiments, R¹ is nitro.

[00240] In formula (IV), R² is selected from hydrogen, alkyl, substituted alkyl, alkenyl,

substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00241] In certain embodiments, R² is hydrogen, alkyl, or substituted alkyl. In certain

embodiments, R 2 is hydrogen. In certain embodiments, R 2 is alkyl. In certain embodiments, R 2 is substituted alkyl.

[00242] In certain embodiments, R² is alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

In certain embodiments, R 2 is alkenyl. In certain embodiments, R 2 is substituted alkenyl. In certain embodiments, R 2 is alkynyl. In certain embodiments, R 2 is substituted alkynyl.

[00243] In certain embodiments, R² is alkoxy or substituted alkoxy. In certain embodiments, R² is alkoxy. In certain embodiments, R is substituted alkoxy.

[00244] In certain embodiments, R² is acyl or substituted acyl. In certain embodiments, R² is acyl. In certain embodiments, R is substituted acyl.

[00245] In certain embodiments, R² is amino, substituted amino, or azido. In certain

embodiments, R 2 is amino. In certain embodiments, R 2 is substituted amino. In certain embodiments, R is azido.

[00246] In certain embodiments, R² is carboxyl, cyano, halogen, hydroxyl, or nitro. In certain embodiments, R 2 is carboxyl. In certain embodiments, R 2 is cyano. In certain embodiments, R 2 is halogen. In certain embodiments, R 2 is fluoro. In certain embodiments, R 2 is chloro. In certain embodiments, R 2 is bromo. In certain embodiments, R 2 is hydroxyl. In certain

2

embodiments, R is nitro. [00247] In formula (IV), R³ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro.

[00248] In certain embodiments, R³ is hydrogen, alkyl, or substituted alkyl. In certain

embodiments, R 3 is hydrogen. In certain embodiments, R 3 is alkyl. In certain embodiments, R 3 is substituted alkyl.

[00249] In certain embodiments, R³ is alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

In certain embodiments, R 3 is alkenyl. In certain embodiments, R 3 is substituted alkenyl. In certain embodiments, R 3 is alkynyl. In certain embodiments, R 3 is substituted alkynyl.

[00250] In certain embodiments, R³ is cycloalkyl or substituted cycloalkyl. In certain

embodiments, R 3 is cycloalkyl. In certain embodiments, R 3 is substituted cycloalkyl.

[00251] In certain embodiments, R³ is acyl, substituted acyl, carboxyl, carboxyl ester, or

aminoacyl. In certain embodiments, R 3 is acyl. In certain embodiments, R 3 is substituted acyl.

In certain embodiments, R 3 is carboxyl. In certain embodiments, R 3 is carboxyl ester. In certain embodiments, R is aminoacyl.

[00252] In certain embodiments, R³ is azido, cyano, halogen, hydroxyl, or nitro. In certain

embodiments, R 3 is azido. In certain embodiments, R 3 is cyano. In certain embodiments, R 3 is halogen. In certain embodiments, R 3 is hydroxyl. In certain embodiments, R 3 is nitro.

[00253] In formula (IV), R⁴ is selected from hydrogen and alkyl. In certain embodiments, R⁴ is hydrogen. In certain embodiments, R⁴ is alkyl.

[00254] In certain embodiments, the compound of formula (IV) is of the formula:

or a pharmaceutically acceptable salt thereof. Tolfenamic Acid

[00255] Tolfenamic acid compounds having the following formula (V) may be used

methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein

[00256] R¹ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,

substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro;

[00257] R² is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and

substituted alkynyl;

[00258] R³ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl,

substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

[00259] R⁴ is selected from hydrogen and alkyl;

[00260] In formula (V), R¹ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro.

[00261] In certain embodiments, R¹ is alkyl, or substituted alkyl. In certain embodiments, R¹ is alkyl. In certain embodiments, R¹ is substituted alkyl.

[00262] In certain embodiments, R¹ is alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

In certain embodiments, R¹ is alkenyl. In certain embodiments, R¹ is substituted alkenyl. In certain embodiments, R¹ is alkynyl. In certain embodiments, R¹ is substituted alkynyl.

[00263] In certain embodiments, R¹ is cycloalkyl or substituted cycloalkyl. In certain

embodiments, R¹ is cycloalkyl. In certain embodiments, R¹ is substituted cycloalkyl.

[00264] In certain embodiments, R¹ is acyl, substituted acyl, carboxyl, carboxyl ester, or

aminoacyl. In certain embodiments, R¹ is acyl. In certain embodiments, R¹ is substituted acyl. In certain embodiments, R is carboxyl. In certain embodiments, R is carboxyl ester. In certain embodiments, R¹ is aminoacyl.

[00265] In certain embodiments, R¹ is azido, cyano, halogen, hydroxyl, or nitro. In certain

embodiments, R¹ is azido. In certain embodiments, R¹ is cyano. In certain embodiments, R¹ is halogen. In certain embodiments, R¹ is hydroxyl. In certain embodiments, R¹ is nitro.

[00266] In formula (V), R² is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl.

[00267] In certain embodiments, R² is alkyl or substituted alkyl. In certain embodiments, R² is alkyl. In certain embodiments, R 2 is methyl. In certain embodiments, R 2 is substituted alkyl.

[00268] In certain embodiments, R² is alkenyl, substituted alkenyl, alkynyl, or substituted alkynyl.

In certain embodiments, R 2 is alkenyl. In certain embodiments, R 2 is substituted alkenyl. In certain embodiments, R 2 is alkynyl. In certain embodiments, R 2 is substituted alkynyl.

[00269] In formula (V), R³ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00270] In certain embodiments, R³ is alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, or substituted alkynyl. In certain embodiments, R is alkyl or substituted alkyl. In certain embodiments, R 3 is alkenyl or substituted alkenyl. In certain embodiments, R 3 is alkynyl or substituted alkynyl.

[00271] In certain embodiments, R³ is alkoxy, substituted alkoxy, acyl, or substituted acyl. In certain embodiments, R 3 is alkoxy or substituted alkoxy. In certain embodiments, R 3 is acyl or substituted acyl.

[00272] In certain embodiments, R³ is amino, substituted amino, or azido. In certain

embodiments, R 3 is amino or substituted amino. In certain embodiments, R 3 is azido.

[00273] In certain embodiments, R³ is carboxyl, cyano, halogen, hydroxyl, or nitro. In certain embodiments, R 3 is carboxyl. In certain embodiments, R 3 is cyano. In certain embodiments, R 3 is halogen. In certain embodiments, R 3 is fluoro. In certain embodiments, R 3 is chloro. In certain embodiments, R 3 is bromo. In certain embodiments, R 3 is hydroxyl. In certain embodiments, R is nitro.

[00274] In formula (V), R⁴ is selected from hydrogen and alkyl. In certain embodiments, R⁴ is hydrogen. In certain embodiments, R⁴ is alkyl. [00275] In certain embodiments, the compound of formula (V) is of the formula:

or a pharmaceutically acceptable salt thereof. Nucleic Acid Agents

[00276] TRPV1 transcription factor inhibitors include nucleic acid agents that inhibit expression of at least one of Spl, Sp3 and Sp4. Nucleic acid agents suitable for use as such inhibitors include small nucleic acid molecules, such as a short interfering RNA (siRNA), a double- stranded RNA (dsRNA), a micro-RNA (miRNA), and a short hairpin RNA (shRNA).

[00277] The terms "short interfering nucleic acid," "siNA," "short interfering RNA," "siRNA," "short interfering nucleic acid molecule," "short interfering oligonucleotide molecule," and "chemically-modified short interfering nucleic acid molecule" as used herein refer to any nucleic acid molecule capable of inhibiting or down regulating gene expression, for example by mediating RNA interference ("RNAi") or gene silencing in a sequence- specific manner. Design of RNAi molecules, given a target gene, is routine in the art. It should be understood that the siNA (e.g., siRNA, e.g., shRNA. e.g. dsRNA) oligonucleotides in general comprise a sequence complementary to the target. "siNA" as used herein is thus meant to encompass any nucleic acid molecules capable of mediating sequence-specific RNA interference (RNAi), for example short interfering RNA (siRNA), double- stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.

[00278] Methods for design and production of siNAs (including siRNAs) to a desired target are known in the art, and their application to a TRPV1 transcription factor-encoding nucleic adi sequence for use in the method of the present disclosure will be readily apparent to the ordinarily skilled artisan. Methods and tools to facilitate design and production of siRNAs are available in the art.

[00279] Suitable TRPV1 transcription factor targets include a contiguous stretch of, for example, from about 10 nucleotides (nt) to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, of (i) a TPRV1 Spl mRNA, see, e.g., GenBank Accession Nos. NM_138473; NM_003109; BC062539 (Homo sapiens); (ii) a TPRV1 Sp3 mRNA, see, e.g., GenBank

Accession Nos. NM_003111.4; NM_001017371.4; AY070137.1; NM_001172712 (Homo sapiens); and (iii) a TPRV1 Sp4 mRNA, see, e.g., GenBank Accession Nos. NM_003112, EU446903, BC109301, BC109300, BC015512 (Homo sapiens), where mRNA sequences can be derived from the sequence of the encoding DNA. Examples of antisense mRNA suitable as nucleic acid inhibitors of Spl, Sp3 or Sp4 activity are described in US Pat. No. 7,812,003, which is incorporated herein by reference in its entirety.

[00280] siNA molecules can be of any of a variety of forms. For example the siNA can be a

double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. siNA can also be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary. In this embodiment, each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example wherein the double stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the siNA molecule are complementary to the target nucleic acid or a portion thereof). [00281] siNA can be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siNA are linked by a nucleic acid-based or non-nucleic acid- based linker(s). The siNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.

[00282] The siNA can be a circular single-stranded polynucleotide having two or more loop

structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi. The siNA can also comprise a single stranded

polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (e.g., where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5'-phosphate or 5',3'-diphosphate.

[00283] In certain embodiments, the siNA molecule contains separate sense and antisense

sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non- covalently linked by ionic interactions, hydrogen bonding, van der Waals interactions, hydrophobic interactions, and/or stacking interactions. In certain embodiments, the siNA molecules comprise nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the siNA molecule interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.

[00284] As used herein, siNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides. In certain embodiments, the short interfering nucleic acid molecules of the invention lack 2'-hydroxy (2'- OH) containing nucleotides. siNAs do not necessarily require the presence of nucleotides having a 2'-hydroxy group for mediating RNAi and as such, siNA molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group). Such siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups. Optionally, siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. The modified short interfering nucleic acid molecules of the invention can also be referred to as short interfering modified oligonucleotides "siMON."

[00285] siNA molecules contemplated herein can comprise an asymmetric hairpin or asymmetric duplex. By "asymmetric hairpin" as used herein is meant a linear siNA molecule comprising an antisense region, a loop portion that can comprise nucleotides or non-nucleotides, and a sense region that comprises fewer nucleotides than the antisense region to the extent that the sense region has enough complementary nucleotides to base pair with the antisense region and form a duplex with loop. For example, an asymmetric hairpin siNA molecule can comprise an antisense region having length sufficient to mediate RNAi in a cell or in vitro system (e.g. about 15 to about 30, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and a loop region comprising about 4 to about 12 (e.g., about 4, 5, 6, 7, 8, 9, 10, 11, or 12) nucleotides, and a sense region having about 3 to about 25 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides that are complementary to the antisense region. The asymmetric hairpin siNA molecule can also comprise a 5'-terminal phosphate group that can be chemically modified. The loop portion of the asymmetric hairpin siNA molecule can comprise nucleotides, non-nucleotides, linker molecules, or conjugate molecules as described herein.

[00286] Stability and/or half-life of siNAs (e.g., siRNAs, shRNAs, etc.) can be improved through chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency. Various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules to provide for enhanced features are known in the art.

[00287] Suitable formulations for delivery of siNA include polymers, polymer conjugates, lipids, micelles, self-assembly colloids, nanoparticles, sterically stabilized nanoparticles, and ligand- directed nanoparticles. For example, siNA molecules can be provided as conjugates and/or complexes, e.g., to facilitate delivery of siNA molecules into a cell. Exemplary conjugates and/or complexes include those composed of an siNA and a small molecule, lipid, cholesterol, phospholipid, nucleoside, antibody, toxin, negatively charged polymer (e.g., protein, peptide, hormone, carbohydrate, polyethylene glycol, or polyamine). In general, the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers. Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.

TRPV1 modulators

[00288] The following are examples of compounds that find use as TRPV1 modulators, and thus are contemplated by the compositions and methods of the present disclosure.

Cur cumin

[00289] Curcumin compounds having the following formula (VI) or (VII) may be used in the methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, or

or a pharmaceutically acceptable salt thereof, wherein [00290] R¹ and R² are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

[00291] R³ and R⁴ are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00292] In formula (VI) and (VII), R¹ and R² are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00293] In certain embodiments, R¹ and R² are independently selected from hydrogen, alkyl, and substituted alkyl. In certain embodiments, R 1 and R 2 are independently hydrogen. In certain embodiments, R 1 and R 2 are independently selected from alkyl and substituted alkyl.

[00294] In certain embodiments, R¹ and R² are independently selected from alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl. In certain embodiments, R 1 and R 2 are independently selected from alkenyl and substituted alkenyl. In certain embodiments, R 1 and R 2 are independently selected from alkynyl and substituted alkynyl.

[00295] In certain embodiments, R¹ and R² are independently selected from alkoxy and

substituted alkoxy. In certain embodiments, R 1 and R 2 are independently alkoxy. In certain embodiments, R 1 and R 2 are independently substituted alkoxy.

[00296] In certain embodiments, R¹ and R² are independently selected from acyl and substituted acyl. In certain embodiments, R 1 and R2 are independently acyl. In certain embodiments, R 1 and R are independently substituted acyl.

[00297] In certain embodiments, R¹ and R² are independently selected from amino, substituted amino, and azido. In certain embodiments, R 1 and R 2 are independently selected from amino. In certain embodiments, R 1 and R 2 are independently selected from substituted amino. In certain embodiments, R 1 and R 2 are independently selected from azido.

[00298] In certain embodiments, R¹ and R² are independently selected from is carboxyl, cyano, halogen, hydroxyl, and nitro. In certain embodiments, R 1 and R 2 are independently carboxyl. In certain embodiments, R 1 and R2 are independently cyano. In certain embodiments, R 1 and R2 are independently halogen. In certain embodiments, R 1 and R 2 are independently fluoro. In certain embodiments, R 1 and R2 are independently chloro. In certain embodiments, R 1 and R2 are independently bromo. In certain embodiments, R 1 and R 2 are independently hydroxyl. In certain embodiments, R 1 and R 2 are independently nitro.

[00299] In formula (VI) and (VII), R³ and R⁴ are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00300] In certain embodiments, R³ and R⁴ are independently selected from hydrogen, alkyl, and substituted alkyl. In certain embodiments, R 3 and R 4 are independently hydrogen. In certain embodiments, R 3 and R 4 are independently selected from alkyl and substituted alkyl.

[00301] In certain embodiments, R³ and R⁴ are independently selected from alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl. In certain embodiments, R 3 and R 4 are independently selected from alkenyl and substituted alkenyl. In certain embodiments, R 3 and R 4 are independently selected from alkynyl and substituted alkynyl.

[00302] In certain embodiments, R³ and R⁴ are independently selected from alkoxy and

substituted alkoxy. In certain embodiments, R 3 and R 4 are independently alkoxy. In certain embodiments, R 3 and R 4 are independently methoxy. In certain embodiments, R 3 and R 4 are independently substituted alkoxy.

[00303] In certain embodiments, R³ and R⁴ are independently selected from acyl and substituted acyl. In certain embodiments, R 3 and R 4 are independently acyl. In certain embodiments, R 3 and R⁴ are independently substituted acyl.

[00304] In certain embodiments, R³ and R⁴ are independently selected from amino, substituted amino, and azido. In certain embodiments, R 3 and R 4 are independently selected from amino. In certain embodiments, R 3 and R 4 are independently selected from substituted amino. In certain embodiments, R 3 and R 4 are independently selected from azido.

[00305] In certain embodiments, R³ and R⁴ are independently selected from is carboxyl, cyano, halogen, hydroxyl, and nitro. In certain embodiments, R 3 and R 4 are independently carboxyl. In certain embodiments, R 3 and R 4 are independently cyano. In certain embodiments, R 3 and R 4 are independently halogen. In certain embodiments, R 3 and R 4 are independently fluoro. In certain embodiments R 3 and R 4 are independently chloro. In certain embodiments, R 3 and R 4 are independently bromo. In certain embodiments, R 3 and R 4 are independently hydroxyl. In certain embodiments, R 3 and R 4 are independently nitro.

[00306] In certain embodiments, the compound of formulae (VI) and (VII) is of the formula:

or a pharmaceutically acceptable salt thereof, or

or a pharmaceutically acceptable salt thereof.

Eugenol

[00307] Eugenol compounds having the following formula (VIII) may be used in the methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein

[00308] R¹ is selected from hydrogen, CrC₆ alkyl, substituted CrC₆ alkyl, CrC₆ alkenyl,

substituted Ci-C₆ alkenyl, Ci-C₆ alkynyl, substituted Ci-C₆ alkynyl, acyl, and substituted acyl;

[00309] R² is selected from hydrogen, Ci-C₆ alkyl, substituted Ci-C₆ alkyl, Ci-C₆ alkenyl,

substituted CrC₆ alkenyl, CrC₆ alkynyl, substituted CrC₆ alkynyl, acyl, and substituted acyl; and [00310] R³ is selected from Ci-C₆ alkenyl, substituted Ci-C₆ alkenyl, Ci-C₆ alkynyl, substituted

Ci-C₆ alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00311] In formula (VIII), R¹ is selected from hydrogen, Ci-C₆ alkyl, substituted Ci-C₆ alkyl, Q-

C₆ alkenyl, substituted Ci-C₆ alkenyl, Ci-C₆ alkynyl, substituted Ci-C₆ alkynyl, acyl, and substituted acyl.

[00312] In certain embodiments, R¹ is hydrogen, Ci-C₆ alkyl, or substituted Ci-C₆ alkyl. In

certain embodiments, R¹ is hydrogen. In certain embodiments, R¹ is Ci-C₆ alkyl or substituted Ci-C₆ alkyl. In certain embodiments, R¹ is Ci-C₆ alkyl. In certain embodiments, R¹ is substituted Ci-C₆ alkyl.

[00313] In certain embodiments, R¹ is Ci-C₆ alkenyl or substituted Ci-C₆ alkenyl. In certain embodiments, R¹ is Ci-C₆ alkenyl. In certain embodiments, R¹ is substituted Ci-C₆ alkenyl.

[00314] In certain embodiments, R¹ is Ci-C₆ alkynyl or substituted Ci-C₆ alkynyl. In certain embodiments, R¹ is Ci-C₆ alkynyl. In certain embodiments, R¹ is substituted Ci-C₆ alkynyl.

[00315] In certain embodiments, R¹ is acyl or substituted acyl. In certain embodiments, R¹ is acyl. In certain embodiments, R¹ is substituted acyl.

[00316] In formula (VIII), R² is selected from hydrogen, Ci-C₆ alkyl, substituted Ci-C₆ alkyl, Q-

C₆ alkenyl, substituted Ci-C₆ alkenyl, Ci-C₆ alkynyl, substituted Ci-C₆ alkynyl, acyl, and substituted acyl.

[00317] In certain embodiments, R² is hydrogen, Ci-C₆ alkyl, or substituted Ci-C₆ alkyl. In

certain embodiments, R 2 is hydrogen. In certain embodiments, R 2 is Ci-C₆ alkyl or substituted

Ci-C₆ alkyl. In certain embodiments, R 2 is Ci-C₆ alkyl. In certain embodiments, R 2 is methyl. In certain embodiments, R is substituted Ci-C₆ alkyl.

[00318] In certain embodiments, R² is Ci-C₆ alkenyl or substituted Ci-C₆ alkenyl. In certain embodiments, R 2 is Ci-C₆ alkenyl. In certain embodiments, R 2 is substituted Ci-C₆ alkenyl.

[00319] In certain embodiments, R² is Ci-C₆ alkynyl or substituted Ci-C₆ alkynyl. In certain embodiments, R 2 is Ci-C₆ alkynyl. In certain embodiments, R 2 is substituted Ci-C₆ alkynyl.

[00320] In certain embodiments, R² is acyl or substituted acyl. In certain embodiments, R² is acyl. In certain embodiments, R is substituted acyl. [00321] In formula (Villi), R³ is selected from Ci-C₆ alkenyl, substituted Ci-C₆ alkenyl, Ci-C₆ alkynyl, substituted Ci-C₆ alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

[00322] In certain embodiments, R³ is CrC₆ alkenyl or substituted CrC₆ alkenyl. In certain embodiments, R 3 is Ci-C₆ alkenyl. In certain embodiments, R 3 is -CH=CH₂. In certain embodiments, R is substituted Ci-C₆ alkenyl.

[00323] In certain embodiments, R³ is CrC₆ alkynyl or substituted CrC₆ alkynyl. In certain embodiments, R 3 is CrC₆ alkynyl. In certain embodiments, R 3 is substituted CrC₆ alkynyl.

[00324] In certain embodiments, R³ is cycloalkyl or substituted cycloalkyl. In certain

embodiments, R 3 is cycloalkyl. In certain embodiments, R 3 is substituted cycloalkyl.

