WO2012151718A1

WO2012151718A1 - Pig myostatin gene promoter and its applications

Info

Publication number: WO2012151718A1
Application number: PCT/CN2011/000831
Authority: WO
Inventors: 毕延震; 郑新民; 乔宪凤; 刘西梅; 张立苹; 华文君; 李莉; 肖红卫; 周荆荣; 魏庆信
Original assignee: 湖北省农业科学院畜牧兽医研究所
Priority date: 2011-05-11
Filing date: 2011-05-11
Publication date: 2012-11-15
Also published as: CN102725408B; CN102725408A

Abstract

A pig myostatin gene promoter and its applications are disclosed in the present invention. The DNA fragment provided in the present invention which is derived from pigs is anyone of the following DNA molecules 1)-4): 1) the DNA molecule of SEQ ID NO:2 shown in the Sequence Listing; 2) the DNA molecule of SEQ ID NO:3 shown in the Sequence Listing; 3) the DNA molecule which hybridizes to the DNA sequence in 1) or 2) under strict conditions and has promoter function; 4) the DNA molecule which has more than 90% homology with the DNA sequence in 1) or 2) and has promoter function. The experiments in the present invention prove that the promoter provided in the present invention can drive the expression of firefly luciferase reporter gene. The promoter can also be built into the reporter vector and then the vector is transfected into cultured swine and human cells, and the activity and efficiency of the promoter are identified by accurate quantitative methods through reporter gene test.

Description

Porcine myostatin gene promoter and its application

The invention relates to the field of biotechnology, in particular to a porcine myostatin gene promoter and application thereof. Background technique

In the past decade, the rapid development and wide application of transgenic technology, especially the combination of gene targeting and somatic cell cloning technology, has made the genetic modification of transgenic animals a reality. The key to this technology is to allow site-specific integration and stable expression of foreign genes on the genome of transgenic animals, and the expression of foreign genes is closely related to the transcriptional activity of their promoters. Therefore, obtaining a promoter with stable expression activity will greatly promote transgenic animal research. However, the types and quantities of promoters currently used in transgenic animals are very limited, mainly from viral promoters, such as cytomegalovirus (CMV), simian virus 40 (SV40), simple blisters. A constitutive promoter such as herpes simplex virus HSV. They regulate foreign gene expression in almost all types of eukaryotic cells and are not spatio-temporal specific. When the above-mentioned promoter is used to regulate the expression of a foreign gene, since the foreign gene is abundantly expressed and accumulated in an undesired cell or an undesired developmental stage, the morphological and physiological functions of the animal are often abnormal, resulting in premature aging or death. In addition, because they belong to heterologous genes, they are susceptible to immunological rejection and epigenetic modification in transgenic animals, leading to instability of foreign gene expression. In view of this, finding an endogenous promoter derived from the transgenic animal itself has become a breakthrough in solving this problem. Moreover, another advantage of using the endogenous promoter of transgenic animals is that the "in situ" site-specific integration of the foreign gene can be achieved by gene targeting, driven by the endogenous promoter "in situ" to express the foreign gene. Control at a certain physiological level. Therefore, research in this area as soon as possible has important application value for the research and production of GM animals.

The myostatin gene was first cloned in mice by McPherron et al. in 1997. This gene belongs to the TGF-β family and is a transforming growth factor. Gene knockout proves that the inactivation of this gene causes muscle tissue hyperplasia and weight gain in mice; and the mice can survive normally and have fertility. Subsequently, it was found in cattle, sheep and other animals that the main function of the myostatin gene is to negatively regulate muscle growth and development, and the inactivation of myostatin does not cause abnormalities in the physiological functions of the above animals. Therefore, myostatin is a candidate modified gene for transgenic animals that has proven to be a phenotypic effect and relatively safe. In view of the fact that the sequence of myostatin gene and protein sequence are highly conserved in species evolution, it is reasonable to speculate that the porcine myostatin gene also has similar functions, and thus it is becoming a hot gene for transgenic pig research, with great potential. However, the current research focuses on the knockout of the myostatin gene to obtain transgenic pigs with higher meat production rate. The research on the cloning, identification and activity analysis of the pig myostatin gene promoter is still blank.

Invention disclosure

It is an object of the present invention to provide a porcine myostatin gene promoter and use thereof.

