WO2012142106A1 - Identification and the use of krp mutants in plants - Google Patents
Identification and the use of krp mutants in plants Download PDFInfo
- Publication number
- WO2012142106A1 WO2012142106A1 PCT/US2012/033047 US2012033047W WO2012142106A1 WO 2012142106 A1 WO2012142106 A1 WO 2012142106A1 US 2012033047 W US2012033047 W US 2012033047W WO 2012142106 A1 WO2012142106 A1 WO 2012142106A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- krp
- wheat
- gene
- missense
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
- A01H6/4678—Triticum sp. [wheat]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the invention generally relates to compositions and methods for improving traits of agronomic and horticultural crops, including by increasing crop yield. More specifically, the present invention relates to compositions and methods for improving one or more agronomic or horticultural traits by disturbing one or more Kinase Inhibitor Protein (KIP) Related Proteins (KRP) in monocotyledonous and dicotyledonous plants.
- KIP Kinase Inhibitor Protein
- KRP Kinase Inhibitor Protein
- the most important trait as a target for crop improvement is yield.
- Efforts to improve crop yields by developing new plant varieties can be divided into two approaches. One is to reduce crop yield losses by breeding or engineering crop varieties with increased resistance to abiotic stress conditions such as drought, cold, or salt or to biotic stress conditions resulting from pests or disease-causing pathogens. While this approach has value, it does not provide fundamentally improved crop yield in the absence of stress conditions and in fact, such resistance may direct plant resources that otherwise would be available for increased yield in the plant.
- the second approach is to breed or engineer new crop varieties in which the basic yield capacity is increased.
- KRP proteins belong to a class of cell cycle inhibitors that bind to and inhibit cyclin/CDK kinase complexes. Mutation of conserved residues within KRP family members are expected to modify KRP's ability to function as an inhibitor of cyclin-CDK kinase complexes. Specifically, some mutations in KRP genes would lead to expression of a non- functional KRP cell cycle inhibitor or a cell cycle inhibitor with reduced activity. This loss of or reduced cyclin/CDK kinase inhibitory activity would lead to increased cyclin-CDK kinase activity in cells when normally these cells would have reduced cyclin-CDK activity.
- This loss of or reduced cyclin/CDK kinase inhibitory activity would lead to increased cell divisions in tissue where the normal wild-type KRP version is expressed.
- This increased cell division would result in positive agronomic traits such as increased yield, increased weight, size, and/or number of one or more organs, for example, increased seed size, larger plants, larger leaves, larger roots etc.
- positive agronomic traits such as increased yield, increased weight, size, and/or number of one or more organs, for example, increased seed size, larger plants, larger leaves, larger roots etc.
- KRP -related technologies see, for example, WO/2007/016319 and US20070056058, each of which is incorporated by reference in its entirety for all purposes.
- the present invention identifies new KRP genes and proteins and provides methods for their use in producing improved agronomic and horticultural plants through conventional plant breeding and/or molecular methodologies.
- the inventors of the present invention have used Targeting Induced Local Lesions in Genomes (TILLING ⁇ ) methods in plants to identify KRP mutants, for example, in monocot plants, such as plants in the Triticeae tribe (e.g., plants in the Triticum genus), and plants in the tribe of Oryzeae (e.g., plants in Oryza genus), or in dicot plants, for example, in Glycine spp.
- TILLING ⁇ Targeting Induced Local Lesions in Genomes
- the organ is seed, leaf, branch, root, shoot, stigma, ovule, pollen, seed pods, seed heads, or tiller.
- the present invention provides methods for increasing plant seed weight, seed size, seed number and/or yield.
- This invention describes the search for mutations in plant KRPs that are expressed in cells within the developing seed.
- the strategy was to identify KRP family member(s) with seed expression and TILL® for mutants in these KRPs.
- Certain mutants that affect KRP function can then be characterized for positive agronomical and horticultural traits such as increased yields, early emergence, accelerated growth etc.
- this same methodology can be used for KRPs expressed in other tissues such as leaves or stalks since increased cell divisions in these other tissues specific to the particular KRP expression pattern could also lead to positive agronomic traits.
- KRP family members in agriculturally, horticulturally and/or industrially important plant species and their expression patterns in developing seed have yet to be studied.
- the inventors' strategy was to identify KRPs that are expressed in the developing seed. KRPs with expression pattern during development in a tissue specific manner are identified.
- the rice KRP4 gene (OsKRP4) showed almost exclusive expression in the developing seed. Equivalents to this sequence in rice and other plant species are also identified.
- the present invention provides mutated KRP genes compared to a wild type KRP having nucleic acid sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 60-86, 100-107, 1 1 1-128, fragments and variations derived from thereof, which encode a KRP gene.
- the KRP has an expression pattern in a tissue specific manner during development.
- the expression is embryonic specific, pollen specific, or seed specific.
- the present invention provides mutated KRP genes compared to a wild type KRP comprising a sequence comprising a nucleic acid sequence that shares at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity to SEQ ID NOs: 60-86, 100-107, 1 1 1 -128, 138-139, 141-142, and 144-145.
- the present invention provides mutated KRP genes compared to a wild type KRP encoding an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity to SEQ ID NO: 87-99, 108-1 10, 129-137, 140, 143, and 146.
- the present invention provides mutants in wheat (Ta) KRP1A, KRP1B, KRP1D, KRP2A, KRP2B, KRP2D, KRP4B, KRP4D, KRP5A, KRP5D, KRP6A, KRP6B, KRP6D.
- TILLING ⁇ the gene appears to be completely missing from the hexaploid wheat genome, although it is still present in the tetraploid genome.
- KRP5B there appears to be one missing nucleotide in the gene, which would shift the translational frame and produce a predicted truncation a few amino acids further on.
- the present invention in another aspect provides plant cells, plant parts, tissue culture, or whole plants comprising one or more disrupted KRP genes as described herein.
- the present invention provides plant cells, plant parts, tissue culture or whole plants comprising at least one KRP gene, wherein the genome of the plant has one or more copies of the gene, and wherein the function of one or more copies of the KRP gene is disrupted.
- the plant is a monocot. In some embodiments, the monocot is a species in the Triticeae tribe or the Oryzeae tribe. In some embodiments, the plant in the Triticeae tribe is a plant in the Triticum genus, and wherein the plant in the Oryzeae tribe is a plant in the Oryza genus.
- the plant in the Triticum genus is wheat, and wherein the plant in the Oryza genus is rice.
- the wheat plant is tetraploid or hexaploid.
- the plant is a dicot. In some embodiments, the plant is a species in the Fabaceae family, for example, Glycine spp., such as soybean.
- the KRP in the wheat is TaKRPl, TaKRP2, TaKRP4, TaKRP5, TaKRP6, for example, SEQ ID NOs. 60-86, 138-139, 141-142, 144-145 or functional variants thereof
- the KRP in the rice is OsKRPl, OsKRP2, OsKRP4, or OsKRP5, for example, SEQ ID NOs. 100- 107, or functional variants thereof
- the KRP in the Glycine spp is any suitable for example, SEQ ID NOs. 100- 107, or functional variants thereof.
- the KRP is TaKRPlA, TaKRPlB, TaKRP2A, TaKRP2B, TaKRP4A, TaKRP4B, TaKRP5A, TaKRPSB, TaKRP6A or TaKRP6B.
- the KRP is TaKRPlA, TaKRPlB, TaKRPID, TaKRP2A, TaKRP2B, TaKRP2D, TaKRP4A, TaKRP4B, TaKRP4D, TaKRP5A, TaKRP5B, TaKRP5D, TaKRP6A, TaKRP6B, or TaKRP6D.
- the KRP genes function is disrupted by nucleotide substitution, deletion, insertion, homologous recombination, T-DNA, transposon, double strand oligonucleotide, antisense oligonucleotide, inverted repeat, or combination thereof.
- the disrupted KRP in the plant cell, plant part, tissue culture or whole plant comprises one or more mutations selected from any one of mutations listed in Tables 2 - 12, 25, 28, 29 - 37 for a particular KRP gene.
- the present invention provides methods for increasing weight, size, and/or number of one or more organs, for example, for increasing seed weight, seed size, seed number and/or yield in a plant comprising disrupting one or more KRPs in the plant.
- the plant is a dicotyledon plant or a monocotyledon plant.
- the plant can be a plant selected from the Triticeae tribe, the Oryzeae tribe, or the Fabaceae family, for example, wheat, rice, and soybean.
- methods of disrupting a gene function include but are not limited to mutagenesis (e.g., chemical mutagenesis, radiation mutagenesis, transposon mutagenesis, insertional mutagenesis, signature tagged mutagenesis, site-directed mutagenesis, and natural mutagenesis), antisense, knock-outs, and/or RNA interference.
- mutagenesis e.g., chemical mutagenesis, radiation mutagenesis, transposon mutagenesis, insertional mutagenesis, signature tagged mutagenesis, site-directed mutagenesis, and natural mutagenesis
- antisense, knock-outs and/or RNA interference.
- the plant with increased weight, size, and/or number of one or more organs for example, a plant with increased seed weight, seed size, seed number and/or yield is not a genetically modified organism, or a transgenic plant.
- the disruption of the KRP in the genome of the plant is simply due to natural mutation, or mutations induced by chemical
- mutations described in the Tables 2 - 12, 25, 28, 29 - 37 can be integrated into species closely related to the plants in the Triticeae tribe, the Oryzeae tribe, the Fabaceae family, or plants closely related to wheat, rice, or soybean.
- amino acids in conserved domains or sites compared to KRP orthologs in other species can be substituted or deleted to make mutants with reduced or abolished activity, and/or mutants that lead to loss-of-function (e.g., protein instability).
- one or more KRPs in a plant are knocked down or knocked out by one or more methods available to one skilled in the art.
- one or more copies of one or more KRP genes are disrupted.
- a KRP gene e.g., KRP1A, KRP IB; KRP 2 A, KRP2B; KRP4A, KRP4B; KRP5A, KRP5B; and KRP6A, KRP6B
- KRP1A, KRP IB KRP ID
- KRP2A, KRP2B KRP 2D
- KRP 4 A, KRP4B, KRP4D KRP5A, KRP5B, KRP5D
- KRP 6 ⁇ , KRP6B, KRP6D KRP6D
- the present invention also provides a plant having increased weight, size, and/or number of one or more organs, for example, a plant with increased seed size, seed number, and/or seed yield compared to a wild type reference plant, wherein the plant has one or more mutations in one or more KRP genes.
- said plant is a monocot plant.
- said monocot plant is a plant from the Triticeae tribe or the Oryzeae tribe.
- said plant is a wheat or a rice plant.
- said plant is a dicot plant.
- said dicot plant is from the Fabaceae family, such as a soybean plant.
- the present invention further provides a seed, a fruit, a plant cell or a plant part of the transgenic plants as described herein.
- the present invention provides a pollen of the plant, an ovule of the plant, a genetically related plant population comprising the plant, a tissue culture of regenerable cells of the plant.
- the regenerable cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, fruits, seeds, flowers, cotyledons, and/or hypocotyls.
- the present invention also provides methods of decreasing the activity of one or more KRP proteins in a plant cell, plant part, tissue culture or whole plant comprising contacting the plant cell, plant part, tissue culture or whole plant with an inhibitory nucleic acid having complementarity to a gene encoding said KRP protein.
- the plant is a plant from the Triticeae tribe or the Oryzeae tribe.
- said plant is a wheat or a rice plant.
- said plant is a dicot plant.
- said dicot plant is from the Fabaceae family, such as a soybean plant.
- the present invention also provides methods of breeding a crop species having increased weight, size, and/or number of one or more organs, for example, a crop species with increased seed size, seed number, seed weight and/or seed yield compared to a wild type reference plant, comprising incorporating the genetic materials of a plant with disrupted KRP(s) into a recipient plant.
- such methods comprise making a cross between a Triticum sp. mutant with one or more mutations listed in Tables 2 - 12 with a second Triticum sp. to produce an Fl plant, or with a species in the Triticeae tribe which can intercross with said first Triticum sp.