[00325] In certain embodiments, R³ is acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, or nitro. In certain embodiments, R is acyl or substituted acyl. In certain embodiments, R 3 is acyl. In certain embodiments, R 3 is substituted acyl. In certain

embodiments, R 3 is azido. In certain embodiments, R 3 is carboxyl. In certain embodiments, R 3 is cyano. In certain embodiments, R 3 is halogen. In certain embodiments, R 3 is hydroxyl. In certain embodiments, R is nitro.

[00326] In certain embodiments, the compound of formula (VIII) is of the formula:

or a pharmaceutically acceptable salt thereof.

Capsaicin

[00327] Capsaicin compounds having the following formula (IX) may be used in the methods of the present disclosure:

or a pharmaceutically acceptable salt thereof, wherein [00328] R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate;

[00329] R² is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted

alkoxy, cyano, halogen, nitro, and sulfate; and

[00330] R³ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl,

alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

[00331] In formula (IX), R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate.

[00332] In certain embodiments, R¹ is hydrogen. In certain embodiments, R¹ is hydroxyl. In certain embodiments, R¹ is alkyl or substituted alkyl. In certain embodiments, R¹ is alkoxy or substituted alkoxy. In certain embodiments, R¹ is cyano. In certain embodiments, R¹ is halogen.

In certain embodiments, R¹ is fluoro. In certain embodiments, R¹ is chloro. In certain embodiments, R¹ is bromo. In certain embodiments, R¹ is nitro. In certain embodiments, R¹ is sulfate.

[00333] In formula (IX), R² is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate.

[00334] In certain embodiments, R² is hydrogen. In certain embodiments, R² is hydroxyl. In certain embodiments, R 2 is alkyl or substituted alkyl. In certain embodiments, R 2 is alkoxy or substituted alkoxy. In certain embodiments, R 2 is methoxy. In certain embodiments, R 2 is cyano. In certain embodiments, R 2 is halogen. In certain embodiments, R 2 is fluoro. In certain embodiments, R 2 is chloro. In certain embodiments, R 2 is bromo. In certain embodiments, R 2 is nitro. In certain embodiments, R is sulfate.

[00335] In formula (IX), R³ is selected from hydrogen, alkyl, substituted alkyl, alkenyl,

substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

[00336] In certain embodiments, R³ is hydrogen. In certain embodiments, R³ is alkyl or

substituted alkyl. In certain embodiments, the alkyl or substituted alkyl comprises 1 to 20 carbons. In certain embodiments, the alkyl or substituted alkyl comprises 5 to 15 carbons. In certain embodiments, the alkyl or substituted alkyl comprises 8 to 12 carbons. In certain embodiments, R 3 is a substituted alkyl which is a benzyl group. In certain embodiments, R 3 is a C₆-Cio alkyl group. [00337] In certain embodiments, R³ is alkenyl or substituted alkenyl. In certain embodiments, the alkenyl or substituted alkenyl comprises 1 to 20 carbons. In certain embodiments, the alkenyl or substituted alkenyl comprises 5 to 15 carbons. In certain embodiments, the alkenyl or substituted alkenyl comprises 8 to 12 carbons. In certain embodiments, R is a C₆-Cio alkenyl group. In certain embodiments, R³ is -(CH₂)4-CH=CH-CH(CH₃)2.

[00338] In certain embodiments, R³ is alkynyl or substituted alkynyl. In certain embodiments, the alkynyl or substituted alkynyl comprises 1 to 20 carbons. In certain embodiments, the alkynyl or substituted alkynyl comprises 5 to 15 carbons. In certain embodiments, the alkynyl or substituted alkynyl comprises 8 to 12 carbons.

[00339] In certain embodiments, R³ is aryl or substituted aryl.

[00340] In certain embodiments, R³ is cycloalkyl or substituted cycloalkyl.

[00341] In certain embodiments, the compound of formula (IX) is of the formula:

or a pharmaceutically acceptable salt thereof.

FORMULATIONS

[00342] Compounds of the present disclosure can be formulated in a pharmaceutical composition suitable for administration to a subject (e.g., by a desired route). A composition comprising a compound of the present disclosure may comprise a pharmaceutically acceptable excipient, a variety of which are known in the art and need not be discussed in detail herein.

[00343] Pharmaceutically acceptable excipients have been amply described in a variety of

publications, including, for example, "Remington: The Science and Practice of Pharmacy", 19th Ed. (1995), or latest edition, Mack Publishing Co; A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., eds 7th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3rd ed. Amer. Pharmaceutical Assoc.

[00344] A subject pharmaceutical composition may comprise other components, such as

pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium, carbonate, and the like. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate

physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, hydrochloride, sulfate salts, solvates (e.g., mixed ionic salts, water, organics), hydrates (e.g., water), and the like.

[00345] In some cases, a subject pharmaceutical composition will be suitable for injection into a subject, e.g., will be sterile. For example, in some embodiments, a subject pharmaceutical composition will be suitable for injection into a subject, e.g., where the composition is sterile and is free of detectable pyrogens and/or other toxins.

[00346] In some embodiments, compounds of the present disclosure are formulated in a sustained release dosage form that is designed to release a compound at a predetermined rate for a specific period of time. Such sustained release formulations may include, for example, formulations for use in drug delivery implants or devices, e.g., ingestible devices.

[00347] Formulations of compounds of the present disclosure may contain additional compounds for the treatment of pain, such as opiates. Opiates that are used in the treatment of pain include naturally-occurring forms, such as morphine and codeine, as well as semi- synthetic opioids, such as hydromorphone, oxycodone, and hydrocodone.

[00348] For oral preparations, the compounds can be used alone or in combination with

appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents. In one embodiment of interest, the oral preparation is provided in the form of an ingestible delivery device, such as a nanoplatform delivery system described herein. [00349] The compounds can be formulated into preparations for injection by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. The compounds can be utilized in aerosol formulation to be administered via inhalation, or can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like.

[00350] Furthermore, the compounds can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases. The compounds of the present invention can be administered rectally via a suppository. The suppository can include vehicles such as cocoa butter, carbowaxes, and polyethylene glycols, which melt at body temperature, yet are solidified at room temperature.

[00351] Unit dosage forms for oral or rectal administration such as syrups, elixirs, and

suspensions may be provided wherein each dosage unit, for example, teaspoonful, tablespoonful, tablet or suppository, contains a predetermined amount of the compounds of the present disclosure. Similarly, unit dosage forms for injection or intravenous administration may comprise one or more compounds in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier.

[00352] The term "unit dosage form," as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of compounds of the present invention calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the unit dosage forms of the present disclosure depend on the particular compound or compounds employed and the effect to be achieved, and the pharmacodynamics associated with each compound in the subject.

[00353] Pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public. [00354] Any of the compounds of the present disclosure may be formulated for use in any route of administration or dosage form disclosed herein.

DELIVERY DEVICES

[00355] In some embodiments, the compounds of the present disclosure are administered to a subject using a delivery device. Suitable delivery devices include transdermal patches; wound treatment preparations and materials, e.g., wound dressing materials, such as fabrics, gauzes, and the like, wound closure materials, such as adhesives, sutures, tapes, and the like; implantable devices, such as pumps and polymeric implants (e.g., substantially biodegradable polymeric implants and substantially non-biodegradable polymeric implants), and the like; any of which may be used to practice the methods of the present disclosure.

[00356] In general, delivery devices suitable for use in the methods of the present disclosure

include a substrate in or on which a compound (or compounds) for delivery is disposed. The substrate can be composed of, for example, a polymeric material, which may be biodegradable or non-biodegradable .

[00357] Suitable polymeric materials that may be used in delivery devices of the present

disclosure include, for example, silicone, poly(methyl methacrylate) (PMMA), poly(2- hydroxyethyl methacrylate) (poly(HEMA), poly(methyl glutaride) (PMGI), poly(ethylene glycol dimethacrylate) (PGDMA), poly (methyl methacrylic acid)-co-PEGDMA, ethylene glycol dimethacrylate (EGDM), polyethylene, polypropylene, poly( vinyl chloride) (PVC), ethylene vinyl acetate copolymer (EVA), polycarbonate, nylon, poly(glycolic acid), poly(lactic acid), copolymers of poly(glycolic acid) and poly(lactic acid), polyurethane, polysaccharide polymers (e.g., linear copolymers of maltotriose or carboxymethylcellulose/hyaluronic acid (e.g. pullulan, Sigma CAS9057-02-7)), phenolic resins (e.g. phenol-formaldehyde resins), cresol isomers, polybutene-l-sulfone, polyisoprene, poly(cis-isoprene), 2,6-bis(4-azidobenzal)-4- methylcyclohexanone ("ABC"), polyepoxide (epoxy) resins, (e.g., SU-8 photosensitive epoxy, e.g. SU-8 2000 permanent epoxy negative photoresist (MicroChem, Newton MA)), and the like.

[00358] Polymeric materials suitable for use in the delivery devices of the present disclosure may be formed into hydrogels. Hydrogels may be homopolymer hydrogels, copolymer hydrogels, multi-polymer hydrogels, or interpenetrating polymeric hydrogels. Hydrogels may be neutral, anionic, cationic, or ampholytic, and may be amorphous, semi-crystalline, or hydrogen bonded. [00359] In some embodiments, the compounds of the present disclosure are loaded into drug- eluting polymeric implants or devices that can be administered to a subject, e.g., by oral administration or by implantation. Compounds of the present disclosure may be loaded into polymeric implants and devices using a variety of methods. In some embodiments, a polymer is mixed with a compound, and the polymeric implant or device is then formed from the mixture, resulting in a polymeric implant or device in which the compound is dispersed throughout the polymer matrix. In other embodiments, the polymeric implant or device may comprise a reservoir into which a compound is placed. In some embodiments, a reservoir may be a discrete feature that is located in or on a specific portion of the polymeric implant or device. In other embodiments, the reservoir may comprise all or a portion of the polymeric implant or device itself, as where the compound is dispersed throughout all or a portion of the polymer matrix of the implant or device.

[00360] Compounds may be loaded into reservoirs by gravity, e.g., by pouring a solution

containing a compound into a reservoir, or by the application of external force, such as by the application of pressure, centrifugation, or spin-coating to load a compound into a reservoir.

Implants, devices, and wound treatment materials and preparations may be submerged in, coated with, or otherwise contacted by a compound or a solution comprising a compound, thus allowing the compound to sufficiently soak into, diffuse into, or coat the implant, device, or wound treatment material or preparation.

[00361] Drug-eluting polymeric devices useful in the methods of the present disclosure include nanoplatform delivery systems such as those made using microfabrication and photolithography techniques. Devices comprising features with micrometer-scale dimensions can be created using microfabrication or photolithography to selectively remove portions of a thin polymeric film from an area of a substrate. Such techniques can be employed to create micrometer-scale reservoirs or other features in polymeric devices that may be useful in accomplishing the methods disclosed herein. Polymeric materials employed as substrates for such devices include positive and negative photoresist materials that can be manipulated by exposure to light and subsequent exposure to a photoresist developer.

[00362] Positive photoresist materials are those materials in which the portion that is exposed to light becomes soluble to a photoresist developer. Portions of the positive photoresist material that are not exposed to light remain insoluble. Negative photoresist materials are those materials in which the portion that is exposed to light becomes insoluble to a photoresist developer. Portions of the negative photoresist material that are not exposed to light are dissolved by a photoresist developer.

[00363] Microfabrication involves successive iterations of forming a substrate layer, applying a photomask and exposing the substrate layer to light, followed by exposing the substrate layer to a photoresist developer that removes non-reacted photoresist from the substrate.

[00364] A substrate layer may be formed by applying a polymeric material to a support, for

example, by spin-coating a substrate material onto a support structure. Once the substrate layer has been applied, a photomask is applied to the substrate. Photomasks are typically designed using computer-aided software, such as AutoCAD (Autodesk, Inc.), to provide an outline of the features that will be patterned onto the substrate during the microfabrication process. For each layer of features on the substrate, a separate photomask is required.

[00365] Photomasks are typically laser-printed in silver on a sheet of polyethylene terephthalate (PETE). To obtain features smaller than 5 μιη, a chrome mask may be used, where the design is printed in chrome on glass to allow fabrication of features down to 1 μιη in size. For negative photoresist substrates, photomasks are designed such that they are clear in areas that define the desired substrate features and opaque in areas where the substrate material is to be etched away. The opposite is true for positive photoresist substrates.

[00366] Once a photomask is placed on a substrate, the substrate is exposed to light, such as UV light of a particular wavelength and intensity, for a desired period of time. After light exposure has been completed, the substrate is washed or rinsed with a photoresist developer that removes any non-reacted photoresist from the substrate to form the desired features.

[00367] In order to make multiple layers of features on a substrate, the above-described process can be repeated. Photomasks are designed with alignment marks to facilitate proper alignment of features during subsequent iterations of the microfabrication process. After all of the successive iterations have been carried out, the microfabricated device is separated from the support structure and is ready for use.

Multilayer Thin Film Delivery Devices

[00368] Multilayer thin film delivery devices that include a plurality of thin film layers and one or more compounds for use in delivery of the compounds to a tissue of a subject in need thereof are provided. In some embodiments, at least one thin film, such as 1, 2, 3, 4, 5 or more thin films, of the subject device includes a biodegradable or non-degradable polymer and a pore forming agent. In some embodiments, at least one thin film, such as 1, 2, 3, 4, 5 or more thin films, of the subject device is a porous thin film (e.g., a microporous thin film or a nanoporous thin film). In some embodiments, the plurality of thin film layers are non-porous and include a compound between two non-porous thin film layers.

[00369] In some embodiments, a multilayer thin film medical device includes a first layer

including a biodegradable or non-degradable polymer and a pore forming agent, a compound, and a second layer in contact with the compound, where the compound is positioned between the first layer and the second layer.

[00370] In some embodiments, the second layer is a non-porous layer (e.g., a backing layer). In some embodiments, the second layer is a porous layer (e.g., a microporous or nanoporous layer). The second layer may include a biodegradable or non-degradable polymer and a pore forming agent. In certain embodiments, the second layer is a nano structured porous layer.

[00371] In some embodiments, the multilayer thin film medical device includes a compound that is positioned between two porous layers. In some cases, one or both of the layers is a

nano structured porous layer. In some cases, one or both of the layers is a microporous layer. In some embodiments, the multilayer thin film medical device includes a reservoir of a compound that is positioned between two layers, where one or both of the layers includes a biodegradable or non-degradable polymer and a pore forming agent. In certain embodiments, the subject device further includes one or more additional nano structured porous layers positioned between the first and/or second layer and the reservoir of the compound.

[00372] In some embodiments, a multilayer thin film medical device includes a first layer

including a biodegradable or non-degradable polymer and a pore forming agent, a compound, and a second non-porous layer in contact with the compound, where the compound is positioned between the first layer and the second layer.

[00373] In some embodiments, a multilayer thin film medical device includes a first porous layer including a biodegradable or non-degradable polymer, a compound, and a second non-porous layer in contact with the compound, where the compound is positioned between the first layer and the second layer. [00374] In certain embodiments, the subject device includes a furled structure (e.g. a substantially cylindrical, substantially conical, or substantially frusto-conical structure). In certain

embodiments, the subject device includes an unfurled structure, where the structure may have a substantially circular peripheral edge.

[00375] In certain embodiments, the subject device further includes a third nanostructured porous layer positioned between the first layer and the reservoir of the compound.

[00376] In some embodiments, a multilayer thin film medical device includes a first non-porous layer including a biodegradable or non-degradable polymer, a compound, and a second non- porous layer in contact with the compound, where the compound is positioned between the first layer and the second layer.

[00377] In certain embodiments, in the subject devices, the first non-porous layer and the second non-porous layer are in contact with each other at the edges of the multilayer thin film thereby sealing the compound inside the multilayer thin film. In certain embodiments, either or both of the non-porous layers are biodegradable. In other embodiments, the either or both of the non- porous layers are non-biodegradable.

[00378] In certain embodiments of the subject devices, the compound is deposited in a plurality of reservoirs that are located across one surface of a second non-porous layer. In other

embodiments, two or more compounds are deposited in the plurality of reservoirs, for example, in the same reservoir or in different reservoirs.

[00379] In certain embodiments, a first compound is deposited in a first reservoir of the plurality of reservoirs located across one surface of the second non-porous layer and a second compound is deposited in a second reservoir of the plurality of reservoirs.

[00380] In other embodiments, a plurality of compounds is present in the multilayer thin film

device. For example, two or more compounds may be present in between a first thin film layer and a second thin film layer.

Pore forming agents

[00381] The pore forming agent is capable of dissolving or eroding away from the first thin film layer to produce a porous first thin film of the polymer that remains. Application of suitable conditions, e.g., contact with an aqueous liquid in vivo, will dissolve the pore forming agent. In certain embodiments, the dissolution of the pore forming agent is rapid, e.g., elution of the compound begins within about 60 minutes after administration, such as within about 30 minutes, within about 15 minutes, within about 10 minutes, within about 5 minutes, or within about 2 minutes after administration.

[00382] In some embodiments, the porous thin film that is formed after dissolution of the pore forming agent is microporous, e.g., the thin film comprises a porous structure having pore sizes of about 1 μιη to about 100 μιη, such as about 1 μιη to about 30 μιη, about 1 μιη to about 20 μιη, or about 1 μιη to about 10 μιη. In certain embodiments, the porous thin film has an average pore size of between about 1 μιη and about 30 μιη, such as between about 1 μιη and about 15 μιη, between about 1 μιη and about 10 μιη, or between about 1 μιη and about 5 μιη. In certain embodiments, the porous thin film has a % porosity of between about 20 % and about 0.01%, such as between about 10 % and about 0.1%, between about 5 % and about 0.1%, or between about 2 % and about 0.1%, and including between about 0.1% and about 0.4%, between about 0.4% and about 1%, and between about 1% and about 2%. In certain embodiments, the microporous thin film has % porosity of 0.1%, 0.5% or 1.8%.

[00383] In some cases, the pore forming agent is biocompatible and/or biodegradable, and

capable of dissolution upon administration to a subject. A suitable pore forming agent may be selected in view of the specific compound and composition of the thin films, and the desired elution profile or release rate of the compound(s). Any suitable water soluble polymer or hydrogel may be used as a pore forming agent. The pore forming agent may be a naturally occurring agent or polymer or a synthetic agent or polymer. In some embodiments, the pore forming agent is a water soluble polymer such as a polyethylene glycol, a polyoxyethylene copolymer, an acrylate polymer, an acrylate- acrylic acid copolymer, a polyacrylic acid, an acrylate copolymer including quaternary ammonium groups, a polyacrylamide, a polyvinyl alcohol, hyaluronan, or a polyvinylpyrrolidone.

[00384] In some embodiments, the pore forming agent is a carbohydrate, a protein or protein derivative, or the like. Exemplary pore forming reagents include, but are not limited to, gelatin, a polyethylene glycol (PEG), chitosan, polyvinylpyrrolidone (PVP), polyvinyl alcohol, or agarose. Any suitable PEG may be selected as a pore forming agent.

[00385] In certain embodiments, at least one thin film of the subject devices includes a ratio by mass of biodegradable or non-biodegradable polymer to pore forming agent that is in the range of between about 1:2 and 99:1, such as between about 1:2, 1:5, or about 7:3 and 9:1, such as about 7:3, about 8:2 or about 9:1.

Biodegradable polymers

[00386] In some embodiments, the subject delivery devices are biodegradable. In some

embodiments, the plurality of thin films of the subject devices each independently include a biodegradable polymer. In some embodiments, the second non-porous thin film layer includes a biodegradable polymer. In some embodiments, the one or more nanoporous thin film layer includes a biodegradable polymer. Thin films of the subject devices can be fabricated from a variety of suitable materials. Exemplary biodegradable polymers include, but are not limited to, biodegradable or bioerodible polymers, such as poly(DL-lactide-co-glycolide) (PLGA), poly(DL-lactide-co-s-caprolactone) (DLPLCL), poly(s-caprolactone) (PCL), or combinations or copolymers thereof, as well as natural biodegradable polymers, such as collagen, and the like. PLGA is a bulk-eroding copolymer of polylactide (PLA) and polyglycolide (PGA). In some embodiments, the biodegradable polymer includes PLA, PGA, PCL, PLGA, or PLCL.

[00387] In some embodiments, the biodegradable polymer includes polycaprolactone (PCL). PCL is an exemplary polymer that is biocompatible and biodegradable in vivo and well tolerated throughout the duration of the presence and degradation of the device. See e.g., Sun et ah, "The in vivo degradation, absorption and excretion of PCL-based device." Biomaterials 27(9) (2006) 1735-1740; Beeley et ah, "Fabrication, implantation, elution, and retrieval of a steroid-loaded polycaprolactone subretinal device." J. Biomed. Mater. Res. A, 73(4) (2005) 437-444; Giavaresi et al. " New polymers for drug delivery systems in orthopaedics: in vivo biocompatibility evaluation. Biomedicine & Pharmacotherapy 58(8) (2004) 411-417.

[00388] In some cases, under physiological conditions the biodegradable polymer degrades by random chain scission, which gives rise to a two-phase degradation. Initially, as molecular weight decreases the physical structure is not significantly affected. Degradation takes place throughout the polymer material, and proceeds until a critical molecular weight is reached, when degradation products become small enough to be solubilized. At this point, the structure starts to become significantly more porous and hydrated. For example, one combination of fast-resorbing PGA and slow-resorbing PLA allows PLGA copolymers to have a resorption rate of

approximately 6 weeks. [00389] In some cases, the biodegradable polymer has a MW of about 80kDa or more and does not degrade until after 1 year or more in the tissue of a subject. In some embodiments, the macroscopic degradation of a biodegradable polymer (e.g., PCL) may occur at about 8 kDa. In some embodiments, the MW of the biodegradable polymer is selected so as to tune the degradation time of the material in vivo. For example, a PCL polymer of about 15 to about 20 kDa may start to structurally break down after 4 months and lose mechanical integrity by 6 months.