The DNA molecule provided by the present invention, which is derived from a pig, is a DNA molecule according to any one of the following 1) -4):

1) a DNA molecule as shown in Sequence 2 of the Sequence Listing;

2) a DNA molecule as shown in SEQ ID NO: 3 of the Sequence Listing; 3) a DNA molecule which hybridizes under stringent conditions to the DNA sequence of 1) or 2) and has a promoter function;

4) A DNA molecule having 90% or more homology with the DNA sequence described in 1) or 2) and having a promoter function.

The DNA molecule shown in 4) is the DNA molecule shown in SEQ ID NO: 1 in the Sequence Listing.

The stringent conditions were hybridization in a 6XSSC, 0.5% SDS solution at 65 °C followed by one wash with 2 XSSC, 0.1% SDS and 1X SSC, 0.1% SDS.

A recombinant vector, expression cassette, transgenic cell line or recombinant strain containing the DNA molecule is also within the scope of protection of the present invention.

The recombinant vector is as follows 1) or 2):

1) a recombinant vector obtained by inserting the DNA molecule between the Μ1 and P Bgl II sites of pGL3-basic;

2) A recombinant vector obtained by inserting the DNA molecule between the el and Nhel sites of pEGFP-Cl.

Primer pairs that amplify the DNA molecule are also within the scope of the invention.

The primer pair is as follows 1) or 2) _:

1) The sequence of one of the primer pairs shown is sequence 5, and the sequence of the other primer is sequence

6;

2) The sequence of one of the primer pairs shown is sequence 7, and the sequence of the other primer is sequence 8.

The use of the DNA molecule in the expression of the gene of interest in ex vivo animal cells is also within the scope of the invention.

The animal cell is a mouse cell or a human cell.

The mouse cell is a mouse myoblast;

The human cell is a human cervical cancer cell.

The mouse myoblast is a C2C12 cell;

The human cervical cancer cells are Hela cells.

Unless otherwise indicated or individually defined, the scientific and technical terms used herein have the same meaning of the meaning of the meaning of the invention. In addition, the materials, methods, and examples described herein are intended to be illustrative and illustrative, and not limiting or limiting.

DRAWINGS

Figure 1 is a schematic diagram of the tissue structure and promoter candidate regions of porcine myostatin gene.

Figure 2 shows the amplification of the porcine myostatin gene promoter.

Figure 3 is a porcine myostatin gene promoter reporter vector digestion verification

Figure 4 shows the cloning, mutation and activity assay of porcine myostatin gene promoter.

Figure 5 is a functional verification of the expression of green fluorescent protein driven by the porcine myostatin gene promoter.

Figure 6 shows the activity assay of porcine myostatin gene promoter reporter vector in human cultured cells. The best way to implement the invention

The experimental methods used in the following examples are all conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not intended to limit the scope of the invention, which is not intended to limit the scope of the invention, and the specific conditions and methods, such as J. Sambrook, DW. Er et al., Huang Peitang et al., Science Press, 2002, The conditions recommended in the third edition of the Molecular Cloning Experiment Guide.

Example 1. Cloning and verification of porcine myostatin gene promoter

1. Experimental materials

Table 1 Experimental materials

Material Source Description Hubei white pig ear tissue Hubei Provincial Academy of Agricultural Sciences animal liquid nitrogen freezing, -8CTC cryopreservation

Pastoral Veterinary Research Institute Experimental Pig Farm

Newborn piglet

pGL3-bas ic, both purchased from pGL3-bas ic, pGL3-p:romote:r, Promega (USA) pGL3- promoter expression firefly incinerated pRL-TK reporter vector photozyme, and pRL-TK reporter vector expresses Renilla fluorescence Prime enzyme reporter gene high fidelity polymerase K0D Toyobo (Japan) amplification of porcine myostatin gene promoter plus sub

Tag DNA polymerase, Shanghai Shenneng Gaming Identification of positive transformants dNTP

MSTN-F upstream primer Shanghai Yingjun synthesis TTCAACGCGTGCTCTATTCT

(5, →3 ' ) CTGCTCCCAGACC (Mlul) (sequence

5)

MSTN-R downstream primer Shanghai Yingjun synthesis CATCAGATCTCGCCAAGCAA

(5, →3 ' ) AATTTTAATGCC (Bgl II) (Sequence 6)

GLprimer2 (5 ^{J →} Shanghai Yingjun Synthetic CTTTATGTTTTTGGCGTCTT

3 ' ) CC

Bgl II, Mlul restriction Takara (Japan) digestion DNA fragment

Endonuclease

DNA Cutting Recycling Kit Beijing Tiangen Cutting Rubber Recovery PCR Product Ultrapure Plasmid Extraction Reagent Beijing Tiangen Preparation of endotoxin-free plasmid for cell transfection

