CN105087578A - Zebrafish nervous tissue-specific enhancer and cloning and application thereof - Google Patents

Abstract

The invention discloses a zebrafish nervous tissue-specific enhancer and cloning and application thereof and relates to the technical field of acquisition of enhancers for tissue and organ specific expressed genes. The enhancer is used for fluorescently labeling nerve cells in a zebrafish embryo development process. Sequences of the enhancer are nucleotide sequences shown in SEQ ID NO. 2. The application of the enhancer includes: developing transgenic fishes of nervous tissue-specific expressed fluorescence so as to serve for studying nerve and organ regeneration; driving specific expression of any target genes in nervous tissues so as to provide powerful tools for researchers to study development of nervous system and treatment of related diseases. The enhancer is applicable to the research on zebrafish eye development and injury regeneration processes, helps study the effect of specific genes in terms of nervous system development and controlling and provides new materials for the treatment of related diseases.

Description

Zebra fish nervous tissue specific enhancer and clone thereof and application

Technical field

The present invention relates to the enhanser capture technique field of a kind of tissue and Organ specific expression gene, particularly relate to a kind of zebra fish nervous tissue specific enhancer and clone thereof and application, for the neurocyte in fluorescent mark zebrafish development.

Background technology

Enhanser capture technique is a kind of one of forward genetics method studying the enhancer sequence existed in genome, and it is for finding the enhancer element of known and unknown organizing specific expression.Come in the past few decades, domestic and international employing enhanser capture technique, obtain the zebra fish strain of Various Tissues and organ specifically expressing fluorescence, and it is less to insert information acquisition to related gene loci, a lot of histoorgan such as the enhanser of the specifically expressings such as neural system, liver, pancreas and kidney and promotor are not yet cloned.Nervous system development is one of focus of developmental biology research, and obtained the neural transgenic zebrafish strain of some fluorescent marks at present, they are widely used in the research that spinous process touches neurotransmitter transmission aspect.The accuracy of nervous system development and signals-modulating and complicacy, need the appearance of the transgenic strain of the different neurocyte of more multiple labeling.

Through retrieval, not yet find at present to be same as the clone to zebra fish nervous tissue specific enhancer of the present invention.

Summary of the invention

Object of the present invention is just to overcome the problem that in existing research, nervous tissue specific enhancer is less, a kind of zebra fish nervous tissue specific enhancer and clone thereof and application are provided, namely set up by enhanser capturing carrier the transgenic zebrafish that nervous specific expresses fluorescence, clone obtains a kind of enhancer sequence at nervous tissue specifically expressing.

To achieve these goals, the present invention is by the following technical solutions:

One, zebra fish nervous tissue specific enhancer

This enhanser is positioned at the region (Zv9, karyomit(e) 7:15189000-15279000) of zebra fish genome No. 7 karyomit(e) 90kb, and specifically expressing is in zebra fish forebrain, midbrain, hindbrain, spinal cord and eyes nervous tissue; Its sequence is the nucleotide sequence shown in SEQIDNO.2.

Two, the cloning process of zebra fish nervous tissue specific enhancer

1. adopted enhanser capturing carrier

There is the nucleotide sequence shown in SEQIDNO.1, long 4881bp, drive Green fluorescent protein fusion vector, acceptor splicing site SA and Tol2 transposon three part to form by mMT1 weak promoter;

2. the acquisition of the genetically engineered fish of the specific expressed green fluorescent protein of nervous tissue

By zebrafish embryo microinjection, green fluorescent protein fluorescent screening and in situ hybridization and slice analysis, obtain the zebra fish of nervous tissue specifically expressing fluorescence;

Particularly, adopt Tol2 Transposon System, carry out zebra fish transgenosis.Adopt the mode of microinjection that transgene carrier is imported zebra fish one cell stage, observed by egfp expression, obtain F0 individual for genetically engineered fish.F0 is carried out test cross for property sexual maturity fish and wild-type fish and obtains F1 generation embryo, the positive fish of F1 generation of the different expression fluorescence of green fluorescent protein fluorescent screening nervous tissue.Because F1 generation majority derives from mosaic embryo, there is the genetic backgrounds such as different insertion points, therefore, positive for F1 generation fish and wild-type fish are carried out the F2 generation that test cross obtains same genetic background.F2 is obtained F3 generation for positive fish selfing, and can obtain the zebra fish strain of stable nervous tissue specifically expressing green fluorescent protein, we are called after pTME12.Confocal laser scanning microscope, whole mount in situ hybridization and frozen section analysis, further demonstrate that green fluorescent protein is specific expressed in zebra fish nervous tissue.