[00390] In some embodiments, the biodegradable polymer includes a polymer having a MW of about 10 kDa or more, such as about 15 kDa or more, about 20 kDa or more, about 30 kDa or more, about 40 kDa or more, about 50 kDa or more, about 60 kDa or more, about 70 kDa or more, about 80 kDa or more, about 90 kDa or more, or about 100 kDa or more. In some embodiments, the biodegradable polymer includes a blend of polymers where the polymers may be of the same or a different type of polymer, and each polymer may be of a different MW. In some embodiments, the biodegradable polymer includes a blend of a high MW polymer and a low MW polymer. The high MW polymer may be of about 25 kDa or more, such as about 30 kDa or more, about 40 kDa or more, about 50 kDa or more, about 60 kDa or more, about 70 kDa or more, about 80 kDa or more, about 90 kDa or more, or about 100 kDa or more. The low MW polymer may be of about 20 kDa or less, such as about 15 kDa or less, about 10 kDa or less, about 8 kDa or less, about 6 kDa or less, or about 4 kDa or less.

[00391] In some embodiments, the ratio by mass of the high MW polymer to the low MW

polymer in a blend of polymers is between about 1:9 and about 9:1, such as between about 2:8 and about 8:2, between about 2:8 and about 6:4, or between about 2:8 and about 1:1. In certain embodiments, the ratio by mass of the high MW polymer to the low MW polymer is about 3:17, about 2:8, about 1:3, about 3:7, about 7:13, about 2:3, about 9:11, about 1:1, about 11:9, or about 3:2. In some embodiments, the composition of the biodegradable polymer is selected to provide a melting temperature (T_m) of between about 50 °C and about 70 °C, such as between about 58 °C and about 63 °C. In some embodiments, the composition of the biodegradable polymer is selected to provide a glass transition (T_g) of between about -50 °C and about -80 °C, such as between about -60 °C to about -65 °C.

[00392] In some embodiments, the thickness of the biodegradable polymer layer may range from about 1 micron to about 100 microns. In some embodiments, the thickness of the biodegradable polymer layer may range from about 100 nm to about 990 nm. For example, the thickness of the biodegradable polymer layer may be about 100 nm, 200 nm, 300 nm, 400 nm, 500 nm, 600 nm, 700 nm, 800 nm, 900 nm, or 990 nm.

Reservoirs of Active Compound

[00393] The subject drug delivery devices may include a reservoir of one or more compounds described herein. The reservoir is generally contained within the subject device, such that upon administration, the compound is subsequently eluted from the device into the surrounding tissue of the subject through one or more porous thin film layers.

[00394] In some embodiments, the reservoir is defined by a continuous layer of a composition that includes the compound. In such embodiments, the reservoir of the compound is positioned between a first thin film layer, and a second thin film (e.g., a non-porous thin film), where the first layer may be a thin film that includes a biodegradable or non-biodegradable polymer and a pore forming agent, or a microporous thin film from which the pore forming agent has dissolved. In certain embodiments, a third nanoporous thin film layer is positioned between the first layer and the reservoir of the compound.

[00395] In some embodiments, the reservoir is defined by a plurality of structures in a thin film layer, such as but not limited to, wells, pores, chambers or channels located through and/or across a surface of the thin film, where the structural voids are filled with a composition that includes the compound. For example, the reservoir may be defined by a plurality of wells in a non-porous thin film that are filled with the compound. In such embodiments, the reservoir defined by the plurality of structures may be covered with a further thin film that provides a porous layer upon administration through which the compound can diffuse (e.g., a nanoporous thin film, a microporous thin film or precursor thereof, or a combination thereof). In such cases, this reservoir defined by the plurality of structures may be described as being positioned between a first thin film layer and a second thin film layer. In some cases, the reservoirs may include a plurality of compounds. In some embodiments, a first reservoir of the plurality of reservoirs may include a first compound, and a second reservoir of the plurality of reservoirs may include a second compound. In some embodiments, a plurality of different compounds may be present in the different reservoirs. In some embodiments, the reservoir is defined by multiple thin film layers (e.g., multiple layers of about 10 μιη or less in thickness) where each layer may sequester a compound, and where each layer may be protected from exposure to a hydrating liquid (e.g., liquid from the surrounding tissues of a subject) by the layer above it. In such cases, after administration, compounds are eluted successively from each layer of the reservoir over an extended period of time. Each layer of the reservoir may further comprise a biodegradable polymer that includes structures, such as nanostructures of pores, channels or wells.

[00396] The pore forming agent may protect the compound from degradation by sealing and

maintaining the compound in the device. In certain embodiments, the device is storage stable, e.g., the compound maintains its bioactivity for an extended period of time, such as, 1 or more months, 2 or more, 3 or more, 6 or more, 9 or more or 12 or more months. In some embodiments, dissolution of the pore forming agent provides for an elution profile of the compound to the surrounding tissue upon placement of the device in a subject (e.g., a delayed elution profile, two elution profiles, a substantially zero order elution profile).

[00397] The compounds may be in a purified form, partially purified form, or any other form

appropriate for inclusion in the multilayer thin film device. The compounds may be free of impurities and contaminants. The compound(s) disposed in the multilayer thin film drug delivery device may include stabilizing agents as additives to increase the stability of the compound(s). For example, the compound may be combined with a stabilizer, such as commercially available stabilizers. In general, the stabilizer used may depend upon the type of compound(s) included in the multilayer thin film device.

Nanoporous thin films

[00398] In some embodiments, one or more thin film layers, such as 1, 2, 3 or more thin films, of the subject devices are nanoporous. As used herein, the term "nanoporous" refers to a

nano structured thin film porous layer where the average pore size is sub-micrometer, such as between about 1 nm and about 990 nm, between about 1 nm and about 100 nm, between about 2 nm and about 700 nm, between about 2 nm and about 500 nm, between about 3 nm and about 400nm, between about 5 nm and about 200 nm, or between about 7 nm and about 50 nm.

[00399] In some embodiments, a nanoporous thin film is positioned between another thin film as described above (e.g., that includes a biodegradable polymer and a pore forming agent), and a reservoir of a compound. The nanoporous thin film is in contact with the compound and provides for a desired elution profile of the compound (e.g., a substantially zero-order elution profile that avoids an initial burst effect) from the subject device. For example, by controlling parameters of the nanoporous thin film such as pore size, polymer thickness, porous area, and pore density, the nanoporous thin film can act as a diffusion barrier for a variety of compounds.

[00400] In some embodiments, the nanoporous thin film includes a biodegradable polymer as described above (e.g., PCL). In some embodiments, the nanoporous thin film has a thickness of about 10 μιη or less, such as about 8 μιη or less, about 6 μιη or less, about 4 μιη or less, about 2 μιη or less, or about 1 μιη or less.

Multilayer thin film structures

[00401] The subject drug delivery devices may form any convenient structure, such as but not limited to, a furled or an unfurled structure, a folded structure, a tubular structure, a planar structure, a toric structure or a discoid structure.

[00402] In some embodiments, the subject devices form either a furled or an unfurled structure.

As used herein, the term "furled" refers to a structure of a material where the material is curled or rolled upon itself (e.g., the structure is an annular sheet disposed about a central axis) as compared to a substantially planar, flat or "unfurled" structure of the material. The term "furling" refers to the process of transforming a material from an unfurled structure to a furled structure (e.g., whereby a flat sheet curls around a central axis to form an annular structure). The term "unfurling" refers to the reverse process where the thin film is unrolled, unfolded, or spread out. Application of suitable furling or unfurling conditions to a subject device can result in transformation to produce a desired furled or unfurled structure, respectively. A multilayer thin film device structure of the present disclosure may spontaneously furl or unfurl in response to suitable conditions. For example, drying conditions sufficient to furl the subject device and produce a furled structure. Alternatively, contact of a furled multilayer thin film structure with a hydrating liquid (e.g., a bodily fluid of a subject), produces a substantially planar unfurled structure. In some cases, upon administration and contact with a hydrating liquid, the multilayer thin film medical device expands. By "expands" is meant that the thin film becomes larger in size or volume as a result of the surrounding liquid hydrating the film.

[00403] In certain embodiments, the furled structure is substantially cylindrical, e.g., a structure where a planar film has curled upon itself to form a cylindrical shape. In certain embodiments, the furled structure is substantially frusto-conical. By frusto-conical is meant a structure having the shape of a frustum of a cone, i.e., the shape of a cone whose tip has been truncated by a plane parallel to its base.

[00404] In certain embodiments, the device has an unfurled structure that includes a substantially circular peripheral edge.

[00405] In some embodiments, the multilayer thin film devices are fabricated to have a diameter of between about 1 mm and about 50 mm, such as between about 1 mm and about 10 mm, between about 2 mm and about 8 mm, between about 3 mm and about 7 mm, between about 4 mm and about 6 mm. In some cases, the diameter is about 1 mm, about 2 mm, about 3 mm, about 4 mm, about 5 mm, about 6 mm, about 7 mm, about 8 mm, about 9 mm or about 10mm. In some embodiments, the multilayer thin film devices are fabricated to have an area between about 1 mm 2 and about 100 mm 2 , including between about 4 mm 2 and about 64 mm 2 , between about 9 mm 2 and about 49 mm 2 , between about 16 mm 2 and about 36 mm 2 , such as about 16 mm 2 , about 25 mm 2 , or about 36 mm 2.

[00406] In some embodiments, the multilayer thin film is fabricated to have a thickness between about 1 μιη and about 1mm, such as between about 10 μιη and about 500 μιη, between about 50 μιη and about 300 μιη, between about 100 μιη and about 200 μιη, such as about 100 μιη, about 125 μιη, about 150 μιη, about 175 μιη or about 200 μιη.

Methods of Preparing Multilayer Drug Delivery Devices

[00407] Also provided are methods of preparing the subject multilayer thin film drug delivery devices. In some embodiments, the method includes fabricating a first thin film layer that includes a biodegradable or non-degradable polymer and a pore forming agent; depositing a layer of a compound over the first thin film layer; positioning a second thin film layer (e.g., a non-porous or porous layer) over the layer of the compound to produce a multilayer thin film structure; sealing the compound between the first thin film layer and the second thin film layer, by using an adhesive, or by using heat, or a solvent to melt the layers; and forming a furled structure of the multilayer thin film device by drying the multilayer thin film structure for a sufficient period of time or by mechanically rolling the device. In some embodiments, a single film may be sealed to itself around a reservoir of a compound to create a single film multilayer device. [00408] The thin film layers may be fabricated using any convenient method. For example, the first thin film layer that includes a biodegradable or non-biodegradable polymer and a pore forming agent, as described above, may be fabricated by spin-casting a solution of biodegradable polymer (e.g., PCL) and pore forming agent (e.g., gelatin) onto a flat circular mold using methods readily adapted from those described by Steedman et al. ("Enhanced differentiation of retinal progenitor cells using microfabricated topographical cues. Biomedical Microdevices", 12(3) (2010) 363-369). The second non-porous thin film layer may be fabricated using similar methods to those described above. Devices with non-porous first thin film layers may be fabricated using similar methods to those described above.

[00409] A reservoir of a compound may be prepared in the subject multilayer thin films, e.g., as a discrete layer of a composition that includes the compound. The layer including the compound may be prepared using any convenient method. For example, the layer including the compound may be formed by application to a thin film of a solution that includes the compound, followed by subsequent drying (e.g., evaporation). The layer including the compound is positioned between the first and second thin film layers.

[00410] In certain embodiments, the sealing step of the subject methods is performed using an annulus that may be heated. An exemplary heating step includes the use of an annulus (e.g., a PDMS annulus heated) that is heated to a temperature (e.g., 80 °C) above the melting

temperature of the polymers (e.g., PCL) used in the fabrication of the thin film layers.

Application of the heated annulus to one surface of the multilayer thin films (e.g., by pressing down on the annulus with a flat stainless steel weight for 30 seconds) melts and seals the films together to produce a multilayer thin film structure having an annular circumference. The size and shape of the annulus may be selected to produce devices of a desired size. In such cases, the first thin film layer and the second thin film layer are bonded thereby sealing the compound between the layers of the multilayer thin film structure.

[00411] In certain embodiments, the sealing step of the subject methods is performed using a laser beam to heat a defined area of the thin film layers, for example, a circular area surrounding the area where the compound has been disposed. In certain embodiments, the sealing step of the subject methods is performed by disposing an adhesive material on one or both of the thin film layers. For example, an adhesive material may be disposed on the first thin film layer and/or the second thin film layer in an area surrounding the area where the compound is disposed. The adhesive may seal the two layers when the two layers are brought in contact. Alternatively, the adhesive may be a heat sensitive adhesive or a pressure sensitive adhesive. In these

embodiments, heat or pressure may be applied in order to seal the layers of the thin film device.

[00412] In some embodiments, forming a furled multilayer thin film device may be performed by drying the multilayer thin film device, for example, under conditions sufficient to allow the multilayer thin film structure to form a furled structure. In other embodiments, forming a furled multilayer thin film device may be performed by mechanically rolling the multilayer thin film device into a furled structure.

[00413] In some embodiments, the method of preparing the subject device is a method that

includes fabricating a first nanoporous thin film layer over a nanotemplate; fabricating a second thin film layer comprising a biodegradable polymer and a pore forming agent over the first nanoporous thin film layer; removing the first and second thin film layers from the nanotemplate; fabricating a third non-porous thin film layer comprising a plurality of reservoir wells; depositing a compound in the plurality of reservoir wells; positioning the third non-porous thin film layer over the first and second layers to produce a multilayer thin film structure; sealing the multilayer thin film structure to bond the first thin film layer to the third thin film layer thereby sealing the compound between the multilayer thin film structure; and furling the multilayer thin film device by, for example, drying the multilayer thin film device for a sufficient period of time to allow the multilayer thin film structure to form a furled structure, or by rolling the multilayer thin film device, such as mechanically rolling.

[00414] The subject method may be performed using methods similar to those described above.

The first nanoporous thin film layer may be fabricated by any convenient method. For example, a nanotemplate synthesis method may be used to produce nanostructures in a biodegradable polymer thin films that are readily adapted for use in the subject methods of preparation. An inorganic nanotemplate of aligned and ordered nanowires (e.g., ZnO rods) may be prepared using any convenient method. A variety of techniques may be used to deposit a polymer (e.g., a biodegradable polymer) onto the nanotemplate. For example, the polymer can be heated above its melting point and allowed to conform to the template. For example, spin casting of polymer solutions may be used. In some cases, to provide mechanical robustness, prior to template removal, a second thin film layer (e.g., a microporous thin film layer, or a layer that includes a pore forming agent) is fabricated on top of the first nanoporous thin film layer. In some embodiments, the thickness of the nanoporous thin film layer corresponds to the lengths of the nanorods of the template.

[00415] A reservoir of one or more compounds may be incorporated into the multilayer thin film before administration to a subject, using any convenient method. For example, by dipping the device during fabrication into a solution or dispersion containing the compound. In some embodiments, a composition that includes the compound is deposited on a thin film that includes a plurality of structures, as described above. The composition fills the structural voids defined by these structures (e.g., wells across on surface of a non-porous thin film). The reservoir of the compound may then be positioned between the first and second thin film layers, and the multilayer thin film structure subsequently sealed and furled, as described above.

Methods of Local Delivery of Compounds

[00416] Also provided is a method of localized delivery of a compound to a tissue of a subject. In some embodiments, the method includes administering to a subject a multilayer thin film drug delivery device, as described above. By administering is meant positioning the device at a location in the body of a subject. Positioning the device in a subject may be carried out by placing the device (e.g., placing surgically, injection by syringe or delivery by catheter, placing orally in mouth) in any suitable opening, tissue, or body cavity of the subject where local delivery of the compound is desired. For example, the device may be injected into an organ or tissue of the subject, or may be positioned in any convenient space in a tissue mass. The device may have a furled structure suitable for injecting, e.g., injection by syringe.

[00417] When a furled multilayer thin film device is positioned in the subject, it may contact a hydrating liquid in the subject and unfurl to produce an unfurled multilayer thin film structure. In addition, the hydrating liquid may dissolve the pore forming agent from a layer of the unfurled multilayer thin film structure to produce a porous layer that provides for release of the compound from the medical device.

[00418] In some embodiments, the subject device releases the compound in a time-controlled fashion. In this way, the therapeutic advantages imparted by the addition of the compound may be continued for an extended period of time. In some embodiments, the subject device will elute the compound to the surrounding tissue upon placement of the device in the patient for a period ranging from about 2 minutes to about 1 day or more, such as 2 days or more, 3 days or more, 7 days or more, 14 days or more, 21 days or more, or 1 month or more. In certain embodiments of the subject method, the releasing device locally delivers an effective amount of the compound over an extended period of time, e.g., 1 or more months, such as 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 9 or more or 12 or more months.

[00419] In certain embodiments of the subject method, the elution of the compound from the drug delivery device is a controlled release that occurs without an initial burst of the compound. By "without an initial burst" is meant that the compound does not release from the device in an appreciable amount during a predetermined initial period (e.g., 1 week or less, such as 3 days or less, 1 day or less, 12 hours or less, 6 hours or less, 3 hours or less, or 1 hour or less). The presence and level of an initial burst of a compound may be readily determined by one of ordinary skill in the art employing any convenient pharmacological methods. For example, less than about 50% of the compound is released in the predetermined initial period, such as less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 2%, or less than about 1% of the compound.

[00420] In certain embodiments of the subject method, the releasing of the compound from the drug delivery device is substantially zero order over an extended period of time. By

"substantially zero order" is meant a release profile of the compound from the device that provides for a substantially constant release of drug, e.g., a release profile where the fraction of the compound eluted from the device is substantially linear with respect to time, over an extended period of time. For example, a release profile where about 20% or less, such as about 10% or less, or 5% or less of the compound is released after 10 days following administration. For example, a release profile where about 40% or less, such as about 20% or less, or about 10% or less of the compound is released after 20 days following administration. For example, a release profile where about 60% or less, such as about 30% or less, or about 15% or less of the compound is released after 30 days following administration. For example, a release profile where about 80% or less, such as about 40% or less, or about 20% or less of the compound is released after 40 days following administration. For example, a release profile where about 80% or less, such as about 70% or less, about 60% or less, or about 50% or less of the compound is released after 50 days following administration. For example, a release profile where about 90% or less, such as about 80% or less, about 70% or less, about 60% or less, or about 50% or less of the compound is released after 60 days following administration. [00421] The bioactivity or stability of the compound may be maintained in the drug delivery device after administration for an extended period of time. For example, the bioactivity of a compound per unit amount of the compound that is eluted from the device is substantially constant over an extended period of time, e.g., 1 month or more, 2 months or more, 70 days or more, 3 months or more, 6 months or more, or 1 year or more. Accordingly, the subject devices provide for a significant improvement in maintaining the bioactivity of a compound over an extended period of time, e.g., 1 month or more, 2 months or more, 70 days or more, or 3 months or more, 6 months or more, or 1 year or more as compared to the bioactivity of the compound that is similarly positioned in a subject but not present in a multilayer thin film device.

[00422] In certain embodiments of the subject methods, the multilayer thin film drug delivery device further comprises a third nanostructured porous layer positioned between the first layer and the reservoir of the compound, wherein the third nanostructured porous layer includes a biodegradable polymer (e.g., PCL). In certain embodiments, the third nanostructured porous layer has an average pore size of between about 2 nm and about 50 nm.

[00423] In certain embodiments of the subject method, the third non-porous layer is

biodegradable. In certain embodiments, the third non-porous layer includes PCL.

[00424] The methods and devices disclosed herein can be used for both human clinical medicine and veterinary applications. Thus, the subject or patient to whom the device is administered can be a human or, in the case of veterinary applications, can be a laboratory, agricultural, domestic, or wild animal. The subject devices and methods can be applied to animals including, but not limited to, humans, laboratory animals such as monkeys and chimpanzees, domestic animals such as dogs and cats, agricultural animals such as cows, horses, pigs, sheep, goats, and wild animals in captivity such as bears, pandas, lions, tigers, leopards, elephants, zebras, giraffes, gorillas, dolphins, and whales.

[00425] In some embodiments, the release kinetics of the one or more compounds that are eluted from the subject devices provide for a substantially constant local delivery of a therapeutically relevant dosage of the compound. In certain embodiments, the release kinetics of the compound are substantially zero order over an extended period of time. In some embodiments, a

composition of the subject device may be designed to provide for two elution profiles, e.g., a first early elution of a compound from a first layer, and a second, later elution of a compound from a second layer. In some embodiments, the compound is stable in the subject devices over an extended period of time. In certain embodiments, the activity of the compound in the reservoir is maintained following administration in vivo. For example, the activity of the compound in the reservoir is maintained over a period of about 30 or more days, such as about 60 or more days, 70 or more days, 3 or more months, about 4 or more months, about 5 or more months, about 6 or more months, about 8 or more months, about 10 or more months, or about 12 or more months.

ROUTES OF ADMINISTRATION AND DOSAGE FORMS

[00426] In practicing the methods of the present disclosure, routes of administration may be selected according to any of a variety of factors, such as properties of the compound(s) to be delivered, the type of condition to be treated (e.g., type of surgical wound site), and the like. For example, compounds of the present disclosure can be administered orally, such as through the digestive tract (enteral administration), buccal, sublabial, or sublingual administration. Such dosage forms may be pills, tablets, capsules, time-release formulations, osmotic controlled release formulations, solutions, softgels, hydrogels, suspensions, emulsions, syrups, orally disintegrating tablets, films, lozenges, chewing gums, mouthwashes, ointments, and the like.

