WO2012159216A1 - Peptides régénérant le tissu osseux - Google Patents

Peptides régénérant le tissu osseux Download PDF

Info

Publication number
WO2012159216A1
WO2012159216A1 PCT/CA2012/050344 CA2012050344W WO2012159216A1 WO 2012159216 A1 WO2012159216 A1 WO 2012159216A1 CA 2012050344 W CA2012050344 W CA 2012050344W WO 2012159216 A1 WO2012159216 A1 WO 2012159216A1
Authority
WO
WIPO (PCT)
Prior art keywords
bone
peptide
seq
composition
streptococcus
Prior art date
Application number
PCT/CA2012/050344
Other languages
English (en)
Inventor
Nandadeva Yakandawala
Karen Lovetri
Purushottam Gawande
Srinivasa Madhyastha
Original Assignee
Kane Biotech Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kane Biotech Inc. filed Critical Kane Biotech Inc.
Publication of WO2012159216A1 publication Critical patent/WO2012159216A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag

Definitions

  • the present invention relates to biologically active peptides, and more particularly relates to a composition comprising an antimicrobial competence stimulating peptide having bone tissue regenerating activity and a bone regenerating peptide.
  • the present invention also includes methods of stimulating bone growth comprising administering a composition comprising an antimicrobial competence stimulating peptide peptide having bone tissue regenerating activity and a bone regenerating peptide.
  • a treatment may include application of a composition or formulation to the defect site to enhance repair and bone healing.
  • the composition typically includes: (i) a particulate material to provide structural support and filling of the defect; (ii) compounds or medicaments to enhance repair of bone; and (iii) a carrier system to facilitate delivery to and retention of the composition at the defect site for the duration of the treatment.
  • the bone particulate may be treated by sintering process to reduce such risks.
  • the bone particulate source material may be replaced by a completely synthetic hydroxyapatite material that includes no organic residue. The difficulty arising for synthetics is that the resulting material may not resorb or otherwise lacks activity in the remodeling process.
  • U.S. Patent No. 4,770,860 describes a resorbable porous hydroxyapatite material derived from lime-containing algae by means of a hydrothermal process in the presence of phosphate. Hydroxyapatite material can be provided in the form of a gel obtained by a unique sol-gel process.
  • Formulations thought to enhance repair of bone tissue may include bone growth agents.
  • Bhatnagar in U. S. Patent No. 5,635,482 described a synthetic collagen-like agent that mimics autogenous cell attachment factors that promote bone growth.
  • Bhatnagar identified and synthesized a fifteen amino acid sequence of Type I collagen that promotes migration of reparative cells from surrounding tissues; directs cell attachment, orients migration, and facilitates a biomimetic environment for bone generation.
  • These and related polypeptide materials, called P-15 are bound to a particulate hydroxyapatite which may be natural, microporous xenogenic bone mineral, such as OsteoGraf ® N-300 manufactured by Dentsply Friadent CeraMed of Lakewood, Colo. In order for the P-15 cell binding irreversible to be active, it must be bound irreversibly to the particulate.
  • Bhatnagar teaches that the resulting dry particulate matrix including P-15, trade marked PepGen P-15 ® .
  • a bone repair material such as the aforementioned PepGen P-15 ® bone graft material, suspended in a suitable carrier is placed.
  • a carrier material may be utilized to retain the repair formulation in contact with the defect.
  • a bone repair material may contain antimicrobial agents or antimicrobial peptides fused with PepGen P-15 E or other osteogenic compounds to prevent infection at the surgical site.
  • the present invention includes a bone tissue regenerating composition comprising (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity and (b) a bone tissue regenerating peptide.
  • An embodiment of the present invention provides a bone tissue regenerating composition comprising (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity having an amino acid sequence of at least one of SEQ ID NOs: 1 to 15, and (b) a bone tissue regenerating peptide having an amino acid sequence of at least one of SEQ ID NOs: 16 to 23.
  • the present invention includes a fusion polypeptide where an antimicrobial competence stimulating peptide with bone tissue regenerating activity is fused to a bone tissue regenerating peptide.
  • a fusion polypeptide comprises (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity having an amino acid sequence of at least one of SEQ ID NOs: 1 to 15, and (b) a bone tissue regenerating peptide having an amino acid sequence of at least one of SEQ ID NOs: 16 to 23.
  • an antimicrobial competence stimulating peptide with bone tissue regenerating activity is linked to one terminus of a linker peptide, wherein the other terminus of a linker peptide is linked to a bone tissue regenerating peptide to form a fusion polypeptide.
  • a peptide linker includes one of SEQ ID NOs: 16 to 23.
  • a fusion polypeptide with both the bone tissue regenerating and antimicrobial activity is recombinant or synthetic.
  • the antimicrobial competence stimulating peptide alone has both the antimicrobial and bone tissue regenerating activity.
  • An embodiment includes an isolated nucleic acid encoding a fusion polypeptide described herein.
  • the nucleic acid can be DNA or RNA.
  • An embodiment of the invention includes a vector comprising DNA encoding a fusion polypeptide of the invention.
  • Another embodiment of the invention includes a host cell comprising the vector comprising DNA encoding a fusion polypeptide of the invention.
  • a further embodiment of the invention provides a method of expressing a recombinant fusion polypeptide of the invention comprising culturing a host cell comprising a nucleic acid encoding a fusion polypeptide of the invention.
  • Yet another embodiment includes a method of expressing a fusion polypeptide of the invention comprising culturing a host cell comprising a vector comprising DNA encoding a fusion polypeptide of the invention.
  • a further embodiment of the invention provides the method of synthesizing the antimicrobial competence stimulating peptide and fusion polypeptide.
  • Another embodiment of the invention provides a treatment method for promoting adhesion and proliferation of osteoblasts comprising administering a bone tissue regenerating composition to a patient in need thereof comprising a recombinant or synthetic fusion polypeptide or synthetic antimicrobial competence stimulating peptide alone.
  • a delivery vehicle for the peptide component which is either fusion polypeptide or antimicrobial competence stimulating peptide alone.
  • a delivery vehicle is preferably a bone-compatible matrix which provides for slow release of peptide component to patient in need of said composition.
  • a bone-compatible matrix can be biodegradable polymer, demineralized bone matrix, ceramic, ⁇ -tricalcium phosphates, calcined or sintered bovine bone (hydroxyapatite), an inorganic component of bovine bone, algae-derived hydroxyapatite, synthetic hydroxyapatite, nanocrystalline precipitated hydroxyapatite, or combinations thereof.
  • the invention provides a method of preparing a bone tissue regenerating composition comprising combining a bone -compatible matrix with a fusion polypeptide of the invention or antimicrobial competence stimulating peptide (CSP); and immobilizing the fusion polypeptide to or CSP within the bone compatible matrix.