3. the clone of enhanser

By chromosome walking and genome sequence electronic cloning, obtain nervous tissue specific enhancer;

Adopt chromosome walking method: we find that enhanser capturing carrier forward is inserted into the non-coding region of rhcga gene coding region downstream 46kb, and to be positioned at the 45kb place, downstream of kif7 gene coding region in the other direction.We are by zebra fish, tiger filefish; the genome sequence in killifish between rhcga and kif7 gene compares genomics analysis, utilize mVISTA software, we obtain the non-coding element of 4 high conservatives (sequence length is greater than 100bp and has the consistence of >75%) at the chromosomal region (Zv9, karyomit(e) 7:15189000-15279000) of zebra fish genome 90kb.Subsequently, four CNE sequences are cloned into the upstream of mMTI promotor in pTME carrier by respectively, carry out zebrafish embryo microinjection, egfp expression analysis, obtain the enhanser of a potential driving green fluorescent protein at nervous tissue specifically expressing.

Three, the application of zebra fish nervous tissue specific enhancer

1. develop the genetically engineered fish of nervous tissue specifically expressing fluorescence, can be used for the research of nervous organ's regenerative process;

2. for driving any goal gene at nervous tissue specifically expressing, nervous system development is studied for investigator and treating correlative diseases provides powerful.

Compared with catching research with enhanser in the past, the present invention has following advantages and positively effect:

1. obtain a kind of genetically engineered fish of nervous tissue specifically expressing, and find these fluorescence specific mark zebra fish eyes M ü llerglia cell, can be used for the research of zebra fish eye development and injury regeneration process.

2. the enhanser gene order expressed in nervous tissue is obtained first, this sequence can be used for driving any aim sequence specifically expressing in neural system comprising reporter gene, thus contribute to the effect of research specific gene in nervous system development and regulation and control, for treating correlative diseases provides novel material.

Accompanying drawing explanation

Fig. 1 is nervous tissue special egfp expression pattern analysis figure,

Laser co-focusing microscopic examination and whole mount in situ hybridization data presentation egfp expression at akrencephalon and olfactory placode (A, D), in the histoorgans such as forebrain, midbrain, hindbrain, spinal cord and eyes (B, C, E, F, G, H, I, J).

Fig. 2 is luciferase expression cell type detection figure,

To pTME12 strain fish 48hpf to 72hpf embryonic section analytical results, A, B show egfp expression similar radial neuroglia cell, Müller's cell (RadialGlia) in zebra fish neural system, and C, D show the M ü llerglia cell type in EGFP mark eye retina.

Fig. 3 is genomic insertion site analysis chart,

A-enhanser capturing carrier genomic insertion site schematic diagram;

B-right side integrity analysis, the primer position is as indicated at a;

C-left side integrity analysis, the primer position as indicated at a.

Fig. 4 is enhancer sequence analysis chart,

Predicted by electronics, obtain the non-coding element of 4 high conservatives, respectively called after CNE1, CNE2, CNE3 and CNE4.

Fig. 5 is enhanser activation analysis figure,

A-enhanser active testing carrier schematic diagram;

B-enhanser activation analysis: a, b are the EGFP expression patterns observed in pTME12 transgenic zebrafish strain; C, d are the expression patterns that CNE2 enhanser drives reporter gene, consistent with pTME12 transgenic zebrafish strain, namely at midbrain, hindbrain and notochord specifically expressing; E, f are the results of whole mount in situ hybridization.

Embodiment

Below in conjunction with drawings and Examples to the detailed description of the invention:

Experimental technique in embodiment, condition is carried out routinely, with reference to as Pehanorm Brooker etc., experimental technique described in Molecular Cloning: A Laboratory guide (second edition, Science Press in 1992).

The structure of embodiment 1, enhanser capturing carrier:

1. design primer, increase mMT1 minimal promoter element from pmMREd12mt1LUC3 plasmid, required primer sequence:

Upstream primer: 5 '-ATATTCGTACGACTCGTCCAACGACTATAA-3 ' (NO.3);

Downstream primer: 5 '-CGGGGTACCGGTGAAGCTGGAGCTACG-3 ' (NO.4).