- the method may further comprise backcrossing the Fl plant to the second Triticum sp. or species in the Triticeae tribe; and repeating the backcrossing step to generate an near isogenic line, wherein the one or more mutations are integrated into the genome of said second Triticum sp. or the species in the Triticeae tribe; wherein the near isogenic line derived from the second Triticum sp.
- Triticeae tribe with the integrated mutations has altered weight, size, and/or number of one or more organs, for example, altered seed weight, seed size, seed number, and/or seed yield.
- such methods can be facilitated by molecular markers or TILLING ⁇ .
- such methods comprise making a cross between an Oryza sp. mutant with one or more mutations listed in Table 25 with a second Oryza sp. to produce an Fl plant, or with a species in the Oryzeae tribe which can intercross with said Oryza sp.
- the method may further comprise backcrossing the Fl plant to the second Oryza sp. or species in the Oryzeae tribe; and repeating the backcrossing step to generate an near isogenic line, wherein the one or more mutations are integrated into the genome of said second Oryza sp. or the species in the Oryzeae tribe; wherein the near isogenic line derived from the second Oryza sp.
- the Oryzeae tribe with the integrated mutations has altered weight, size, and/or number of one or more organs, for example, altered seed weight, seed size, seed number, and/or seed yield.
- such methods can be facilitated by molecular markers or TILLING®.
- such methods comprise making a cross between a Glycine sp. mutant with one or more mutations listed in Tables 29 - 37 with a second Glycine sp. to produce an Fl plant, or with a species in the Fabaceae family which can intercross with said first Glycine sp.
- the method may further comprise backcrossing the Fl plant to the second Glycine sp. or species in the Fabaceae family; and repeating the backcrossing step to generate an near isogenic line, wherein the one or more mutations are integrated into the genome of said second Glycine sp. or species in the Fabaceae family; wherein the near isogenic line derived from the second Glycine sp.
- Fabaceae family with the integrated mutations has altered weight, size, and/or number of one or more organs, for example, altered seed weight, seed size, seed number, and/or seed yield.
- such methods can be facilitated by molecular markers or TILLING ⁇ .
- the present invention provides an isolated nucleic acid sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 138, 139, 141, 142, 144, and 145, and fragments and variations derived from thereof, which encode a wheat KRP gene.
- the present invention provides an isolated polynucleotide encoding plant KRP protein, comprising a nucleic acid sequence that shares at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1 %, at least 99.2%, at least 99.3%, at leas 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity to SEQ ID NOs: 138, 139, 141, 142, 144, and 145.
- the present invention further provides an isolated amino acid sequence (e.g., a peptide, polypeptide and the like) comprising a sequence selected from the group consisting of SEQ ID NOs: 140. 143, and 146 and fragments and variations derived from thereof, which form a KRP protein.
- an isolated amino acid sequence e.g., a peptide, polypeptide and the like
- SEQ ID NOs: 140. 143, and 146 sequence selected from the group consisting of SEQ ID NOs: 140. 143, and 146 and fragments and variations derived from thereof, which form a KRP protein.
- the present invention provides an isolated amino acid sequence which forms a protein that shares an amino acid sequence having at least 90%>, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1 %, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identity to SEQ ID NOs: 140,
- isolated polynucleotides of the present invention comprise a sequence selected from the group consisting of: (a) sequences recited in SEQ ID NOs: 138, 139, 141 , 142, 144, and 145, or portions thereof; (b) complements of the sequences recited in SEQ ID NOs: 138, 139, 141 , 142, 144, and 145, or portions thereof; (c) reverse complements of the sequences recited in SEQ ID NOs: 138, 139, 141 , 142, 144, and 145 or portions thereof; (d) reverse sequences of the sequences recited in SEQ ID NOs: 138, 139, 141 , 142,
- the present invention also provides a chimeric gene comprising the isolated nucleic acid sequence of any one of the polynucleotides described above operably linked to suitable regulatory sequences.
- the present invention also provides recombinant constructs comprising the chimeric gene as described above.
- the present invention further provides interfering RNA (RNAi) constructs based on nucleic acid sequences of the present invention.
- the RNAi constructs are can be transformed into a wheat plant to down-regulate one or more KRPs.
- the RNAi construct can be, but is not limited to antisense oligonucleotide construct, double-strand oligonucleotide construct, siRNA construct, or inverted repeat construct.
- the RNAi constructs comprise a plant promoter, such as a constitutive promoter, an inducible promoter, or a tissue-specific promoter. In some embodiments, the promoter is embryonic specific or seed specific.
- Figure 1A depicts an amplification plot of fluorescence signal versus cycle number for a wheat genomic sample homozygous for the wild type allele of wheat KRP4B.
- the upper curve represents the amplification with the wild type probe, while the bottom curve represents the amplification with the mutant probe.
- Figure IB depicts an amplification plot of fluorescence signal versus cycle number for a wheat genomic sample homozygous for the mutant allele of wheat KRP4B.
- the upper curve represents the amplification with the mutant probe, while the bottom curve represents the amplification with the wild type probe.
- Figure 1C depicts an amplification plot of fluorescence signal versus cycle number for a wheat genomic sample heterozygous for the mutant allele of wheat KRP4B.
- Figure ID depicts a sequence chromatogram showing the two nucleotides detected in a wheat genomic sample heterozygous for the mutant allele of wheat KRP4B.
- Figure 2 depicts an allelic discrimination plot for samples in a KRP4B allelic discrimination assay. Samples homozygous for the wild type KRP4B allele are in blue, samples homozygous for the mutant KRP4B P109L allele are in red and samples heterozygous for the mutant KRP4B P109L allele are in green. Black squares represent no template controls and black x's are undetermined samples.
- Figure 3 depicts the C-terminal amino acid sequences that include the cyclin and cyclin-dependent kinase (CD ) binding domains for KRP1A, 2D, 4A and 5 A. Nonsense and Type I severe missense TILLING® mutations tested in the in vitro kinase assay are indicated by asterisks or mutant amino acids, respectively, below the wild-type amino acids.
- CD cyclin and cyclin-dependent kinase
- Figure 4 depicts an autoradiograph of kinase assays using ZmCyclinD4/CD A;l kinase complex, indicated wild-type Triticum aestivum KRP and indicated Triticum aestivum KRP TILLING® mutant.
- Histone HI HH1 was used as the substrate for phosphorylation.
- Lanes 1 and 18 kinase complex without any wild-type or KRP TILLING® mutant.
- Lanes 2 and 19 only kinase complex in buffer.
- Lanes 3, 4, 5 kinase complex and wild-type TaKRPlA at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 6, 7, 8 kinase complex and mutant TaKRPlA P232L at 0.5, 0.25 and 0.1 ⁇ g, respectively
- Lanes 9, 10, 1 1 kinase complex and mutant TaKRPlA G236S at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 12, 13, 14 kinase complex and mutant TaKRPlA W240* at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 15, 16, 17 kinase complex and wild-type TaKRP2D at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 20, 21 , 22 kinase complex and mutant TaKRP2D P228S at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 23, 24, 25 kinase complex and mutant TaKRP2D D254N at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 26, 27, 28 kinase complex and mutant TaKRP2D R257C at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 29, 30 kinase complex and wild-type TaKRP4A at 0.25 and 0.1 ⁇ g, respectively.
- Lanes 31 , 32, 33 kinase complex and mutant TaKRP4A W186* at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Figure 5 depicts an autoradiograph of kinase assays using ZmCyclinD4/CDKA; l kinase complex, indicated wild-type Triticum aestivum KRP and indicated Triticum aestivum KRP TILLING® mutant. Histone HI (HH1) was used as the substrate for phosphorylation. Lane 1 : kinase complex without any wild-type or KRP TILLING® mutant. Lanes 2 and 18: only kinase complex in buffer. Lanes 3, 4, 5 : kinase complex and wild-type TaKRP2D at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 6, 7, 8 kinase complex and mutant TaKRP2D A238V at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 9, 10, 1 1 kinase complex and mutant TaKRP2D A239T at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 12, 13, 14 kinase complex and wild-type TaKRP5A at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 15, 16, 17 kinase complex and mutant TaKRP5A W199* at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Figure 6A depicts an autoradiograph of repeat kinase assays using ZmCyclinD4/CDKA; l kinase complex, indicated wild-type Triticum aestivum KRP and indicated Triticum aestivum KRP TILLING® mutant. Histone HI (HH1) was used as the substrate for phosphorylation. Lane 1 : kinase complex without any wild-type or KRP TILLING® mutant. Lane 2: only kinase complex in buffer. Lanes 3, 4, 5: kinase complex and wild-type TaKRPlA at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 6, 7, 8 kinase complex and mutant TaKRP lA W240* at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Lanes 9, 10 kinase complex and wild-type TaKRP4A at 0.25 and 0.1 ⁇ g, respectively.
- Lanes 1 1, 12, 13 kinase complex and mutant TaKRP4A W186* at 0.5, 0.25 and 0.1 ⁇ g, respectively.
- Figure 6B depicts an autoradiograph of kinase assays using ZmCyclinD4/CDKA; 1 kinase complex and ZmKRP2 W250*.
- ZmKRP2 W250* is the mutant corn krp2 protein with an equivalent premature stop codon very close to the end of the protein.
- Lanes 1 and 2 kinase complex and mutant ZmKRP2 W250* at 0.3 and 3 ⁇ g, respectively.
- Figure 7 depicts average grain yield (lbs/ac) of spring wheat KRP TILLING® mutants and check cultivar Express. Bozeman, MT, Fort Collins, CO. *, ** stands for significant difference between mutant and check cultivar at the 0.05 and 0.01 probability levels, respectively.
- Figure 8 depicts average grain yield (lbs/ac) of wild type (WT) and homozygous (Homo) zygotic groups for each spring wheat KRP TILLING® mutant and for check cultivar 'Express' .
- Figure 9 depicts average grain yield (lbs/ac) of wild type (WT) and homozygous (Homo) zygotic groups within sister Fl lines ' 148E04' and 149E05'from spring wheat KRP TILLING® mutant KRP4D Stop. Bozeman, MT, Fort Collins, CO.
- Figure 10 depicts a phylogenetic tree of rice (Os), corn (Zm) and wheat (Ta) KRPs.
- Figure 11 depicts an alignment of rice (Os), corn (Zm) and wheat (Ta) KRP proteins.
- Figure 12 depicts an alignment of soy (Gm), Arabidopsis (At) and Brassica napus (Bn) KRP proteins.
- the term "plant” refers to any living organism belonging to the kingdom Plantae (i.e., any genus/species in the Plant Kingdom). This includes familiar organisms such as but not limited to trees, herbs, bushes, grasses, vines, ferns, mosses and green algae. The term refers to both monocotyledonous plants, also called monocots, and dicotyledonous plants, also called dicots.
- plants in the Triticeae tribe e.g., plants in the Triticum genus
- plants in the tribe of Oryzeae e.g., plants in Oryza genus
- plants in the Andropogoneae tribe e.g., plants in the Zea genus, such has corn.
- plant examples include, potatoes, roses, apple trees, sunflowers, bananas, tomatoes, opo, pumpkins, squash, lettuce, cabbage, oak trees, guzmania, geraniums, hibiscus, clematis, poinsettias, sugarcane, taro, duck weed, pine trees, Kentucky blue grass, zoysia, coconut trees, brassica leafy vegetables (e.g. broccoli, broccoli raab, Brussels sprouts, cabbage, Chinese cabbage (Bok Choy and Napa), cauliflower, cavalo, collards, kale, kohlrabi, mustard greens, rape greens, and other brassica leafy vegetable crops), bulb vegetables (e.g.
- citrus fruits e.g. grapefruit, lemon, lime, orange, tangerine, citrus hybrids, pummelo, and other citrus fruit crops
- cucurbit vegetables e.g. cucumber, citron melon, edible gourds, gherkin, muskmelons (including hybrids and/or cultivars of cucumis melons), water-melon, cantaloupe, and other cucurbit vegetable crops
- fruiting vegetables including eggplant, ground cherry, pepino, pepper, tomato, tomatillo, and other fruiting vegetable crops
- grape, leafy vegetables e.g. romaine
- root/tuber and corm vegetables e.g.