  • CSP antimicrobial competence stimulating peptide
  • composition of the present invention is administered to stimulate bone growth.
  • Such treatments can be administered to subjects in need of bone repair due to bone damage and for tooth implants in reconstructive surgeries.
  • FIG. 1 is the plasmid construct expressing fusion polypeptide (P15-CSP) comprising an antimicrobial competence stimulating peptide (CSP) and an osteogenic peptide (P-15) with a helical linker peptide and His-tag.
  • P15-CSP fusion polypeptide
  • CSP antimicrobial competence stimulating peptide
  • P-15 osteogenic peptide
  • FIG. 2 is the plasmid construct expressing fusion polypeptide (P15-CSP) comprising an antimicrobial competence stimulating peptide (CSP) and an osteogenic peptide (P-15) with a flexible linker peptide and His-tag.
  • P15-CSP fusion polypeptide
  • CSP antimicrobial competence stimulating peptide
  • P-15 osteogenic peptide
  • FIG. 3 is the plasmid construct expressing fusion polypeptide (CSP-Osteogenic Peptide OP8) comprising an antimicrobial competence stimulating peptide (CSP) and an osteogenic peptide (OP8) with a helical linker peptide and His-tag.
  • CSP-Osteogenic Peptide OP8 fusion polypeptide
  • CSP antimicrobial competence stimulating peptide
  • OP8 osteogenic peptide
  • FIG. 4 is the plasmid construct expressing fusion polypeptide (CSP-Osteogenic Peptide OP8) comprising an antimicrobial competence stimulating peptide (CSP) and an osteogenic peptide (OP8) with a flexible linker peptide and His-tag.
  • CSP-Osteogenic Peptide OP8 fusion polypeptide
  • CSP antimicrobial competence stimulating peptide
  • OP8 osteogenic peptide
  • the present invention includes a bone tissue regenerating composition comprising (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity and (b) a bone tissue regenerating peptide.
  • An embodiment of the present invention provides a bone tissue regenerating composition comprising (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity having an amino acid sequence of at least one of SEQ ID NOs: 1 to 15, and (b) a bone tissue regenerating peptide having an amino acid sequence of at least one of SEQ ID NOs: 16 to 23.
  • An embodiment includes an antimicrobial competence stimulating peptide component of recombinant or synthetic fusion polypeptide selected from a family of peptides with 8 to 21 amino acid residues (SEQ ID NO: 1 to SEQ ID NO: 15), which is summarized in Table 1.
  • Table 1 Antimicrobial Competence Stimulating Peptides (CSP)
  • the present invention includes a fusion polypeptide where an antimicrobial competence stimulating peptide with bone tissue regenerating activity is fused to a bone tissue regenerating peptide.
  • a fusion polypeptide comprises (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity having an amino acid sequence of at least one of SEQ ID NOs: 1 to 15, and (b) a bone tissue regenerating peptide having an amino acid sequence of at least one of SEQ ID NOs: 16 to 23.
  • an antimicrobial competence stimulating peptide with bone tissue regenerating activity is linked to one terminus of a linker peptide, wherein the other terminus of a linker peptide is linked to a bone tissue regenerating peptide to form a fusion peptide.
  • a peptide linker includes one of SEQ ID NOs: 16 to 23.
  • Another embodiment includes the recombinant or synthetic bone tissue regenerating peptide component of fusion polypeptide selected from a family of peptides that mimic cell binding domain of collagen with 5 to 15 amino acid residues (SEQ ID NO: 16 to SEQ ID NO: 22) and a bone tissue regenerating peptide (SEQ ID NO: 23), which is summarized in Table 2.
  • Table 2 Bone Tissue Regenerating Peptides
  • a linker peptide is selected from the group consisting of SEQ ID NO: 24 to SEQ ID NO: 37 as summarized in Table 3 or a combination (a multimer) of any two (dimmer), three (trimer), four (tetramer), five (pentamer) or more than five thereof.
  • Another aspect of this invention includes fusion polypeptides comprising (a) an antimicrobial with bone tissue regenerating activity selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 5, (b) a bone tissue regenerating peptide having SEQ ID NO: 16 or 23, and (c) a linker peptide selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 30, SEQ ID NO: 34, and SEQ ID NO: 35.
  • fusion polypeptides comprising various possible combinations of sequences of selected antimicrobial peptides, bone regenerating peptides and linkers plus polyhistidine peptides (MGHHHHHH (SEP ID 126), MHHHHHH (SEP ID 127), and HHHHHH (SEP ID 128)) are summarized in Tables 4a and 4b.
  • fusion polypeptide refers to a chimeric polypeptide that comprises an antimicrobial competence stimulating peptide and a bone tissue regenerating peptide.
  • a bone tissue regenerating peptide is covalently linked or conjugated (e.g., via a peptide bond) to an antimicrobial peptide either at the C-terminal or N-terminal of the targeting peptide.
  • a fusion polypeptide may comprise a bone tissue regenerating peptide with its C-terminal covalently linked to N-terminal of an antimicrobial peptide [Amino terminus- osteogenic peptide-peptide bond-antimicrobial peptide-peptide bond-carboxyl terminus], or an antimicrobial peptide with its C-terminal covalently linked to the N-terminal of a bone tissue regenerating peptide [Amino terminus-antimicrobial peptide-peptide bond-osteogenic peptide- carboxyl terminus].
  • a fusion polypeptide comprises a peptide linker by which an antimicrobial competence stimulating peptide is covalently linked or conjugated to a bone tissue regenerating peptide.
  • a fusion polypeptide may comprise an antimicrobial peptide with its C-terminal covalently linked to the N-terminal of a linker peptide and a bone tissue regenerating peptide with its N-terminal covalently linked to the C-terminal of the linker peptide (Amino terminus-osteogenic peptide-peptide bond-linker peptide-antimicrobial peptide-peptide bond-carboxyl terminus).
  • an antimicrobial peptide with its N-terminal covalently linked to the C-terminal of a linker peptide and an osteogenic peptide with its C-terminal covalently linked to the N-terminal of the linker peptide (Amino terminus-antimicrobial peptide-peptide bond-linker peptide-peptide bond- osteogenic peptide-carboxyl terminus).
  • a fusion polypeptide or antimicrobial competence stimulating peptide with bone tissue regenerating activity may be the sole active ingredient in a bone tissue regenerating composition.
  • the composition may be used for preventing or treating bone fractures.
  • a fusion polypeptide or antimicrobial competence stimulating peptide with bone tissue regenerating activity may also be used as a bone tissue regeneration accelerator obtained by fixing, mixing, dissolving or suspending the peptide in a pharmaceutically acceptable carrier or an aqueous solvent.
  • suitable examples of carriers or aqueous solvents include, but are not limited to, clinical grade sterile water, sterile saline, sterile buffered saline, dextrose in sterile water, sterile liquid media or other physiologically acceptable isotonic liquids.
  • a bone tissue regenerating composition of the present invention can contain a variety of pharmacologically acceptable additives, such as a stabilizer, a preservative, a thickener, a solubilizer and the like, which can be combined with the carrier or aqueous solvent.
  • pharmacologically acceptable additives such as a stabilizer, a preservative, a thickener, a solubilizer and the like, which can be combined with the carrier or aqueous solvent.