T4 DNA ligase Fermentas vector linked to the insert SeaKem agarose US FMC electrophoresis detection and analysis of ethidium bromide (ethidium S igma nucleic acid staining)

Bromide)

Tris saturated phenol, chloroform, Sinopharm Group (analytical nucleic acid extraction

Isoamyl alcohol, absolute ethanol, acetic acid pure)

Sodium

Lkb DNA molecular weight standard Guangzhou Dongsheng nucleic acid fragment size recognition protease K S igma nucleic acid extraction process protein removal

Ribonuclease Rnase Amresco RNA removal

Ammonia antibiotic Amp Amresco transformation and screening

2, equipment

Table 2 Instrumentation

Name Source Description

Ultra-clean workbench Beijing semiconductor equipment, aseptic operation such as bacterial transformation

High speed centrifuge Beckman-Coulter DNA, plasmid extraction

(USA)

Horizontal Electrophoresis System Beijing Liuyi Electrophoresis Detection

Gel Imaging System Uvitek, UK Image Capture

ThermoCycler PCR Thermo- Fisher nucleic acid PCR amplification Thermostat, shaker Shanghai Zhicheng Bacterial culture

3. Experimental methods

1) Pig genome DNA extraction

Take the isolated pig ear muscle tissue sample 0. 1 gram, wash, cut.

Each sample was added with 300 μl DNA extraction buffer (Tris-Hcl 10 mM, EDTA 10 mM, SDS 2%, NaCl 300 mM, pH 8.0), 8 μl proteinase K (10 mg/ml), and digested at 55 ° C for 6 hours.

The mixture was extracted twice with phenol, centrifuged at 10, OOO rpm for 10 minutes, and the supernatant was removed to remove the protein and the lower phenol.

The extract was again extracted with chloroform/isoamyl alcohol phenol, and the supernatant was taken by centrifugation at 10, OOO rpm for 10 minutes.

Add 30 μl of 3 Μ NaAC to the supernatant, mix well with 600 μl of absolute ethanol, and centrifuge at 10, OOO rpm for 10 minutes to remove the precipitate.

The precipitate was washed once with 75% cold ethanol, and centrifuged for 5 minutes to remove the ethanol to take a precipitate.

The precipitate is fully dried at 4 ° C, added with three distilled water Ι θ θ μΐ, electrophoresis check quantitative, -20 ° C frozen storage available The pig genomic DNA was obtained by PCR amplification.

2) PCR amplification of porcine myostatin gene promoter fragment

Using the genomic DNA obtained above as a template, specific primers (MSTN-F and MSTN-R) with predetermined restriction sites were used to amplify the promoter sequence of the porcine myostatin gene. The reaction system was:

Table 3 Reaction system Ingredients Initial concentration Amount Final concentration

PCR buffer 10 X 5μ1 I X

dNTP 2mmol/L 5μ1 200μπιο1/1 magnesium sulphate 25 mmol/L 2μl lmmol/L

MgS0 ₄

KOD plus lunit/μΐ ΐμΐ 0. 02 unit/μΐ

MSTN-F 10μπιο1/1 4μ1 800nmo/L

MSTN-R 10μπιο1/1 4μ1 800nmo/L Genomic DNA 25ng/ l ΐμΐ ο. Sng/μΐ Double distilled water 28μ1

Total volume 50μ1 Reaction conditions are:

Pre-denaturation at 95 °C for 2 minutes;

Denaturation at 95 °C for 30 seconds;

Annealing 55 °C 30 seconds; 30

Extension 68 °C 1. 5 minutes;

After the reaction, the PCR product was detected by 1% agarose gel electrophoresis. The results are shown in Fig. 2. M is the molecular weight standard of lkb DNA, and the length is 0.5 kb, lkb, 1. 5 kb, 2 kb, 3 kb, 4 kb, 5kb, 6kb, 8kb, lOkb, PCR amplification to obtain 1. lkb fragment.

The PCR product was sent to the Huada gene for sequencing, and the sequencing primer was Glprimer2. As a result, the PCR product had the nucleotide shown in SEQ ID NO: 1 in the sequence listing, and the gene of the PCR product was named MSTN. From the 5' end, 1031-1038 is the 5' end transcriptional element TATA box (5' end TATA box), from the 5' end 1056-1063 to the 3' end transcriptional element TATA box (3 ' end TATA box) ), from the 5' end to the 991-996 position for the 3'-end transcriptional element CAAT box.