- berries e.g., tomatoes, barberries, currants, elderberries, gooseberries, honeysuckles, mayapples, nannyberries, Oregon-grapes, see-buckthorns, hackberries, bearberries, lingonberries, strawberries, sea grapes, lackberries, cloudberries, loganberries, raspberries, salmonberries, thimbleberries, and wineberries
- cereal crops e.g., corn, rice, wheat, barley, sorghum, millets, oats, ryes, triticales, buckwheats, fonio, quinoa, oil palm), pome fruit (e.g., apples, pears), stone fruits (e.g., coffees, jujubes, mangos, olives, coconuts, oil palms, pistachios, almonds, apricots, cherries, damsons, nectarines, peaches and plums), vine (e.g.,
- plant part refers to any part of a plant including but not limited to the shoot, root, stem, seeds, stipules, leaves, petals, flowers, ovules, bracts, branches, petioles, internodes, bark, pubescence, tillers, rhizomes, fronds, blades, pollen, stamen, and the like.
- the two main parts of plants grown in some sort of media, such as soil, are often referred to as the "above-ground” part, also often referred to as the "shoots”, and the "below-ground” part, also often referred to as the "roots”.
- a or “an” refers to one or more of that entity; for example, "a gene” refers to one or more genes or at least one gene. As such, the terms “a” (or “an”), “one or more” and “at least one” are used interchangeably herein.
- reference to “an element” by the indefinite article “a” or “an” does not exclude the possibility that more than one of the elements are present, unless the context clearly requires that there is one and only one of the elements.
- nucleic acid refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers to the primary structure of the molecule, and thus includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modified nucleic acids such as methylated and/or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like. The terms “nucleic acid” and “nucleotide sequence” are used interchangeably.
- polypeptide As used herein, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. These terms also include proteins that are post-translationally modified through reactions that include glycosylation, acetylation and phosphorylation.
- homologous or “homologue” or “ortholog” is known in the art and refers to related sequences that share a common ancestor or family member and are determined based on the degree of sequence identity.
- the terms “homology”, “homologous”, “substantially similar” and “corresponding substantially” are used interchangeably herein. They refer to nucleic acid fragments wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype.
- a functional relationship may be indicated in any one of a number of ways, including, but not limited to: (a) degree of sequence identity and/or (b) the same or similar biological function. Preferably, both (a) and (b) are indicated.
- the degree of sequence identity may vary, but in one embodiment, is at least 50% (when using standard sequence alignment programs known in the art), at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least about 91 %, at least about 92%o, at least about 93%, at least about 94%, at least about 95%o, at least about 96%, at least about 97%., at least about 98%>, or at least 98.5%, or at least about 99%, or at least 99.5%>, or at least 99.8%o, or at least 99.9%.
- Homology can be determined using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1 987) Supplement 30, section 7.71 8, Table 7.71.
- Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, U.K.), ALIGN Plus (Scientific and Educational Software, Pennsylvania) and AlignX (Vector NTI, Invitrogen, Carlsbad, CA).
- Another alignment program is Sequencher (Gene Codes, Ann Arbor, Michigan), using default parameters.
- nucleotide change refers to, e.g., nucleotide substitution, deletion, and/or insertion, as is well understood in the art. For example, mutations contain alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded protein or how the proteins are made.
- protein modification refers to, e.g., amino acid substitution, amino acid modification, deletion, and/or insertion, as is well understood in the art
- nucleic acid or an amino acid derived from an origin or source may have all kinds of nucleotide changes or protein modification as defined elsewhere herein.
- the term "at least a portion” or “fragment” of a nucleic acid or polypeptide means a portion having the minimal size characteristics of such sequences, or any larger fragment of the full length molecule, up to and including the full length molecule.
- a portion of a nucleic acid may be 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides, 32 nucleotides, 34 nucleotides, 36 nucleotides, 38 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, and so on, going up to the full length nucleic acid.
- a portion of a polypeptide may be 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, and so on, going up to the full length polypeptide.
- the length of the portion to be used will depend on the particular application.
- a portion of a nucleic acid useful as hybridization probe may be as short as 12 nucleotides; in one embodiment, it is 20 nucleotides.
- a portion of a polypeptide useful as an epitope may be as short as 4 amino acids.
- a portion of a polypeptide that performs the function of the full-length polypeptide would generally be longer than 4 amino acids.
- sequence identity in the context of two nucleic acid or - polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window.
- sequence identity or “identity” in the context of two nucleic acid or - polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window.
- Sequences which differ by such conservative substitutions are said to have "sequence similarity" or "similarity.” Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4: 1 1-17 (1988).
- the term "substantially complementary” means that two nucleic acid sequences have at least about 65%, preferably about 70% or 75%, more preferably about 80% or 85%, even more preferably 90% or 95%, and most preferably about 98% or 99%, sequence complementarities to each other.
- primers and probes must exhibit sufficient complementarity to their template and target nucleic acid, respectively, to hybridize under stringent conditions. Therefore, the primer and probe sequences need not reflect the exact complementary sequence of the binding region on the template and degenerate primers can be used.
- a non-complementary nucleotide fragment may be attached to the 5'- end of the primer, with the remainder of the primer sequence being complementary to the strand.
- non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer has sufficient complementarity with the sequence of one of the strands to be amplified to hybridize therewith, and to thereby form a duplex structure which can be extended by polymerizing means.
- the non-complementary nucleotide sequences of the primers may include restriction enzyme sites. Appending a restriction enzyme site to the end(s) of the target sequence would be particularly helpful for cloning of the target sequence.
- a substantially complementary primer sequence is one that has sufficient sequence complementarity to the amplification template to result in primer binding and second-strand synthesis. The skilled person is familiar with the requirements of primers to have sufficient sequence complementarity to the amplification template.
- polynucleotide As used herein, the terms “polynucleotide”, “polynucleotide sequence”, “nucleic acid sequence”, “nucleic acid fragment”, and “isolated nucleic acid fragment” are used interchangeably herein. These terms encompass nucleotide sequences and the like.
- a polynucleotide may be a polymer of RNA or DNA that is single- or double-stranded, that optionally contains synthetic, non-natural or altered nucleotide bases.
- a polynucleotide in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
- Nucleotides are referred to by a single letter designation as follows: "A” for adenylate or deoxyadenylate (for RNA or DNA, respectively), “C” for cytidylate or deoxycytidylate, “G” for guanylate or deoxyguanylate, “U” for uridylate, “T” for deoxythymidylate, “R” for purines (A or G), “Y” for pyrimidines (C or T), "K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide.
- A for adenylate or deoxyadenylate (for RNA or DNA, respectively)
- C for cytidylate or deoxycytidylate
- G for guanylate or deoxyguanylate
- U for uridylate
- T for deoxythymidylate
- R for purines
- a biologically active variant or “functional variant” with respect to a protein refers to an amino acid sequence that is altered by one or more amino acids with respect to a reference sequence, while still maintains substantial biological activity of the reference sequence.
- the variant can have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine.
- a variant can have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan.
- Analogous minor variations can also include amino acid deletion or insertion, or both. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without eliminating biological or immunological activity can be found using computer programs well known in the art, for example, DNASTAR software.
- primer refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach, thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH.
- the (amplification) primer is preferably single stranded for maximum efficiency in amplification.
- the primer is an oligodeoxyribonucleotide.
- the primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization.
- a pair of bi-directional primers consists of one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
- stringency or “stringent hybridization conditions” refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimized to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence.
- the terms as used include reference to conditions under which a probe or primer will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background).
- Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
- the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe or primer.
- stringent conditions will be those in which the salt concentration is less than about 1.0 M Na + ion, typically about 0.01 to 1.0 M Na + ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60° C for long probes or primers (e.g. greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary low stringent conditions or “conditions of reduced stringency” include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37° C and a wash in 2*SSC at 40° C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1 % SDS at 37° C, and a wash in O. l xSSC at 60° C. Hybridization procedures are well known in the art and are described by e.g. Ausubel et al, 1998 and Sambrook et al., 2001.
- coding sequence refers to a DNA sequence that codes for a specific amino acid sequence.
- regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3 ' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence.
- regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
- promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
- the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
- an “enhancer” is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.
- promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity.
- a "plant promoter” is a promoter capable of initiating transcription in plant cells whether or not its origin is a plant cell, e.g. it is well known that Agrobacterium promoters are functional in plant cells.
- plant promoters include promoter DNA obtained from plants, plant viruses and bacteria such as Agrobacterium and Bradyrhizobium bacteria.
- a plant promoter can be a constitutive promoter or a non-constitutive promoter.
- a "constitutive promoter” is a promoter which is active under most conditions and/or during most development stages. There are several advantages to using constitutive promoters in expression vectors used in plant biotechnology, such as: high level of production of proteins used to select transgenic cells or plants; high level of expression of reporter proteins or scorable markers, allowing easy detection and quantification; high level of production of a transcription factor that is part of a regulatory transcription system; production of compounds that requires ubiquitous activity in the plant; and production of compounds that are required during all stages of plant development.
- Non-limiting exemplary constitutive promoters include, CaMV 35 S promoter, opine promoters, ubiquitin promoter, actin promoter, alcohol dehydrogenase promoter, etc.
- tissue specific, tissue preferred, cell type specific, cell type preferred, inducible promoters, and promoters under development control are non-constitutive promoters.
- promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as stems, leaves, roots, or seeds.
- inducible or “repressible” promoter is a promoter which is under chemical or environmental factors control.
- environmental conditions that may effect transcription by inducible promoters include anaerobic conditions, or certain chemicals, or the presence of light.
- tissue specific promoter is a promoter that initiates transcription only in certain tissues. Unlike constitutive expression of genes, tissue-specific expression is the result of several interacting levels of gene regulation. As such, in the art sometimes it is preferable to use promoters from homologous or closely related plant species to achieve efficient and reliable expression of transgenes in particular tissues. This is one of the main reasons for the large amount of tissue-specific promoters isolated from particular plants and tissues found in both scientific and patent literature.
- Non-limiting tissue specific promoters include, beta-amylase gene or barley hordein gene promoters (for seed gene expression), tomato pz7 and pzl 30 gene promoters (for ovary gene expression), tobacco RD2 gene promoter (for root gene expression), banana TRX promoter and melon actin promoter (for fruit gene expression), and embryo specific promoters, e.g., a promoter associated with an amino acid permease gene (AAP1), an oleate 12-hydroxylase:desaturase gene from Lesquerella fendleri (LFAH12), an 2S2 albumin gene (2S2), a fatty acid elongase gene (FAE1), or a leafy cotyledon gene (LEC2).
- AAP1 amino acid permease gene
- LFAH12 oleate 12-hydroxylase:desaturase gene from Lesquerella fendleri
- 2S2 albumin gene 2S2 albumin gene
- FAE1 fatty acid
- tissue preferred promoter is a promoter that initiates transcription mostly, but not necessarily entirely or solely in certain tissues.
- a "cell type specific" promoter is a promoter that primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots, leaves, stalk cells, and stem cells.
- a "cell type preferred" promoter is a promoter that primarily drives expression mostly, but not necessarily entirely or solely in certain cell types in one or more organs, for example, vascular cells in roots, leaves, stalk cells, and stem cells.
- the "3' non-coding sequences" or “3 ' untranslated regions” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 f end of the mRNA precursor.
- the use of different 3 ' non-coding sequences is exemplified by Ingelbrecht, I. L., et al. (1989) Plant Cell 1 :671 -680.
- RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript. An RNA transcript is referred to as the mature RNA when it is an RNA sequence derived from post-transcriptional processing of the primary transcript.
- Messenger RNA (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell.
- cDNA refers to a DNA that is complementary to and synthesized from an mRNA template using the enzyme reverse transcriptase.
- RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro.
- Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA, and that blocks the expression of a target gene (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
- RNA refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes.
- complement and “reverse complement” are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other.
- a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
- the complementary RNA regions of the invention can be operably linked, either directly or indirectly, 5' to the target mRNA, or 3' to the target mRNA, or within the target mRNA, or a first complementary region is 5' and its complement is 3' to the target mRNA.
- the term "recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
- a recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature.
- a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Such construct may be used by itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art.
- a plasmid vector can be used.
- the skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the invention.