  • Peptides of the present invention can be useful in clinical applications in conjunction with a suitable matrix that acts as a delivery or support system.
  • a successful matrix for a bone tissue regenerating peptide desirably performs several important functions. It desirably binds the bone tissue regenerating peptide and acts as a slow release delivery system, accommodates each step of the cellular response during bone development, and protects a bone tissue regenerating peptide from nonspecific proteolysis.
  • selected materials should be biocompatible in vivo, porous and preferably biodegradable. In bones, dissolution rates can vary according to whether an implant is placed in cortical or trabecular bone.
  • a matrix also desirably acts as a temporary scaffold until replaced by new bone formation. Therefore, in one embodiment, a bone- compatible matrix provides for slow release of a peptide component to a patient in need of a bone tissue regenerating composition and/or provides a structure for developing bone in the patient.
  • a matrix is preferably ceramic, biodegradable biopolymer, demineralized bone matrix, ⁇ - tricalcium phosphates, calcined and sintered bovine bone (hydro xyapatite), inorganic component of bovine bone, algae-derived hydroxyapatite, synthetic hydroxyapatite, nanocrystalline precipitated hydroxyapatite, or combinations thereof.
  • a bone-compatible matrix is a woven or non-woven porous structure.
  • a bone-compatible matrix is a powder, microparticles, microspheres, microfibers, microfibrils, a strip, a gel, a web, a sponge, or combinations thereof.
  • Suitable ceramics for use as a bone-compatible matrix include, but are not limited to, calcium sulfate, hydroxyapatite, tricalcium phosphate, and combinations thereof. Other ceramics used as artificial bone are also suitable.
  • a ceramic can be in particulate form or can be a structurally stable, three-dimensional implant (e.g., a scaffold).
  • An implant can be, for example, a cube, cylinder, block or an appropriate anatomical form.
  • a bone-compatible matrix may comprise natural, modified natural or synthetic biodegradable polymers, copolymers, block polymers, or combinations thereof.
  • suitable biodegradable polymers or polymer classes include fibrin, collagen, elastin, celluloses, gelatin, vitronectin, fibronectin, laminin, reconstituted basement membrane matrices, starches, dextrans, alginates, hyaluron, chitin, chitosan, agarose, polysaccharides, hyaluronic acid, poly(lactic acid), poly(glycolic acid), polyethylene glycol, decellularized tissue, self-assembling peptides, polypeptides, glycosaminoglycans, their derivatives and mixtures thereof.
  • an intermediate cyclic dimer can be prepared and purified, prior to polymerization.
  • Such intermediate dimers are called glycolide and lactide, respectively.
  • Self- assembling peptides are described in U.S. Pat. Nos. 5,670,483 and 5,955,343.
  • Other useful biodegradable polymers or polymer classes include polydioxanones, polycarbonates, polyoxalates, poly(alpha-esters), polyanhydrides, polyacetates, polycaprolactones, poly(orthoesters), polyamino acids, polyamides and mixtures and copolymers thereof.
  • Additional useful biodegradable polymers include, stereopolymers of L- and D-lactic acid, copolymers of bis(p-carboxyphenoxy) propane acid and sebacic acid, sebacic acid copolymers, copolymers of caprolactone, poly(lactic acid)/poly(glycolic acid)/polyethyleneglycol copolymers, copolymers of polyurethane and (poly(lactic acid), copolymers of polyurethane and poly(lactic acid), copolymers of alpha-amino acids, copolymers of alpha-amino acids and caproic acid, copolymers of alpha-benzyl glutamate and polyethylene glycol, copolymers of succinate and poly(glycols), polyp ho sphazene, polyhydroxy-alkanoates, and mixtures thereof.
  • Binary and ternary systems are contemplated.
  • a polymer used to form a bone-compatible matrix is a hydrogel.
  • a hydrogel is produced from a synthetic polymeric material.
  • synthetic polymers can be tailored to a range of properties and predictable lot-to-lot uniformity, and represent a reliable source of material and one generally free from concerns of immunogenicity.
  • hydrogels are polymeric materials that can absorb more than 20% of their weight in water while maintaining a distinct three-dimensional structure. This definition includes dry polymers that will swell in aqueous environments, as well as to water-swollen materials.
  • Many hydrophilic polymers can be cross-linked to produce hydrogels, whether the polymer is of biological origin, semi-synthetic, or wholly synthetic.
  • a suitable biodegradable polymer for use as a bone-compatible matrix is desirably configured so that it has mechanical properties that match the application, remaining sufficiently intact until bone tissue has in-grown and healed, does not invoke an inflammatory or toxic response, is metabolized in the body after fulfilling its purpose, leaving no trace, is easily processible into the final product formed, demonstrates acceptable shelf-life, and is easily sterilized.
  • hydrogels Properties that make hydrogels valuable in drug delivery applications include the equilibrium swelling degree, sorption kinetics, solute permeability, and their in vivo performance characteristics. Permeability to compounds, including the fusion polypeptide, depends in part upon the swelling degree or water content and the rate of biodegradation. Since the mechanical strength of a gel declines in direct proportion to the swelling degree, it is also well within the contemplation of the present invention that a hydrogel can be attached to a substrate so that a composite system enhances mechanical strength. In alternative embodiments, a hydrogel can be impregnated within a porous substrate, such as a ceramic scaffold, so as to gain the mechanical strength of the substrate, along with the useful delivery properties of the hydrogel for the poly peptide.
  • a porous substrate such as a ceramic scaffold
  • Biodegradation can be accomplished by synthesizing polymers that have unstable linkages in the backbone, or linkages that can be safely oxidized or hydrolyzed in the body.
  • the most common chemical functional groups having this characteristic are ethers, esters, anhydrides, orthoesters and amides. Therefore, in one embodiment, a peptide component is controllably released from a biodegradable polymer to a site where it is needed by hydrolysis of chemical bonds in the biodegradable polymer.
  • Biodegradable polymers are preferably in the form of a powder, microparticle, microsphere, strip, gel, web or sponge.
  • a bone-compatible matrix can be a demineralized bone matrix (DBM).
  • DBM demineralized bone matrix
  • This is produced by decalcifying cortical bone, and represents a form of allograft processing (Trumees, E. and Herkowitz, H. (1999) Univ. of Penn. Orthop. J. 12:77 88). The resulting matrix is more bone tissue regenerating than ordinary allograft.
  • One commercially available preparation of a demineralized bone matrix gel is Grafton ® gel (Osteotech, Inc., Eatontown, J), which combines DBM with a glycerol carrier.
  • a matrix medium, vehicle excipient or carrier can be any of those known to be pharmaceutically acceptable for administration to a patient, particularly locally at the site at which new bone growth is to be induced.
  • liquid media for example, Dulbeccos Modified Eagles Medium (DMEM), sterile saline, dextrose in sterile water and any other physiologically acceptable isotonic liquid.
  • DMEM Dulbeccos Modified Eagles Medium
  • sterile saline sterile saline