2. with pmMREd12mt1LUC3 plasmid for template, use above-mentioned primer, amplify the fragment of 105bp, PCR cycling condition: 94 DEG C of 5min; 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 30 circulations; 72 DEG C of 10min, pcr amplification product reclaims through 1% agarose gel electrophoresis test kit.

3. above-mentioned PCR primer reclaims after purifying through glue, carry out enzyme with restriction enzyme BsiWI and KpnI to cut, be connected with the pEF1 ɑ-EGFP carrier large fragment of cutting through same enzyme, transformation of E. coli Top10 ' competent cell, positive bacterium colony is obtained with penbritin (Amp)-LB plate screening, cut qualification through enzyme, obtain pmMT1-EGFP-BGHPolyA intermediate carrier; Then adopt BsiWI and BbuI double digestion pmMT1-EGFP-BGHPolyA and En-Trap carrier respectively, and digestion products is connected, obtain pmMT1-enhancertrap carrier.

4. design primer, catch core parts from the pmMT1-enhancertrap plasmid enhanser that increases, the primer sequence is as follows:

Upstream primer: 5 '-CCGGAATTCTTCAGCCGATGATGAAATTG-3 ' (NO.5);

Downstream primer: 5 '-CATGCTTAGCCTGCCCCAGCTGGTTCTTTCCG-3 ' (NO.6).

5. with pmMT1-enhancertrap plasmid for template, use above-mentioned primer, amplify the long segment of 1204bp, PCR cycling condition: 94 DEG C of 5min; 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 2min30s, 30 circulations; 72 DEG C of 10min; Pcr amplification product reclaims through 1% agarose gel electrophoresis test kit.

6. above-mentioned PCR primer reclaims after purifying through glue, double digestion is carried out with restriction enzyme EcoRI and Bpu1102I, be connected with the pminiTol2-genebreaking carrier large fragment of cutting through same enzyme, transformation of E. coli Top10 ' competent cell, positive bacterium colony is obtained with penbritin (Amp)-LB plate screening, cut qualification through enzyme, be enhanced sub-capturing carrier pminiTol2/SA-Exon-mMT1-EGFP-BGHPolyA, and we are abbreviated as pTME.

Embodiment 2, zebra fish are raised and transgenosis microinjection

1. zebra fish is raised: zebra fish (Daniorerio), AB strain, rearing conditions 28 DEG C, 12h illumination/12h night.

2. Tol2 transposase cappedmRNA is synthesized

A, linearizing: transcribe used carrier with BamHI linearization for enzyme restriction;

B, employing BioFluxDNA gel reclaim test kit and reclaim linearizing template, DEPC water dissolution linearizing template;

C, to transcribe: adopt the T7 transcriptase (Ambion, FosterCity, CA) in ripe mRNA synthetic agent box to transcribe, system of transcribing is as follows:

After said components being mixed, 37 DEG C, transcribe 2h;

D, get 1 μ L electrophoresis detection after, add 0.5 μ L2U/ μ LDnaseI, 37 DEG C of 15min;

E, add 57.5 μ LNucleare-freewater and 7.5 μ LNH4AC termination reactions;

F, equal-volume phenol chloroform/chloroform, equal-volume isopropanol precipitating ,-20 DEG C of 15min.

G, 12000g (rotating speed) 4 DEG C of centrifugal 15min, 70% ethanol washes 3 times, and room temperature places 5min.

H, be dissolved in 10 μ LDEPC water.

I, get the integrity of 0.5 μ L electrophoresis observation synthesis RNA product, and use spectrophotometer detectable level.

3. transgenosis microinjection

The preparation of A, zebrafish embryo: the male and female zebra fish of maturation is put in same container in the ratio of 1:2 evening before that day by experiment, and centre dividing plate separates, and dividing plate is taken away by the next morning, collects zygote after 15min;

B, whole operating process ensure that nuclease free is polluted, the transgene carrier pTME of the Tol2 transposase cappedmRNA of 50ng/ μ L and 25ng/ μ L is mixed, be expelled to the zebrafish embryo of one cell stage, injection site is the intersection of blastodisc and yolk, and volume injected is about 2nL;

C, the embryo injected is put into the plate filling water of breeding fish, be positioned in 28 DEG C of incubators.