- the skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al, (1985) EMBO J. 4:241 1 -2418; De Almeida et al, (1989) Mol. Gen. Genetics 218:78-86), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern.
- Vectors can be plasmids, viruses, bacteriophages, pro-viruses, phagemids, transposons, artificial chromosomes, and the like, that replicate autonomously or can integrate into a chromosome of a host cell.
- a vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that is not autonomously replicating.
- expression refers to the production of a functional end- product e.g., an mRNA or a protein (precursor or mature).
- plant selectable or screenable marker refers to a genetic marker functional in a plant cell.
- a selectable marker allows cells containing and expressing that marker to grow under conditions unfavorable to growth of cells not expressing that marker.
- a screenable marker facilitates identification of cells which express that marker.
- the term "inbred”, “inbred plant” is used in the context of the present invention. This also includes any single gene conversions of that inbred.
- the term single allele converted plant as used herein refers to those plants which are developed by a plant breeding technique called backcrossing wherein essentially all of the desired morphological and physiological characteristics of an inbred are recovered in addition to the single allele transferred into the inbred via the backcrossing technique.
- sample includes a sample from a plant, a plant part, a plant cell, or from a transmission vector, or a soil, water or air sample.
- the term "offspring” refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof.
- an offspring plant may be obtained by cloning or selfing of a parent plant or by crossing two parent plants and include selfmgs as well as the Fl or F2 or still further generations.
- An Fl is a first-generation offspring produced from parents at least one of which is used for the first time as donor of a trait, while offspring of second generation (F2) or subsequent generations (F3, F4, etc.) are specimens produced from selfmgs of Fl 's, F2's etc.
- An F l may thus be (and usually is) a hybrid resulting from a cross between two true breeding parents (true-breeding is homozygous for a trait), while an F2 may be (and usually is) an offspring resulting from self-pollination of said Fl hybrids.
- cross refers to the process by which the pollen of one flower on one plant is applied (artificially or naturally) to the ovule (stigma) of a flower on another plant.
- the term "cultivar” refers to a variety, strain or race of plant that has been produced by horticultural or agronomic 'techniques and is not normally found in wild populations.
- Dicotyledon and “dicot” refer to a flowering plant having an embryo containing two seed halves or cotyledons.
- Dicotyledon plants at least include the Eudicot, Magnoliid, Amborella, Nymphaeales, Austrobaileyales, Chloranthales, and Ceratophyllum groups.
- Eudicots include these clades: Ranunculales, sabiales, Proteales, Trochodendrales, Buxales, and Core Eudicots (e.g., Berberidopsidales, Dilleniales, Gunnerales, Caryophyllales, Santalahs, Saxifragales, Vitales, Rosids and Asterids).
- Non- limiting examples of dicotyledon plants include tobacco, tomato, pea, alfalfa, clover, bean, soybean, peanut, members of the Brassicaceae family (e.g., camelina, Canola, oilseed rape, etc.), amaranth, sunflower, sugarbeet, cotton, Oaks, maples, roses, mints, squashes, daisies, nuts; cacti, violets and buttercups.
- Non-limiting examples of monocotyledon plants include lilies, orchids, corn, rice, wheat, barley, sorghum, millets, oats, ryes, triticales, buckwheats, fonio, quinoa, grasses, such as tall fescue, goat grass, and Kentucky bluegrass; grains, such as wheat, oats and barley, irises, onions, palms.
- genes refers to any segment of DNA associated with a biological function.
- genes include, but are not limited to, coding sequences and/or the regulatory sequences required for their expression.
- Genes can also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins.
- Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
- the term "genotype” refers to the genetic makeup of an individual cell, cell culture, tissue, organism (e.g., a plant), or group of organisms.
- the term "hemizygous” refers to a cell, tissue or organism in which a gene is present only once in a genotype, as a gene in a haploid cell or organism, a sex-linked gene in the heterogametic sex, or a gene in a segment of chromosome in a diploid cell or organism where its partner segment has been deleted.
- heterologous polynucleotide or a “heterologous nucleic acid” or an “exogenous DNA segment” refer to a polynucleotide, nucleic acid or DNA segment that originates from a source foreign to the particular host cell, or, if from the same source, is modified from its original form.
- a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell, but has been modified.
- the terms refer to a DNA segment which is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found.
- heterologous trait refers to a phenotype imparted to a transformed host cell or transgenic organism by an exogenous DNA segment, heterologous polynucleotide or heterologous nucleic acid.
- heterozygote refers to a diploid or polyploid individual cell or plant having different alleles (forms of a given gene) present at least at one locus.
- heterozygous refers to the presence of different alleles (forms of a given gene) at a particular gene locus.
- homolog or “homologue” refer to a nucleic acid or peptide sequence which has a common origin and functions similarly to a nucleic acid or peptide sequence from another species.
- homozygote refers to an individual cell or plant having the same alleles at one or more or all loci.
- locus or gene When the term is used with reference to a specific locus or gene, it means at least that locus or gene has the same alleles.
- homozygous or “HOMO” refer to the presence of identical alleles at one or more or all loci in homologous chromosomal segments.
- HOMO HOMO
- hybrid refers to any individual cell, tissue or plant resulting from a cross between parents that differ in one or more genes.
- inbred or “inbred line” refers to a relatively true-breeding strain.
- the term "line” is used broadly to include, but is not limited to, a group of plants vegetatively propagated from a single parent plant, via tissue culture techniques or a group of inbred plants which are genetically very similar due to descent from a common parent(s).
- a plant is said to "belong” to a particular line if it (a) is a primary transforniant (TO) plant regenerated from material of that line; (b) has a pedigree comprised of a TO plant of that line; or (c) is genetically very similar due to common ancestry (e.g., via inbreeding or selfmg).
- the term “pedigree” denotes the lineage of a plant, e.g. in terms of the sexual crosses affected such that a gene or a combination of genes, in heterozygous (hemizygous) or homozygous condition, imparts a desired trait to the plant.
- mutant or “mutation” refer to a gene, cell, or organism with an abnormal genetic constitution that may result in a variant phenotype.
- open pollination refers to a plant population that is freely exposed to some gene flow, as opposed to a closed one in which there is an effective barrier to gene flow.
- open-pollinated population or “open-pollinated variety” refer to plants normally capable of at least some cross-fertilization, selected to a standard, that may show variation but that also have one or more genotypic or phenotypic characteristics by which the population or the variety can be differentiated from others.
- a hybrid which has no barriers to cross-pollination, is an open-pollinated population or an open-pollinated variety.
- ovule refers to the female gametophyte
- polyen means the male gametophyte
- phenotype refers to the observable characters of an individual cell, cell culture, organism (e.g., a plant), or group of organisms which results from the interaction between that individual's genetic makeup (i.e., genotype) and the environment.
- plant tissue refers to any part of a plant.
- plant organs include, but are not limited to the leaf, stem, root, tuber, seed, branch, pubescence, nodule, leaf axil, flower, pollen, stamen, pistil, petal, peduncle, stalk, stigma, style, bract, fruit, trunk, carpel, sepal, anther, ovule, pedicel, needle, cone, rhizome, stolon, shoot, pericarp, endosperm, placenta, berry, stamen, and leaf sheath.
- self-crossing means the pollen of one flower on one plant is applied (artificially or naturally) to the ovule (stigma) of the same or a different flower on the same plant.
- transformation refers to the transfer of nucleic acid (i. e., a nucleotide polymer) into a cell.
- genetic transformation refers to the transfer and incorporation of DNA, especially recombinant DNA, into a cell.
- transformant refers to a cell, tissue or organism that has undergone transformation.
- the original transformant is designated as “TO” or “To.”
- Selfing the TO produces a first transformed generation designated as “Tl” or “Ti.”
- transgene refers to a nucleic acid that is inserted into an organism, host cell or vector in a manner that ensures its function.
- transgenic refers to cells, cell cultures, organisms (e.g., plants), and progeny which have received a foreign or modified gene by one of the various methods of transformation, wherein the foreign or modified gene is from the same or different species than the species of the organism receiving the foreign or modified gene.
- transposition event refers to the movement of a transposon from a donor site to a target site.
- variable refers to a subdivision of a species, consisting of a group of individuals within the species that are distinct in form or function from other similar arrays of individuals.
- the term "vector”, “plasmid”, or “construct” refers broadly to any plasmid or virus encoding an exogenous nucleic acid.
- the term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into virions or cells, such as, for example, polylysine compounds and the like.
- the vector may be a viral vector that is suitable as a delivery vehicle for delivery of the nucleic acid, or mutant thereof, to a cell, or the vector may be a non-viral vector which is suitable for the same purpose. Examples of viral and non-viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U.S.A. 94: 12744-12746).
- seed size refers to the volume of the seed material itself, which is the space occupied by the constituents of the seed.
- seed number refers to the average number of seeds produced from each fruit, each plant, or each predetermined area (e.g., 1 acre).
- Test Weight is a determination of bulk density (mass/volume), measured for commerce under specific conditions defined in the U.S. by the USDA-FGIS. Test weight is a general indicator of grain quality and higher test weight normally means higher quality grain. Grain test weight in units of pounds per bushel specifies the weight of a "volume" bushel, which is 32 quarts (30,283 cubic centimeters) of grain. When grain is traded, samples are usually tested for quality, and test weight is one of the tests carried out. Test weights have been a part of U.S. grain grades since the United States Grain Standards Act was passed by Congress in 1916. U.S. grades for most grains specify test weight minimums for each grade level.
- the official minimum allowable test weight in the U.S. for No. 1 yellow corn is 56 lbs/bu and for No. 2 yellow corn is 54 lbs/bu (USDA-GIPSA, 1996).
- a "weight" bushel of corn is exactly 56 pounds, a soybean bushel is 60 pounds, and a wheat bushel is 60 pounds, regardless of the test weight.
- the "weight” bushel is used for the basis of payment for grain, but price discounts are often tied to shipments of lower grade grain possessing low test weight.
- Grain Apparent Density refers to grain density determined in a fashion wherein the bulk density (mass/volume) of cereal seed is sometimes measured with the aid of a gas pycnometer, which typically uses helium and measures the volume of the sample. Grain kernels contain internal void spaces and intercellular spaces and are not completely porous to helium. Since the gas cannot reach all internal spaces, the volume of material comprising the kernel can be overestimated with gas pycnometry and a density lower than the "true density” of grain material is determined (Chang, CS (1988) Cereal Chem:65: 13-15).
- Gram True Density refers to the bulk density of grain, expressed as the quotient of mass divided by volume, whereby all void space not comprising solid materials of the seed has been eliminated before, or discounted in, determination of the volume used in the calculation (Chang, CS (1988) Cereal Chem:65: 13- 15).
- cyclin dependent kinase inhibitor refers to a class of proteins that negatively regulate cyclin dependent kinases (CDKs).
- CKIs amenable to the present invention are those having separate polypeptide regions capable of independently binding a cyclin and a CDK.
- Such CKIs include, for example, identified families of plant CKIs (the seven identified Arabidopsis CKIs), having homology to Kinase Inhibitor Proteins (KIPs) in animals, referred to as ⁇ - related proteins ( KRPs) (also known as Inhibitors of "CDKs,” or "ICKs").
- naturally occurring in the context of CKI polypeptides and nucleic acids, means a polypeptide or nucleic acid having an amino acid or nucleotide sequence that is found in nature, i.e., an amino acid or nucleotide sequence that can be isolated from a source in nature (an organism) and which has not been intentionally modified by human intervention.
- laboratory strains of plants which may have been selectively bred according to classical genetics are considered naturally-occurring plants.
- wild-type CKI gene or wild-type CKI nucleic acid refers to a sequence of nucleic acid, corresponding to a CKI genetic locus in the genome of an organism, that encodes a gene product performing the normal function of the CKI protein encoded by a naturally-occurring nucleotide sequence corresponding to the genetic locus.
- a genetic locus can have more than one sequence or allele in a population of individuals, and the term “wild-type” encompasses all such naturally-occurring alleles that encode a gene product performing the normal function.
- Wild-type also encompasses gene sequences that are not necessarily naturally occurring, but that still encode a gene product with normal function (e.g., genes having silent mutations or encoding proteins with conservative substitutions).