  • dextrose in sterile water
  • any other physiologically acceptable isotonic liquid any other physiologically acceptable isotonic liquid.
  • one or more of the peptides of the present invention is immobilized to the bone-compatible matrix.
  • one or more of the inventive peptides is impregnated or encapsulated within the bone-compatible matrix so as to be immobilized there within.
  • cells which have been genetically engineered to include a nucleic acid sequence encoding a peptide of the present invention can be impregnated or encapsulated within the bone-compatible matrix so as to produce the peptide at the treatment site.
  • a fusion polypeptide or antimicrobial competence stimulating peptide with bone tissue regenerating activity can be impregnated within a porous bone-compatible matrix.
  • a fusion polypeptide or antimicrobial competence stimulating peptide may be blended with a fluid material such as an aqueous solvent or a hydrogel to form a mixture which is used to impregnate pores of a porous bone-compatible matrix, such as a ceramic scaffold.
  • pores of the bone-compatible matrix may first be filled with a fluid material and that air pressure or other suitable means may then be employed to disperse a dry peptide of the invention substantially evenly within the filled pores of the bone- compatible matrix.
  • a fusion polypeptide may be encapsulated in a polymer or a lipid-containing vesicle, such as a liposome, to allow for a controlled release of the peptide to a site where it is needed.
  • a polymeric matrix containing one or more peptides according to the invention may include, without limitation, microparticles, microspheres, microfibers or microfibrils.
  • a microsphere could be contained within a mesh of a polymeric scaffold or other implant or device for peptide delivery.
  • Microspheres containing a fusion polypeptide may be incorporated within a polymeric scaffold by adhesively positioning them onto a scaffold.
  • microspheres may be mixed with a fluid or gel and allowed to flow into a polymeric matrix of the scaffold.
  • microfibers or microfibrils which may be peptide loaded by extrusion, can be adhesively layered or woven into the polymeric material included in a surface of a scaffold for peptide delivery.
  • One or more peptides according to the invention can be encapsulated within a liposome.
  • Liposomes are spherical vesicles prepared from either natural or synthetic phospholipids or cholesterol. These vesicles can be composed of either one (unilamellar liposomes) or several (oligo- or multilamallar liposomes) lipid bilayes surrounding internal aqueous volumes. It is known to entrap drugs, proteins and nucleic acids within the internal aqueous space of a liposome.
  • G-CSF encapsulated granulocyte-colony stimulating factor
  • U.S. Pat. No. 4,241,046 describes a method for encapsulating an enzyme within a synthetic liposome, the product liposomes being useful for enzyme replacement therapy.
  • Liposomes allow the parenteral administration of the therapeutic agent. On the cellular level, liposomes interact with cell membranes by adsorption, endocytose, membrane fusion, and lipid exchange, or by a combination of these mechanisms as described by Pagano and Weinstein in Ann. Rev. Biophys. Bioeng. (1978) 7:435. Fast elimination of a therapeutic agent and its metabolism can be impeded by shielding the therapeutic agent in a liposome.
  • One or more of the peptides described herein can be combined with a variety of orthopedic devices, including, but not limited to, bone graft material, replacement knees, hips, joints, pins, rods, plates, crews, fasteners, darts, arrows and staples.
  • orthopedic devices including, but not limited to, bone graft material, replacement knees, hips, joints, pins, rods, plates, crews, fasteners, darts, arrows and staples.
  • immobilizing a peptide to a bone-compatible matrix There are many methods of immobilizing a peptide to a bone-compatible matrix. It is possible to adopt an immobilization method allowing formation of a covalent bond, ionic bond, hydrophobic bond, hydrogen bond, sulfur-sulfur bond or the like, for example, an immersion, impregnation, spray, application and dropping method with use of a solution containing the peptide.
  • fixation by covalent bond is preferred due to its stability and continuity of effect.
  • free carboxyl groups on a biocompatible, biodegradable polymer forming the bone-compatible matrix may be chemically cross-linked to a free amino group on the peptide using carbodiimide as a cross-linker agent.
  • carbodiimide as a cross-linker agent.
  • Other standard immobilization chemistries are known by those of skill in the art and can be used to join the peptides of the present invention to the bone-compatible matrix. For example, see Protein Immobilization: Fundamentals and Applications Taylor, R. (Ed.) M. Dekker, NY, (1991).
  • An embodiment includes a therapeutic method comprising administering a composition comprising (a) an antimicrobial competence stimulating peptide with bone tissue regenerating activity and (b) a bone tissue regenerating peptide.
  • An embodiment includes a therapeutic method comprising administering a fusion polypeptide described herein.
  • a composition can be administered topically, systematically, or locally (e.g., as an implant or device). When administered, a therapeutic composition of the invention is in a pyrogen-free, physiologically acceptable form. Further, a composition of the invention may be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage. Topical administration may be suitable for wound healing and tissue repair.
  • Therapeutically useful agents other than the fusion polypeptide of the current invention may alternatively or additionally, be administered simultaneously or sequentially with the fusion polypeptide composition in the methods of the invention. Dosages of therapeutic compositions described herein can vary as required depending upon the weight of bone desired to be formed, the site of injured bone, the condition of bone, and the age, sex and weight of a patient and the like.
  • a fusion polypeptide of the invention can also be administered in combination with additional components, such as bone tissue regenerating factors.
  • Bone tissue regenerating factors include, for example, dexamethasone, ascorbic acid-2-phosphate, beta-glycerophosphate and combinations thereof.
  • a composition can also contain antibiotic, antimycotic, antiinflammatory, immunosuppressive and other types of therapeutic, preservative and excipient agents.
  • a fusion polypeptide of the invention can be administered in combination with a bone tissue regenerating substance such as growth factors, cytokines, hormones, enzymes, enzyme inhibitors, bone matrix components, growth differentiation factors, and combinations thereof.
  • a bone tissue regenerating substance such as growth factors, cytokines, hormones, enzymes, enzyme inhibitors, bone matrix components, growth differentiation factors, and combinations thereof.
  • the peptides of the invention may act in concert with other related proteins and growth factors.
  • growth factors include various growth factors such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), members of the transforming growth factor superfamily of proteins (e.g., TGF-. alpha, and TGF-.beta.), insulin-like growth factor (IGF), basic fibroblast growth factor (bFGF), bone morphogenic proteins (BMPs), and combinations thereof.
  • EGF epidermal growth factor
  • PDGF platelet derived growth factor
  • TGF-. alpha transforming growth factor superfamily of proteins