Sequence 1 can also be synthesized manually.

Figure 1 is a schematic diagram showing the tissue structure and promoter candidate region of porcine myostatin gene. It can be seen that the porcine myostatin gene contains three exons and two introns, and the full length is 3789 bp. The exon lengths were 373 bp, 374 bp and 381 bp, respectively; the intron lengths were 1809 bp and 1980 bp, respectively. The sequence immediately upstream of exon 1 contains a TATA cassette (2) and a CAAT box (1), and a MEF (myocyte enhancer factor) binding sequence. 3) Cloning and identification of porcine myostatin gene promoter fragment

The fragment obtained by digesting the PCR product obtained in the above 2) with Μ1Λ and Bgl II was ligated to the reporter vector pGL3-basi _C fragment obtained by the same digestion:

Table 4 Connection system Ingredients Initial concentration Dosage Final concentration After digestion, PCR 5μ1

Product

pGL3~bais o ΐμΐ lOng/μΙ

o o

c fragment mouth

10 X buffer 10 X ΐμΐ I X

T4 DNA lOunits/μΙ ΐμΐ 1 unit/μΐ l igase

Double distilled water 2μ1

Total volume Ιθμΐ

The reaction conditions were: 16 ° C, and allowed to stand overnight.

The ligation product was transformed into Escherichia coli DH5a according to standard methods, and cultured overnight at 37 ° C to obtain a transformant. The transformants obtained above were identified by colony PCR using the MSTN-F and MSTN-R primers, and the recombinant which can obtain the lkb amplification product was a positive plasmid;

The positive plasmid was digested with Mlu I and Bgl II, and pGL3-basi _{C was used} as a control. The results are shown in Fig. 3. Among them, lanes 1, 3 are pGL3-basic, 2, 4 is a p-port GL3_basic plasmid digested with Mlul and BglU; it can be seen that the pGL3-basi _C plasmid has no insert, so the plasmid is electrophoretically displayed after double digestion. It is a single strip with a length of 4. 8 kb, which is consistent with the theoretical analysis. Lanes 5, 7, 9 are recombinants, 6, 8, and 10, respectively, 5, 7, and 9 recombinants were digested with Mlul and BglU; it can be seen that lanes 6, 8, 10 were digested and electrophoresed. The results showed that 1. lkb (shown by the black arrow on the right, the brightness was weak) and the 4.8 kb two fragments were positive plasmids, which was consistent with the theoretical analysis, indicating that lanes 5, 7, and 9 were positive plasmids.

The plasmid which was positive by PCR and restriction enzyme digestion was sent for sequencing. The result was that the plasmid was inserted into the plasmid between the Mlu I and Bgl II cleavage sites of pGL3-baisc, and the plasmid was named. For pGL3-MSTN. Example 2. Functional identification of the porcine myostatin gene promoter

I. Detection of transcriptional activity of porcine myostatin gene promoter

A. Preparation and verification of mutation vector for porcine myostatin gene promoter reporter system

1. Experimental materials

Table 5 experimental materials

Main material Source Description

High fidelity polymerase K0D Toyobo amplification circular plasmid Plus (Japan)

5 'TATA box deletion mutation Shanghai Ying CGACACTTGTCTCATCAAGTGGAAAGC upstream primer Jun synthesis CACTTGGAATACAGTATAAAAG

5 'TATA box deletion mutation Shanghai Ying CTTTTATACTGTATTCCAAGTGGCTTTC Downstream primer Jun synthesis CTTGATGAGACAAGTGTCG

3 'TATA box deletion mutation Shanghai Ying GGAATATAAAAAGCCACTTGGAATACA upstream primer Jun synthesis GGATTCACTGGTGTGGCAAGTTGTCTCTC

3 'TATA box deletion mutation Shanghai Ying GAGAGACAACTTGCCACACCAGTGAAT Downstream primer Jun synthesis CCTGTATTCCAAGTGGCTTTTTATATTCC Three-element deletion mutation introduction Shanghai Ying CATCAGATCTCCACAATGAATCTCGCT Material Jun synthesis GTC (BgllT)

Glprimer2 Shanghai Ying CTTTATGTTTTTGGCGTCTTCC

Jun synthesis

Dpnl restriction enzyme ΡΘΓΠΙΘΠ removal of methylated plasmid DNA

Tas

SeaKem Agarose US Electrophoresis Detection and Analysis

FMC

Ethidium bromide (ethidium Sigma nucleic acid staining)