- wild-type CKI polypeptide or wild-type CKI protein refers to a CKI polypeptide encoded by a wild-type gene.
- a genetic locus can have more than one sequence or allele in a population of individuals, and the term “wild-type” encompasses all such naturally-occurring alleles that encode a gene product performing the normal function.
- Classic breeding methods can be included in the present invention to introduce one or more recombinant KRPs of the present invention into other plant varieties, or other close- related species that are compatible to be crossed with the transgenic plant of the present invention.
- Open-Pollinated Populations The improvement of open-pollinated populations of such crops as rye, many maizes and sugar beets, herbage grasses, legumes such as alfalfa and clover, and tropical tree crops such as cacao, coconuts, oil palm and some rubber, depends essentially upon changing gene-frequencies towards fixation of favorable alleles while maintaining a high (but far from maximal) degree of heterozygosity. Uniformity in such populations is impossible and trueness-to-type in an open-pollinated variety is a statistical feature of the population as a whole, not a characteristic of individual plants. Thus, the heterogeneity of open-pollinated populations contrasts with the homogeneity (or virtually so) of inbred lines, clones and hybrids.
- Interpopulation improvement utilizes the concept of open breeding populations; allowing genes to flow from one population to another. Plants in one population (cultivar, strain, ecotype, or any germplasm source) are crossed either naturally (e.g., by wind) or by hand or by bees (commonly Apis mellifera L. or Megachile rotundata F.) with plants from other populations. Selection is applied to improve one (or sometimes both) population(s) by isolating plants with desirable traits from both sources.
- Mass Selection In mass selection, desirable individual plants are chosen, harvested, and the seed composited without progeny testing to produce the following generation. Since selection is based on the maternal parent only, and there is no control over pollination, mass selection amounts to a form of random mating with selection. As stated herein, the purpose of mass selection is to increase the proportion of superior genotypes in the population.
- Synthetics A synthetic variety is produced by crossing inter se a number of genotypes selected for good combining ability in all possible hybrid combinations, with subsequent maintenance of the variety by open pollination. Whether parents are (more or less inbred) seed-propagated lines, as in some sugar beet and beans (Vicia) or clones, as in herbage grasses, clovers and alfalfa, makes no difference in principle. Parents are selected on general combining ability, sometimes by test crosses or topcrosses, more generally by polycrosses. Parental seed lines may be deliberately inbred (e.g. by selfing or sib crossing). However, even if the parents are not deliberately inbred, selection within lines during line maintenance will ensure that some inbreeding occurs. Clonal parents will, of course, remain unchanged and highly heterozygous.
- the number of parental lines or clones that enter a synthetic varies widely. In practice, numbers of parental lines range from 10 to several hundred, with 100-200 being the average. Broad based synthetics formed from 100 or more clones would be expected to be more stable during seed multiplication than narrow based synthetics.
- Pedigreed varieties A pedigreed variety is a superior genotype developed from selection of individual plants out of a segregating population followed by propagation and seed increase of self pollinated offspring and careful testing of the genotype over several generations. This is an open pollinated method that works well with naturally self pollinating species. This method can be used in combination with mass selection in variety development. Variations in pedigree and mass selection in combination are the most common methods for generating varieties in self pollinated crops.
- Hybrids A hybrid is an individual plant resulting from a cross between parents of differing genotypes. Commercial hybrids are now used extensively in many crops, including corn (maize), sorghum, sugarbeet, sunflower and broccoli. Hybrids can be formed in a number of different ways, including by crossing two parents directly (single cross hybrids), by crossing a single cross hybrid with another parent (three-way or triple cross hybrids), or by crossing two different hybrids (four-way or double cross hybrids).
- hybrids most individuals in an out breeding (i.e., open-pollinated) population are hybrids, but the term is usually reserved for cases in which the parents are individuals whose genomes are sufficiently distinct for them to be recognized as different species or subspecies.
- Hybrids may be fertile or sterile depending on qualitative and/or quantitative differences in the genomes of the two parents.
- Heterosis, or hybrid vigor is usually associated with increased heterozygosity that results in increased vigor of growth, survival, and fertility of hybrids as compared with the parental lines that were used to form the hybrid. Maximum heterosis is usually achieved by crossing two genetically different, highly inbred lines.
- hybrids The production of hybrids is a well-developed industry, involving the isolated production of both the parental lines and the hybrids which result from crossing those lines.
- hybrid production process see, e.g., Wright, Commercial Hybrid Seed Production 8: 161-176, In Hybridization of Crop Plants.
- TILLING Targeting Induced Local Lesions in Genomes
- TILLING® was introduced in 2000, using the model plant Arabidopsis thaliana.
- TILLING® has since been used as a reverse genetics method in other organisms such as zebrafish, corn, wheat, rice, soybean, tomato and lettuce.
- the method combines a standard and efficient technique of mutagenesis with a chemical mutagen (e.g., Ethyl methanesulfonate (EMS)) with a sensitive DNA screening- technique that identifies single base mutations (also called point mutations) in a target gene.
- EcoTILLING is a method that uses TILLING® techniques to look for natural mutations in individuals, usually for population genetics analysis. See Comai, et al., 2003. Efficient discovery of DNA polymorphisms in natural populations by Ecotilling. The Plant Journal 37, 778-786. Gilchrist et al. 2006. Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa. Mol. Ecol.
- the TILLING® method relies on the formation of heteroduplexes that are formed when multiple alleles (which could be from a heterozygote or a pool of multiple homozygotes and heterozygotes) are amplified in a PCR, heated, and then slowly cooled. A "bubble” forms at the mismatch of the two DNA strands (the induced mutation in TILLING® or the natural mutation or SNP in EcoTILLING), which is then cleaved by single stranded nucleases. The products are then separated by size on several different platforms.
- TILLING ⁇ centers exists over the world that focus on agriculturally important species: UC Davis (USA), focusing on Rice; Purdue University (USA), focusing on Maize; University of British Columbia (CA), focusing on Brassica napus; John Innes Centre (UK), focusing on Brassica rapa; Fred Hutchinson Cancer Research, focusing on Arabidopsis; Southern Illinois University (USA), focusing on Soybean; John Innes Centre (UK), focusing on Lotus and Medicago ; and INRA (France), focusing on Pea and Tomato.
- Triticeae is a tribe within the Pooideae subfamily of grasses that includes genera with many domesticated species. Major crop genera are found in this tribe including wheat (See Wheat taxonomy), barley, and rye; crops in other genera include some for human consumption and others used for animal feed or rangeland protection. Among the world's cultivated species, this tribe has some of the most complex genetic histories. An example is bread wheat, which contains the genomes of three species, only one of them originally a wheat Triticum species.
- Genera in the Triticeae tribe include, but are not limited to, Aegilops (goat grasses - jointed goatgrass, Tausch goatgrass, etc.); Agropyron (crested wheatgrasses - Desert wheatgrass, quackgrass, etc.); Amblyopyrum (Slim wheat grass - amblyopyrum, etc.); Australopyrum (Australian wheatgrasses - velvet wheatgrass,pectinated wheatgrass, etc.); Cockaynea (See Stenostachys; Cockaynea is a younger, and hence invalid, name for Stenostachys, etc.); Crithopsis (delileana grass etc.); Dasypyrum (Mosquito grass; etc.); Elymus (Elymus (wild ryes - blue wildrye,Texas ryegrass, etc.); Elytrigia; Eremium (Argentine desert ryegrass, etc.); Eremopyrum (false wheatgrasses
- Taeniatherum (medusahead etc.); Thinopyrum (intermediate wheatgrass. Russian wheatgrass, thick quackgrass, etc.); Triticum (Wheats - common wheat, durum wheat, etc.).
- Triticeae and its sister tribe Bromeae (possible cultivars: Bromus mango S. America) when joined form a sister clade with Poeae and Aveneae (oats).
- Inter-generic gene flow characterized these taxa from the early stages. For example, Poeae and Aveneae share a genetic marker with barley and 10 other members of Triticeae, whereas all 19 genera of Triticeae bear a wheat marker along with Bromeae.
- Genera within Triticeae contain diploid, allotetraploid and/or allohexaploid genomes, the capacity to form allopolyploid genomes varies within the tribe. In this tribe, the majority of diploid species tested are closely related to Aegilops, the more distal members (earliest branch points) include Hordeum (Barley), Eremian, Psathyrostachys.
- Triticeae are exemplary of allopolyploids, having more chromosomes than seen in typical diploids.
- allopolyploids are tetraploid or hexaploid, AABB or AABBDD.
- the creation of polyploid species results from natural random events tolerated by polyploid capable plants.
- natural allopolyploid plants may have selective benefits and may allow the recombination of distantly related genetic material facilitating at a later time a reversion back to diploid.
- Poulard wheat is an example of a stable allotetraploid wheat.
- Aegilops appears to be basal to several taxa such as Triticum, Ambylopyrum, and Crithopsis. Certain species such as Aegilops speltoides could potentially represent core variants of the taxa. The generic placement may be more a matter of nomenclature. Aegilops and Triticum genera are very closely related as the Aegilops species occupy most of the basal branch points in bread wheat evolution indicating that Triticum genus evolved from Aegilops after an estimated 4 million years ago. The divergence of the genomes is followed by allotetraploidation of a speltoid goatgrass x basal wheat species Triticum boeoticum with strains in the Middle Eastern region giving rise to cultivated emmer wheat. Triticum spp.
- Triticum sp. is a grass cultivated worldwide. In 2007 world production of wheat was 607 million tons, making it the third most-produced cereal after maize (784 million tons) and rice (651 million tons). Globally, wheat is the leading source of vegetable protein in human food, having a higher protein content than either maize (corn) or rice, the other major cereals. In terms of total production tonnages used for food, it is currently second to rice as the main human food
- Wheat is planted to a limited extent as a forage crop for livestock, and its straw can be used as a construction material for roofing thatch.
- Wheat germ is the embryo portion of the wheat kernel. It is a concentrated source of vitamins, minerals, and protein, and is sustained by the larger, starch storage region of the kernel— the endosperm.
- Triticum species include, T. aestivum (e.g., common wheat, or bread wheat, a.k.a. Triticum aestivum L. subsp. Aestivum; Club wheat, a.k.a. Triticum aestivum subspecies compactum (Host) MacKey; Macha wheat, a.k.a. Triticum aestivum subsp. macha (Dek. and Men.) MacKey; Vavilovi wheat, a.k.a. Triticum aestivum subsp. vavilovi (Tuman) Sears; Shot wheat, a.k.a. Triticum aestivum subsp. sphacrococcum (Perc.)
- T. aestivum e.g., common wheat, or bread wheat, a.k.a. Triticum aestivum L. subsp. Aestivum; Club wheat, a.k.a. Triticum aestiv
- T. aethiopicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. carthlicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. carthlicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. carthlicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. carthlicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. carthlicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. carthlicum e.g., wild Einkorn, a.k.a. Triticum boeotictim Boiss
- T. durum e.g., durum wheat
- T. ispahanicum T. karamyschevii, T. macha, T. militinae, T. monococcum (e.g., Einkorn, a.k.a. Triticum monococcum L.), T. polonicum, T. spelta, T. sphacrococcum, T. timopheevii (e.g. timopheevi wheat, a.k.a. Triticum timopheevii
- T. turanicum e.g., oriental wheat, a.k.a. Triticum turanicum jakubz
- T. turgidum e.g., poulard wheat, a.k.a. Triticum turgidum L.
- T. urartu T, vavilovii, and T. zhukovskyi.
- tetraploid wheats e.g. emmer and durum wheat
- Most tetraploid wheats are derived from wild emmer, T. dicoccoides. Wild emmer is itself the result of a hybridization between two diploid wild grasses, T. urartu and a wild goatgrass such as Aegilops searsii or Ae. speltoides. The unknown grass has never been identified among now surviving wild grasses, but the closest living relative is Aegilops speltoides.
- Triticum spp. Plant breeding methods for Triticum spp. are well known. Non-limiting methods for Triticum spp. breeding and agriculturally important traits (e.g., improving wheat yield, biotic stress tolerance, and abiotic stress tolerance etc.) are described in references Nos. 36 - 51 , US 7652204, US 6197518, US 7034208, US 7528297, US 640731 1, US20080040826, US20090300783, US20060223707, US201 10027233, US20080028480, US20090320152, US20090320151 , WO/2001/029237A2, WO/2008/025097A1 , and WO/2003/057848A2, each of which is incorporated by reference in its entirety for all purposes.