  • IGF insulin-like growth factor
  • bFGF basic fibroblast growth factor
  • BMPs bone morphogenic proteins
  • the following molecules have a mitogenic effect and are polypeptides that exhibit heparin- binding affinity: acidic fibroblast growth factor, basic fibroblast growth factor, platelet-derived growth factor, and an insulin- like growth factor II, originally called skeletal growth factor.
  • TGF ⁇ p 2 is effective in promoting bone mass in several animal models.
  • BMPs are members of the transforming growth factor (TGF) P family. BMP has the function of acting on undifferentiated mesenchymal cells, inducing differentiation to chondroblasts and osteoblasts and effecting chondrogenesis and osteogenesis.
  • BMPs are characterized by the presence of several interchain disulfide bonds essential to bioactivity (they exist as a homodimer in their active form) and moderate affinity for heparin.
  • Bone tissue regenerating peptides disclosed herein will permit the physician to obtain optimal predictable bone formation to correct, for example, acquired and congenital craniofacial and other skeletal or dental anomalies (Glowacki et al, Lancet 317: 959-963, 1981).
  • Devices may be used to induce local endochondral bone formation in non-union fractures as demonstrated in animal tests, and in other clinical applications including dental and periodontal applications where bone formation is required.
  • Another potential clinical application is in cartilage repair, for example, in the treatment of osteoarthritis.
  • the peptides of the present invention can promote treatment of fractures by being administered to patients with fractures caused by rheumatoid arthritis and osteoporosis or by being filled or implanted in a defective site in bone. Also, they can inhibit a decrease in bone substance and prevent fractures by being administered to patients with rheumatoid arthritis, osteoporosis and periodontic diseases.
  • MSC therapy can serve as a means to deliver high densities of repair-competent cells to a defect site when adequate numbers of MSC and MSC lineage- specific cells are not present in vivo, especially in older and/or diseased patients.
  • methods for rapidly producing large numbers of MSC are necessary.
  • Methods that increase the ex vivo proliferation rate of MSC will greatly increase the utility of MSC therapy.
  • methods that increase in vivo proliferation rate of MSC will enhance the utility of MSC therapy by rapidly increasing local concentrations of MSC at the repair site.
  • MSC lineage-specific descendants of MSC
  • methods that enhance the proliferation rate of lineage- specific descendants of MSC including, but not limited to, bone marrow stromal cells, osteoclasts, chondrocytes, and adipocytes, will enhance the therapeutic utility of MSC therapy by increasing the concentration of lineage- specific cell types at appropriate repair sites.
  • Bone tissue regeneration (i.e., the production of new bone) can occur directly from osteoblasts and osteoprognitor cells.
  • circulating mesenchymal stem cells and osteoinductive growth factors can migrate and adhere to a bone-compatible matrix, such as a ceramic scaffold, in the body.
  • progenitor cells can differentiate into functioning osteoblasts.
  • an orthopedic implant or device which includes one or more of the peptides of the present invention, and which also includes osteogenic cells, such as osteoprogenitor stem cells and/or osteoblasts so as to increase the bone tissue regenerating potential associated with bone-graft substituents like ceramic scaffolds.
  • Mesenchymal stem cells are described by Minguell, J., et al, Exp. Biol. Med. 226; 507-520, 2001 and Fibbe, W. Ann Rheum Dis 61 (Suppl II): ii29- ii31, 2002) These cells can be incorporated into an implant or device prior to, during, or following implantation.
  • the implant or device may further incorporate other bone tissue regenerating substances, such as those described herein.
  • compositions of the invention may also be used for veterinary applications. Particularly domestic animals and thoroughbred horses, in addition to humans, are desired patients for such treatment with peptides of the present invention.
  • Peptides described herein may be prepared by methods known in the art. Such methods include synthesizing a fusion polypeptide or a single peptide chemically from individual amino acids or synthesizing a nucleic acid encoding the fusion polypeptide and using the nucleic acid to produce recombinant fusion polypeptide ex vivo or in vivo.
  • Fusion polypeptides of the invention and nucleic acids encoding the fusion polypeptides may be chemically synthesized by methods known in the art. Suitable methods for synthesizing the peptide are described by Stuart and Young (1984), "Solid Phase Peptide Synthesis,” Solid Phase Peptide Synthesis, Methods Enzymol, Second Edition, Pierce Chemical Company, 289, Academic Press, Inc., NY (1997). For example, a solid phase synthesis method or a liquid phase synthesis method may be used. The solid phase synthesis is usually carried out by protecting amino groups with appropriate protecting groups. For example, either Boc (tert-butoxycarbonyl) or Fmoc (9-fluorenylmethyloxycarbonyl), or a combination thereof may be used.
  • N- and C- terminals of peptides of the invention may optionally be modified chemically.
  • an N-terminal may be acetylated and a C-terminal may be amidated.
  • Nucleic acids encoding peptides of the invention may be replicated.
  • DNA encoding peptides of the invention can be used to express a recombinant peptide following insertion into a wide variety of host cells in a wide variety of cloning and expression vectors.
  • a host cell may be prokaryotic or eukaryotic.
  • nucleic acids may be chemically synthesized. Suitable methods for synthesizing DNA are described by Caruthers in Science (1985) 230:281-285 and DNA Structure, Part A: Synthesis and Physical Analysis of DNA, Lilley. D. and Dahlberg, J. (Eds.). Methods Enzymol, 211, Academic Press, Inc., NY (1992).
  • Cloning vectors may comprise segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Some suitable prokaryotic cloning vectors include plasmids from E. coli, such as colEl, pCRl, pBR322B9, pUC, pKSM, and RP4.
  • Prokaryotic vectors also include derivatives of phage DNA such as M13 fd, and other filamentous single- stranded DNA phages.
  • Vectors for expressing proteins in bacteria are also known.
  • Such vectors include the pK233 (or any of the tac family of plasmids), T7, pBluescript II, bacteriophage lamba ZAP, and lambda P.sub.L.
  • pK233 or any of the tac family of plasmids
  • T7 or any of the tac family of plasmids
  • pBluescript II or any of the tac family of plasmids
  • bacteriophage lamba ZAP bacteriophage lamba ZAP
  • lambda P.sub.L lambda P.sub.L.
  • Examples of vectors that express fusion proteins are PATH vectors described by Dieckmann and Tzagoloff (J. Biol. Chem. 260: 1513 1520, 1985).
  • TrpE anthranilate synthetase
  • Other expression vector systems are based on .beta.-galactosidase (pEX); maltose binding protein (pMAL); glutathione S-transferase (pGST or PGEX) (Smith, D., Methods Mol. Cell Biol. 4:220- 229, 1993; Smith, D. and Johnson, K. Gene 67:31-40, 1988; and Peptide Res. 3: 167, 1990; and TRX (thioredoxin) fusion protein (LaVallie, R., et al, Bio/Technology 11: 187-193, 1993).
  • Suitable cloning/expression vectors for use in mammalian cells are also known.
  • Such vectors include well-known derivatives of SV-40, adenovirus, cytomegalovirus (CMV) retrovirus-derived DNA sequences.
  • CMV cytomegalovirus