[00427] Compounds of the present disclosure can also be administered through the respiratory tract. Such dosage forms may be smoking devices, dry powder inhalers, pressurized metered dose inhalers, nebulizers, vaporizers, and the like.

[00428] Compounds of the present disclosure can be administered by direct injection into a target tissue or into the blood stream, including intradermal, subcutaneous, intravenous, intracardiac, intramuscular, intraosseous, or intraperitoneal injection. Compounds of the present disclosure can be administered by intracavernous or intravitreal delivery to organs or tissues, or administered by intracerebral, intrathecal, or epidural delivery to tissues of the central nervous system.

[00429] Compounds of the present disclosure can be administered locally or topically. Such

dosage forms include creams, gels, liniments, balms, lotions, ointments, drops, skin patches, and the like. Topical dosage forms may be used for the treatment of wounds, including surgical wounds as well as wounds resulting from non-surgical trauma. Such dosage forms may include those for the immediate treatment of wounds as well as those for long-term treatment of wounds throughout the healing process. Dosage forms for the long-term treatment of wounds, such as post-operative treatment of surgical wounds or long-term treatment of wounds resulting from non-surgical trauma, may take the form of bandages, gauzes, fabrics, adhesives, and the like.

[00430] In the methods of the present disclosure, the compounds may be administered to the subject using any convenient routes of administration that are capable of resulting in the desired treatment of pain. Thus, the compounds can be incorporated into a variety of formulations for therapeutic administration. More particularly, the compounds of the present disclosure can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols.

[00431] In pharmaceutical dosage forms, the compounds of the present disclosure may be

administered in the form of their pharmaceutically acceptable salts, or they may also be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds. The previously-described routes of administration and dosage forms are merely exemplary and are in no way limiting.

METHODS OF USE

[00432] The present disclosure provides methods for the treatment of pain, wherein the method involves administration of one or more compounds that provide for inhibition of activity of TRPVl transcription factors and, in some embodiments, administration of one or more compounds that provide for modulation of TRPVl receptor activity. Combination therapies are contemplated which involve administration of one or more TRPVl transcription factor - inhibitors and one or more TRPVl activity-modulators.

[00433] "Combination" as used herein is meant to include therapies that can be administered separately, e.g., formulated separately for separate administration (e.g., as may be provided in a kit), or undertaken as a separate regimen, as well as for administration in a single formulation (i.e., "co-formulated") for administration to a subject. Thus, the methods of the present disclosure contemplate both administration of TRPVl transcription factor inhibitors and TRPVl modulators separately (by the same or different route) as well as a co-formulation.

[00434] Where a compound is administered in combination with one or more other compounds or therapies, the combination can be administered anywhere from up to 5 hours or more, e.g., 10 hours, 15 hours, or 20 hours prior to or after administration of the first compound. In certain embodiments, combinations of the compounds disclosed herein are administered or applied sequentially, e.g., where a compound is administered before or after another compound or therapeutic treatment, where the dose of each compound may be separated by up to several hours (e.g., 4, 8, or 12 hours). In yet other embodiments, a combination of compounds is administered together, but in separate formulations, e.g., where a first compound and a second compound are administered at the same time, e.g., where a combination of compounds can be administered as two separate formulations or combined into a single formulation (e.g., co -formulated) that is administered to the subject. Regardless of whether administration is achieved sequentially or simultaneously, as discussed above, the treatments are considered to be administered together or in combination for purposes of the present disclosure.

[00435] In some embodiments, the combination of mithramycin, or a derivative thereof, and

eugenol is used to treat pain. For example, at least one of mithramycin A, mithramycin SK, or mithramycin SDK is administered in combination with eugenol for the treatment of pain. In some embodiments, one or more nucleic acid agents that inhibit the activity of a TRPV1 transcription factor are administered in combination with eugenol for the treatment of pain. In some embodiments, diclofenac is administered in combination with eugenol for the treatment of pain. In some embodiments, tolfenamic acid is administered in combination with eugenol for the treatment of pain.

[00436] In some embodiments, the combination of mithramycin, or a derivative thereof, and

capsaicin is used to treat pain. For example, at least one of mithramycin A, mithramycin SK, or mithramycin SDK is administered in combination with capsaicin for the treatment of pain. In some embodiments, one or more nucleic acid agents that inhibit the activity of a TRPV1 transcription factor are administered in combination with capsaicin for the treatment of pain. In some embodiments, diclofenac is administered in combination with capsaicin for the treatment of pain. In some embodiments, tolfenamic acid is administered in combination with capsaicin for the treatment of pain.

[00437] In some embodiments, the combination of mithramycin, or a derivative thereof, and

curcumin is used to treat pain. For example, at least one of mithramycin A, mithramycin SK, or mithramycin SDK is administered in combination with curcumin for the treatment of pain. In some embodiments, one or more nucleic acid agents that inhibit the activity of a TRPV1 transcription factor are administered in combination with curcumin for the treatment of pain. In some embodiments, diclofenac is administered in combination with curcumin for the treatment of pain. In some embodiments, tolfenamic acid is administered in combination with curcumin for the treatment of pain.

[00438] In some embodiments, at least one of mithramycin A, mithramycin SK, mithramycin SDK, one or more nucleic agents that reduce the expression of Spl, Sp3, or Sp4, diclofenac, or tolfenamic acid may be administered in combination with at least one of eugenol, curcumin, or capsaicin for the treatment of pain.

[00439] In some embodiments, a nucleic acid agent that reduces the expression of Spl, Sp3, or Sp4 is administered to a subject to treat pain.

[00440] In some embodiments, at least one of mithramycin A, mithramycin SK, or mithramycin SDK is administered to a subject to treat pain.

[00441] In some embodiments, diclofenac is administered to a subject to treat pain. In some

embodiments, tolfenamic acid is administered to a subject to treat pain.

[00442] In some embodiments, one or more of mithramycin or a derivative thereof (e.g.,

mithramycin A, mithramycin SK, mithramycin SDK), one or more nucleic agents that reduce the expression of Spl, Sp3, or Sp4, diclofenac, or tolfenamic acid may be combined and

administered to a subject to treat pain.

[00443] In general, the methods of the present disclosure involve administration of an effective amount of one or more of the above described compounds to a subject in need of treatment, where "effective amount" means a dosage sufficient to produce a desired result, where the desired result is at least an amelioration, and can include complete cessation, of pain for a desired period. More specifically, the amount of a compound that is an effective amount of a compound is an amount that inhibits the activity of a TRPV1 transcription factor and/or modulates the activity of the TRPV1 receptor. While exact amounts may vary depending on the nature of the compound and delivery vehicle employed, and can be readily determined empirically by those of skill in the art, in many embodiments, the amount of a compound that is administered in any given dose or dosage regimen provides for the following target tissue and/or blood

concentrations: Mithramycin A, SK, SDK, (from about 5 nM - 50 nM); Tolfenamic acid (from about 0.5 μΜ - 100 μΜ); Diclofenac (from about 5 μΜ - 100 μΜ); Eugenol (from about 300 μΜ-l mM); Curcumin (from about 1 μΜ - 10 μΜ); Capsaicin (from about 0.5 μΜ -5μΜ), where such target time and/or blood concentrations are maintained for a period, e.g., at least about 8 hours, about 12 hours, about 24 hours, or more. Where a combination of compounds is administered, the same or similar amounts of each compound as described above may be used. For example, where a combination of mithramycin A and eugenol is administered, the target blood concentration of mithramycin A may be about 50nM for at least 24 hours, and the target blood concentration of eugenol may be about 300 μΜ for at least 24 hours. Where the TRPV1 transcription factor is a nucleic acid agent, the nucleic acid agent is administered in amount effective to inhibit transcription and/or translation of the target TRPV1 transcription factor (e.g., an amount effective to inhibit expression of Spl, Sp3, or Sp4).

[00444] Treatment regimens may include a single dose, or a plurality of different doses

administered over various time intervals, e.g., hourly, daily, weekly, monthly, etc. In general, the methods involve administration of a therapeutically effective amount of a TRPV1 transcription factor inhibitor and a TRPV1 modulator to a subject in need thereof. The amount administered varies depending upon the goal of the administration, the health and physical condition of the individual to be treated, age, the degree of resolution desired, the formulation of a subject composition, the activity of the subject composition employed, the treating clinician's assessment of the medical situation, the condition of the subject, the body weight of the subject, as well as the severity of the disease, disorder, or condition, and other relevant factors. The size of the dose will also be determined by the existence, nature, and extent of any adverse side-effects that might accompany the administration of a particular compound.

[00445] It is expected that the dosage amount will fall in a relatively broad range that can be

determined through routine trials. For example, the amount of compound or combination of compounds employed to treat pain in a subject is not more than about the amount that could otherwise be irreversibly toxic to the subject (i.e., maximum tolerated dose). In other cases, the amount is around or even well below the toxic threshold, but still in an effective concentration range, or even as low as a threshold dose.

[00446] A variety of subjects are treatable according to the methods of the present disclosure.

Generally such subjects are "mammals" or "mammalian," where these terms are used broadly to describe organisms which are within the class mammalia, including the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs, and rats), and primates (e.g., humans, chimpanzees, and monkeys). In many embodiments, the subjects will be humans. [00447] The methods of the present disclosure can be applied in the treatment of any of a variety of types of pain, including acute pain, persistent pain and chronic pain, and can involve sensory neurons. "Pain" as is used herein means an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage. "Acute pain" as used herein means pain that comes on quickly and may last a short time (e.g., a few hours) or continue for days, weeks or months. Acute pain typically serves as a warning of injury or illness. Acute pain can range from mild to severe and is often caused by an injury or sudden illness. "Persistent pain" as used herein generally refers to a post-surgical, post traumatic or other post- wound infliction period and generally refers to a pain state present for more than two months after such surgery or other wound infliction, which cannot be wholly attributed to other causes. "Chronic pain" as used herein means pain that persists beyond normal tissue healing time, which is assumed to require a period of about three months. Chronic pain may occur in the context of numerous diseases and syndromes or following tissue and/or nerve injury.

[00448] Pain amenable to treatment includes mechanical pain, inflammatory pain, tissue injury pain, nerve injury pain, and mixed nerve and tissue injury pain. Pain amenable to treatment also includes pain accompanying wounds, which may be a result of, for example, accidental or intentional infliction. Examples of surgical wounds include, but are not limited to, those resulting from craniotomy, neck dissections, median sternotomy, cardiothoracic surgery, posterolateral thoracotomy, anterolateral thoracotomy, thyroid surgery, rib fracture, plastic surgical procedures (breast augmentation/reduction, liposuction, spine access procedures, knee surgery, hip surgery, and arthroscopy. In addition, wounds resulting from abdominal surgery and/or alternately, midline incision, hernia repair, laparotomy and/or laparoscopic procedures and the like are amenable to treatment according to the methods disclosed herein.

[00449] In addition to the above, pain amenable to treatment includes that originating from tissue injury, nerve injury, or a combination of tissue and nerve injury that arises from

pathophysiologic states. These include but are not limited to chronic inflammation of the joints including that associated with autoimmune and degenerative joint disease (rheumatoid arthritis, osteoarthritic, juvinile arthritis), which are significant causes of acute and chronic pain, morbidity, disability and functional impairment. Tissue and/or nerve injuries of the spine also initiate and sustain spinal pain syndromes that are amenable to analgesic treatment. These include: lower back pain, sciatica/radicular chronic pain syndromes, lumbar disc disease, chronic post-operative pain, spinal stenosis, congenital spinal malformation, post traumatic back pain, de novo scoliosis, ankylosing spondylosis, rheumatic spine disease, pseudoarthrosis, and

neuromuscular scoliosis. Also, pain arising from these spinal structures may require specific application of the analgesic agent(s) via epidural application, zygapophysial joint and disc injection, the superior pedical of the vertebral level of interest or the intervertebral disk of the level of interest associated with acute and/or chronic back pain.

[00450] In some embodiments, the methods of the present disclosure involve treatment of pain arising from or associated with dental procedures. Following a dental procedure (e.g., tooth extraction or endodontic procedures involving root end surgery), a delivery device may be applied directly to the dental bed to treat pain.

[00451] The delivery devices described herein may be tunable to achieve the desired release of compounds over a desired time period to treat pain in the subject. Such may be achieved by, for example, providing for a desired delivery profile of one or more compounds.

[00452] One or more compounds that modulate the activity TRPV1, alone or in combination with one or more compounds that inhibit a TRPV1 transcription factor, may be used to bridge the period of time between application of a local anesthetic and onset of pain arising from tissue granulation and repair associated with resolution of acute post interventional pain. For example, where the pain to be treated involves surgical intervention (e.g., as in surgical dental procedures), the compounds can be administered following application of a local anesthetic, and may be administered prior to, during, or after the time of surgical intervention.

[00453] In some embodiments, the methods of the present disclosure involve treatment of pain other than cancer pain, e.g., other than bone cancer pain. For example, where the methods of the present disclosure involve a TRPV1 transcription factor monotherapy, the pain to be treated is other than cancer pain, e.g., other than bone cancer pain.

[00454] Those of skill in the art will readily appreciate that dose levels can vary as a function of the specific compound, the severity of the symptoms and the susceptibility of the subject to side effects. Preferred dosages for a given compound are readily determinable by those of skill in the art by a variety of means.

[00455] As mentioned above, by treatment is meant that at least an amelioration of pain

symptoms is achieved, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a pain symptom. As such, treatment for pain also includes situations where pain is completely inhibited, e.g., prevented from happening, or stopped, e.g., terminated, such that the subject no longer suffers from pain.

SCREENING METHODS

[00456] In some embodiments, the present disclosure relates to methods for screening compounds that may be effective in the treatment of pain. Compounds identified by the screening methods of the present disclosure may be used in the treatment of pain.

[00457] In some embodiments, the screening method involves culturing cells in vitro and

contacting the cultured cells with test compounds. In certain embodiments, cells that express specificity proteins Spl, Sp3, or Sp4 are used to screen test compounds. A cultured cell expressing a TRPVl transcription factor and TRPVl (e.g., a neuronal cell) is contacted with a test compound, and the level of expression of the Spl, Sp3, or Sp4 gene is detected. A decrease in the level of expression of the gene in the presence of the test compound as compared to the level of expression of the gene in the absence of the test compound indicates that the test compound may have use in the treatment of pain.

[00458] The screening methods of the present disclosure may also be used to screen for

compounds with the ability to inhibit the activity of a cyclooxygenase 2 (COX-2) while maintaining a desirable level of expression of an Spl, Sp3, and/or Sp4 gene. Cultured cells are contacted with test compounds that inhibit the activity of COX-2. Test compounds that elicit a desirable level of expression of an Spl, Sp3, or Sp4 gene in the cell may be useful in the treatment of pain.

[00459] In some embodiments, transgenic animal models may be used to screen test compounds for use in the treatment of pain. In some embodiments, a transgenic animal that is deficient in expression of a TRPVl transcription factor (i.e., a heterozygous or homozygous knock-out in at least one of Spl, Sp3, or Sp4) gene may be used in an assay to assess compounds that act to relive pain in a manner specific for a TRPVl transcription factor. Such transgenic animals (e.g., transgenic mice) can be used in any of a variety of pain models, including models of

inflammatory or mechanical pain, nerve pain, pain caused by tissue injury, and combination pain models of nerve and tissue injury.

[00460] Any of a variety of candidate agents can be screened for potential activity in the

treatment of pain. "Candidate agents" is meant to include synthetic, naturally occurring, or recombinantly produced molecules (e.g., small molecule; drugs; peptides; antibodies (including antigen-binding antibody fragments, e.g., to provide for passive immunity); endogenous factors present in eukaryotic or prokaryotic cells (e.g., polypeptides, plant extracts, and the like)); etc.). Of particular interest are screening assays for agents that have a low toxicity for human cells.

[00461] Candidate agents encompass numerous chemical classes, though typically they are

organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents may be created synthetically or may be found among biomolecules including, but not limited to: peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

[00462] Candidate agents can be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

[00463] The candidate agent can be administered in any manner desired and/or appropriate for delivery of the agent in order to examine paint treatment activity. For example, the candidate agent can be administered topically, by injection (e.g., by injection intravenously,

intramuscularly, subcutaneously, and the like), orally, or by any other desirable means.

[00464] The screening method can involve administering varying amounts of the candidate agent (from no agent to an amount of agent that approaches an upper limit of the amount that can be delivered successfully to the animal, e.g., within toxicity limits), and may include delivery of the agent in different formulations and routes. The agents can be administered singly or can be combined in combinations of two or more, especially where administration of a combination of agents may result in a synergistic effect.

[00465] The ability of a candidate agent to inhibit pain in a manner that involves a TRPV1

transcription factor can be assessed by comparing the levels of pain response observed in transgenic and wild type animals. Transgenic animals with deficient or diminished expression of the TRPV1 transcription factor gene will ordinarily exhibit diminished pain responses when compared to wild type animals. When a candidate agent is administered to both the transgenic and the wild type animals and the wild type animals exhibit pain responses that are similar to those of the transgenic animals, this indicates that the candidate agent inhibits the activity of a TRPV1 transcription factor, and may therefore have use in the treatment of pain.

KITS

[00466] Also provided by the present disclosure are kits for using the compounds disclosed herein and for practicing the methods, as described above. The kits may be provided for administration of the subject compounds to a subject in need of such treatment. The kit can include one or more of the compounds disclosed herein, which may be provided in a sterile container, and can be provided in formulation with a suitable pharmaceutically acceptable excipient for administration to a subject. The compounds can be provided with a formulation that is ready to be used as it is or can be reconstituted to have the desired concentrations. Where the compounds are provided to be reconstituted by a user, the kit may also provide buffers, pharmaceutically acceptable excipient, and the like, packaged separately from the subject compounds. The compounds of the present kit may be formulated separately or in combination with other drugs. Where a compound is formulated separately with another drug, a subject kit can include: 1) a first container (e.g., a sterile container) comprising a subject pharmaceutical composition (e.g., a pharmaceutical composition comprising a subject compound); and 2) a second container (e.g., a sterile container) comprising a second agent (e.g., a therapeutic agent that treats a disease, disorder, or condition).

[00467] In addition to the above-mentioned components, the kits can further include instructions for using the components of the kit to practice the subject methods. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging), etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.

METHODS AND MATERIALS [00468] The following methods and materials were used in the examples below.

Chromatin Immunoprecipitation assay (ChIP)

[00469] Identification of Spl-like transcription factor binding to the TRPV1 promoter in native rat dorsal root ganglion (DRG) chromatin was obtained using ChIP-IT® Enzymatic (Active Motif, Carlsbad, CA) with the following modifications: Whole rat DRG or enriched DRG neurons were harvested on ice then dounce homogenized ten times in an ethanol - dry ice bath followed by crosslinking (1% formaldehyde in PBS). Goat IgG antiserum directed against Spl (PEP 2), Sp3 (D-20) and Sp4 (V-20) (Santa Cruz Biotech, Santa Cruz, CA) were used to direct chromatin antibody pull-down at 4°C overnight (2μg of antisera per sample). Control goat IgG was prepared from normal goat serum using a Protein A column. Cross-linking was reversed at 65 °C overnight. DNA for PCR analysis was eluted in 50 μΐ of sterile water. Primers were designed to amplify chromatin DNA spanning P2-promoter GC-box "a" and "b" using

MacVector® software (Accelrys, San Diego, CA). GC-box F (5 ' -TTG AGTGCC AGAG

TATGCCCAG), GC-box R (5 ' -C ACCCC AAATGGAGC AAGTG) . PCR: 94°C for 3 min (94°C for 20 sec; 56°C for 30 sec; 72°C for 30 sec) and repeated for 36 cycles; and finally terminated at 4°C. PCR products were electrophoresed through a 2% agarose gel and visualized with ethidium bromide staining.

Cell Culture

[00470] Prior authorization was obtained through the Institutional Animal Care and Use

Committee- IACUC (UCSF) for all experiments and protocols requiring the use of rat tissues. Primary cultures of rat neonatal DRG neurons were isolated and maintained in media containing NGF (100 ng/ml) as previously described. PC12 cells from American Type Culture Collection (ATCC, Manassas, VA) were maintained in F-12K (Kaighn's Modification, Gibco-Invitrogen Corp., Rockville, MD) supplemented with 10% heat inactivated horse serum, 5% heat inactivated fetal bovine serum (FBS), streptomycin (100 μg/ml), and penicillin (100 units/ml). HEK293 cells (ATCC) were grown in Dulbecco's modified Eagle's medium (DMEM) H-21 supplemented with 10% heat inactivated FBS, streptomycin (100 μg/ml) and penicillin (100 units/ml) in the UCSF Cell Culture Facility.