- Triticum spp. and other species, for example, some plant species in the Triticeae tribe.
- Xiang et al. describe somatic hybrids between wheat and Selaria italica (Genome 47: 680-688 (2004)); Ge et al. describe protoplast electrofusion between common wheat and Italian ryegrass (In Vitro Cellular and Developmental Biology - Plant 42(2): 179- 187. 2006); Yue e al. describe asymmetic somatic hybridization between Aeleuropus littorulis sinensis and wheat (Plant Science, Volume 161 , Issue 2, July 2001 , Pages 259-266); Cai et al. describe somatic hybrids between Festuca arundinacea Schreb.
- the tribe Oryzeae (Poaceae), as conventionally delimited, includes approximately 12 genera and more than 70 species distributed throughout the tropical and temperate regions of the world (Clayton and RAIDze, 1986; Vaughan, 1994). As the largest tribe in the subfamily Ehrhartoideae, Oryzeae contains more than half of both genera and species of the subfamily (Quo et al., 2005, Watson and Dallwitz, 1999; GPWG, 2001).
- Genera in the Oryzeae tribe include, but are not limited to, Chikusichloa Koidz,
- Oryza is a genus of seven to twenty species of grasses in the tribe Oryzeae, native to tropical and subtropical regions of Asia, Northern Australia and Africa. They are tall wetland grasses, growing to 1-2 m tall; the genus includes both annual and perennial species.
- Oryza is situated within the tribe Oryzeae, which is characterized morphologically by its single flowered spikelets whose glumes are almost completely suppressed. In Oryza, two sterile lemma simulate glumes.
- the tribe Oryzeae is within the subfamily Bambusoideae, a group of Poaceae tribes with certain features of internal leaf anatomy in common.
- the Bambusoideae are in the family Poaceae, as they all have fibrous root systems, cylindrical stems, sheathing leaves with parallel veined blades, and inflorescences with spikelets.
- Non-limiting Oryza spp. include, O. saliva (e.g., Asian rice), O. barthii, O. glaberrima (e.g., Africa rice), O. longistaminata, O. meridionalis, O. nivara, O. rufipogon (e.g., brownbeard rice and red rice), O. punctata, O. latifolia, O. aha, O. grandiglumis, O. eichingeri, O. officinalis, O. rhisomatis, O. minuta, O. australiensis, O. granulata, O. meyeriana, and O. brachyantha.
- O. saliva e.g., Asian rice
- O. barthii e.g., Africa rice
- O. longistaminata e. meridionalis
- O. nivara e.g., brownbeard rice and red rice
- O. punctata O.
- Oryza sativa contains two major subspecies: the sticky, short grained japonica or sinica variety, and the non-sticky, long-grained indica variety.
- Japonica are usually cultivated in dry fields, in temperate East Asia, upland areas of Southeast Asia and high elevations in South Asia, while indica are mainly lowland rices, grown mostly submerged, throughout tropical Asia.
- Rice is known to come in a variety of colors, including: white, brown, black, purple, and red.
- Examples of this variety include the medium grain Tinawon' and 'Unoy' cultivars, which are grown in the high-elevation rice terraces of the Cordillera Mountains of northern Luzon, Philippines.
- Glaszmann (1987) used isozymes to sort Oryza sativa into six groups: japonica, aromatic, indica, aus, rayada, and ashina;
- Garris et al. (2004) used SSRs to sort Oryza sativa into five groups; temperate japonica, tropical japonica and aromatic comprise the japonica varieties, while indica and aus comprise the indica varieties.
- Plant breeding methods for Oryza spp. are well known. Non-limiting methods for Oryza spp. breeding and agriculturally important traits (e.g., improving wheat yield, biotic stress tolerance, and abiotic stress tolerance etc.) are described in references Nos. 56 - 76, US20050097639, US20040168232. US20100287664, US20080109919, US 5981842, and US20050183173, WO/2003/000904A2.
- Fabaceae or Leguminosae is a large and economically important family of flowering plants, which is commonly known as the legume family, pea family, bean family or pulse family.
- the name 'Fabaceae' comes from the defunct genus Faba, now included into Vicia.
- Leguminosae is an older name still considered valid, and refers to the typical fruit of these plants, which are called legumes.
- Fabaceae is the third largest family of flowering plants, behind Orchidaceae and Asteraceae, with 730 genera and over 19,400 species, according to the Royal Botanical Gardens.
- the largest genera are Astragalus with more than 2,000 species, Acacia with more than 900 species, and Indigofera with around 700 species.
- Other large genera include Crotalaria with 600 species and Mimosa with 500 species.
- the species of this family are found throughout the world, growing in many different environments and climates.
- a number are important agricultural plants, including: Glycine max (soybean), Phaseolus (beans), Pisum sativum (pea), Cicer arietinum (chickpeas), Medicago saliva (alfalfa), Arachis hypogaea (peanut), Ceratonia siliqua (carob), and Glycyrrhiza glabra (licorice), which are among the best known members of Fabaceae.
- a number of species are also weedy pests in different parts of the world, including: Cytisus scoparius (broom) and Pueraria lobata (kudzu), and a number of Lupinus species.
- soybean U.S. or soya bean (UK) ⁇ Glycine max
- U.S. or soya bean (UK) ⁇ Glycine max is a species of legume native to East Asia, widely grown for its edible bean which has numerous uses.
- the plant is classed as an oilseed rather than a pulse.
- Fat-free (defatted) soybean meal is a primary, low-cost, source of protein for animal feeds and most prepackaged meals; soy vegetable oil is another valuable product of processing the soybean crop.
- soybean products such as textured vegetable protein (TVP) are important ingredients in many meat and dairy analogues.
- TVP textured vegetable protein
- KIP Kinase Inhibitor Protein
- KRP Kinase Inhibitor Protein
- CDK cyclin dependent kinases
- At least two classes of CDKs are involved in cell cycle regulation: the A-type CDKs that are represented by only one gene in the model species Arabidopsis (designated Arath;CDKA;l) and the B-type CDK family that has four members, grouped into the B l (Arath;CDKBl ;l and Arath;CDKBl ;2) and B2 (Arath;
- CDKB2; 1 and Arath;CDKB2;2) subclasses (Vandepoele et al., 2002, Genome-wide analysis of core cell cycle genes in Arabidopsis. Plant Cell 14: 903-916).
- A-type CDKs display kinase activity from late Gl phase until the end of mitosis, suggesting a role for this particular CD at both the Gl -to-S and G2-to-M transition points (Magyar et al., 1997; Porceddu et al., 2001 ; Sorrell et al., 2001).
- CDKA central role for CDKA;1 in controlling cell number has been demonstrated using transgenic tobacco (Nicotiana tabac m) plants with reduced A-type CDK activity (Hemerly et al, 1995).
- Arath;CKDA; l at least for entry into mitosis has been demonstrated as well by cdka; 1 null mutants that fail to progress through the second mitosis during male gametophytic development (Nowack et al, 2005).
- the group of B-type CDKs displays a peak of activity at the G2-to-M phase transition only (Magyar et al., 1997; Porceddu et al., 2001 ; Sorrell et al., 2001), suggesting that they play a role at the onset of, or progression through, mitosis.
- cells of plants with reduced B-type CDK activity arrest in the G2 phase of the cell cycle (Porceddu et al., 2001 ; Boudolf et al., 2004).
- CDK is regulated by cyclins. Plant cyclins are very complicated. There are at least 49 different cyclins in Arabidopsis, which were classified into seven subclasses (A, B, C, D, H, P, and T) (Vandepoele et al., 2002; Wang et al conflict 2004). CDK are also regulated by docking of small proteins, generally known as CDK inhibitors (CKIs). CKIs have been identified in many organisms, e.g., budding yeast ⁇ Saccharomyces cerevisiae), fission yeast (Schizosaccharomyces pombe), mammals, and plants, see, Mendenhail, 1998; Kwon T.K. et al.
- CKIs CDK inhibitors
- KRPs KIP Related Proteins
- Plant CKIs are also known as KIP Related Proteins (KRPs). They have cyclin binding and CDK binding domains at their C-terminal, however the mechanism regulating this protein stability and function remains unknown (Zhou et al., 2003a; Weinl et al. 2005).
- KRP activity can be both regulated at the transcriptional level or at the posttranslational level (Wang et al., 1998; De Veylder et al., 2001 ; Jasinski et al, 2002b; Ormenese et al., 2004; Coqueret, 2003; Hengst, 2004; Verkest et al., 2005; Coelho et al., 2005, each of which is incorporated by reference in its entirety).
- KRPs in plant normally localize in nucleus (Jasinski et al., 2002b; Zhou et al, 2003a; Weinl et al, 2005).
- KRP can function as an integrator of developmental signals, and control endocycle onset, in different cell cycle programs (e.g., proliferation, endoreduplication, and cell cycle exit). See Wang et al, 1998; Richard et al., 2001 ; Himanen et al., 2002; Grafi and Larkins, 1995; Joube ' s et al, 1999; Verkest et al, 2005; Weinl et al, 2005; Boudolf et al., 2004b.
- the present invention further provides disrupted KRP polynucleotides and KRP amino acid sequences compared to a wild type KRP gene or a wild type KRP protein.
- the present invention provides mutations in one or more KRP genes that can be used to increase weight, size, and/or number of one or more organs, for example, to increase seed size, seed number, seed weight, and/or seed yield in a plant.
- the mutations in a mutated KRP gene of the present invention can be in the coding region or the non-coding region of the KRP genes.
- the mutations can either lead to, or not lead to amino acid changes in the encoded KRP polypeptides.
- the mutations can be missense, severe missense, silent, nonsense mutations.
- the mutation can be nucleotide substitution, insertion, deletion, or genome re-arrangement, which in turn may lead to reading frame shift, splicing change, amino acid substitution, insertion, deletion, and/or polypeptides truncation.
- the mutant KRP gene encodes a KRP polypeptide having less inhibition activity on a cyclin/CDK complex compared to a polypeptide encoded by its corresponding wild-type KRP gene.
- a nonsense mutation is a point mutation, e.g., a single-nucleotide polymorphism (SNP), in a sequence of DNA that results in a premature stop codon, or a nonsense codon in the transcribed mRNA, and in a truncated, incomplete, and usually nonfunctional protein product.
- a missense mutation (a type of nonsynonymous mutation) is a point mutation in which a single nucleotide is changed, resulting in a codon that codes for a different amino acid (mutations that change an amino acid to a stop codon are considered nonsense mutations, rather than missense mutations). This can render the resulting protein nonfunctional.
- Silent mutations are DNA mutations that do not result in a change to the amino acid sequence of a protein. They may occur in a non-coding region (outside of a gene or within an intron), or they may occur within an exon in a manner that does not alter the final amino acid sequence. A severe missense mutation changes the amino acid, which lead to dramatic changes in conformation, charge status etc.
- the mutations can be located at any portion of a KRP gene, for example, at the 5', the middle, or the 3' of a KRP gene, resulting mutations in any potions of the encoded KRP protein, for example, in the CD binding domain or the cyclin binding domain, so long as the mutated gene encodes a mutant KRP polypeptide partially or completely lose the ability to inhibit one or more cyclin/CDK complexes, compared to the protein encoded by the corresponding wild type KRP gene.
- the KRP and the cyclin/CDK complexes can belong to the same plant species, different plant species in the same genus, or different plant species in different species.
- the present invention provides effective systems to test if a candidate mutant KRP protein loses the inhibition ability on a cyclin/CDK complex compared to a wild type KRP protein.
- the effective systems comprise a kinase assay (the "in vitro KRP-Cylin-CDK kinase assay"), a non-limiting example of which is described herein.
- this kinase assay is an in vitro kinase assay.
- a candidate mutant KRP derived from a wild type KRP of a plant species A, the wild type KRP protein of the plant species A, a wild type cyclin protein of a plant species B, and a wild type CDK protein of the plant species B are recombinantly expressed and purified.