  • Expression vectors can contain at least one expression control sequence that is operatively linked to the DNA sequence or fragment to be expressed.
  • a control sequence is inserted in the vector in order to control and regulate expression of the cloned DNA sequence.
  • useful expression control sequences are the lac system, the trp system, the tac system, the trc system, the tet system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the glycolytic promoters of yeast, e.g., the promoter for 3- phosphoglycerate kinase, the promoters of yeast acid phosphatase, e.g., Pho5, the promoters of the yeast alpha-mating factors, and promoters derived from polyoma, adenovirus, retrovirus, and simian virus, e.g., the early and late promoters or SV40, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells and
  • Expression hosts include well-known prokaryotic and eukaryotic cells.
  • Suitable prokaryotic hosts include, for example, E. coli, such as E. Coli SG-936, E. coli HB 101, E. coli W3110, E. coli X1776, E. coli X2282, E. coli DH1, E. coli DH5aF, and E. coli MRC1, Bacilus, such as Bacillus subtilis, and Streptomyces.
  • Suitable eukaryotic cells include yeasts and other fungi, insect, animal cells, such as COS cells and CHO cells, human cells and plant cells in tissue culture.
  • a recombinant fusion polypeptide can be purified by methods known in the art (e.g., utilizing a his-tag). Such methods include affinity chromatography using specific antibodies. Alternatively, a recombinant fusion polypeptide of the invention may be purified using a combination of ion-exchange, size-exclusion, hydrophobic interaction chromatography and reverse phase liquid chromatography using methods known in the art. These and other suitable methods are described by Marston, "The Purification of Eukaryotic Proteins Expressed in E. coli" DNA Cloning, D. Glover (Ed.), Volume III, IRL Press Ltd., England (1987); "Guide to Protein Purification", M.
  • composition of the present invention also provides antimicrobial effect and can be used to prevent and treat infection associated with oral pathogens.
  • An antimicrobial effect refers to interfering with any biological function of a target microorganism.
  • An antimicrobial effect includes killing or inhibiting the growth of target microorganisms.
  • compositions of the present invention are administered to treat a disease or infection on an implant site containing a biofilm.
  • Target microorganisms for the antimicrobial peptide in the fusion polypeptide include, without limitation, Streptococcus mutans, Streptococcus sobrinus, Streptococcus gordonii, Streptococcus mitis, Streptococcus sanguis, Streptococcus sanguinis, Streptococcus parasanguis, Streptococcus crista, Streptococcus salivarius, Streptococcus vestibularis, Streptococcus milleri and Streptococcus oralis, Fusobacterium nucleatum, Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia, Treponema denticola, and Bacteroides forsythus.
  • Example 1 Preparation of plasmid constructs to express P15-CSP fusion polypeptide or OP8 (an osteogenic peptide)-CSP fusion polypeptide with helical or flexible linker in
  • the nucleotide sequence encoding the fusion peptide was constructed by two step PCR using two sets of long oligonucleotide primers. The first PCR was conducted using forward primer 5-GGCATTGCGGGCCAGCGCGGCGT GGTGGCGGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAG-3' (SEQ ID NO: 107) and reverse primer 5 ' - AGGTGCTC AGGCTGCCGCTCGCTTTCGCCGCCGCTTCTTTCGCCG CCGCTTCTTTTCTTTCGC-3' (SEQ ID NO: 108), which are complimentary at their 3' ends.
  • the second PCR reaction used 1/10 th of the 1 st PCR reaction as the template and forward primer 5'-ATAATTCCATGGGCCATCATCATCATCATGGCACCCCGGGCCC GCAGGGCATTGCGGGCCAGCGCGG-3' (SEQ ID NO: 109) and reverse primer 5'- ATAATTGATCCTTATTTGCCCAGCGCCTGGGTAAAGCTGCGGTTAAACAGGCGAAAA AAGGTGCTCAGGCTGCCGCTCG-3' (SEQ ID NO: 110).
  • the PCR product were digested with Ncol and Bamlil and ligated to Ncol and BamHl digested pQE60 vector(Qiagen) to yield PQEFUP2 (Fig. 1).
  • the nucleotide sequence encoding fusion polypeptide was constructed by two step PCR using two sets of long oligonucleotide primers. The first PCR was conducted using forward primer 5'- GCGGTACTCCAGGTCCTCAAGGTATTGCAGGTCAACGTGGTGTTGTGTCTGGTGGCG GTGGATC-3' (SEQ ID NO: 112) and reverse primer 5'- AGGTACTCAGGCTGCCAGATCCGCCACCACCCGAACCACCACCACCGCCCGATCCACCG CCACCAG-3' (SEQ ID NO: 113), which are complimentary at their 3' ends.
  • the second PCR reaction used l/10 th of the 1 st PCR reaction as the template and forward primer 5'- ATAATACCATGGGCCATCATCATCATCATCATAGCGGTGGTGGCAGCGGTACTCCAG GTCCTC-3' (SEQ ID NO: 114) and reverse primer 5 '-TATTATGGATCCT TATTTACCAAGCGCCTGCGTGAACGAACGGTTGAAGAGGCGAAAGAAGGTACTCAG GCTGCCAG-3' (SEQ ID NO: 115).
  • the PCR product were digested with Ncol and Bamlil and ligated to Ncol and Bamlil digested pQE60 vector (Qiagen) to yield pQEP15CSP-l (Fig. 2).
  • the nucleotide sequence encoding a fusion polypeptide was constructed by two step PCR using two sets of long oligonucleotide primers. The first PCR was conducted using forward primer 5'-GGTCGCTG GTGCGGTGCGGAAGCGGCGGCGAAAGAAGCGGCGGCGAAAGAAGCGGCGGCG-3' (SEQ ID NO: 117). and reverse primer 5 ' -TAAAC AGGCG AAAAAAGGTGCTC AGGCT GCCGCTCGCTTTCGCCGCCGCTTCTTTCGCCG-3' (SEQ ID NO: 118), which are complimentary at their 3' ends.
  • the second PCR reaction used l/10 th of the 1 st PCR reaction as the template and forward primer 5'-TATAATCCATGGGCCATCATCATCATCATCATTGC GGCGGTGGTCGCTGGTGCGGTGCGG AAG-3 ' (SEQ ID NO: 119) and reverse primer 5'- ATTATAGGATCCTTATTTGCCCAGCGCCTGGGTAAAGCTGCGGTTAAACAGGCGAAA AAAGGTG-3' (SEQ ID NO: 120).
  • the PCR product were digested with Ncol and BamUl and ligated to Ncol and BamHl digested pQE60 vector(Qiagen) to yield pQEOPHeCSP (Fig. 3). Nucleotide Sequence of the coding region
  • the nucleotide sequence encoding fusion polypeptide was constructed by two step PCR using two sets of long oligonucleotide primers. The first PCR was conducted using forward primer 5'-GCTGG TGCGGTTCTGGTGGCGGTGGATCGGGCGGTGGTGGTTCGGGTGGTGGCGGATCTG-3' (SEQ ID NO: 122) and reverse primer 5'-GGCGAAAGAAGGTACTCAGGCTGCCAGATCC GCCACCACCCGAACCACCACCGCCCGATC-3' (SEQ ID NO: 123), which are complimentary at their 3' ends.
  • the second PCR reaction used l/10 th of the 1 st PCR reaction as the template and forward primer 5'-TATAATCCATGGGCCATCATCATCATCATCATTGC GGCGGTGGTCGCTGGTGCGGTTCTGGTGGC-3' (SEQ ID NO: 124) and reverse primer 5'- ATTATAGGATCCTTATTTACCAAGCGCCTGCGTGAACGAACGGTTGAAGAGGCGAA AG AAGGTACTC AGGCTGC-3 ' (SEQ ID NO: 125).
  • the PCR product were digested with Ncol and BamHl and ligated to Ncol and BamHl digested pQE60 vector (Qiagen) to yield pQEOPFxCSP (Fig. 4).
  • E. coli Tuner (DE3)pLacI strain bearing the plasmid pQEFUP2, pQEP15CSP-l, pQEOPHeCSP, or pQEOPFxCSP was grown in Luria-Bertani (LB) medium at 37°C.
  • the expression of the P15-CSP fusion polypeptide was induced with ImM IPTG at exponential growth phase.
  • the cells were harvested by centrifugation 4 hrs post-induction, resuspended in extraction buffer (20 mM Tris-HCl, pH 7.5, 500 mM NaCl) containing ImM PMSF, 2 mg/mL lysozyme and 0.1% Igepal ® , ruptured by sonication, and treated with DNasel and RNaseA.
  • P15-CSP was captured by passing the cleared lysate through a column of His-SelectTM Nickel Affinity Gel equilibrated with extraction buffer. The column was washed twice with extraction buffer containing 5 mM imidazole and then 20 mM imidazole.
  • P15-CSP was eluted with extraction buffer containing lOOmM imidazole, dialyzed against deionized water, and then lyophilized.
  • Example 3 Synthesis of antimicrobial competence stimulating peptide (CSP) and P15-CSP fusion polypeptide