Bromide)

Lkb DNA molecular weight standard Guangzhou East nucleic acid fragment size recognition

Sheng

Ampicillin Amp Amresc Transformation and Screening

2, equipment

Table 6 Instrument and equipment Name Source Description Ultra-clean workbench Beijing Semiconductor Design Aseptic operation such as bacterial transformation Preparation plant Use

High speed centrifuge Beckman-Chur DNA, plasmid extraction

Special (USA)

Horizontal Electrophoresis System Beijing Liuyi Electrophoresis Detection

Gel Imaging System Uvitek, UK Image Capture ThermoCycler PCR Thermo - PCR amplification of Fishe nucleic acid

r

Pre-deferred

Thermostat, shaker, Shanghai Zhicheng, bacterial culture

Fire resistance

3. Test method

1) Construction of mutant vector The present invention adopts a Dpnl-mediated point mutation method,

The reaction system of the mutant PCR is as follows:

Table 7 reaction system

Initial concentration final concentration

PCR buffer 10X 5μ1 IX

dNTP 2mmol/L 5μ1 200μπιο1/1 magnesium sulphate 25 mmol/L 2μl lmmol/L

MgS0 ₄

KOD plus lunit/μΐ ΐμΐ 0.02 unit/μΐ upstream primer 10μπιο1/1 4μ1 800nmo/L downstream primer 10μπιο1/1 4μ1 800nmo/L PGL3-MSTN song/μΐ ΐμΐ lng/μΐ double distilled water 28μ1

Total volume 50μ1

The reaction conditions are:

95 ° C for 2 minutes;

95 °C 30 seconds; _3Q

55 ° C for 30 seconds;

68 ° C for 1.5 minutes;

details as follows:

Using PGL3-MSTN as a template, 5' TATA box deletion mutation upstream primer and 5' TATA box deletion mutation downstream primer were used as primers, and PCR amplification was performed to obtain 5.9 kb PCR product 1 which was sequenced and shown in sequence 2 in the sequence listing. Nucleotide (5' TATA box deletion);

Using PGL3-MSTN as a template, the 3' TATA box deletion mutation upstream primer and the 3' TATA box deletion mutation downstream primer were used as primers, and PCR amplification was performed to obtain a 5.9 kb PCR product 2, which was sequenced and shown in sequence 3 in the sequence listing. Nucleotide (3' TATA box);

Using pGL3-MSTN as a template, using the three-component deletion mutant primer and MSTN-F as primers, PCR amplification was performed to obtain 981 bp PCR product 3, which was digested, ligated, transformed, identified, and sequenced, and shown in sequence 4 in the sequence listing. Nucleotide

Sequence 2 or Sequence 3 can also be synthesized manually.

The above PCR product (removal of the cyclized template PGL3-MSTN) was separately digested with Dpnl, and the system was as follows: Table 8 Reaction system Initial concentration of component

Buffer 10 X 3μ1 I X

l ango

Dpn I lOunits/μΙ ΐμΐ 0. 33 unit/μΐ

PCR product 26μ1

Total volume 30μ1

The reaction was carried out in a water bath at 37 ° C for 2 hours.

After digestion, the Ιθμΐ digested product was separately transformed into E. coli competent cells DH5 _a according to standard procedures. (The linear digested product has a homology arm at both ends, which can be cyclized in E. coli. This is the principle of the classical mutation method. Developed by Stratagene, USA, three transformants were obtained: positive plasmid 1, positive plasmid 2, transformant 3.

The plasmid of transformant 1 was extracted and sent for sequencing. As a result, the plasmid contained the sequence 2 in the sequence listing, and the plasmid was inserted between the Mlu I and Bgl II cleavage sites of pGL3-basic. The plasmid was named PGL3-TATA1;

The plasmid of transformant 2 was extracted and sent for sequencing. As a result, the plasmid contained the sequence 3 in the sequence listing, which was obtained by inserting sequence 3 in the sequence listing between the Mlu I and Bgl II cleavage sites of pGL3-basic. Plasmid, named PGL3-TATA2;

The plasmid of transformant 3 was extracted and sent for sequencing. As a result, the plasmid contained the sequence 4 in the sequence listing, which was obtained by inserting the sequence 4 in the sequence listing between the Mlu I and Bgl II cleavage sites of pGL3-basic. The plasmid was named pGL3-3-boxes.