The positive-selecting of embodiment 3, transgenic zebrafish

F0 is hybridized for sexually matured zebra fish and wild-type zebrafish, adopts CarlZeissSteReoLumarV12 Stereo fluorescence microscope, green fluorescence observation is carried out to the F1 generation obtained; The excitation wavelength of green fluorescent protein is 488nm, emission wavelength is 507nm, adopt Zeiss fluorescence inverted microscope, to 12hpf, 24hpf, 48hpf, 72hpf, the F1 generation embryo in 4day, 5day period carries out Fluirescence observation, obtains the zebrafish embryo having special egfp expression in neural system; Fluorescence embryo is chosen, supports to zebra fish adult fish, and hybridize with wild-type zebrafish further, obtain enough transgenic zebrafish heterozygote F2; Heterozygote selfing can obtain fluorescently-labeled homozygote F3.

Laser co-focusing microscopic examination and whole mount in situ hybridization show the central nervous system expression pattern (Figure 1A-J) of green fluorescent protein at 24hpf, 42hpf, 48hpf, 72hpf different development stage; Further frozen section analysis, we find similar radial neuroglia cell, Müller's cell (RadialGlia) (Fig. 2 A in this strain fish Green fluorescent protein labeling zebra fish neural system, B) the M ü llerglia cell type (Fig. 2 C, D) and in eye retina.

Embodiment 4, enhancer sequence clonal analysis

1. essence carries genomic dna

A, preparation high molecular extracting lysate: 10mMTris-cl, 100mMEDTA, 0.5%SDS (Westerfield.2000);

Before B, use, in lysate, add Proteinase K, make its final concentration be 200ng/ μ L; Packing 200 μ L lysate in each 1.5mLEP pipe, with operating scissors clip zebra fish tail fin; 56 DEG C of cracking 6h, therebetween every two hours shake EP pipes, can accelerate Tissue Lysis; Along with the cracking of tissue block, lysate becomes transparent, illustrates that cracking is complete.

C, add the saturated phenol of isopyknic Tris-, mixing leaves standstill 5min, then 5000g, and centrifugal 10min, gets supernatant, and repetitive operation once;

D, get supernatant and transfer to inside a new pipe, add isopyknic phenol chloroform-primary isoamyl alcohol (25:24:1), mixing leaves standstill 5min, then 5000g, centrifugal 10min;

E, then supernatant is transferred to inside new pipe, with the dehydrated alcohol precipitation genomic dna of the precooling of 2.5 times of volumes, add appropriate sodium-chlor, make its final concentration be 0.1M;

F, can see that flocks is formed, by this flocks round mouth rifle head sucking-off, transfer in the dehydrated alcohol of 75%, washing 5min;

G, add TEbuffer dissolution precipitation DNA;

H, employing ultramicrospectrophotometer carry out DNA concentration determination.

2. chromosome walking method obtains insertion point sequence information

For detecting the insertion point of enhanser capture element in genome in pTME12 strain, we carry out chromosome walking analysis to deriving from the genome of F2 for embryo, find that enhanser capturing carrier forward is inserted into the non-coding region of rhcga gene coding region downstream 46kb, and to be positioned at the downstream of kif7 gene coding region in the other direction, as shown in Figure 3A.

Concrete experimental implementation process is as follows:

A, get F2 and carry genomic dna for transgenic zebrafish embryo essence;

B, according to the left and right arms sequence ITR-L of Tol2 transposon and ITR-R, design three primers in the same way respectively, primer sequence is respectively L1, L2, L3 and R1, R2, R3, the principle of design of primers is with reference to Takara chromosome walking test kit, and the concrete sequence of the primer is as follows:

AD5:5 '-STAGNATSGNGTNCAA-3 ' (NO.7) (degenerate primer);

R1：5’-GTACAATTTTAATGGAGTACTTTTTTACTTTTACTCAAG-3’(NO.8)；

R2：5’-CCAGATACTTTTACTTTTAATTGAGTAAAATTTTCC-3’(NO.9)；

R3：5’-CACTTGAGTAAAATTTTTGAGTACTTTTTACACC-3’(NO.10)；

L1：5’-GGTTTGGTAATAGCAAGGGAAAATAGAATG-3’(NO.11)；

L2：5’-GATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCC-3’(NO.12)；

L3：5’-CAGTAATCAAGTAAAATTACTCAAGTACTTTACACC-3’(NO.13)；

C, carry out first round PCR reaction, reaction system following (illustrating for AD5 and Tol2 transposon right arm primer):