  • Example 4 Cell adhesion activity of CSP, P15 peptide and recombinant P15-CSP fusion polypeptides
  • the cell adhesion activity of CSP, P15 peptide and recombinant P15-CSP fusion polypeptide were tested as follows: A hydroxyapatite-based carrier was added to solutions containing CSP, P15 peptide and recombinant P15-CSP fusion polypeptide separately and was shaken for a desired period of time. The solution was decanted and the particles were washed 4-5 times with phosphate buffered saline (PBS) followed by water for injection 4-5 times. After the liquid was decanted, the samples were placed in a vacuum oven at 25 °C until dry.
  • PBS phosphate buffered saline
  • samples were sterilized and tested for cell adhesion using short -term cell attachment assay as described by Vogler and Bussien (J. Biomed. Mater Res. 21: 1197, 1987).
  • Samples of both the test material and parent particulate were placed in 96- well plate separately and the wells were seeded with fibroblast cells. Plates were placed in an incubator for 3 h to allow cellular attachment followed by washing with modified eagle medium to remove the unattached cells. The plates were further incubated for 3 days, followed by tissue culture medium-tetrazolium salt-phenazine metho sulphate reaction to demonstrate cell viability and to determine the number of adhered cells.
  • CSP and P15-CSP fusion peptide showed unexpected level of increase in the cell (osteoblast) adhesion to hydroxyapatite carrier as compared to a modest increase in cell adhesion by P15 peptide alone.
  • recombinant P15-CSP fusion peptide showed two-fold increase in osteoblast adhesion compared to that by P15 peptide alone.
  • Example 5 Osteogenic activity of CSP, P15 peptide and P15-CSP (synthetic and
  • the main objective of this study was to determine if CSP, P15 peptide, synthetic P15-CSP and recombinant P15-CSP polypeptides promote osteogenesis of osteoblast precursors such as human bone marrow stromal cells (hBMSCs) in mineralizing media with and without Dexamethasone as an osteogenic inducer.
  • P15 peptide-only served as a control.
  • Osteogenic activity was determined by the in situ staining intensity of alkaline phosphatase enzyme, calcium mineral deposition, and phosphate mineral accumulation after 3 weeks in confluent hBMSCs culture stimulated with the peptides in order to determine their level of differentiation.
  • control media 16% fetal bovine serum, alpha-Minimal Essential Medium, Pen-Strep, 100 ⁇ L-ascorbate-2-phosphate, 5 mM disodium beta-glycerol phosphate; and osteogenic media (OSM): control media containing 10 nM dexamethasone) with or without peptides at different concentrations (1, 10, 100 ⁇ g/mL).
  • the media was refreshed twice a week for a period of 3 weeks.
  • the media volume was 0.5 mL per well. 2 petri dishes per peptide were treated with 0, 1, 10, and 100 ⁇ g/mL peptide in control media, or peptide in OSM.
  • the 24 well plates were aspirated of media, rinsed in isotonic saline, and the cell monolayers or nodules fixed for 1 hour in 10% normal buffered formalin, then exposed to alkaline phosphatase reagent prepared according to the manufacturer (SigmaFast alkaline phosphatase enzymatic staining kit, Sigma-Aldrich, Oakville, ON, Canada, Product N° B5655) for 20 minutes at room temperature. After 20 minutes the substrate was aspirated and the plates rinsed in PBS with 20 mM EDTA to stop the reaction.
  • alkaline phosphatase reagent prepared according to the manufacturer (SigmaFast alkaline phosphatase enzymatic staining kit, Sigma-Aldrich, Oakville, ON, Canada, Product N° B5655) for 20 minutes at room temperature. After 20 minutes the substrate was aspirated and the plates rinsed in PBS with 20 mM EDTA to stop the reaction.
  • the plates were aspirated of media, rinsed in isotonic saline, fixed for 1 hour in 10% normal buffered formalin, and stained for 1 hour in alizarin red staining solution (1.37 g/100 mL adjusted to pH 4 with NH 4 OH).
  • the plates were washed at least 3 times with ddH 2 0 to remove unbound alizarin red dye, and stored at 4°C covered in ddH 2 0.
  • 800 xL acetic acid was added to each of the alizarin red wells, the plates rocked for 30 minutes at room temperature, and all the well contents transferred to a 2-ml screw-cap tube.
  • CSP qualitatively led to more phosphate deposition (but not calcium) in osteogenic media, and may have stimulated cell proliferation (thicker monolayer). Furthermore, it inhibited phosphate deposition at the highest concentration in control media without Dex.
  • P15 peptide is not osteogenic in this assay based on macro scopically visible mineral deposition. P15 seems to aggravate cell detachment and to promote ball formation in absence of Dex (on Costar plates) and P15 led to a more fragmented monolayer sheet and did not enhance deposition of calcium or phosphate mineral. P15 did not enhance ALP activity by this BMSC culture in osteogenic media (with Dex).
  • Synthetic P15-CSP did not intensify monolayer adhesion (to Falcon plate) without Dex. Monolayers that stuck to Falcon dish without Dex had high calcium accumulation (with or without peptide). It seems to promote phosphate accumulation without Dex only at 100 ⁇ g/mL. Furthermore, it intensified calcium deposition and phosphate with Dex. No further increase was seen for ALP in the presence of peptide. This peptide showed evidence of enhancing osteogenesis in Dex+ media.
  • NR Not Relevant (data could not be collected on balls); ⁇ : Intensification of Signal; j: Less Signal; Same: No Difference from Control Monolayer; ALP: Alkaline Phosphatase; AR: Alizarin Red; Pi: Inorganic Phosphate; and ⁇ Evidence of Osteogenic Activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Materials For Medical Uses (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un polypeptide de fusion recombiné ou synthétique comprenant un composant de peptide ayant une activité de régénération du tissu osseux, un peptide lieur et un peptide stimulant la compétence antimicrobienne ayant une activité de régénération du tissu osseux. Le polypeptide de fusion ou le peptide stimulant la compétence antimicrobienne, qui stimule la liaison des cellules ostéogéniques, est utile pour la réparation des défauts osseux dentaires comme ceux provoqués par la perte osseuse résultant d'une parodontite modérée à sévère, pour l'augmentation des défauts osseux de la crête alvéolaire, pour le remplissage des sites d'extraction de dents ou de greffage d'élévation de sinus. Le matériau de réparation inclut une substance particulaire poreuse, résorbable qui est dérivée des os ou dérivée d'hydroxyapatite de type os ou d'hydroxyapatite synthétique et/ou un support résorbable comme des polysaccharides de poids moléculaire élevé. En outre, le polypeptide de fusion ou le peptide stimulant la compétence antimicrobienne seul de cette invention est utile pour le traitement de fractures, en tant que charge dans des sites déficients des os, pour l'inhibition de la diminution de la substance osseuse liée à l'ostéoporose, et aussi pour la prévention de fractures associées à l'ostéoporose et à l'arthrite rhumatoïde. Le polypeptide de fusion ou le peptide stimulant la compétence antimicrobienne peut être combiné avec une matrice compatible avec l'os pour faciliter la libération lente du peptide dans un site de traitement et/ou fournir une structure pour le développement osseux.
PCT/CA2012/050344 2011-05-25 2012-05-25 Peptides régénérant le tissu osseux WO2012159216A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161489947P 2011-05-25 2011-05-25
US61/489,947 2011-05-25