Dual Luciferase Reporter Assay

[00471] Neonatal DRG neurons and PC12 cells were plated onto coated 96-well plates (Nunc, Naperville, IL) as previously described. In either case, each sample was composed of 50 μΐ_^ of Opti-MEM® I (Cell Culture Facility, UCSF) combined with 0.70 ng of Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA) and allowed to incubate for 5 minutes at room temperature. 50 μΐ_^ of Opti-MEM® I was also combined with a total of 0.3 μg/well of the desired pGL3-reporter construct and/or appropriate expression construct. Additionally, the reference renilla luciferase reporter plasmid, pRL-SV40 was included at 0.05 μg/well. The Lipofectamine™ 2000 and DNA solutions were then combined following the manufacturer' s recommendations (Invitrogen, Carlsbad, CA). Overall, transfection efficiency was < 5% in primary neonatal DRG neurons. When indicated, PC12 cells were cultured in the presence of NGF (100 ng/ml) after transfection. Following 48 hours of culture, cell lysates were prepared according to the manufacturer's recommendations of the Dual Luciferase Reporter Assay System® (Promega, Madison, WI). Both firefly and renilla luciferase products were measured in a MicroLumatPlus® LB96V microplate luminometer using Winglow® software (Perkin-Elmer Berthold, Wellesley, MA). Firefly luciferase activity was normalized to renilla luciferase activity as a relative ratio resulting in a "Relative Luciferase Activity," which represents the transcriptional activity directed by a particular luciferase reporter construct. In experiments where multiple expression plasmids were required, empty control plasmid was used to maintain an equivalent DNA concentration between transfected samples.

Plasmid Constructs and siRNA

[00472] Luciferase reporter plasmids pGL3-E (empty) and pGL3-0.4kb containing TRPV1 P2- promoter were previously described. Co-expression of Spl-like transcription factors was accomplished through the transfection of pN3-Spl, pN3-Sp3, pN3-Sp4 and pN3-Empty, a gift from Prof. G. Suske (Marburg, Germany). siRNA knockdown experiments were performed through the transfection of the pBS/U6 plasmid based constructs containing targeted short hairpin loops: siRNA scrambled (scr) (gggaattaatatgcacacaggcc) siRNA-Spl

(gggaacatcaccttgctacct) nucleotides 881-901, accession no. NM_138473 (XM 028606.7) and siRNA Sp4-1: (gggctccaactttaacacctt) nucleotides 1551- 1571 accession no. NM_003112. Total plasmid concentrations remained constant between experimental groups through the addition of empty control plasmids. (siRNAs were a gift from G. Gill, Boston, MA).

Site-directed mutagenesis

[00473] To delete GC-box "a" and "b" residing within the P2-promoter, the pGL3-0.4kb

luciferase reporter plasmid was utilized as a template following the manufacturer' s primer design software (Stratagene, La Jolla, CA). Using primers: Del-a F (5'-CATCCCTGCCG

TACGCCACGAGGACC CTCA); Del-a R (5 ' -TCTGTGAGGGTCCTCGTGGCGTACGGC AGGGATG); Del-b F (GAGGACCCTCACAGAGGCACCGGCCACTC); Del-b R (GAGTG GCCGGTGCCTCTGTGAGGGTCCTC), deletion was performed according to the method described in the QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). All PCR was performed using pfu Turbo (Stratagene, La Jolla, CA) by initially denaturing the template at 95°C for 30 sec, followed by denaturing at 95°C for 30 seconds, annealing at 60°C for 1 minute, extension at 68°C for 7 minutes, with this cycle repeated 19 times. Original template DNA was digested by Dpn I treatment at 37°C for 1 hour. After 1% agarose gel analysis, desired bands were excised and isolated using the PureLink Quick Gel Extraction Kit (Invitrogen, Carlsbad, CA). Isolated DNA was then ligated using T4 DNA ligase (New England Biolabs, Beverly, MA) and transformed into XLl-Blue "super-competent" cells (Stratagene, La Jolla, CA). The resultant constructs containing GC-box deletions "a" and "b" were subjected to DNA sequence analysis and only the targeted GC-box binding sites "a" (GGGGAGGGG) and "b" (GGGAGG) were confirmed to be disrupted within the modified 0.4 kb reporter plasmid (Biomolecular Resource Center DNA Sequencing Facility, UCSF, San Francisco, CA).

Electroporation

[00474] To obtain a sufficiently high level of transfection efficiency to detect gene expression changes in cultured DRG neurons, the Amaxa Nucleofector II Device with the Rat Neuron Nucleofector Kit (Lonza, Basel, CH) was used. For each nucleofection sample, 40 neonatal DRGs (-1.3 x 10⁶ cells according to the hemacytometer count) were harvested. The

manufacturer's protocol (Optimized Protocol for Rat Dorsal Ganglion Neurons - Amaxa®, Lonza Basel CH) was followed. Samples were transfected with 3 μg of the cDNA expression plasmids: PN3-empty, PN3-Spl, or PN3-Sp4; or the knockdown plasmids: siRNA- scramble, siRNA-Spl, or siRNA-Sp4 #1. Each sample was transfected using program G-013. Following electroporation, total DRG cultures were plated with a total volume of 2 mL in 24-well plates on 15 mm coverslips pre-coated with poly-D-ornithine/laminin (0.1mg/ml/5ug/ml). After a three- hour incubation period, the top 1 mL of media was replaced with an equal volume of fresh media plus 100 ng/ml NGF. Transfection by electroporation with 3μg Monster™ GFP (Promega, Madison, WI) resulted in a transfection efficiency of approximately 30-40% in neonatal DRG neurons (data not shown).

Quantitative PCR (qPCR)

75] Following RNA purification (Trlzol®, Invitrogen, Carlsbad, CA), precipitation and first strand cDNA synthesis (First Strand®, Stratagene, San Diego, CA), the level of expression Spl and Sp4 mRNAs in rat DRG neurons in culture were analyzed using quantitative real-time PCR performed on the StepOnePlus Real-Time PCR system (Applied Biosystems, Carlsbad, CA). Two experimental approaches were used to manipulate gene expression in the DRGs: siRNA- directed knockdown of Spl or Sp4, and over-expression of Spl or Sp4 through transfection with Spl or Sp4 cDNA. All PCR reactions were performed using ΙΟμΙ of TaqMan® Fast Universal Master Mix 2x (Applied Biosystems, Carlsbad, CA), 2μ1 SOng/μΙ cDNA, Ιμΐ of forward and reverse primers, and water to reach the final volume of 20μ1/Γχη. PCR was carried out using inventoried primers specific for rat G6PDH from Applied Biosystems (ABI), Carlsbad, CA: (Cat# Rn00566576_ml), Spl (Cat# Rn00561953_ml) and Sp4 (Cat# Rn00562717_ml), human Spl (Cat# Hs00916521_ml) and Sp4 (Cat# Hs00162095_ml), and custom designed primers for rat TRPV1 (Forward: CAA GGC ACT TGC TCC ATT TG; Reverse: TCT GTG GCC CAA TTT CGA; Probe: CCT GCA CCT AGC TGG). Each sample was run as a single-plex reaction system along with a negative control (template: water) for each primer being tested, all samples were run in triplicate. The mRNA expression levels of the genes analyzed were represented as Relative Quantities (RQ) using the comparative CT method (RQ = 2-AACt). First, CT (threshold cycle) values for each sample and target gene were obtained from real-time PCR analysis with the StepOne® Software (Applied Biosystems, Carlsbad, CA). CT values of each gene were then normalized with respect to the housekeeping gene (G6PDH), using the equation where AACT = (CT, Target - CT, G6PDH) Sample - (CT, Target - CT, G6PDH). The reference CT values were derived from the control (empty vector / scrambled) samples. RQ values of all other treated samples with the same target gene are compared to the control reference values.

Primary Cultures of Dorsal Root Ganglia (DRG) neurons

[00476] Peripheral sensory neurons (DRG neurons) were prepared as follows: Following C0₂ narcosis and decapitation, mouse DRG neurons were removed on ice, de-sheathed in cold HBSS, and dispersed in HBSS containing 1 mg/ml collagenase type I and 0.1 mg/ml DNAse for 60 min under agitation at 37°C followed by treatment with 0.25% trypsin for 30 min under agitation at 37°C. After blocking trypsin activity with soybean trypsin inhibitor type III (5 mg/ml), the suspension was triturated using a sequence of pipettes with diminishing diameter. Neurons were pelleted and re-suspended in DMEM containing 5% fetal bovine serum, 5% horse serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 2 mM glutamine, and 100 ng/ml nerve growth factor. After plating on glass coverslips coated with poly-D-lysine and laminin, cells were cultured overnight before subsequent treatments and/or calcium imaging experiments.

Intracellular Calcium Measurements

[00477] Increases in intracellular calcium [Ca²⁺]i as reflected in an increase in the fluorescence ratio F340/F380 of the calcium dye Fura-2 AM (Invitrogen, Carlsbad, CA) has become an acceptable endpoint response in the measurement of TRPV1 activation. DRG neurons were incubated in HBSS, 0.1% BSA, 20mM HEPES, pH 7.4, containing 2.5μΜ of Fura-2 AM for 30- 45 min at 37°C. Fluorescence was measured at 340 nm and 380 nm excitation and 510 nm emission using a microscope-based calcium imaging system consisting of a Zeiss Axiovert microscope (Carl Zeiss, Thornwood, NY, USA), an ICCD video camera (Stanford Photonics, Stanford, CA, USA), and a video acquisition and analysis software system (Imaging Workbench 6 (INDEC Biosystems, Santa Clara, CA, USA)) for measurements in individual DRG neurons. Results were reported as fluorescence ratio F340/F380 to indicate relative changes in [Ca²⁺]i. All experiments were at room temperature (21-22°C). [00478] DRG neurons were plated on 12 mm cover slips. Using this method, an average of 12-20 neurons are typically captured simultaneously per cover slip in the microscopic view field.

Triplicate cover slip experiments were performed for each condition analyzed. Each experiment included treatment with capsaicin (500nM). The maximal increase in intracellular calcium within 30 seconds after capsaicin application was used as the response value for a particular sensory neuron. Following this study period, a depolarizing concentration of KCl was applied to the recording bath to verify viability of the studied sensory neurons. Only sensory neurons responsive to KCl were included in subsequent analyses. Unless otherwise noted, the data from 3 independent experiments were then analyzed for significant differences (ANOVA) with control conditions.

Transcriptional Assay of Cultured Sensory Neurons and PC12 Cells

[00479] To carry out transfection and luciferase reporter assays, primary cultures of DRG neurons were plated as previously described. A typical experiment required microscopic dissection of -20 neonatal DRGs / pup x 2-3 pups for a 21 well experiment. 0.01% DMSO served as a vehicle control. In aach well, 50 μΐ. of Opti-MEM® I (Cell Culture Facility, UCSF) was combined with 0.70 ng of Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA) and allowed to incubate for 5 minutes at room temperature. 50 μΐ_^ of Opti-MEM® I was combined with 0.5 μg/well of the desired pGL3-reporter construct plus the Renilla luciferase reporter plasmid, pRL-SV40, at 0.05 μg/well. The Lipofectamine™ 2000 and DNA solutions were then combined following the manufacturers recommendations (Invitrogen, Carlsbad, CA). Following 48 hours of transfection, cell lysates were prepared according to manufacturer's instructions, and the Dual-Luciferase assay was completed per the manufacturer's protocol (Invitrogen, Carlsbad, CA). The data were expressed as the mean +/- SEM. Experiments were performed in quadruplicate and repeated in at least three independent trials. Following ANOVA, significant differences required a p value < 0.05.

Animal Model of Inflammatory Pain and Hyperalgesia

[00480] Following an approved protocol from the UCSF committee on animal research (IACUC) and the NIH guideline for the care and use of research animals, transgenic Sp4 +/- mice from the laboratory of Sjaak Philipsen (Rotterdam, Netherlands) were received and bred for behavioral studies of nociception. Mice (male, 25 g) were bred and housed in a temperature and humidity controlled vivarium (12-hour dark/light cycle, with free access to food and water) for the duration of all studies. Using quantitative RT-PCR (qPCR) to measure mRNA content in the dorsal root ganglia (DRG), the predicted 50% knock down of Sp4 mRNA in dorsal root ganglia (DRG) was confirmed. This 50% knock down was predicted by the PCR-based genetic profile in the Sp4 +/- mouse chromatin (not shown).

[00481] To establish a model of peripheral inflammation, Complete Freund's Adjuvant - CFA (Sigma) was mixed as 5 mg in 10 mL of a 1:1 emulsion of saline and mineral oil (50 μΐ / injection) and injected into the left hind paw of either wild type B6 or Sp4 +/- mice under isoflurane anesthesia. Control injections of saline (50 μΐ) were also performed in a parallel group of mice. To quantify the degree of left hind paw swelling following either saline or CFA injection, digital calipers were used to measure paw size (mm) in each group (n=3) at 3, 6 and 10 days following injection. The mean paw thickness for saline versus CFA injected mice was calculated for both control B6 and Sp4+/- mice.

Measurement of CFA-Induced Inflammatory Hyperalgesia in Transgenic Sp4 +/- Mice

[00482] Radiant heat- induced paw withdrawal latencies (Hargreaves test) were measured on wild type B6 and Sp4 +/- mice (n= 6-10/ group). In all cases, triplicate measures of paw withdrawal latency (seconds) were taken for each mouse using the Hargreaves device. Control B6 and Sp4 +/- mice were tested at pre-injection days -1, -2, -3 and a mean value was calculated for their baseline (B) left paw withdrawal latency. On post-injection days 2, 3, 6 and 10, triplicate measures of paw withdrawal latency (seconds) were taken for each mouse using the Hargreaves device. Mean values for paw withdrawal latencies were then calculated and plotted (+/- SEM).

Measuring the Effect of Mithramycin-a on mRNA Encoding TRPVl in Cultured Sensory Neurons

[00483] Quantification of the mRNA content of DRG or cultured sensory-DRG neurons required that the cells undergo RNA purification (Trlzol®, Invitrogen, Carlsbad, CA), precipitation, DNAse 1 treatment and first strand cDNA synthesis (First Strand®, Stratagene, San Diego, CA). Subsequently, the level of TRPVl mRNA expression in cultured rat DRG neurons was analyzed using quantitative real-time PCR performed on the StepOnePlus Real-Time PCR system (Applied Biosystems, Carlsbad, CA). The mRNA expression levels of the genes analyzed were represented as Relative Quantities (RQ) using the comparative CT method (RQ = 2-ΔΔΟ:). First, CT (threshold cycle) values for each sample and target gene were obtained from real-time PCR analysis with the StepOne® Software (Applied Biosystems, Carlsbad, CA). CT values of each gene were then normalized with respect to the housekeeping gene G6PDH using the following equation: AACT = (CT, Target - CT, G6PDH) Sample - (CT, Target - CT, G6PDH). The reference CT values were derived from the controls. RQ values of all other treated samples with the same target gene were compared to the control reference values. RQ - relative quantification of mRNA content was normalized to G6PDH gene expression. A value of 1 signified control levels observed under vehicle (DMSO) exposure.

[00484] All PCR reactions were performed using ΙΟμΙ of TaqMan® Fast Universal Master Mix 2x (Applied Biosystems, Carlsbad, CA), 2μ1 SOng/μΙ cDNA, Ιμΐ of forward and reverse primers, and water to reach the final volume of 20μ1/Γχη. PCR was carried out using inventoried primers specific for rat G6PDH from Applied Biosystems (ABI), Carlsbad, CA: (Cat# Rn00566576_ml), Spl (Cat# Rn00561953_ml) and Sp4 (Cat# Rn00562717_ml), human Spl (Cat#

Hs00916521_ml) and Sp4 (Cat# Hs00162095_ml), and custom designed primers for rat TRPVl (Forward: CAA GGC ACT TGC TCC ATT TG; Reverse: TCT GTG GCC CAA TTT CGA; Probe: CCT GCA CCT AGC TGG). Each sample was run as a single-plex reaction system along with a negative control (template: water) for each primer being tested, with all samples run in triplicate.

Measuring the Effect of Diclofenac Sodium on TRPVl Promoter Activity in NGF- Treated PC12 Cells

[00485] Methods for these experiments were previously described except for the following

modifications: PC12 cells were plated onto poly-D-lysine (Sigma- Aldrich, St. Louis, MO) coated 96-well plates (Nunc, Naperville, IL) and grown to 90 - 95% confluence. Subsequently, cells were transfected as previously described with TRPVl -P2 promoter containing construct 0.4kb. Following transfection, PC12 cells were cultured in the presence or absence of Diclofenac sodium (50 uM) for 72 hours, and cell lysates were prepared and assayed for lucif erase activity.

Detection and Measurement of TRPVl Modulator Concentration [00486] Eugenol concentrations were determined in solution (phosphate buffered saline) by use of a SmartS pec Plus ¹ Spectrophotometer (BioRad, CA) at 281 nanometers (nm). For sample separation and uv detection, a reverse-phase HPLC (HP 1100 Series, 46 X 250 mm with CI 8 stationary phase) interfaced with a uv detector and PC computer was utilized. An isocratic mobile phase was employed at a ratio of 25% acetonitrile and 75% water (rendered slightly acidic with the addition of H₂PO₄). Under these conditions, it was observed that eugenol elutes at t = 26 min. This technique cand be modified by varying the composition of the mobile phase in order to determine the elution profile of other TRPV1 modulators, including curcumin and capsaicin.

Detection and Measurement of TRPV1 Transcription Factor Inhibitor Concentration

[00487] In order to assay mithramycin, whose ring structure lends a characteristic absorbance at 280 nm, a reverse-phase LC-UV method was used (HP 1100 Series, 46 x 250 mm with bonded hydrocarbon, CI 8, as stationary phase). A gradient mobile phase, which varied from 10-100% acetonitrile in water (rendered slightly acidic with the addition of H₂P0₄) was used over a period of 30 minutes. Mithramycin A eluted at t = 15.4 minutes. Modification of this technique varying the composition / gradient of the mobile phase may be applied to determine the elution profiles of other TRPV1 transcrition factor inhibitors, such as mithramcyin SK, SDK, tolfenamic acid, and diclofenac.

Statistics

[00488] Relative luciferase activity was expressed as the mean of three independent experiments each done in at least triplicate measures, +/- SEM. Mean values between groups were compared using ANOVA with Bonferroni post-hoc test (Prism 5.0, GraphPad). P values less than 0.05 were considered to show a significant difference. Differences in mRNA expression levels between non-treated control DRGs and Spl or Sp4 over-expession and siRNA knockdowns, respectively, were analyzed by two tailed unpaired t-test with the GraphPad Prism software (GraphPad Software, La JoUa, CA). In studies not otherwise described, data was analyzed using ANOVA and t-test (Prism 5, GraphPad Software, La Jolla, CA, USA) as indicated in the Results and Figures, P < 0.05 was considered statistically significant. All data are presented as mean +/- SEM unless otherwise noted. Microporous Thin Film Fabrication

[00489] Thin films were spin-cast onto a flat circular poly(dimethylsiloxane) (PDMS) (Sylgard 184, Dow Corning, Midland, MI) mold due to its flexibility and the delicacy of the PCL/gelatin thin films. To fabricate the PDMS mold, the base and curing agent were mixed at a 10:1 ratio, degassed under vacuum, poured onto a 3" Silicon wafer, and baked at 65 °C for 2 hours. Once cured, the PDMS was peeled from the silicon master and cut into a 35 mm diameter circle.

Separate solutions of polycaprolactone (PCL) (MW 80,000, Sigma- Aldrich, St. Louis, MO) and gelatin (from porcine skin, Sigma- Aldrich) were constantly stirred in 0.1 g mL^"1 2,2,2- trifluoroethanol (TFE) (Sigma- Aldrich) on a hot plate at 80 °C until dissolved. PCL and gelatin solutions were then combined into centrifuge tubes in the following volumetric ratios: 7:3, 8:2, 9:1, and 10:0 (PCL: Gelatin). To mix the PCL and gelatin together, solutions were vortexed for 30 seconds and inverted twice. This process was repeated for at least 5 minutes per solution immediately prior to casting. PCL/gelatin solutions were spin cast using a P6700 Series

Spincoater (Specialty Coating Systems, Indianapolis, IN) at 1500 RPM for 1 minute. Thin films were carefully peeled from the PDMS mold after spin casting using forceps.

Nanoporous thin film fabrication

[00490] All chemicals for nanoporous PCL fabrication were obtained from Sigma- Aldrich (St.

Louis, MO). Nanoporous PCL films were fabricated using zinc oxide nanorod templates. Zinc oxide rods were grown on glass or silicon substrates that were cleaned prior to use with a solution of sulfuric acid and hydrogen peroxide (3: 1) for 30 minutes and subsequently rinsed with deionized water and dried with nitrogen. Substrates were exposed to an oxygen plasma (200W, 0.5 mTorr) for 5 minutes prior to spin casting a zinc acetate (ZnAc₂) seed layer. For this, a solution of 0.75 M ZnAc₂ and ethanolamine in 2-methoxyethanol was cast onto clean glass or silicon substrates at 1000 rpm for 60 seconds. Substrates were annealed on a hot plate at 400 °C for 30 minutes to convert ZnAc₂ into ZnO. Substrates were then placed in an aqueous 5 mM ZnAc₂ solution at 85-90 °C for 4 hours (replacing the growth bath once), which resulted in the growth of ZnO nanorods. A 300 mg/ml solution of PCL in 2,2,2-trifluoroethanol was prepared as described above and cast onto ZnO templates at 500 rpm for 30 seconds followed by 1500 rpm for 30 seconds, which is sufficiently thick to cover the ZnO template. These substrates were heated to 130 °C on a hot plate to remove any excess solvent and to allow the PCL to intimately contact the template. ZnO templates were then etched with 10 mM H₂SO₄ until the template was removed and PCL films naturally floated off.

Thin Film Degradation Analysis

[00491] Thin films were stored in PBS under constant agitation for 5 days. Prior to imaging, samples were rinsed with deionized water and dehydrated in a vacuum oven. Samples were imaged using a mySEM scanning electron microscope (NovelX, Lafayette, CA) with an accelerating voltage of 1 kV. For pore area and porosity calculations, 3 thin films of each PCL: Gelatin ratio were imaged. For each thin film, 10 random areas per thin film were imaged and compiled. Pore areas were calculated using ImageJ (National Institutes of Health, Bethesda, MD).