- the recombinant wild type cyclin protein and the wild type CDK protein are mixed to form a complex (alternatively, the cyclin protein and the CDK protein can be co-expressed and co- purified as a complex).
- the recombinant proteins are expressed in insect cells.
- Plant species A can be the same as or different from plant species B. This kinase activity of said complex is then monitored with a standard kinase assay described below.
- a substrate protein that can be activated (i.e., phosphorylated) by the Cyclin-CDK complex is selected.
- Such substrate protein can be Histone HI (HHI) or recombinant tobacco retinoblastoma protein (Nt Rb). At least three mixtures can be made by adding recombinant proteins into a kinase buffer cocktail according to the table below:
- a non-limiting example of the kinase buffer cocktail comprises KAB: 50 mM Tris pH 8.0, 10 mM MgCl 2 , 100 ⁇ ATP plus 0.5 ⁇ / ⁇ 32 ⁇ and the substrate protein.
- Concentrations CI , C2, and C3 can be determined and optimized by one skilled in the art depending on experiment conditions.
- C2 should be about equimolar with CI ; and, C3 should be no more than 50X of C2, or no more than 40X of C2, or no more than 3 OX of C2, or no more than 20X of C2, or no more than 10X of C2, or no more than 5X of C2.
- the amount of C3 is about IX, or about 2X, or about 3X, or about 4X, or about 5X, or about 6X, or about 7X, or about 8X, or about 9X, or about 10X, Or about 1 1X, or about 12X, or about 13X, or about 14X, or about 15X, or about 16X, or about 17X, or about 18X, or about 19X, or about 20X of the amount of C2.
- the amount of C3 may be about 25X, or about 30X, or about 35X, or about 40X, or about 45X, or about 50X of the amount of C2.
- the amount of C3 which is utilized in any particular situation must be physiologically achievable in a plant cell, tissue or whole plant in order to have a dominant negative effect on the wild-type KRP.
- Composition I and/or Composition III are incubated on ice for a certain amount of time (e.g., 30 minutes). Subsequently, Composition II is then added to the mixture and incubated at 4° C. for certain amount of time (e.g., 30 mins) to allow binding to the kinase complex. The kinase reaction is then initiated by adding the buffer cocktail (KAB) and to the kinase complex mixture (I, II, or III) and incubated at 27°C for a certain amount of time (e.g., 30 minutes) to allow reaction to complete. The kinase reaction in each mixture is stopped
- the mutant KRPs of the present invention do not substantially inhibit the kinase activity of the cyclin/CDK complex, even when present in large molar excess over the cyclin/CDK complex.
- Mutant KRPs with a Zmax%o value higher than 0% are particularly useful for increasing weight, size, and/or number of one or more organs, for example, for increasing seed yield, seed size, seed number, and/or seed yield in a plant.
- the CDK protein and the cyclin protein in the cyclin/CDK complex can be derived from any plant, for example, any dicot plants or monocot plants, especially agriculturally or industrially important plants.
- the CDK protein and the cyclin protein can be derived from the same plant species, or from different species.
- the KRP protein can be derived from the same species from which the CDK protein and the cyclin protein are derived, or from different plant species.
- the Cyclin/CDK complexes comprise a CDK protein selected from the group consisting of Zea mays CDK A; l (ZmCDKA; l), Zea mays CDK A;2 (ZmCDKA;2), wheat CDKs (e.g., GenBank Accession No.
- AAD10483 and rice CDKs (e.g., GenBank Accession No. NP_001048772 and NP_001045731), and CDKs from a plant in the Triticeae tribe or Oryzeae tribe, or the Fabaceae family; the cyclin protein selected from the group consisting of Zea mays Cyclin Dl, D2, D3, D4, D5, D6, D7, wheat cyclin proteins (e.g., GenBank Accession No. AAQ08041 (cyclin D2)), rice cyclin proteins (e.g., GenBank Accession Nos.
- rice KRPl rice KRP2, rice KRP3, rice KRP4, rice KRP5, rice KRP6, rice KRP7, for example, SEQ ID NOs. 99, 108-1 10, or functional variants thereof, soy KRPs, for example, SEQ ID NOs. 129- 137, or functional variants thereof, KRPs from a plant in the Triliceae tribe or Oryzeae tribe, the Fabaceae family, and combinations thereof.
- the wild-type KRP is wheat KRP l , wheat KRP2, wheat KRP4, wheat KRP5, or wheat KRP6.
- the numbering of the KRPs in wheat or rice does not necessarily correspond to the numbering of the KRPs in other species (e.g., Arabidopsis or maize).
- wheat KRPl is not necessarily equivalent or orthologous to Arabidopsis KRPl .
- the Zea mays cyclin is selected from the 59 cyclins described in Hu et al., 2010, which is incorporated herein by reference in its entirety. In some embodiments, Zea mays cyclin is selected from the 21 cyclin D proteins described in Hu et al., 2010.
- the cyclin is selected from the group consisting of Zea mays cyclin Dl ; l , D2;l , D2;2, D3; l , D3;2, D4;l , D4;2, D4;3, D4;4, D4;5, D4;6, D4;7, D4;8, D4;9, D4; 10, D5; l , D5;2, D5;3, D5;4, D6; l , D7;l, and combination thereof.
- said mutant KRP is derived from a wheat KRP.
- the mutant KRP is derived from wheat KRPl (A,B, or D), wheat KRP2 (A,B, or D), wheat KRP4 (A, B, or D), wheat KRP 5 (A, B, or D), or wheat KRP6 (A, B, or D).
- said mutant KRP is derived from a rice KRP.
- the mutant KRP is derived from rice KRPl, rice KRP2, rice KRP3, rice KRP4, or rice KRP5.
- said mutant KRP is derived from a soybean KRP.
- said mutant KRP is derived from a biologically active variant, or fragment thereof of wild-type wheat, rice or soybean KRPs.
- the mutant KRP can be natural mutation, or a mutation induced artificially by methods well known to one skilled in the art.
- Mutant KRP protein of the present invention can have one or more modifications to the wild-type KRP, or biologically active variant, or fragment thereof.
- Particularly suitable modifications include amino acid substitutions, insertions, deletions, or truncation.
- amino acid substitutions can be generated as modifications in the CDK or the cyclin-binding region that reduce or eliminate binding.
- amino acid substitutions can be generated as modifications in the CDK or the cyclin-binding region of the KRP that reduce or eliminate the inhibitory activity of the KRP towards the Cyclin/CDK complex.
- At least one non-conservative amino acid substitution, insertion, or deletion in the CDK binding region or the cyclin binding region is made to disrupt or modify binding of the CKI polypeptide to a CDK or cyclin protein.
- the substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.
- Insertional KRP mutants are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in the wild-type KRP protein molecule, biologically active variant, or fragment thereof.
- the insertion can be one or more amino acids.
- the insertion can consist, e.g., of one or two conservative amino acids.
- mutant KRP protein includes the insertion of an amino acid with a charge and/or structure that is substantially different from the amino acids adjacent to the site of insertion.
- the mutant KRP is a truncated protein losing one or more domains compared to the corresponding wild type KRP protein.
- the present invention further provides methods of increasing weight, size, and/or number of one or more organs, for example, methods of increasing seed weight, seed size, seed number, and/or yield in a plant.
- the plant can be a dicot plant or a monocot plant. In some embodiments, the plant is a monocot plant. In some embodiments, the plant is a plant species in the Triticeae tribe or Oryzeae tribe, or the Fabaceae family, for example, a wheat plant or a rice plant.
- the methods comprise disrupting one or more KRPs in the plant. The disruption can be at genomic level, transcriptional level, post- transcriptional level, translational level, and/or post translational level.
- the methods comprise introducing one or more mutations into one or more KRP genes in the plant. In some embodiments, the methods comprise knocking-down expression of one or more KRP genes in the plant. In some embodiments, the methods comprise knocking-down KRP mRNAs stability in the plant. In some embodiments, the methods comprise down-regulating one or more KRP proteins activity in the plant.
- the methods comprise introducing one or more KRP mutants of the present invention into the genome of the plant.
- the methods comprise hybridizing a first plant having one or more mutated KRPs of the present invention with a second plant.
- the hybridizing step comprises crossing the first plant with the second plant.
- the hybridizing step comprises transferring the genetic materials in the first plant to the second plant through in vitro breeding, e.g., somatic hybridization.
- the methods comprise mutating one or more KRPs in a plant.
- Methods of mutating a target gene have been known to one skilled in the art. These methods include, but are not limited to, mutagenesis (e.g., chemical mutagenesis, radiation mutagenesis, transposon mutagenesis, insertional mutagenesis, signature tagged mutagenesis, site-directed mutagenesis, and natural mutagenesis), TILLING®, homologous recombination, knockouts/knock-ins, antisense and RNA interference.
- mutagenesis e.g., chemical mutagenesis, radiation mutagenesis, transposon mutagenesis, insertional mutagenesis, signature tagged mutagenesis, site-directed mutagenesis, and natural mutagenesis
- TILLING® homologous recombination
- knockouts/knock-ins antisense and RNA interference.
- Various types of mutagenesis can be used to produce and/
- mutagenesis include but are not limited to site-directed, random point mutagenesis, homologous recombination, DNA shuffling, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA or the like. Additional suitable methods include point mismatch repair, mutagenesis using repair- deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, and the like. Mutagenesis, e.g., involving chimeric constructs, is also included in the present invention.
- mutagenesis can be guided by known information of the naturally occurring molecule or altered or mutated naturally occurring molecule, e.g., sequence, sequence comparisons, physical properties, crystal structure or the like.
- sequence e.g., sequence, sequence comparisons, physical properties, crystal structure or the like.
- agents, protocols see reference Nos. 94 to 98, each of which is herein incorporated by reference in its entity).
- random mutations in KRP genes are created in vitro.
- a library of KRP genes with one or more random mutations can be generated, and the produced mutant KRP genes are subjected to the in vitro KRP-Cylin-CDK kinase assay described herein to determine if the mutant KRP genes can be used for increasing weight, size, and/or number of one or more organs, for example, for increasing seed size, seed number, seed weight and/or yield.
- Methods for in vitro mutagenesis include, but are not limited to error-prone PCR, Rolling circle error-prone PCR, mutator strains, temporary mutator strains, insertion mutagenesis, chemical mutagenesis (e.g., EMS, nitrous acid etc.), DNA shuffling, and site directed random mutagenesis. More methods are described in Chusacultanachai et al, Fujii et al., Braman, and Trower. Commercial random mutagenesis kits are available, such as Random Mutagenesis Kits from Jena Bioscience. cat. No. PP-101 , Diversify ⁇ PCR random mutagenesis kit from Clontech.
- mutated KRPs of the present invention are generated in vivo by methods such as TILLING®, site-directed mutagenesis, homologous recombination, etc.
- the produced mutant KRP genes are screened and subjected to the in vitro KRP-Cylin-CDK kinase assay described herein to determine if the mutant KRP genes can be used for increasing weight, size, and/or number of one or more organs, for example, for increasing seed size, seed number, seed weight and/or yield.
- the methods comprise knocking down expression of one or more KRPs in the plant.
- Techniques which can be employed in accordance with the present invention to knock down gene expression include, but are not limited to: (1) disrupting a gene's transcript, such as disrupting a gene's mRNA transcript; (2) disrupting the function of a polypeptide encoded by a gene, or (3) disrupting the gene itself.
- antisense RNA RNA, ribozyme, dsRNAi, RNA interference (RNAi) technologies can be used in the present invention to target RNA transcripts of one or more KRP genes.
- Antisense RNA technology involves expressing in, or introducing into, a cell an RNA molecule (or RNA derivative) that is complementary to, or antisense to, sequences found in a particular mRNA in a cell. By associating with the mRNA, the antisense RNA can inhibit translation of the encoded gene product.
- the use of antisense technology to reduce or inhibit the expression of specific plant genes has been described, for example in European Patent Publication No. 271988, Smith et al, Nature, 334:724-726 (1988); Smith et. al, Plant Mol. Biol., 14:369-379 (1990)).
- a ribozyme is an RNA that has both a catalytic domain and a sequence that is complementary to a particular mRNA.
- the ribozyme functions by associating with the mRNA (through the complementary domain of the ribozyme) and then cleaving (degrading) the message using the catalytic domain.