Publications (1)

Publication Number Publication Date
WO2012159216A1 true WO2012159216A1 (fr) 2012-11-29

Family

ID=47216495

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2012/050344 WO2012159216A1 (fr) 2011-05-25 2012-05-25 Peptides régénérant le tissu osseux

Country Status (1)

Country Link
WO (1) WO2012159216A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110225920A (zh) * 2016-12-27 2019-09-10 首尔大学校产学协力团 具有细胞渗透性和骨组织再生能力的双功能新颖肽及其用途
WO2021089764A1 (fr) * 2019-11-07 2021-05-14 Universiteit Gent Diagnostic et utilisation de molécules de détection du quorum dans l'atrophie musculaire

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005032461A2 (fr) * 2003-09-30 2005-04-14 Ethicon, Inc. Nouveau peptide a activite osteogene
WO2006004778A2 (fr) * 2004-06-30 2006-01-12 Dentsply International Inc. Implant a surface biofonctionnelle et son procede de production
WO2006060903A1 (fr) * 2004-12-06 2006-06-15 Kane Biotech Inc. Molecules d'acides nucleiques, peptides signaux, et procedes de traitement
US20100016234A1 (en) * 2001-02-20 2010-01-21 The Governing Council Of The University Of Toronto Signal peptides, nucleic acid molecules and methods for treatment of caries

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100016234A1 (en) * 2001-02-20 2010-01-21 The Governing Council Of The University Of Toronto Signal peptides, nucleic acid molecules and methods for treatment of caries
WO2005032461A2 (fr) * 2003-09-30 2005-04-14 Ethicon, Inc. Nouveau peptide a activite osteogene
WO2006004778A2 (fr) * 2004-06-30 2006-01-12 Dentsply International Inc. Implant a surface biofonctionnelle et son procede de production
WO2006060903A1 (fr) * 2004-12-06 2006-06-15 Kane Biotech Inc. Molecules d'acides nucleiques, peptides signaux, et procedes de traitement

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110225920A (zh) * 2016-12-27 2019-09-10 首尔大学校产学协力团 具有细胞渗透性和骨组织再生能力的双功能新颖肽及其用途
CN110225920B (zh) * 2016-12-27 2023-05-26 首尔大学校产学协力团 具有细胞渗透性和骨组织再生能力的双功能新颖肽及其用途
WO2021089764A1 (fr) * 2019-11-07 2021-05-14 Universiteit Gent Diagnostic et utilisation de molécules de détection du quorum dans l'atrophie musculaire

Similar Documents

Publication Publication Date Title
Saravanan et al. A review on injectable chitosan/beta glycerophosphate hydrogels for bone tissue regeneration
Li et al. Collagen-based biomaterials for bone tissue engineering
Rather et al. Dual functional approaches for osteogenesis coupled angiogenesis in bone tissue engineering
Begam et al. Strategies for delivering bone morphogenetic protein for bone healing
Zara et al. High doses of bone morphogenetic protein 2 induce structurally abnormal bone and inflammation in vivo
US5916870A (en) Compositions and therapeutic methods using morphogenic proteins and stimulatory factors
US8546529B2 (en) Injectable bone regeneration gel containing bone formation enhancing peptide
US7163920B2 (en) Peptide with osteogenic activity
Bessa et al. Bone morphogenetic proteins in tissue engineering: the road from laboratory to clinic, part II (BMP delivery)
Place et al. Strontium-and zinc-alginate hydrogels for bone tissue engineering
JP2011519292A (ja) 成長因子／両親媒性ポリマー複合体、可溶性のカチオン塩及び有機支持体を含有する骨形成組成物
US7026292B1 (en) Compositions and therapeutic methods using morphogenic proteins and stimulatory factors
US20190117734A1 (en) System and Method for Multiphasic Release of Growth Factors
Yang et al. Bone regeneration induced by local delivery of a modified PTH-derived peptide from nanohydroxyapatite/chitosan coated true bone ceramics
US20130337028A1 (en) Biomimetic peptides for bone augmentation
Zheng et al. Novel three‐dimensional bioglass functionalized gelatin nanofibrous scaffolds for bone regeneration
JP6318143B2 (ja) 成長因子の多相性放出のためのシステムおよび方法
WO2012159216A1 (fr) Peptides régénérant le tissu osseux
US20080118542A1 (en) Growth Factor Composition
Ying et al. Shape-memory ECM-mimicking heparin-modified nanofibrous gelatin scaffold for enhanced bone regeneration in sinus augmentation
AU2011251991B2 (en) Lactoferrin -based biomaterials for tissue regeneration and drug delivery
AU2011251991A1 (en) Lactoferrin -based biomaterials for tissue regeneration and drug delivery
Schliephake et al. Growth Factors
Song Nanostructured carriers for the delivery of antibacterial agents
Han Effects of human hair keratin alkylation on growth factor delivery and cellular response: implications in bone regeneration

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12790123

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12790123

Country of ref document: EP

Kind code of ref document: A1