The amount of each reacted constituent of system

Response procedures: 1 circulation: 94 DEG C, 1min;

1 circulation: 98 DEG C, 1min;

5 circulations: 94 DEG C, 30s; 63 DEG C, 1min; 72 DEG C, 2min;

1 circulation: 94 DEG C, 30s; 25 DEG C, 3min; 72 DEG C, 2min;

15 systemic circulations: 94 DEG C, 30s; 63 DEG C, 1min; 72 DEG C, 2min;

94℃，30s；63℃，1min；72℃，2min；

94℃，30s；44℃，1min；72℃，2min；

1 circulation: 70 DEG C, 10min;

D, get first round PCR primer 0.5 μ L as template carry out second take turns PCR reaction, reaction system is as follows:

15 systemic circulations: 94 DEG C, 30s; 63 DEG C, 1min; 72 DEG C, 2min;

94℃，30s；63℃，1min；72℃，2min；

94℃，30s；44℃，1min；72℃，2min；

1 circulation: 70 DEG C, 10min;

E, get second and take turns PCR primer 0.5 μ L and carry out third round PCR reaction as template, reaction system takes turns PCR system with second, and it is identical that response procedures and second takes turns PCR program.

F, get first and second and take turns PCR primer 15 μ L and third round PCR primer all carries out agarose gel electrophoresis analysis, get third round takes turns little about 100bp object band than second to check order, the BLAT inputted by sequencing result in ENSEMBL website searches the matching sequence in genome;

3. insertion point PCR checking

For determining the integration site of capture element further, the primer that our design is positioned at genome sequence near capture element and insertion point carries out PCR.As shown in the B in Fig. 3, obtain the DNA band of 283bp with primer RF/R3 amplification, obtain the DNA band of 711bp with RF/ER amplification; To the left end precise integration of the sequencing result display capture element of these two bands to genome; Meanwhile, we obtain the PCR primer of 484bp with primer pair L2/LR amplification, and increasing with primer pair L1/LR obtains the DNA fragmentation (C in Fig. 3) of 620bp.Sequencing sequence data show that the right-hand member of capture element is also inserted in genome in our mode of expection.

The primer sequence is as follows:

RF：5’-ATGTGTCTTCATCTGAAAAGCGTTC-3’(NO.14)；

LR：5’-GTACATCCTTGCTCAGAATCTCCCTC-3’(NO.15)；

R3：5’-CACTTGAGTAAAATTTTTGAGTACTTTTTACACC-3’(NO.10)；

ER:5’-CACATACCGGCTACGTTGCTAAC-3’(NO.16)；

L1：5’-GGTTTGGTAATAGCAAGGGAAAATAGAATG-3’(NO.11)；

L2：5’-GATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCC-3’(NO.12)；

4. enhancer sequence clone

For insertion point sequence information, download from NCBI the sequence that zebra fish genome is positioned at insertion point upstream and the common 99kb in downstream, download Qing Medaka, the sequence of brave filefish correspondence position simultaneously; Above three groups of sequences are uploaded to mVISTA, carry out the prediction of potential enhancer sequence.

Genome sequence in zebra fish, brave filefish and killifish between rhcga and kif7 gene is compared genomics analysis by us, utilize mVISTA software, we are at the chromosomal region (Zv9 of zebra fish genome 90kb, karyomit(e) 7:15189000-15279000) obtain the non-coding element of 4 high conservatives (sequence length is greater than 100bp and has the consistence of >75%), called after CNE1 respectively, CNE2, CNE3 and CNE4 (Fig. 4).