Profilometry

[00492] Device thickness was characterized with an Ambios Technology XP-2 Stylus Profiler (Santa Cruz, CA). Profilometry was conducted with a scan speed of 0.01 mm sec^"1, a length of 1.5 mm and a stylus force of 0.2 mg.

Rapamycin Loaded PCL Film

[00493] Rapamycin loaded PCL film was prepared by stirring a solution of 200mg/mL PCL in 2,2,2-trifluoroethanol (TFE) (Sigma-Aldrich) on a hot plate at 70 °C until dissolved. Rapamycin was then added to the solution at a concentration of 5 mg/mL and stirred until dissolved. The solution was then spin-cast onto a 3 inch silicon wafer at 1000 rpm for 30 seconds followed by 2000 rpm for 30 seconds. Circular sections of the film 16 mm in diameter were cut and incubated in PBS at 37 °C. To sample drug release, 1 mL of solution was removed during sampling and replaced with fresh PBS. Rapamycin concentration was read at 260 nm on a SpectraMax 190 microplate reader (Molecular Devices, Sunnyvale, CA). Data and linear regression analysis were performed in Excel (Microsoft, Redmond, WA). EXAMPLES

EXAMPLE 1: SPI AND SP4 ARE BOUND IN VIVO TO THE GC-BOX REGION OF TRPVl P2-

PROMOTER

[00494] A search for TRPVl genomic control elements capable of responding to inflammatory mediators revealed no classical response elements within the P2- promoter region. A search for alternative regulatory sites revealed tandem GC-box sites 5' to the P2 transcriptional start site (FIG. 1). These two GC-box regions have been termed: GC-box 'a' (GGGGAGGGGC) and GC- box 'b' (GGGAGGCCGGCC) (GenBank: DQ015702). Since Spl-like transcription factors are known to bind to GC-box sites and activate promoter regions in an NGF-dependent manner, it was first determined if any of the most well-studied Spl-like transcription factors could be expressed in rat DRG by performing a RT-PCR survey of mRNA for factors Spl -4. mRNA encoding transcription factors Spl, Sp3 and Sp4 but not Sp2 were identified in rat DRG (data not shown). To determine which of these Spl-like transcription factors were expressed as protein in DRG and subsequently bound to the endogenous TRPVl promoter region spanning GC-box "a" and "b", chromatin immunoprecipitation-ChIP analysis was utilized. Although primer sets that individually amplified GC-box "a" versus "b" could not be developed due to the inherent GC- content and secondary structures (data not shown), ChIP analysis still provided a superior method (when compared to electrophoretic mobility shift assays - EMSA) to distinguish transcription factor binding that occured only in the context of the native chromatin structure. This is especially critical given that Spl-like factors (Spl, Sp3, Sp4) are reported to have identical binding affinities to isolated GC-box binding targets when studied by EMSA in vitro.

[00495] When sheared chromatin derived from intact DRGs harvested from rats 1.5 months of age or enriched cultures of neonatal DRG neurons were analyzed by ChIP, DRG chromatin fragments were successfully amplified using antisera directed against Spl or Sp4 (FIG. 1).

Overall, strong evidence for Spl (3/4 ChlPs) and Sp4 (3/3 ChlPs) binding were observed (not all gels shown). In contrast, evidence for Sp3 binding was much less convincing (1/3 ChlPs) with a faint band representing the lowest levels of binding detectable amongst the three transcription factors tested (data not shown). When non-specific antiserum (IgG) was used for immunoprecipitation or when PCR amplification was performed without template DNA (primers alone - Pr), either a very faint band of smaller size was observed or no detectable fragment was visualized. Nevertheless, taken together ChIP analysis of rat DRG demonstrates transcription factors Spl and Sp4 binding to a region spanning GC boxes "a" and "b" within the P2-promoter.

EXAMPLE 2: GC-BOX "A" IS ESSENTIAL FOR ACTIVATION OF THE TRPVl P2-PROMOTER

[00496] To establish a functional link between candidate GC-box sites and P2-promoter

activation, the effect of their individual deletion on P2-promoter activation in cultured DRG neurons and on NGF-dependent promoter activity in cultured PC 12 cells was examined. As shown in FIG. 2A, when the luciferase reporter construct 0.4kb containing P2-promoter was transfected into cultured DRG neurons and luciferase activity was measured 48 hours later, a robust increase in transcriptional activity was observed when compared with the empty vector control. Following the selective deletion of GC-box "a", P2-associated promoter activity directed by the 0.4 kb reporter was completely lost. When GC-box "b" was deleted but GC-box "a" remained intact, there was a small decrease that did not reach significance. As shown in FIG. 2B, when identical experiments were conducted in an established model of NGF action - PC 12 cells, the previously reported NGF-dependent increase in P2-promoter activity following NGF treatment was observed. However, the loss of NGF-dependent promoter activity with the deletion of GC-box "a" was also observed. A small decrease in NGF-dependent activity with deletion of GC-box "b" was also observed, but did not reach significance. When both GC-box "a+b" were deleted, the lowest observed level of promoter activity was obtained. These experiments suggest that GC-box "a" is essential for P2-promoter activation in DRG neurons as well as NGF-dependent transcription in PC12 cells. In contrast, GC-box "b" may have a modulatory role in DRG neurons given that its loss is associated with a trend to diminish promoter activity in DRG neurons.

[00497] The complete loss of promoter activity with deletion of GC -boxes "a+b" indicates that within the P2-promoter, no additional (cryptic) regulatory sites capable of promoter activation exist beyond GC -boxes "a & b". Given the evidence that transcription factor Spl is bound to the P2-promoter (FIG. 1), this series of experiments was repeated under conditions of Spl over- expression. As shown in FIG. 2A, co-transfection of Spl-cDNA with the P2-promoter construct 0.4kb directed an increase in promoter activity. However, deletion of GC-box "a", or GC-box "a + b", again resulted in a complete loss of promoter activity whereas deletion of GC-box "b" did not show significant change in promoter activity. Similar results were observed in parallel experiments conducted in NGF treated PC12 cells (FIG. 2B). An identical series of experiments was completed, now including conditions of Sp4 over-expression instead of Spl over-expression in cultured DRG neurons and NGF treated PC12 cells (FIG. 2C, 2D). Although there was a trend for increased promoter activity under conditions of Sp4 over-expression in NGF treated PC12 cells, it did not reach significance. As previously observed under conditions of Spl over- expression, loss of promoter activity following deletion of GC-box "a" or GC-box "a + b" was not reversed by Sp4. Interestingly, deletion of GC-box "b" in this series was now associated with a statistically significant decrease in promoter activity in cultured DRG neurons and NGF treated PC12 cells.

EXAMPLE 3: SPI AND SP3 INCREASE TRPVl P2-PROMOTER ACTIVITY IN CULTURED DRG

NEURONS

98] Given evidence of Spl, Sp4 and possibly small amounts of Sp3 binding to the GC-box region, the effect of the over-expression of these Spl-like factors on P2-promoter (0.4kb) - directed promoter activity in cultured DRG neurons was then investigated. As shown in FIG. 3, the expected increase in promoter activity following transfection of the 0.4kb construct was again observed. Co-transfection of expression plasmids encoding Spl or Sp3 expression plasmids with the 0.4kb construct directed a further increase in promoter activity. On the other hand, co-transfection of the Sp4 expression plasmid did not show a significant increase.

Interestingly, when Spl was paired with Sp3 or Sp4, no increase in promoter activity was observed, as was also observed when Sp3 was paired with Sp4. These results suggest that transcription factor Spl positively regulates TRPVl P2-promoter activity and the presence of other members of the Spl-like family (Sp3, Sp4) may serve to modulate or compete for control of transcription at the TRPVl gene P2-promoter. EXAMPLE 4: AN INHIBITOR OF SPI-LIKE TRANSCRIPTION FACTORS DOSE-DEPENDENTLY

BLOCKS NGF AND SPI- DEPENDENT TRPVl PROMOTER ACTIVITY IN PC12 CELLS

[00499] The ability of an inhibitor of Spl function to disrupt P2-promoter activity in a model of NGF-dependent TRPVl transcription was investigated to further establish the role of Spl -like transcription factors in the regulation of TRPVl promoter activation. As previously observed, NGF increased P2-promoter activity in PC12 cells (FIG. 4, 0.4kb black bars); however, mithramycin A, an inhibitor of Spl function, dose-dependently blocked the NGF- induced promoter activity. Importantly, mithramycin A also dose-dependently blocked Spl -dependent increases in P2-promoter activity (FIG. 4). Similar results were observed for Sp3 (data not shown). Attempts to perform identical experiments in neonatal DRG neurons were unsuccessful due to mithramycin A-associated toxicity and the requirement of NGF to sustain viability of neonatal DRG neurons, not seen with PC 12 cells. Although the inhibitory effect of mithramycin A does not preclude disruption of other Spl -like member binding to GC-box binding sites, it does support the idea that, in part, NGF-dependent transcription at the P2-promoter is mediated by Spl and/or other Spl -like transcription factors.

EXAMPLE 5: siRNA DIRECTED KNOCKDOWN OF SPI DECREASES P2-PROMOTER ACTIVITY IN

DRG NEURONS AND NGF-DEPENDENT ACTIVITY IN PC12 CELLS

[00500] The dependence of endogenous Spl and Sp4 transcription factors on the activation of the P2-promoter through the use of a siRNA knockdown strategy previously shown to decrease Spl and Sp4 in primary cerebellar granule neurons was investigated. Search for off-site hits matched only the Spl and Sp4 sequence in a BLAST search of the NCBI nucleotide database (not shown). Although the low transfection efficiency using lipofectamine (< 5%) in DRG neurons precluded quantitative analysis of Spl or Sp4 content following siRNA treatment, the utility and fidelity of these probes have been previously reported, and the efficacy of DNA constructs for over-expression or siRNA knockdown at the mRNA level following electroporation have been validated. As shown in FIG. 5 A, co-transfection of siRNA-Spl into cultured DRG neurons significantly reduced P2-promoter activity directed by the 0.4kb reporter plasmid. Co- transfection of siRNA-Sp4 showed a trend to decreased levels of promoter activity that did not reach significance. Similar findings were observed when promoter activity was studied in transfected PC12 cells. As shown in FIG. 5B, NGF again directed an expected increase in 0.4kb reporter activity whereas co-transfection of Spl-siRNA decreased the NGF-dependent promoter activity. Moreover, under conditions of Spl over-expression (FIG. 5B, 0.4kb Spl), the additional increase in promoter activity directed by Spl was significantly reversed by co-transfection of Spl-siRNA. In addition, co-transfection of siRNA-Sp4 also produced a decrease in promoter activity in NGF- treated PC 12 cells.

EXAMPLE 6: OVER-EXPRESSION OF SPI OR SP4 INCREASES ENDOGENOUS LEVELS OF TRPVl MRNA IN CULTURED DRG NEURONS

[00501] Building on observations that Spl and Sp4 are bound to the TRPVl P2-promoter region in vivo and regulate P2-promoter activity, manipulation of Spl or Sp4 expression in cultured DRG neurons was investigated to determine their subsequent downstream effects on changes in endogenous TRPVl mRNA expression. Given that the lipofectamine-based transfection of DRG neurons and PC12 cells provides relatively low (< 5%) transfection efficiencies, these experiments were conducted in cultured DRG neurons following electroporation to provide greater transfection rates (30-40%) based on GFP staining in viable cells at 24-48 hours (data not shown). As shown in FIG. 6A, endogenous levels of rat Spl mRNA were first quantified in cultured DRG neurons following transfection with the empty expression plasmid PN3. Because no amplification of the Spl/Sp4 genes for the reference control sample occurs and 2— ΔΔΟ; analysis cannot be utilized, Ct values are used instead of RQ values to compare mRNA expression levels. Resultant mRNA content of human Spl mRNA were then measured following electroporation with the empty PN3 vector versus a human Spl/PN3 expression plasmid

(previously used in promoter activity assays) and Ct values were compared with the Ct value associated with baseline levels of the rat Spl or Sp4 mRNA.

[00502] Human Spl -like transcription factors and their cognate cDNAs differ slightly in

nucleotide sequence, but encode indistinguishable functional properties across species.

Therefore, the additional contribution of human Spl mRNA could be individually measured and compared. As shown in FIG. 6A, following transfection with the human Spl cDNA, an approximately equal amount of human Spl mRNA in addition to the endogenous rat Spl mRNA was detected in cultured DRG neurons. Therefore, following an approximate doubling of Spl mRNA, a significant increase in endogenous TRPVl mRNA was observed (FIG. 6B). In like manner, these experiments were repeated but the endogenous expression of rat Sp4 mRNA was measured (FIG.6C) and subsequently human Sp4 mRNA content in cultured DRG neurons following electroporation of the Sp4 cDNA was measured. Again, an approximate doubling of Sp4 mRNA was observed along with a corresponding significant increase in TRPVl mRNA (FIG. 6D).

EXAMPLE 7: DOUBLE KNOCKDOWN OF TRANSCRIPTION FACTORS SPI AND SP4 DIRECTS A

DECREASE IN TRPVl MRNA IN CULTURED DRG NEURONS

[00503] Having observed the generally positive regulatory effects of Spl and Sp4 on TRPVl mRNA expression in cultured DRG neurons (FIG. 6), an siRNA knockdown strategy was used to confirm the relationship between Spl, Sp4 and TRPVl RNA transcriptional control. As shown in FIG. 7 A, following electroporation of cultured DRG neurons with Spl -siRNA, a significant decrease in Spl mRNA was detected when compared with control experiments conducted with a scrambled Spl -like siRNA control vector. However, no significant changes were observed in concurrently measured Sp4 mRNA or TRPVl mRNA content. When parallel experiments with siSp4-mediated knockdown were conducted, a decrease in Sp4 mRNA was observed.

Importantly, when Sp4 mRNA knockdown was achieved, there was evidence of a concurrent decrease in Spl and TRPVl mRNA (FIG. 7B). Finally, given the apparent "cross-talk" between Spl and Sp4 gene expression, an equal ratio (1:1) of siSpl plus siSp4 were electroporated and a significant decrease in TRPVl mRNA in cultured DRG neurons was observed (FIG. 7B).

EXAMPLE 8: INVESTIGATION OF TRANSCRIPTIONAL REGULATION OF THE TRPVl GENE

[00504] Two members of the Spl -like transcription factor family (Spl and Sp4) have been

identified as candidate transcription factors that control TRPVl gene expression (TRPVl RNA) in cultured sensory neurons. Based on a combination of experiments including Chromatin immunoprecipitation (ChIP), luciferase-based transcriptional assays and cDNA driven over- expression versus siRNA mediated knock down, transcription factor Sp4 emerged as the most convincing candidate thus far that positively regulates TRPVl transcription (FIG. 8).

[00505] Based on these findings, transgenic Sp4 +/- mice were obtained from the laboratory of Sjaak Philipsen (Rotterdam, Netherlands) for behavioral studies of nociception. Based on previously published work, it is known that classic homozygous Sp4 -/- knockout mice die at birth or die suddenly a few weeks post-partum due to cardiac conduction disturbances (the mechanism of which is unknown). Their litter sizes are small, and those that survive are generally heterozygous. Given this, experiments were undertaken to determine whether a behavioral phenotype could be observed by studying the heterozygous mouse (Sp4 +/-) with a presumed 50% reduction in Sp4 in all cells. Using quantitative RT-PCR (qPCR) to measure mRNA content in the dorsal root ganglia (DRG), it was confirmed that a 50% knock down of Sp4 mRNA (as predicted) was present in the Sp4+/- mouse.

[00506] A behavioral series of studies (n=6) of B6 versus Sp4 +/- mice using the thermal paw withdrawal (Hargreaves) test have were completed. The "working hypothesis" was that TRPV1- dependent inflammatory thermal hyperalgesia would become manifest and would be sustained by the overproduction of TRPV1 in nociceptive neurons. Therefore, the reduction of Sp4 (Sp4 +/- mice) under inflammatory conditions would reduce the ability of these mice to respond to inflammation with an over-expression of TRPV1. It was predicted that Sp4 +/- mice would develop the expected inflammatory response to injection of CFA into the left hind paw (paw swelling - edema) but fail to develop persistent thermal hyperalgesia.

EXAMPLE 9: A MODEL OF INFLAMMATORY PAIN AND HYPERALGESIA IN CONTROL (C57/B6)

AND SP4 +/- KNOCKDOWN MICE

[00507] As shown in FIG. 9, left hind-paw thickness (mm) measured at 3, 6 and 10 days

following injections of saline was not significantly different between wild type B6 versus Sp4 +/-. Importantly, CFA injected into the left hind paw directed the expected redness (not shown) and paw swelling in both control B6 and Sp4 +/- mice beginning on day 2 and persisting through the study period of day 10. There was no difference in the magnitude of CFA induced paw swelling between B6 control and Sp4+/- knockdown mice. Therefore, based on an established measure of paw inflammation (paw thickness), the expected degree of CFA- induced

inflammation in both control B6 and Sp4 +/- mice was observed. EXAMPLE 10: TRANSGENIC MICE (SP4 +/-) WITH A 50% REDUCTION IN TRANSCRIPTION FACTOR SP4 FAILED TO DEVELOP CFA-INDUCED INFLAMMATORY HYPERALGESIA

[00508] Inflammatory pain and thermal hyperalgesia becomes manifest and is sustained by the expression and overproduction of TRPVl in nociceptive neurons. Given the evidence linking transcription factor Sp4 and TRPVl expression in nociceptive neurons, it was hypothesized that a reduction of Sp4 in vivo as modeled in Sp4 +/- knockdown mice, would decrease their ability to develop and sustain pain-related behaviors in response to an inflammatory stimulus (CFA). As shown in FIG. 10, there was no significant difference found between baseline (pre-injection) thermal paw withdrawal latencies between wild type-B6 and Sp4 +/- mice (FIG. 10 - comparison of top and bottom histograms "B"). This suggests that under normal conditions, there is no major dysfunction of noxious thermal sensation and expected paw withdrawal behavior in mice with a reduction in transcription factor Sp4.

[00509] When control B6 and Sp4 +/- mice were subsequently studied following saline or CFA injection (inflammation), wild type-B6 developed the expected decrease in thermal paw withdrawal latency (FIG. 10, top left panel), whereas no such decrease was seen following control saline paw injection in wild type B6 mice (FIG. 10, top right panel). Importantly, and despite a robust paw inflammatory response, (FIG. 9), there was no evidence of thermal hyperalgesia in the Sp4 +/- mice (FIG. 10, Sp4 +/- lower left panel compared with the B6 controls - top left panel). Moreover, the paw withdrawal latency values for Sp4 +/- mice injected with CFA were indistinguishable from the saline injected Sp4 +/- mice (FIG. 10, bottom left panel compared with bottom right panel). These results support the belief that transcription factor Sp4 is critical for the expression / over-expression of TRPVl under inflammatory conditions and that a reduction of Sp4-mediated TRPVl gene expression blocks the development of persistent inflammatory thermal hyperalgesia.

EXAMPLE 11: REDUCTION IN THE NUMBER OF SENSORY NEURONS RESPONSIVE TO CAPSAICIN IN SP4 +/- KNOCKDOWN MICE

[00510] When cultured DRG neurons from wild type versus Sp4 +/- mice were compared for their ability to respond to capsaicin (500 nM) as measured by changes in intracellular calcium, Sp4 +/- sensory neurons showed a trend of decreased responses to capsaicin (FIG. 11, each point represents an individual sensory neuron). More striking was that Sp4 +/- mice had a decreased percentage of capsaicin-responsive sensory neurons (FIG. 12). This finding can also be seen when the number of capsaicin responsive neurons is compared to all viable sensory neurons studied (FIG. 13). These results are consistent with previous findings and further establish a strong link between transcription factor Sp4, a sensory neuron's ability to respond to capsaicin (functional TRPVl receptors), and ability to develop inflammatory thermal hyperalgesia.

EXAMPLE 12: THE ANTICANCER ANTIBIOTIC MITHRAMYCIN A DECREASES THE MRNA

CONTENT ENCODING TRPVl IN CULTURED SENSORY NEURONS

[00511] The Mithramycin A-directed decrease in transcriptional activity of the TRPVl promoter P2 was investigated to see whether Mithramycin A could decrease TRPVl mRNA expression in cultured sensory neurons. As shown in FIG. 14, Mithramycin A (50 nM x 24 hours) decreased not only factors Spl and Sp4, but importantly TRPVl mRNA content in cultured sensory neurons when compared to vehicle (DMSO) control treated sensory neurons. In addition, the ability of mithramycin A to decrease TRPVl mRNA expression in sensory neurons is dose- dependent. As shown in FIG. 23, mithramycin A directed a dose-dependent reduction in TRPVl mRNA measured at 24 hours of treatment with a threshold effect at 5 nM and a maximal effect at 50 nM.