B. Detection of transcriptional activity of porcine myostatin gene promoter

1. Experimental materials

Table 9 Experimental materials Main materials Source Description

Lipof ectamine2000 Invitr Cell Transfection

Gene

Mouse myoblast C2C12 ATCC fine muscle cell model

Cell line number is

CRL-1772

Dual luciferase kit Promeg for reporter gene assay

DLR ^M Assay a

Ultrapure plasmid extraction reagent Beijing Tian Preparation of endotoxin-free plasmids for root transfection

Opti-MEM Gibco Cell Transfection Auxiliary Reagent 24-well cell culture plate Cornin cell culture

g

2, equipment

Table 10 experimental materials

Name Source Description

C02 Incubator Sanyo (Japan) Mammalian Cell Culture Super Clean Bench Beijing Semiconductor Design Cell Experiment

Preparation plant

GloMAX Promega Reporter Gene Test

3. Test method

1) , cell transfection

One day before transfection, ⁴ ×10 ⁴ C2C12 cells were plated into 24-well plates. After overnight growth, transfection complexes were prepared according to the system listed in the table, and dropped into 24-well plates, supplemented with 400 μl complete medium, placed. Incubate at 37 ° C under 5% CO ₂ . Cells were harvested 48 h after transfection. Luciferase activity assays were performed according to Promega's DLR Assay kit instructions.

The transfection system is as follows:

Table 11 transfection system

Lipof ecta

MEM mine2000

pGL3~basi lOOng Ιθθμΐ 0. 5μ1

PGL3-prom lOOng Ιθθμΐ 0. 5μ1

Oter

PGL3-MSTN lOOng Ιθθμΐ 0. 5μ1

pGL3- TATA lOOng Ιθθμΐ 0. 5μ1 pGL3- TATA lOOng Ιθθμΐ 5μ1 pGL3-3~bo lOOng Ιθθμΐ 5μ1

Xes

RL-TK (intraOOOOng Ιθθμΐ 5μ1 experiment set three biological replicates, the results were averaged.

The absolute and relative enzymatic activities of the individual reporter vectors are shown in Table 12 below:

Table 12 Absolute and relative values of enzyme activity of each reporter vector

A schematic diagram of the partial structure of each reporter vector and the relative ratio of enzyme activity are shown in Figure 4. As can be seen from the above, the TATA box and the CAAT box are key components of the transcription of the porcine myostatin gene, and the deletion of the three components can lead to the report. Loss of gene activity (not significantly different from the enzyme activity of the negative control pGL3-basi _C ). Two TATA boxes were deleted, respectively, and they were all able to efficiently drive transcription. It was proved that these two TATA boxes are effective elements for the transcription initiation of porcine myostatin gene (mutant and wild type enzyme activities are almost identical), but the two are not superimposed. effect. *, p < 0.05, the difference is significant, indicating that the DNA molecule shown in SEQ ID NO: 2 and the DNA molecule shown in SEQ ID NO: 3 are also promoters.

2. Functional verification of porcine myostatin gene promoter driving green fluorescent protein expression

A. Preparation and detection of green fluorescent protein carrier

1. Experimental materials

Table 13 Experimental materials Main materials Source Description

pEGFP-Cl Invitr green fluorescent protein reporter containing ogen

T4 DNA ligase Fermen gene cloning Tas

Asel, Nhel Fermen restriction enzyme

Tas

Promoter upstream primer Shanghai Ying TTCATTAATGCTCTATTC Jun TCTGCTCCCAGACC (AseT)

(sequence 7)

Promoter downstream primer Shanghai Ying CATCGCTAGCCGCCAAGC Jun AAAATTTTAATGCC {Nhel)

(sequence 8)

Ultrapure plasmid extraction reagent Beijing Tian Preparation of endotoxin-free plasmid

2, equipment

Table 14 Instrumentation

Name Source Description Ultra-clean workbench Beijing Semiconductor Design Aseptic operation such as bacterial transformation Preparation plant

High speed centrifuge Beckman-Chur DNA, plasmid extraction

Special (USA)

Horizontal Electrophoresis System Beijing Liuyi Electrophoresis Detection

Gel Imaging System Uvitek, UK Image Capture

ThermoCycler PCR Thermo-Fi she nucleic acid PCR amplification instrument r

Thermostat, shaker, Shanghai Zhicheng, bacterial culture

3. Experimental methods

1) PCR amplification of porcine myostatin gene promoter fragment

The pGL3-MSTN plasmid DNA was used as a template, and a specific primer with a predetermined restriction site (promoter upstream primer and promoter downstream primer) was used to amplify the porcine myostatin gene promoter sequence. The reaction system was:

Table 15 reaction system

Final concentration

PCR 10 X 5μ1 I X

Buffer

dNTP 2mmol/L 5μ1 200μπιο1/1 sulfur painting

25 mmol/L 2μ1 lmmol/L

MgS0 ₄ KOD plus lunit/μΐ ΐμΐ 0.02 unit/μΐ 10μπιο1/1 4μ1 800nmo/L on the promoter

Under the promoter 10μπιο1/1 4μ1 800nmo/L

Grain 25ng/ l ΐμΐ ο. Sng/μΐ

PGL3-MSTN

Double steamed water 28μ1

Total volume 50μ1

The reaction conditions are:

Pre-denaturation at 95 °C for 2 minutes;

Denaturation at 95 °C for 30 seconds;

Annealing 55 °C 30 seconds; 30

Extend at 68 °C for 1.5 minutes;

After the completion of the reaction, the lj PCR product was subjected to 1% agarose gel electrophoresis to obtain a 1122 bp PCR product.

2) Cloning and identification of porcine myostatin gene promoter fragment

The PCR product obtained by the above 1) digested with Nhel and the reporter vector pEGFP-Cl fragment obtained by the same digestion were linked by the following system:

Table 16 connection system

Ingredients Initial concentration Amount Final concentration After digestion, PCR 100 ng/μΐ 5μ1 10 ng/μΐ Product

pEGFP-Cl sheet 100 ng/μΐ ΐμΐ lOng/μΙ segment

10 X Buffer 10X ΐμΐ IX

T4 DNA lOunits/μΙ ΐμΐ 1 unit/μΐ ligase

Double distilled water 2μ1

Total volume Ιθμΐ

The reaction conditions were: 16 ° C, and allowed to stand overnight.

The ligation product was transformed into E. coli DH5a according to standard methods and cultured overnight at 37 ° C to obtain a transformant.

The plasmid of the transformant was extracted, and the primer upstream of the promoter and the primer downstream of the promoter were subjected to PCR amplification to obtain a 1122 bp fragment as a positive plasmid. The positive plasmid was digested with Nhel to obtain 1122 bp. The fragment was further proved to be a positive plasmid, and the plasmid which was positive by PCR and restriction enzyme digestion was sent for sequencing, and the result was that the plasmid 1 was inserted between the sel and Nhel cleavage sites of pEGFP-Cl. The plasmid was named pMSTN-EGFP.

B. Functional verification of porcine myostatin gene promoter driving green fluorescent protein expression

1. Experimental materials

Table 17 Experimental materials

Main material Source Description

Lipof ectamine2000 Invi tr Cell Transfection

Gene

Mouse myoblast C2C12 ATCC fine muscle cell model

Cell line number is

CRL-1772

Opt i-MEM Gibco Cell Transfection Auxiliary Reagent

24-well cell culture plate Cornin cell culture

g

2, equipment

Table 18 Instrument Equipment Name Source Description

Preparation plant

Fluorescence microscope Le i ca (German observation fluorescence

y)

3. Test method

1) Cell transfection

The constructed pMSTN-EGFP reporter vector was transfected (transfection method is described in detail in the kit). Mouse myoblast C2C12 was observed 24 hours later, and pEGFP-Cl was used as a control.

The results are shown in Figure 5. After transfection of the positive control plasmid pEGFP-Cl, a large amount of green fluorescent protein was expressed. After pMSTN-EGFP transfected cells, some cells expressed green fluorescent protein, but the total brightness was significantly lower than that of pEGFP- Cl sample. This aspect indicates that the identified MSTN promoter can drive the expression of the reporter gene green fluorescent protein, and on the other hand, the activity of the identified MSTN promoter is indeed lower than that of the constitutive promoter CMV, which is related to the luciferase reporter gene. The results of the test are consistent and the two can be verified interactively. Therefore, it can be considered that the promoter activity of the cloned fragment was detected by using different reporter gene systems. Prove that the fragment is a promoter sequence of the porcine myostatin gene.