At prediction non-coding sequence two ends design primer, with zebra fish genome for template, carry out pcr amplification, the primer sequence is as follows:

CNE1-F：5’-CAATCTAGAGCCCACAGATCTGCACTTG-3’(NO.17)；

CNE1-R：5’-GGCTCGAGATTATACCCAAGCAACAACAGG-3’(NO.18)；

CNE2-F：5’-CAATCTAGACTGCGTCAAACTATAGAAAACTGG-3’(NO.19)；

CNE2-R：5’-GGCTCGAGAATCATTTATATCTTCCAAACCAGTAAG-3’(NO.20)；

CNE3-F：5’-CAATCTAGAATCCCAATCCCAGGCTTTTC-3’(NO.21)；

CNE3-R：5’-GGCTCGAGTCATCTGTGGTCATAGCAGC-3’(NO.22)；

CNE4-F：5’-CAATCTAGAGTGAGAGGCGACAGCGTGAG-3’(NO.23)；

CNE4-R：5’-GGCTCGAGGGTACAGTGTCTCTCCGAGGGCAG-3’(NO.24)。

5. enhanser activity checking

The upstream that four CNE sequences are cloned into mMTI promotor in pTME carrier is respectively formed four plasmid pTME-CNE1 by us, pTME-CNE2, pTME-CNE3 and pTME-CNE4 (A in Fig. 5); These four plasmids are expelled to the zygote of zebra fish unit cell phase respectively, we find that 9% (58/650) fetal development of having injected pTME-CNE2 plasmid occurs midbrain to during 48h, hindbrain and the special EGFP of spinal cord express the (B-d in B-c and Fig. 5 in Fig. 5, EGFP) (B-e and B-f in Fig. 5, WISH), this embryo expresses region and EGFP that we observe in pTME12 transgenic zebrafish strain expresses region basically identical (B-a and B-b in Fig. 5) at the EGFP of 48h; Injection plasmid pTME-CNE1, the embryo of pTME-CNE3 and pTME-CNE4 shows the GFP signal of general expression, may imply that these sequences have weak promoter activity, but lack enhanser activity; These results show that CNE2 is the enhancer element of a potential regulation and control mMTI promoters driven EGFP nervous tissue specifically expressing, have the nucleotide sequence shown in SEQIDNO.2.

Sequence table

<110> Inst. of Hydrobiology, Chinese Academy of Sciences

<120> zebra fish nervous tissue specific enhancer and clone thereof and application

<160>24

<210>1

<211>4881

<212>DNA

<400>

GGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGAGCAGAGGTGTAAAAAGTACTCAAAAATTTTACTCAAGTGAAAGTACAAGTACTTAGGGAAAATTTTACTCAATTAAAAGTAAAAGTATCTGGCTAGAATCTTACTTGAGTAAAAGTAAAAAAGTACTCCATTAAAATTGTACTTGAGTATTAAGGAAGTAAAAGTAAAAGCAAGAAAGAAAACTAGAGATTCTTGTTTAAGCTCATGGTAGGGATAACAGGGTAATATAACTTCGTATAGCATACATTATACGAAGTTATCGTTACCACCCACTAGCGGTCAGACTGCAGATTGCAGCACGAAACAGGAAGCTGACTCCACATGGTCACATGCTCACTGAAGTGTTGACTTCCCTGACAGCTGTGCACTTTCTAAACCGGTTTTCTCATTCATTTACAGTTCAGCCGGAATTCTTCAGCCGATGATGAAATTGCCGCACTGGTTGTTAGCAACGTAGCCGGTATGTGAATGATGAATTAGTGACGTACGACTCGTCCAACGACTATAAAGAGGGCAGGCTGTCCTCTAAGCGTCACCACGACTTCAACGTCCTGAGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCGGTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCAGGCTAAGCATGCTGATAACTTCGTATAGCATACATTATACGAAGTTATTACCCTGTTATCCCTACAAATTAAACTGGGCATCAGCGCAATTCAATTGGTTTGGTAATAGCAAGGGAAAATAGAATGAAGTGATCTCCAAAAAATAAGTACTTTTTGACTGTAAATAAAATTGTAAGGAGTAAAAAGTACTTTTTTTTCTAAAAAAATGTAATTAAGTAAAAGTAAAAGTATTGATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCCAAAAATAATACTTAAGTACAGTAATCAAGTAAAATTACTCAAGTACTTTACACCTCTGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGC；

<210>2

<211>247

<212>DNA

<400>

CTGCGTCAAACTATAGAAAAACTGGACTCAAGCAGCCGGGGGGGTTTAAGATATATTAAATTACCATGATTGGGAATTTAGGCATGGTTCAAGCCTGTTGAAGAGGCTGGGGTGTCTGAAAGTGGTGCTATTCATCTCGGGAAAAGAGGGTCAGAAGGTCGGGGAAGTTCACAGGACCTGTTCCTATTCTTATGCTAACTTACAATACAGAGTCTAATGCTTACTGGTTTGGAAGATATAAATGATT；