EXAMPLE 13: THE ANTICANCER ANTIBIOTIC MITHRAMYCIN- A DECREASED THE NUMBER OF CAPSAICIN-SENSITIVE SENSORY NEURONS IN CULTURED SENSORY NEURONS

[00512] Given that Mithramycin A directed a decrease in TRPVl mRNA content in cultured

DRG neurons, it was then determined whether Mithramycin A would reduce the responsiveness of cultured sensory neurons to the TRPVl activator capsaicin. A decrease in the magnitude and number of sensory neurons responding to capsaicin (500nM) was observed (FIG. 15, FIG. 16). As summarized in FIG. 17, when all viable sensory neurons were compared for their ability to respond to capsaicin, Mithramycin A treatment directed a more than 50% reduction in capsaicin- responsive neurons. EXAMPLE 14: TOLFENAMIC ACID DECREASED TRPVl PROMOTER P2 ACTIVITY IN CULTURED

SENSORY NEURONS

[00513] Given the findings that TRPVl transcription is dependent on Sp4 and possibly on Spl and/or other members of the Spl-like transcription factor family, the ability of tolfenamic acid to block TRPVl promoter activity in sensory neurons was investigated. DRG neurons were transfected with either an empty vector control (pGL-E) or the TRPVl promoter-P2 construct - 0.4kb under control conditions (DMSO vehicle control alone) versus tolfenamic acid (50 μΜ x 48 hours). As shown in FIG. 18, a significant decrease in promoter activity as measured by the Relative Luciferase activity was observed.

EXAMPLE 15: TOLFENAMIC ACID DECREASED TRPVl MRNA CONTENT IN CULTURED

SENSORY NEURONS

[00514] As shown in FIG. 19, tolfenamic acid (TA) (50 μΜ x 24 hours) produced a small but statistically significant decrease in transcription factors Spl and Sp4 as well as a proportionate decrease in TRPVl mRNA content in cultured sensory neurons. DRG neurons treated with vehicle alone (DMSO) served as the control condition. Experiments were then repeated at multiple tolfenamic acid concentrations (0.5 μΜ to 100 μΜ x 24 hours). As shown in FIG. 20, TRPVl mRNA content was dose dependently decreased by 33% at a concentration of 100 μΜ tolfenamic acid (TA).

EXAMPLE 16: DICLOFENAC SODIUM DECREASES THE TRPVl PROMOTER ACTIVITY IN NGF

TREATED PC12 CELLS

[00515] There was a trend of a decrease in TRPVl P2 -promoter activity in NGF treated PC12 cells cultured with diclofenac sodium (FIG. 21). Moreover, NGF-treated / Spl co-transfected PC 12 cells directed a significantly decreased TRPVl promoter activity following treatment with diclofenac sodium (50 μΜ). DRG cultures studied following 72 hour exposure to NSAIDS (n=3, triplicate measures) ANOVA ** p<0.001; *** p<0.0001. EXAMPLE 17: EUGENOL DECREASES THE RESPONSE SIZE AND NUMBER OF CAPSAICIN- SENSITIVE SENSORY NEURONS IN PRIMARY CULTURE

[00516] The application of eugenol applied for a brief time period to sensory neurons at 600 μΜ or 1 mM was investigated to determine whether it would decrease the magnitude and/or number of responses to capsaicin (500 nM). As shown in FIG. 24, individual capsaicin-induced calcium responses were plotted as either control (cap plus 0.1% DMSO) versus eugenol treatment (600 μΜ or 1 mM) x 45 min. A clear decrease in the magnitude (FIG. 25) and number (FIG. 26) of capsaicin-induced responses was observed. Importantly, at 1 mM, no responses to capsaicin were observed in any sensory neurons tested, although they remained viable and responded to a challenge of potassium chloride at the end of the experiment (not shown). These experiments were extended to test a lower range of eugenol concentrations (300 μΜ, 600 μΜ) applied over a 24-hour period. As shown in FIG. 22, when all viable sensory neurons were compared for their ability to respond to capsaicin, eugenol treatment (300 μΜ and 600 μΜ) x 24 hours directed an approximately 50% reduction in the number of capsaicin (500 nM)-responsive neurons.

EXAMPLE 18: MANUFACTURE OF A POLYMERIC DELIVERY DEVICE BY MICROFABRICATION

[00517] A nanoplatform delivery device that is 150 μιη x 150 μιη in size with a reservoir well of 70 μιη x 70 μιη x 6 μιη was made by spin-coating SU-8 2010 photoresist onto a silicon wafer substrate at a speed of 3,000 rpm for 30 seconds (the spin-coating procedure consisted of a preliminary phase wherein the silicon wafer substrate was spun at 300 rpm for 10 seconds, followed by acceleration at 300 rpm/second to reach the desired target speed, followed by a principal phase wherein the silicon wafer substrate was spun at the target speed for the duration of the specified time period). The wafer was then pre-baked at 95 °C for 1 minute followed by 2 minutes of cooling. UV light of wavelength 405 nm, 16 mW/cm was used to polymerize the exposed SU-8 photoresist through a negative photomask for 18 seconds. This UV light exposure step defined the body of the microdevice. Post baking was then performed at 95°C for 1 minute followed by 2 minutes of cooling.

[00518] Next, another coating of SU-8 photoresist was spin-coated onto the silicon wafer

substrate at 1250 rpm for 30 seconds. The wafer was then pre-baked at 95°C for 1 minute followed by 2 minutes of cooling. A second photomask was then aligned onto the silicon wafer substrate, and UV light exposure was performed to create the reservoir wells. The wafer was then post-baked at 95°C for 1 minute followed by 2 minutes of cooling. Finally, the silicon wafer substrate was developed in SU-8 photoresist developer for 1 min followed by an isopropyl alcohol wash. The wafers were then dried in nitrogen.

[00519] Once the nanoplatform delivery devices were created, the empty reservoir wells were filled with a solution comprising 1 mL of PEGDMA crosslinker, 300 μΐ_^ of eugenol (6M), and 300 μΐ_^ of 60 mg/mL dimethoxyacetophenone initiator in poly vinyl pyridine monomer. The solution (500 μί) was loaded into the empty microdevices by spin-coating the silicon wafer substrate at 1250 rpm for 30 seconds. Next, a third photomask was aligned onto the wafer substrate the filled nanoplatform delivery devices were exposed to UV light for 90 seconds, followed by water development of the wafers for 30 seconds, followed by isopropyl alcohol wash and nitrogen drying. The third photomask was designed to polymerize the PEGDMA and poly vinyl pyridine into a hydrogel in order to entrap the applied compound in the delivery device reservoir.

[00520] A razor blade was used to remove strips of devices (5,000 devices/strip) from wafers sprayed with 70% ethanol. The devices then were collected in a 15 mL tube, suspended in 2 mL 70% ethanol, and centrifuged to pellet at 4,000 rpm for 2 min. Following centrifugation, the ethanol was aspirated and an aqueous solution (PBS) was replaced over the devices with slight agitation at room temperature. When contacted with a fluid medium, the hydrogel swells and allows the compound to diffuse out of the reservoir wells, which functions as the delivery mode. At the desired time point, a supernatant sample was removed and analyzed using HPLC-UV spectroscopy to quantify the amount of the compound that had eluted from the delivery device.

EXAMPLE 19: DETECTION AND QUANTIFICATION OF EUGENOL IN SOLUTION BY A

COMBINATION OF HPLC AND UV SPECTROSCOPY

[00521] Based on absorbance measurements of known concentrations of eugenol (10 μΜ - 300 μΜ), a standard calibration curve was composed and plotted (FIG. 27), showing a linear relationship with a predicted linear regression of r = 0.98. This allowed the determination of concentrations of experimental samples below the level of measurement used for the standard curve. A method was also devised that was capable of separating eugenol from other compounds prior to its detection by UV absorbance (Lambda ABS = 281 nm). As shown in FIG. 28, it was observed that eugenol (300 μΜ) eluted at a signature time of t = 26.73 min. The elution time and magnitude of the peak was subsequently used to identify and quantitate eugenol (or other TRPVl modulators) released from delivery devices. Such information may be used modify the pore size and loading concentrations of delivery devices, and therefore facilitate "tuning" of the devices to achieve a specific target profile of drug release timing and concentration.

EXAMPLE 20: MITHRAMYCIN A CAN BE DETECTED AND QUANTIFIED IN SOLUTION BY A

COMBINATION OF HPLC - UV SPECTROSCOPY

[00522] As shown in FIG. 30, mithramycin A (5 μΜ) was detected using HPLC-UV

chromatography. Mithramycin A eluted at t = 15.4 minutes. This elution time and the magnitude of the peak were subsequently used to identify and mithramycin A (or other TRPVl transcription factor inhibitors) released from delivery devices. Such information may be used modify the pore size and loading concentrations of delivery devices, and therefore facilitate "tuning" of the devices to achieve a specific target profile of drug release timing and concentration.

EXAMPLE 21: LOADING AND RELEASING OF EUGENOL INTO A STRIP OF POLYMERIC DELIVERY DEVICES

[00523] Delivery devices manufactured and loaded with eugenol as described in Example 18 were placed in an aqueous solution (PBS) and subjected to agitation at room temperature for 40 minutes, a sample (60 μί,) of the supernatant was removed and analyzed using HPLC-UV spectroscopy. As shown in FIG. 29, a detectable peak was identified by the HPLC-UV system at 26.801 min, the time signature established for eugenol. Based on the peak height / area under the curve observed from this prototype, eugenol was delivered from the devices into the solution and achieved a eugenol concentration of 5 μΜ. Subsequently, this prototype will be modified to provide other target concentrations at a predicted time point. EXAMPLE 22: LOADING AND RELEASING OF MITHRAMYCIN INTO A STRIP OF POLYMERIC DELIVERY DEVICES

[00524] Delivery devices manufactured as described in Example 18 were loaded with a

formulation including the following components: 1 mL of PEGDMA crosslinker, 300 μΐ_^ of mithramycin (2.88 mM), and 300 μΐ_^ of 60mg/mL dimethoxyacetophenone initiator in poly vinyl pyridine monomer. The formulation (500 μί) was loaded into the empty delivery devices by spin-coating the silicon wafer substrate at 1250 rpm for 30 seconds, and the processessing of the devices was completed as previously described. Two strips of the formulated delivery devices were then placed in an aqueous solution (PBS) and stored at room temperature for 98 hours. A sample of the PBS was then removed and analyzed using HPLC-UV spectroscopy. As shown in FIG. 31, a detectable peak was identified by the HPLC-UV system at 15.5 min, the time signature established for mithramycin A. Based on the peak height / area under the curve observed from this prototype, mithramycin A was delivered from the devices into the solution and achieved a mithramycin A concentration of 64.5 nM. Subsequently, this prototype will be modified to provide other target concentrations at a predicted time point.

EXAMPLE 23: ANALYTICAL OPTIMIZATION OF A STRIP OF POLYMERIC DELIVERY DEVICES

[00525] Since the release of eugenol is dictated primarily by loading concentration and pore size, additional changes in therapeutic composition will be made to this prototype. For example, quantitative measurement of delivered eugenol will be considered under different loading concentrations, hydrogel composition that governs the porosity and time points during delivery. Also, the volume of drug used can be modified by using a thicker microdevice having more reservoir volume. The resultant compositional profiles (loading concentration, pore size- hydrogel composition, and resultant time of release) will be varied in an iterative process to compose polymeric devices that are intended to deliver a therapeutic agent(s) at specific concentrations over a defined time interval. Therapeutic agents include modulators of TRPV1 activity (eugenol, curcumin, capsaicin) and/or inhibitors of TRPV1 transcription factors

(mithramycin, tolfenamic acid, diclofenac). EXAMPLE 24: OPTIMIZATION OF A STRIP OF POLYMERIC DELIVERY DEVICES TO DECREASE TRPV1 EXPRESSION AND/OR ACTIVITY IN CULTURED SENSORY NEURONS

[00526] Based on a free concentration found to be effective for the decrease of TRPV1 expression and/or activity in cultured sensory neurons, a TRPV1 transcription factor inhibitor (mithramycin, tolfenamic acid, diclofenac) and/or a TRPV1 modulator (eugenol, curcumin, capsaicin) will be loaded into a strip of Polymeric Delivery Devices and allowed to incubate with cultured sensory neurons for a period of time ranging from several hours to several days. The resultant decrease in the magnitude and/or number of capsaicin responsive neurons will link drug delivery by a strip of polymeric delivery devices to a pharmacologic end point, such as inhibition of TRPV1.

EXAMPLE 25: OPTIMIZATION OF A STRIP OF POLYMERIC DELIVERY DEVICES ASSESSED IN EXPERIMENTAL MODELS OF PAIN AND HYPERALGESIA

[00527] Each pathophysiologic state (e.g., tissue injury, nerve injury, or a combination of tissue and nerve injury, inflammation, metabolic, autoimmune) can result in the activation of the pain pathway. To determine the analgesic efficacy of a strip of polymeric delivery devices loaded with TRPV1 transcription factor inhibitors (mithramycin, nucleic acid agents that decrease expression of TRPV1 transcription factors, tolfenamic acid, and/or diclofenac) and/or TRPV1 modulators (eugenol, curcumin, capsaicin) are placed at or near the site of injury to deliver the compounds orally, transdermally, systemically, or intrathecally. The analgesic system will decrease a behavioral measure of pain - hyperalgesia in one or more established rodent models of nociception. These include: A) Inflammation-CFA paw injection; B) Neuropathic - Partial Nerve Injury; C) Incision - paw incision model, and D) Mixed Tissue/Nerve - post-operative Thoracotomy Model).

[00528] Model A) Inflammatory Pain: CFA- Complete Freund's Adjuvant is injected into the paw of a mouse to provide a model of inflammatory pain and hyperalgesia. This model is used to assess the capacity of an analgesic Polymeric Delivery Device to decrease behavioural measures of inflammatory hyperalgesia through measurement of thermal and/or mechanical paw withdrawl latency to a noxious / non-noxious stimulus.

[00529] Model B) Neuropathic Pain: A Partial Sciatic Nerve Injury Model provides a

reproducible representation of nerve injury-evoked pain condition in the rodent. A partial ligature around 1/3 to 1/2 of the diameter of the sciatic nerve results in an ensuing mechanical and thermal allodynia (pain hypersensitivity). This model is used to assess the capacity of the analgesic Polymeric Delivery Device to decrease a model of neuropathic pain through measurement of thermal and/or mechanical paw withdrawl latency to a noxious / non noxious stimulus.

[00530] Model C) Incision Model. The plantar paw incision model is a reproducible short-term pain model that mimics the pain associated with acute surgical intervention / incision. Both evoked pain behaviors and neurophysiologic testing suggest a time course that mimics similar studies of forearm incision in humans. This model is used to assess the capacity of the analgesic Polymeric Delivery Device to decrease evoked pain behaviors through measurement of thermal and/or mechanical paw withdrawl latency to a noxious / non noxious stimulus.

[00531] Model D) Skin Muscle Incision Retractor Model (SMIR) AKA: Mixed Post-operative Thoracotomy Pain Model. This model combines the elements of inflammation and neuropathic pain in a reproducible manner to evaluate hyperalgesic responses and allodynia (pain behavioiur to a non-noxious stimulus) following a clinically relevant experimental surgical injury. In this model, the pleura of mature anesthetized rats are opened between the ribs and a retractor placed under both ribs and opened 8 mm. This also results in a compression/stretch injury of the intercostal nerves adjacent to the retracted ribs. This model is used to assess the capacity of the analgesic Polymeric Delivery Device to decrease behavioural measures of pain - hyperalgesia through measurement of mechanical and cold allodynia over the incision site.

EXAMPLE 26: PRODUCTION OF A PAIN MANAGEMENT STRIP

[00532] Pullulan (about 0.225 grams; from Aureobasidium pullulan, Sigma CAS9057-02-7) dry weight was combined with a plasticizer, Sucrose 0.025 grams, plus 5 ml of autoclaved Mili Q water. Following gentle mixing for 5 minutes at room temperature, 5 microliters of a 10 mM/L capsaicin stock solution (in ethanol) was added for a final concentration of 10 μΜ/L. The solution was then slowly mixed by a mechanical rotator at room temperature for 6.5 hours and then poured into a sterile plastic trough and the water content was slowly extracted at room temperature by evaporation in a fume hood for 24 hours. The newly formed strip (5 inches x 1/2 inch) with a thickness and flexibility that approximates a piece of copy paper was then easily detached from the plastic trough. EXAMPLE 27: FABRICATION OF A BIOCOMPATIBLE POLYMERIC DELIVERY DEVICE STRIP

[00533] A delivery device containing poly (methyl methacrylic acid)-co-PEGDMA (PMMA- PEGDMA) prepolymer solution is manufactured). The mode of fabrication can involve similar steps as used in SU-8 delivery device fabrication, or can involve using a combination of positive photoresist microfabrication techniques and reactive ion etching. In addition to the fabrication process and loading with the intended compound or compounds of interest, the delivery devices may also be chemically modified to include cell- specific targeting functionality. For this functionalization, both biotin-avidin chemistry and carbodiimide chemistry approaches will be used.

EXAMPLE 28: SP4 +/- KNOCKDOWN MICE EXPRESS A REDUCED AMOUNT OF TRPVl-

IMMUNOREACTIVE SUBUNIT PROTEIN IN DRG

[00534] Western blots of DRG protein extracts derived from control (wild type) mice (B6) versus knock down (Sp4 +/-) mice were performed. DRG derived from Sp4+/- mice showed a reduction in TRPVl - like protein expression (FIG. 32A). Histogram data of TRPVl-like protein expression based on the expected TRPVl protein band -90 kDa (upper arrow in FIG. 32A) using a C-terminal directed TRPVl antisera (Eilers et al Neuroreport 2007) and quantitated with Infrared fluorescent secondary antibodies using an Odyssey IR detection system is shown in FIG. 32B. TRPVl-like protein expression was normalized using GAPDH (lower arrow in FIG. 32A) and the resultant ratio plotted as a normalized integrated intensity in FIG. 32B. Each histogram in FIG. 32B represents the mean (+/- SEM) of four independent B6 and Sp4+/- mice.

EXAMPLE 29: IMMUNOFLUORESCENCE STAINING OF DRG NEURONS FOR DETECTION OF TRPVl IN WILDTYPE B6 VERSUS SP4 +/- MICE

[00535] Peripheral inflammation as experimentally modeled by the injection of Complete

Freund's Adjuvant (CFA) into the hind paw of rats / mice induces a state of experimental pain and hyperalgesia that can persist for days to weeks. TRPVl is a critical receptor channel that mediates inflammatory thermal hyperalgesia. It has also been proposed that as a result of peripheral inflammation, specialized sensory neurons called nociceptors undergo phenotypic changes such as the de novo expression of TRPV1 in larger diameter sensory neurons that typically do not express this nociceptive channel. One consequence of this phenotypic change is a shift from acute to persistent (chronic) pain states driven by a change in transcriptional control of TRPV1 gene expression. The transcription factor Sp4 is believed to be critical for the expression of TRPV1 in sensory neurons, and a reduction / blockade of Sp4 function under inflammatory conditions or tissue injury should reduce or eliminate phenotypic changes that are associated with the development of persistent inflammatory hyperalgesia.

[00536] Complete Freund's Adjuvant (CFA) was injected at a volume of 20 μΐ_^ into the left

hindpaw of Sp4 heterozygous mice and age-matched (8-10 week old) wild type mice (C57BL/6J; Jackson Laboratories) to induce inflammation. An equivalent number of mice of each strain were injected with 20 μΐ_^ saline as a control. Throughout the procedure, animals were anesthetized with 1.5% isoflurane (vol/vol). On post- injection day 6, left side L4 and L5 dorsal root ganglia (DRGs) were harvested and post-fixed in 4% formaldehyde in phosphate-buffered saline solution (PBS) for 2 hours at 4 °C. Tissues were washed 3 times with PBS and cryoprotected in 25% sucrose solution in PBS overnight at 4 °C. After cryoprotection, tissue was washed three times with PBS, frozen in Optimal Cutting Temperature compound (OCT) and stored at -80 °C.

[00537] For each animal, 3 x 10 μιη-thick sections were cut onto each of 2 Fisher SuperfrostPlus slides. Hydrophobic ink was used to line the edges of the slides to prevent loss of liquid during incubation. Sections were blocked for 1 hour at room temperature in PBS solution containing 10% donkey serum and 0.1% Triton X-100 and washed 1 time with PBS. Slides were then incubated overnight at 4 °C with goat anti-TRPVl primary antibody solution (1:500; Santa Cruz Biotechnology, sc- 12498), and washed 3 times with PBS. Sections were then incubated 1 hour at room temperature with AlexaFluor® 488-conjugated donkey anti-goat secondary antibody solution (1:1000; Invitrogen, A- 11055) and washed 3 times with PBS. All antibodies were diluted in PBS solution containing 2.4% donkey serum and 0.1% Triton X-100. Crystal Mount Aqueous Mounting Medium (Sigma 117K1035) was applied for mounting coverslips.

[00538] Viewing and image-capture were performed using a Zeiss Axiovert200 microscope and Axiocam MRm camera. Fluorescent images were captured at 40X using an oil immersion lens and a Zeiss 09 filter on Zeiss Axio Vision software. Tissues were identified using the oculars and halogen light. Images of every fourth view were captured, starting at the bottom left corner of the tissue region and moving right-to-left and bottom- to-top. To standardize analysis, 6 images from each animal were used for quantitation. For each animal, the number of captured images was divided by 6, yielding n. Every nth image was then analyzed. An individual who was blinded to the tissue identity outlined the circumferences of TRPVl -expressing cells. TRPVl -positive neurons were identified as those significantly brighter than the background. Only neurons exhibiting a clear nuclear profile were considered positive. Zeiss Axio Vision software generated area values for selected regions. These values were recorded and areas were entered into a GraphPad Prism® file, where they were divided into 100 sq. μιη bins.

[00539] TRPVl immuno-cytochemistry of L4-5 DRGs taken from control B6 mice with left hindpaw CFA-induced inflammation showed an increase in the number of larger diameter TRPVl immuno staining sensory neurons (FIG. 33A). In contrast, DRGs examined from CFA- treated Sp4+/- mice failed to develop an increase in TRPVl immuno-like expression in the larger diameter DRG neurons (FIG. 33B).