The transfection system is as follows:

Table 19 Transfection system

Plasmid dosage Opti- Lipof ectami

MEM ne2000

pEGFP-Cl lOOOng Ιθθμΐ 2μ1

pMSTN-EGF lOOOng Ιθθμΐ 2μ1

P. Expression of porcine myostatin gene promoter reporter vector in human cells

1. Experimental materials

Table 20 Main materials of experimental materials

Lipof ectamine2000 Invitr Cell Transfection

Gene

Hela cell ATCC fine human cell

Cell line number is

CCL-2

Ultrapure plasmid extraction reagent Beijing Tian Preparation of endotoxin-free plasmid for root cell transfection

Opti-MEM Gibco Cell Transfection Auxiliary Reagent

24-well cell culture plate Cornin cell culture

g

2, equipment

Table 21 Instrument Equipment Name Source Description

Preparation plant

GloMAX Promega Reporter Gene Test

3. Test method

1) Cell transfection

One day before transfection, 4 X 10 ⁴ hela cells were plated into 24-well plates and grown overnight. The transfected complexes were prepared separately in the system listed, and were added to a 24-well plate, supplemented with 400 μl of complete medium, and cultured at 37 ° C and 5% CO ₂ . Cells were harvested 48 h after transfection. Luciferase activity assays were performed according to Promega's DLR ^M Assay kit instructions.

Three biological replicates were set up in the experiment and the results were averaged.

The transfection system is as follows:

Table 22 Transfection system

Opti- Lipof ectamine2

MEM 000

pGL3-basic lOOOng Ιθθμΐ 2μ1

PGL3-promo lOOOng Ιθθμΐ 2μ1

Ter

PGL3-MSTN lOOOng Ιθθμΐ 2μ1

The results of RL-TK (inner 500ng Ιθθμΐ 2μ1 luciferase activity are shown in the following table:

Table 23 Luciferase activity

The results are averaged as shown in Figure 6.

It can be seen that the porcine myostatin gene promoter reporter vector PGL3-MSTN was transfected into human cervical cancer Hela cells, and the transcriptional activity of the porcine myostatin gene promoter in human cells was examined by a reporter gene. The results showed that the cloned promoter fragment was highly active in human cells, demonstrating that the identified porcine myostatin gene promoter is efficiently expressed in mammalian cells.

Industrial application

The experiments of the present invention prove that the promoter provided by the present invention can drive the expression of the reporter gene firefly luciferase, and can also be used to construct the promoter into the reporter vector and then transfect the pig source and the human cultured cell. Through reporter gene testing, the activity and efficiency of the promoter are identified by accurate quantitative methods, and the problems of introducing foreign genes after the promoter, solving the unsteadiness of the expression of foreign genes in transgenic pigs, and the unpredictability of positional effects are provided. A reliable and valuable genetic resource.

Claims

Rights request

1. A DNA molecule, which is a DNA molecule as described in any one of the following 1) -4):

1) a DNA molecule as shown in Sequence 2 of the Sequence Listing;

2) the DNA molecule shown in sequence 3 of the sequence listing;

3) a DNA molecule that hybridizes under stringent conditions to the DNA sequence of 1) or 2) and has a promoter function;

The DNA molecule according to claim 2, wherein the DNA molecule shown in the above 4) is a DNA molecule represented by SEQ ID NO: 1 in the Sequence Listing.

3. A recombinant vector, expression cassette, transgenic cell line or recombinant strain comprising the DNA molecule of claim 1 or 2.

4. The recombinant vector according to claim 3, wherein: the recombinant vector is as follows 1) or 2):

1) a recombinant vector obtained by inserting the DNA molecule of claim 1 or 2 into a multiple cloning site of pGL3-basic;

2) A recombinant vector obtained by inserting the DNA molecule of claim 1 or 2 into the multiple cloning site of pEGFP-Cl.

5. A primer pair for amplifying the DNA molecule of claim 1 or 2.

6. The primer pair according to claim 5, wherein: the primer pair is as follows 1) or

2) :

6;

2) The sequence of one of the primer pairs shown is sequence 7, and the sequence of the other primer is sequence

8.

7. Use of a DNA molecule according to claim 1 or 2 for expression of a gene of interest in an ex vivo animal cell.

8. Use according to claim 7, characterized in that the animal cells are mouse cells or human cells.

9. Use according to claim 7 or 8, characterized in that:

The mouse cell is a mouse myoblast;

The human cell is a human cervical cancer cell.

10. Use according to any of claims 7-9, characterized in that:

The mouse myoblast is a C2C12 cell;

The human cervical cancer cells are Hela cells.