<210>3

<211>30

<212>DNA

<400>

ATATTCGTACGACTCGTCCAACGACTATAA；

<210>4

<211>27

<212>DNA

<400>

CGGGGTACCGGTGAAGCTGGAGCTACG；

<210>5

<211>29

<212>DNA

<400>

CCGGAATTCTTCAGCCGATGATGAAATTG；

<210>6

<211>32

<212>DNA

<400>

CATGCTTAGCCTGCCCCAGCTGGTTCTTTCCG；

<210>7

<211>16

<212>DNA

<400>

STAGNATSGNGTNCAA；

<210>8

<211>39

<212>DNA

<400>

GTACAATTTTAATGGAGTACTTTTTTACTTTTACTCAAG；

<210>9

<211>36

<212>DNA

<400>

CCAGATACTTTTACTTTTAATTGAGTAAAATTTTCC；

<210>10

<211>34

<212>DNA

<400>

CACTTGAGTAAAATTTTTGAGTACTTTTTACACC；

<210>11

<211>30

<212>DNA

<400>

GGTTTGGTAATAGCAAGGGAAAATAGAATG；

<210>12

<211>36

<212>DNA

<400>

GATTTTTAATTGTACTCAAGTAAAGTAAAAATCCCC；

<210>13

<211>36

<212>DNA

<400>

CAGTAATCAAGTAAAATTACTCAAGTACTTTACACC；

<210>14

<211>25

<212>DNA

<400>

ATGTGTCTTCATCTGAAAAGCGTTC；

<210>15

<211>26

<212>DNA

<400>

GTACATCCTTGCTCAGAATCTCCCTC；

<210>16

<211>23

<212>DNA

<400>

CACATACCGGCTACGTTGCTAAC；

<210>17

<211>28

<212>DNA

<400>

CAATCTAGAGCCCACAGATCTGCACTTG；

<210>18

<211>30

<212>DNA

<400>

GGCTCGAGATTATACCCAAGCAACAACAGG；

<210>19

<211>33

<212>DNA

<400>

CAATCTAGACTGCGTCAAACTATAGAAAACTGG；

<210>20

<211>36

<212>DNA

<400>

GGCTCGAGAATCATTTATATCTTCCAAACCAGTAAG；

<210>21

<211>29

<212>DNA

<400>

CAATCTAGAATCCCAATCCCAGGCTTTTC；

<210>22

<211>28

<212>DNA

<400>

GGCTCGAGTCATCTGTGGTCATAGCAGC；

<210>23

<211>29

<212>DNA

<400>

CAATCTAGAGTGAGAGGCGACAGCGTGAG；

<210>24

<211>32

<212>DNA

<400>

GGCTCGAGGGTACAGTGTCTCTCCGAGGGCAG。

Claims (3)

1. a zebra fish nervous tissue specific enhancer, is characterized in that:

Its sequence is the nucleotide sequence shown in SEQIDNO.2.

2., by the cloning process of zebra fish nervous tissue specific enhancer described in claim 1, it is characterized in that:

1. adopted enhanser capturing carrier

There is the nucleotide sequence shown in SEQIDNO.1, drive Green fluorescent protein fusion vector, acceptor splicing site SA and Tol2 transposon three part to form by mMT1 weak promoter;

2. the acquisition of the genetically engineered fish of the specific expressed green fluorescent protein of nervous tissue

By zebrafish embryo microinjection, green fluorescent protein fluorescent screening and in situ hybridization and slice analysis, obtain the zebra fish of nervous tissue specifically expressing fluorescence;

3. the clone of enhanser

By chromosome walking and genome sequence electronic cloning, obtain nervous tissue specific enhancer.

3., according to the application of zebra fish nervous tissue specific enhancer described in claim 1, it is characterized in that:

1. develop the genetically engineered fish of nervous tissue specifically expressing fluorescence, can be used for the research of nervous organ's regenerative process;

2. for driving any goal gene at nervous tissue specifically expressing, nervous system development is studied for investigator and treating correlative diseases provides powerful.