EXAMPLE 30: MICROPOROUS THIN FILM FABRICATION AND DEGRADATION

[00540] Solutions of PCL and gelatin were combined, respectively, in the following volumetric ratios: 7:3, 8:2, 9:1 and 10:0. After vigorous mixing, the combined solutions were spin cast into flexible polymer thin films. Initially non-porous, thin films were exposed to PBS for 5 days to eliminate the readily soluble gelatin components of the thin films. After 5 days of degradation in PBS, thin films were imaged using scanning electron microscopy (FIG. 34A-F). Micropores were found in all thin films containing gelatin, while PCL-only thin films showed no signs of degradation or porous architecture. Individual pore areas were quantified and are displayed in FIG. 34A-F.

[00541] FIG. 34A-F show images of scanning electron micrographs and corresponding pore size histograms of PCL/gelatin thin films after five days of degradation in PBS. Thin films were made from mixtures of PCL and gelatin at ratios of 7:3 (FIG. 34A and B), 8:2 (FIG. 34C and D), and 9:1 (FIG. 34E and F). Thin films made from PCL only did not contain any pores.

[00542] Thin films fabricated with the highest concentration of gelatin (7:3) contained a broad range of pore sizes, the smallest less than 2 μιη in diameter and the largest over 30 μιη in diameter (FIG. 34A and B). Thin films with a medium gelatin concentration (8:2) also contained a wide range of pore sizes, although the largest pores found in these films were smaller than in the 7:3 gelatin thin films and only reached a maximum of 28 μιη in diameter (FIG. 34C and D). Thin films with the lowest gelatin concentration (9:1) contained much smaller pores, 95% of which were smaller than 10 μιη in diameter (FIG. 34E and F). Thin films fabricated without gelatin (10:0) were non-porous throughout the entire spin cast thin film surface.

[00543] The percent porosity, or the pore area divided by the total area of each thin film, was quantified and is shown in FIG. 35A. As the gelatin rapidly dissolves in PBS, increasing the amount of gelatin in the thin films led to more porosity after degradation. The 7:3 films were the most porous, followed by the 8:2 films, and then by the 9:1 films. Since the 10:0 films contained no gelatin, no degradation and therefore no porosity was observed.

[00544] FIG. 35A and B illustrate the porosity and mass loss of PCL/gelatin thin films after

incubation in PBS. FIG. 35 A: Percent porosity of PCL/gelatin thin films of varying gelatin concentrations after 5 days in PBS. Overall porosity increases with gelatin concentration. FIG. 35B: Porosity resulting from gelatin dissolution lead to a decrease in mass. PCL swelling and salt absorption leads to a small overall increase in mass for thin films containing no gelatin. *p<0.05, Student-Newman, Keuls test. Error bars indicate standard deviation over three independent experiments.

[00545] The porosity found in the thin films is due to the incomplete mixing of PCL and gelatin.

Although both species dissolve in TFE, combining the two solutions results in a heterogeneous emulsion that must be constantly mixed or the two solutions will separate into two immiscible liquids. Due to the high viscosity of the dissolved solutions it was empirically determined that maintenance of a consistent mixture necessitated near constant vortexing prior to spin casting. Adding increasing amounts of gelatin resulted in aggregation of the gelatin in the PCL/gelatin mixture that was not found in the 9:1 thin films.

[00546] Degradation was also quantified using the amount of mass lost after 5 days in PBS. Initial mass was determined prior to PBS immersion, while post-degradation mass was determined after 5 days in PBS and subsequent dehydration of the thin films in a vacuum oven. Results were consistent with pore area and percent porosity; the 7:3 thin films lost the most mass,

approximately 25% of their initial mass, while 8:2 films lost just less than 10% on average. 9:1 thin films lost less than 5%, and films containing no gelatin gained a very small amount of mass due to the immersion in PBS (FIG. 35B). This most likely occurred due to water and salt absorption, causing the PCL areas to swell during immersion in PBS. EXAMPLE 31: NANOSTRUCTURED THIN FILMS

[00547] A template-synthesis method is used to produce nanostructures in thin biodegradable polymer films. This approach is based on templating, which entails using an inorganic nanostructured surface (e.g., well-characterized rod structures of a zinc oxide (ZnO) material) as a template for the subsequent creation of a "soft" biopolymer thin film with desired nano- architectures. A two-step procedure is used for ZnO nanrod growth: a nanostructured seed layer is deposited and rods are grown hydrothermally from the seed layer. Through variations in seed layer deposition and hydrothermal growth conditions, a variety of morphologies are produced, from random to well-oriented rods. Control of processing conditions allows nanorods to be fabricated in a wide range of diameters, lengths, and inter-rod spacing.

[00548] A variety of techniques are used to deposit the target polymer onto ZnO templates.

[00549] In one example, polymers are heated above their melting point and allowed to conform to the template. Alternatively, spin casting of polymer solutions is used to generate thin films with reproducible thickness. Polycaprolactone was selected as a starting material since it has excellent biocompatibility and integrity properties. Under physiological conditions, PCL degrades by random chain scission, which gives rise to a two-phase degradation. Initially, as molecular weight decreases, the physical structure is unaffected since the generated polymer chains are not sufficiently soluble. After extended degradation, there is an increased generation of monomeric degradation products, resulting in significant physical degradation.

[00550] 80 kDa PCL films do not degrade until after 1 year in vivo and, based on the approximate MW for macroscopic degradation (8 kDa), it is estimated that PCL devices of MW between 15 and 20 kDa will start to structurally breakdown after 4 months and lose mechanical integrity by 6 months. Therefore, films are created using two exemplary different ratios (20:80 and 45:55) of 80kDa:10kDa PCL (T_m = 58-63 °C, T_g = -65 to -60 °C). Other degradable polymers can also be incorporated into the device. In addition, other films may be created, such as co-polymers of 25/75 poly(DL-lactide-co-s-caprolactone) (25/75 DLPLCL) (amorphous, T_g = 20 °C) or 80/20 poly(DL-lactide-co-s-caprolactone) (80/20 DLPLCL) (amorphous, T_g = 20 °C) to modulate the degradation rate. Finally, ZnO templates are then removed by dissolution in either acidic or strongly basic solutions. The template structure is inverted upon transfer and the subsequent polymer thin film exhibits nano-channels for drug elution and controlled release. Using this approach, ZnO rods with average rod diameter of 23+7 nm and density of approximately 10¹⁰ rods/cm 2 can result in a PCL film with pore sizes of 21+7 nm and a pore density of 5 x 109 pores/cm . The thickness of the film corresponds to the lengths of the nanorods that are grown, e.g., about 1 micron. Therefore, to further improve mechanical robustness, an additional porous layer is deposited prior to template removal, resulting in films with both nanoporous and microporous regions (FIG. 36A-C). For example, this is accomplished by casting a polymer mixture that naturally forms a porous network, such as polyethyleneglycol (PEG) and PCL, where PEG is easily dissolved in conjunction with template removal.

[00551] An exemplary process for thin film fabrication is illustrated in FIG. 37A-E. (FIG. 37A) A clean silicon substrate is (FIG. 37B) spin cast with a zinc oxide seed layer and nanorods are hydrothermally grown. Onto the ZnO template (FIG. 37C) PCL is spin cast followed by (FIG. 37D) spin casting a PCL and PEG solution. (FIG. 37E) rinsing with deionized water rinses the PEG-phase from the supporting layer and 10 mM H₂SO₄ etches the ZnO template to leave a supported nanostructured PCL thin film. FIG. 37F shows a scanning electron microscope image of a typical nanostructured PCL film. FIG. 37G shows a thin layer of nanostructures on a supporting membrane.

[00552] Scanning electron microscopy (SEM) is used to verify template morphology and fidelity of transfer to the polymer film. Additional characterization with electron dispersive x-ray spectroscopy (EDX) or x-ray photoelectron spectroscopy (XPS) is used to determine chemical composition and demonstrate effective removal of the ZnO template. Nanostructured membranes are then heat sealed to an impermeable capping film containing a drug reservoir (FIG. 38A-B).

[00553] As an example, using an inorganic template of aligned and ordered nanowires produces a nanoporous polymer membrane, as described above, an exemplary thin film was made from 80kDa MW polycaprolactone that is curled up in its dry state and unfurls when in an aqueous environment (FIG. 39A-C). This thin film device was fabricated to have both physical dimensions (less than 100 microns) and mechanical properties (furlability) suitable for the minimally invasive drug delivery application described herein.

EXAMPLE 32: DRUG LOADING APPROACHES AND DRUG PAYLOAD

[00554] Because nanoporous film fabrication is independent of drug loading, several strategies are utilized to incorporate the therapeutic payload. One approach joins the membrane with an underlying film containing larger drug reservoirs. This configuration allows for a large drug carrying capacity and versatility in payload formulation, while the nanoporous membrane helps to control drug elution out of the reservoir structure.

[00555] By utilizing a further microporous supporting layer, the nanochannels are placed near the neutral mechanical plane of the device, minimizing strain on the nanopores upon

rolling/unfurling. Photo- and soft lithographic techniques are used to fabricate a reservoir component of the device: photolithography is used to create a master mold on a silicon wafer by patterning a photocurable epoxy (SU-8), which determines eventual reservoir geometry. A precise master pattern is designed using CAD, and patterned on a chromium mask, to act as a stencil for optical patterning. Soft lithography is then used to cast the inverse of the master mold into an elastomer polydimethylsiloxane (PDMS). By casting the polymer of interest against the PDMS mold, the geometry of drug loaded reservoirs is transferred directly to the desired polymer, e.g., as shown in FIG. 38A. The entire device is flat, thin (e.g., about 100 μιη or less), and contains multiple therapeutic reservoirs. This provides the drug payload while minimizing burst release of therapeutic upon local film rupture or failure.

[00556] The modular nature of the thin film devices allows for the reservoirs to be filled during construction of the multi-laminar biopolymer device in multiple ways. One approach is to fill the reservoir and associated nanochannels of assembled devices by submersion into a solution containing the drug. A second approach uses direct deposition of a polymeric layer containing the drug onto the reservoir film and subsequent lamination of the films, heat sealing the films to generate the complete device. Drugs can be deposited directly into device reservoirs or can be incorporated within a biodegradable polymer or gel matrix.

EXAMPLE 33: MULTILAYER THIN FILM DEVICE FOR CONTROLLED RELEASE OF COMPOUNDS

[00557] A nanoporous multilayer thin film device was fabricated with a reservoir containing the small molecule rapamycin (MW 914 Da). The release kinetics of rapamycin from this nanoporous multilayer thin film device were compared to the release kinetics of rapamycin from a non-porous device and from PCL thin film with rapamycin mixed in the polymer film.

[00558] FIG. 40 illustrates the release kinetics of a small molecule (Rapamycin, molecular weight 914.172 Da) from a nanoporous thin film device (solid circles), non-porous device (solid squares) and from a PCL thin film with drug mixed in the polymer film (solid triangles). [00559] The nanoporous thin film device consisted of a first layer of supported nanostructured film (nanostructured pores of 20-40 nm and support layer pores of 1-3 microns) and a second non-porous layer, produced as described above. Rapamycin was deposited on a surface of the first layer. The nano-porous first thin film layer was then placed on a non-porous film

encapsulating the rapamycin between the nanoporous layer and the non-porous layer.

[00560] The non-porous device included a first layer of a non-porous film. Rapamycin was

deposited on a surface of the first layer. A second non-porous layer was placed on the first layer. The two non-porous layers were sealed together, encapsulating the rapamycin between the non- porous layers.

[00561] For the PCL thin film, the rapamycin was mixed within the polymer itself rather than being contained between the two layers.

[00562] Kinetics of release of the small molecule drug rapamycin (sirolimus) from the

nanoporous and non-porous PCL devices were compared to the release kinetics of the same molecule from a PCL film containing the drug. FIG. 40 illustrates that the nanoporous PCL device (nanostructured pores of 20-40 nm and support layer pores of 1-3 microns) and the non- porous PCL device provide for a zero order release of the small molecule over an extended period of time. In contrast, the PCL thin film containing rapamycin released the compound over a shorter period of time and with first order release kinetics.

[00563] Although the foregoing invention has been described in some detail by way of

illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[00564] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims.

Claims

1. A method of treating pain, said method comprising:

administering to a subject in need of treatment

(i) a first compound that inhibits activity of a transient receptor potential cation channel subfamily V member 1 (TRPV1) transcription factor, and

(ii) a second compound that that modulates TRPV1 activity,

wherein said administering is effective to treat pain.

2. The method of claim 1, wherein the first compound is a compound of the following formula (I):

or a pharmaceutically acceptable salt thereof, wherein

R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl;

R 30 is selected from hydroxyl and oxo;

R⁴⁰ is selected from hydroxyl and oxo; and

R⁵⁰ is selected from alkyl and substituted alkyl.

3. The method of claim 1, wherein the first compound is a compound of the following formula (II):

or a pharmaceutically acceptable salt thereof, wherein

R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl.

The method of claim 3, wherein the first compound is a compound of the following

or a pharmaceutically acceptable salt thereof.

5. The method of claim 1, wherein the first compound is a compound of the following formula (III):

or a pharmaceutically acceptable salt thereof, wherein

R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl; and

R 30 is selected from hydroxyl and oxo.

6. The method of claim 5, wherein the first compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

7. The method of claim 5, wherein the first compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

8. The method of claim 1, wherein the first compound is a compound of the formula (IV):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl.

9. The method of claim 8, wherein the first compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

10. The method of claim 1, wherein the first compound is a compound of the formula (V):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl.

11. The method of claim 10, wherein the first compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

12. The method of claim 1, wherein the first compound is a nucleic acid agent that reduces expression of specificity protein 1 (Spl), Sp3, or Sp4.

13. The method of claims 1-12, wherein the second compound is a compound of the following formula (VI) or (VII):

or a pharmaceutically acceptable salt thereof, wherein

R 1 and IT 2 are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R 3^J and R 4" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

The method of claim 13, wherein the second compound is a compound of the following

or a pharmaceutically acceptable salt thereof.

15. The method of claim 13, wherein the second compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

16. The method of claims 1-12, wherein the second compound is a compound of the following formula (VIII):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl;

R is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; and

R is selected from C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

17. The method of claim 16, wherein the second compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

18. The method of claims 1-12, wherein the second compound is a compound of the following formula (IX):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate;

R is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate; and

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

19. The method of claim 18, wherein the second compound is a compound of the following formula:

or a pharmaceutically acceptable salt thereof.

20. The method of claim 1, wherein the first compound is a compound of one of the following formulae (I), (II), or (III):

or a pharmaceutically acceptable salt thereof, wherein

R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl;

R 30 is selected from hydroxyl and oxo;

R⁴⁰ is selected from hydroxyl and oxo; and

R⁵⁰ is selected from alkyl and substituted alkyl, and

the second compound is a compound of one of the following formula (VI) or (VII):

or a pharmaceutically acceptable salt thereof, wherein

R 1 and IT 2 are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R 3^J and R 4" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

21. The method of claim 1, wherein the first compound is a compound of one of the following formulae (I), (II), or (III):

or a pharmaceutically acceptable salt thereof, wherein

R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl;

R 30 is selected from hydroxyl and oxo;

R⁴⁰ is selected from hydroxyl and oxo; and

R⁵⁰ is selected from alkyl and substituted alkyl, and

the second compound is a compound of the following formula (VIII):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; R is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; and

R is selected from C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

22. The method of claim 1, wherein the first compound is a compound of one of the following formulae (I), (II), or (III):

or a pharmaceutically acceptable salt thereof, wherein R and R are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl;

R 30 is selected from hydroxyl and oxo;

R⁴⁰ is selected from hydroxyl and oxo; and

R⁵⁰ is selected from alkyl and substituted alkyl, and

the second compound is a compound of the following formula (IX):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate;

R is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate; and

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

The method of claim 1, wherein the first compound is a compound of the following

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl, and

the second compound is a compound of one of the following formulae (VI) or (VII):

or a pharmaceutically acceptable salt thereof, wherein

R 1 and R 2" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R 3^J and R 4" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro. The method of claim 1, wherein the first compound is a compound of the following

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl, and

the second compound is a compound of the following formula (VIII):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; 2

R is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; and

R is selected from C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

25. The method of claim 1, wherein the first compound is a compound of the following formula (IV):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro;

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl, and

the second compound is a compound of the following formula (IX):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate;

R is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate; and

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

26. The method of claim 1, wherein the first compound is a compound of the following formula (V):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl, and

the second compound is a compound of one of the following formulae (VI) or (VII):

or a pharmaceutically acceptable salt thereof, wherein

R 1 and R 2" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R 3^J and R 4" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

27. The method of claim 1, wherein the first compound is a compound of the following formula V:

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro; 2

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl, and

the second compound is a compound of the following formula (VIII):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl;

R is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; and

R is selected from C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

28. The method of claim 1, wherein the first compound is a compound of the following formula (V):

or a pharmaceutically acceptable salt thereof, wherein R¹ is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, carboxyl, carboxyl ester, aminoacyl, azido, cyano, halogen, hydroxyl, and nitro;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl;

R is selected from alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R⁴ is selected from hydrogen and alkyl, and

the second compound is a compound of the following formula (IX):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate;

R is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate; and

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

29. The method of claim 1, wherein the first compound is a nucleic acid agent that reduces expression of specificity protein 1 (Spl), Sp3, or Sp4, and

the second compound is a compound of one of the following formulae (VI) or (VII):

O OH (VII), or a pharmaceutically acceptable salt thereof, wherein

R 1 and R 2" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro; and

R 3^J and R 4" are independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, substituted acyl, amino, substituted amino, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

30. The method of claim 1, wherein the first compound is a nucleic acid agent that reduces expression of specificity protein 1 (Spl), Sp3, or Sp4, and

the second compound is a compound of the following formula (VIII):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl;

R is selected from hydrogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, acyl, and substituted acyl; and R is selected from C1-C6 alkenyl, substituted C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkynyl, cycloalkyl, substituted cycloalkyl, acyl, substituted acyl, azido, carboxyl, cyano, halogen, hydroxyl, and nitro.

31. The method of claim 1, wherein the first compound is a nucleic acid agent that reduces expression of specificity protein 1 (Spl), Sp3, or Sp4, and

the second compound is a compound of the following formula (IX):

or a pharmaceutically acceptable salt thereof, wherein

R¹ is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate;

R is selected from hydrogen, hydroxyl, alkyl, substituted alkyl, alkoxy, substituted alkoxy, cyano, halogen, nitro, and sulfate; and

R is selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, and substituted cycloalkyl.

32. The method of claims 1-31, wherein the first and second compounds are co-formulated.

33. The method of claims 1-32, wherein the first compound and/or the second compound are formulated for sustained release.

34. The method of claims 1-33, wherein the first compound and/or the second compound are disposed in or on a substrate of a drug delivery device.

The method of claims 1-34, wherein said administration is by oral administration.

36. The method of claim 35, wherein said oral administration comprises orally administering a drug delivery device to the subject.

37. The method of claims 1-34, wherein said administration is by local administration to a tissue.

38. The method of claim 37, wherein said local administration is to a wound site.

39. The method of claim 38, wherein said wound site is a surgical wound site.

40. The method of claims 37-39, wherein said administration comprises implanting a drug delivery device into a subject.

41. A method of treating pain, said method comprising:

administering a nucleic acid agent that reduces expression of Spl, Sp3, or Sp4 to a subject, wherein said administering is effective to treat pain.

42. The method of claim 41, wherein said administering is by a drug delivery device comprising a substrate in or on which the nucleic acid agent is disposed.

43. The method of claim 41 or 42, wherein the nucleic acid agent is formulated for sustained release.

44. A method of treating pain, the method comprising administering to a subject a compound of one of the following formulae (I), (II), or (III):

or a pharmaceutically acceptable salt thereof, wherein

R¹⁰ and R²⁰ are independently selected from oligosaccharide, peptide, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, polycycloalkyl, substituted polycycloalkyl, aryl, substituted aryl, polyaryl, substituted polyaryl, heterocyclyl, substituted heterocyclyl, polyheterocyclyl, substituted polyheterocyclyl, heteroaryl, substituted heteroaryl, polyheteroaryl, substituted polyheteroaryl, and chain of mixed rings selected from cycloalkyl, aryl, heterocyclyl, and heteroaryl;

R 30 is selected from hydroxyl and oxo;

R⁴⁰ is selected from hydroxyl and oxo; and

R⁵⁰ is selected from alkyl and substituted alkyl,

wherein said administering is effective to treat pain.

45. The method of claim 44, wherein said administering is by a drug delivery device comprising a substrate in or on which the compound is disposed.

The method of claim 44 or 45, wherein the compound is formulated for sustained release.

47. A method of identifying a test compound, said method comprising:

contacting a cell that expresses a gene selected from an Spl, Sp3, or Sp4 gene with the test compound; and

detecting a level of expression of the gene, wherein a decrease in the level of expression of the gene in the presence of the test compound compared to a level of expression of the gene in the absence of the test compound indicates that the test compound has use in the treatment of pain.

48. The method of claim 47, wherein the test compound is a compound that inhibits the activity of a cyclooxygenase 2 (COX-2), and wherein contacting the cell with the test compound results in a desirable level of expression of the gene.

49. The method of claim 47 or 48, wherein the cell is in vivo in a transgenic animal that has a deficient level of expression of a TRPV1 transcription factor gene.

50. A composition comprising a first compound that inhibits activity of a transient receptor potential cation channel subfamily V member 1 (TRPV1) transcription factor and a second compound that modulates TRPV1 activity.