- RNA interference is the process of sequence-specific, post-transcriptional gene silencing or transcriptional gene silencing in animals and plants, initiated by double- stranded RNA (dsRNA) that is homologous in sequence to the silenced gene.
- dsRNA double- stranded RNA
- the RNAi technique is discussed, for example, in Elibashir, et al., Methods Enzymol. 26: 199 (2002); McManus & Sharp, Nature Rev. Genetics 3:737 (2002); PCT application WO 01/75164; Martinez et al, Cell 1 10:563 (2002); Elbashir et al., supra; Lagos-Quintana et al., Curr. Biol.
- dsRNA or "dsRNA molecule” or “double-strand RNA effector molecule” refers to an at least partially double-strand ribonucleic acid molecule containing a region of at least about 19 or more nucleotides that are in a double-strand conformation.
- the double- stranded RNA effector molecule may be a duplex double-stranded RNA formed from two separate RNA strands or it may be a single RNA strand with regions of self-complementarity capable of assuming an at least partially double-stranded hairpin conformation (i.e., a hairpin dsRNA or stem-loop dsRNA).
- the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as RNA/DNA hybrids.
- the dsRNA may be a single molecule with regions of self- complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule.
- the regions of self- complementarity are linked by a region of at least about 3-4 nucleotides, or about 5, 6, 7, 9 to 15 nucleotides or more, which lacks complementarity to another part of the molecule and thus remains single-stranded (i.e., the "loop region").
- Such a molecule will assume a partially double-stranded stem-loop structure, optionally, with short single stranded 5' and/or 3 ' ends.
- the regions of self-complementarity of the hairpin dsRNA or the double-stranded region of a duplex dsRNA will comprise an Effector Sequence and an Effector Complement (e.g., linked by a single-stranded loop region in a hairpin dsRNA).
- the Effector Sequence or Effector Strand is that strand of the double-stranded region or duplex which is incorporated in or associates with RISC.
- the double-stranded RNA effector molecule will comprise an at least 19 contiguous nucleotide effector sequence, preferably 19 to 29, 19 to 27, or 19 to 21 nucleotides, which is a reverse complement to the RNA of KRPs, or an opposite strand replication intermediate, or the anti-genomic plus strand or non-mRNA plus strand sequences of KRPs.
- said double-stranded RNA effector molecules are provided by providing to a plant, plant tissue, or plant cell an expression construct comprising one or more double-stranded RNA effector molecules.
- the expression construct comprise a double-strand RNA derived from any one of SEQ ID NOs 60-86, 100-107, 1 1 1 -128, 138-139, 141 -142, and 144-145.
- SEQ ID NOs 60-86, 100-107, 1 1 1 1 -128, 138-139, 141 -142, and 144-145 One skilled in the art will be able to design suitable double-strand RNA effector molecule based on the nucleotide sequences of KRPs in the present invention.
- the dsRNA effector molecule of the invention is a "hairpin dsRNA", a “dsRNA hairpin”, “short-hairpin RNA” or “shRNA”, i.e., an RNA molecule of less than approximately 400 to 500 nucleotides (nt), or less than 100 to 200 nt, in which at least one stretch of at least 15 to 100 nucleotides (e.g., 17 to 50 nt, 19 to 29 nt) is based paired with a complementary sequence located on the same RNA molecule (single RNA strand), and where said sequence and complementary sequence are separated by an unpaired region of at least about 4 to 7 nucleotides (or about 9 to about 15 nt, about 15 to about 100 nt, about 100 to about 1000 nt) which forms a single-stranded loop above the stem structure created by the two regions of base complementarity.
- the shRNA molecules comprise at least one stem-loop structure comprising a double-stranded stem region of about 17 to about 100 bp; about 17 to about 50 bp; about 40 to about 100 bp; about 18 to about 40 bp; or from about 19 to about 29 bp; homologous and complementary to a target sequence to be inhibited; and an unpaired loop region of at least about 4 to 7 nucleotides, or about 9 to about 15 nucleotides, about 15 to about 100 nt, about 100 to about 1000 nt, which forms a single-stranded loop above the stem structure created by the two regions of base complementarity.
- a plant of the present invention is used as a donor plant of genetic material which can be transferred to a recipient plant to produce a plant with desired agronomic traits which has the transferred genetic material and having increased weight, size, and/or number of one or more organs, for example, having increased seed weight, seed size, seed number and/or yield.
- Any suitable method known in the art can be applied to transfer genetic material from a donor plant to a recipient plant. In most cases, such genetic material is genomic material.
- a backcross breeding process comprises the following steps: (a) crossing a first wheat plants having one or more disrupted KRP genes with a second plant that comprise the desired trait(s); (b) selecting the Fi progeny plants that have the desired trait(s); (c) crossing the selected Fi progeny plants with the first wheat plant or the second wheat plant to produce backcross progeny plants; (d) selecting for backcross progeny plants that have the desired trait(s) and one or more disrupted KRP genes to produce selected backcross progeny plants; and (e) repeating steps (c) and (d) one, two, three, four, five six, seven, eight, nine, or more times in succession to produce selected, second, third, fourth, fifth, sixth, seventh, eighth, ninth, or higher backcross progeny plants that comprise said disrupted KRP genes, and/or the desired trait(s).
- the invention further provides methods for developing wheat varieties in a wheat breeding program using plant breeding techniques including recurrent selection, backcrossing, pedigree breeding, molecular markers (Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs). Amplified Fragment Length Polymorphisms (AFLPs), and Simple Sequence Repeats (SSRs) which are also referred to as Microsatellites, etc.) enhanced selection, genetic marker enhanced selection, and transformation. Seeds, plants, and part(s) thereof produced by such breeding methods are also part of the invention.
- molecular markers Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNA
- the whole genome of the plants of the present invention with disrupted KRP(s) is transferred into a recipient plant.
- This can be done by conventional breeding such as crossing, or somatic hybridization.
- at least the parts having the disrupted KRP(s) of the donor plant's genome are transferred. This can be done by crossing donor plants to a recipient plant to create a F 1 plant, followed with one or more backcrosses to one of the parent plants to give plants with the desired genetic background.
- Molecular marker assisted breeding can be utilized to monitor the transfer of the genetic material.
- the produced offsprings can be selected for having increased weight, size, and/or number of one or more organs, for example, having increased seed weight, seed size, seed number and/or yield.
- the recipient plant is an elite line having one or more certain agronomically important traits.
- agronomically important traits include any phenotype in a plant or plant part that is useful or advantageous for human use. Examples of agronomically important traits include but are not limited to those that result in increased biomass production, increased food production, improved food quality, decrease in cracking, quicker color change when the fruit matures etc. Additional examples of agronomically important traits includes pest resistance, vigor, development time (time to harvest), enhanced nutrient content, increase in seed oil content, novel growth patterns, flavors or colors, salt, heat, drought and cold tolerance, and the like.
- agronomically important traits include resistance to biotic and/or abiotic stresses.
- the phrase “biotic stress” or “biotic pressure” refers to a situation where damage is done to plants by other living organisms, such as bacteria, viruses, fungi, parasites, insects, weeds, animals and human.
- the phrase “abiotic stress” or “abiotic pressure” refers to the negative impact of non-living factors on plants in a specific environment. The non-living variable must influence the environment beyond its normal range of variation to adversely affect the population performance or individual physiology of plants in a significant way.
- Non-limiting examples of stressors are high winds, extreme temperatures, drought, flood, and other natural disasters, such as tornados and wildfires.
- the method comprises i) making a cross between a plant with one or more disrupted KRP genes to a second plant to produce a Fl plant, for example, a wheat, a rice, or a soybean plant with one or more disrupted KRP genes.
- the method further comprises ii) backcrossing the Fl plant to the first or the second plant; and Hi) repeating the backcrossing step to generate a near isogenic line, wherein the one or more disrupted KRPs are integrated into the genome of the second plant.
- the disrupted KRP gene is a wheat KRP selected from the group consisting of TaKRPlA, TaKRPlB, TaKRPID, TaKRP2A, TaKRP2B, TaKRP2D, TaKRP4A, TaKRP4B, TaKRP4D, TaKRP5A, TaKRPSB, TaKRP5D, TaKRP6A, TaKRP6B, or TaKRP6D, for example, SEQ ID NOs. 60-86, 138- 139, 141-142, and 144-145, or functional variants thereof.
- the first plant comprises one or more mutations selected from any one of mutations listed in Tables 2 - 12 for a particular KRP gene.
- the disrupted KRP gene is a rice KRP selected from the group consisting of OsKRPl, OSKRP2, OsKRP4, and OsKRP5, for example, SEQ ID NOs. 100- 107, or functional variants thereof.
- the first plant comprises one or more mutations selected from any one of mutations listed in Table 25 for a particular KRP gene.
- the disrupted KRP gene is a soybean KRP.
- the KRP is selected from the group consisting of Gm0003x00821 , Gm0013x00399, Gm0043, Gm0053x00526, Gm0087x00306, Gm0102x00087, GraOl 19x00131 , Gra0151 x00019, Gm0067x00001, for example, SEQ ID NOs. 1 1 1-128, or functional variants thereof.
- the first plant comprises one or more mutations selected from any one of mutations listed in Tables 29 - 37 for a particular KRP gene.
- the methods of the present invention can increase the average weight, size, and/or number of one or more organs, for example, the average seed weight, seed size, seed number and/or yield of a plant by at least 5%, at least 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %,
- the mutated KRPs in a plant genome can be viewed as quantitative trait loci (QTLs) related to weight, size, and/or number of one or more organs, for example, QTLs related to seed weight, seed size, seed number and/or yield of for yield.
- QTLs quantitative trait loci
- a QTL is a region of DNA that is associated with a particular phenotypic trait - these QTLs are often found on different chromosomes. Knowing the number of QTLs that explains variation in a particular phenotypic trait informs about the genetic architecture of the trait. It may tell that plant with preferred phenotype is controlled by many genes of small effect, or by a few genes of large effect. Therefore, QTL mapping can be applied to determine the parts of the donor plant's genome comprising the mutated KRPs, and facilitate the breeding methods.
- One or more of such QTLs of mutated KRPs in a donor can be transferred to a recipient plant, confirming the phenotype of having increased weight, size, and/or number of one or more organs, for example, having increased seed weight, seed size, seed number, and/or yield.
- the QTLs related to mutated KRPs can be combined with one or more other QTLs that contribute to agriculturally important phenotypes, such as yield enhancement, resistance to biotic and abiotic stresses, etc.
- the primers in the present invention used for genotyping the mutated KRPs can be used as molecular markers indicating the presence or absence of the mutated KRPs. Instead, molecular marks closely linked to the mutated KRPs can be also used. Methods of developing molecular markers and their applications are described by Avise (Molecular markers, natural history, and evolution, Publisher: Sinauer Associates, 2004, ISBN
- a plant having one or more disrupted KRPs may have one or more other phenotypes that are agriculturally or industrially important, which include, but are not limited to, increased plant vigor, organ size, increased adaptability to the environment, increased oil production, increased biomass production, and traits that allow a plant to grow better under certain environments with specific temperatures, soil conditions and levels of sunlight and precipitation compared to a wild type control plant.
- the composition of the medium particularly the plant hormones and the nitrogen source (nitrate versus ammonium salts or amino acids) have profound effects on the morphology of the tissues that grow from the initial explant.
- an excess of auxin will often result in a proliferation of roots, while an excess of cytokinin may yield shoots.
- a balance of both auxin and cytokinin will often produce an unorganized growth of cells, or callus, but the morphology of the outgrowth will depend on the plant species as well as the medium composition.
- cultures grow pieces are typically sliced off and transferred to new media (subcultured) to allow for growth or to alter the morphology of the culture.
- the skill and experience of the tissue culturist are important in judging which pieces to culture and which to discard.
- shoots emerge from a culture they may be sliced off and rooted with auxin to produce plantlets which, when mature, can be transferred to potting soil for further growth in the greenhouse as normal plants.
- explant The tissue obtained from the plant to culture is called an explant. Based on work with certain model systems, particularly tobacco, it has often been claimed that a totipotent explant can be grown from any part of the plant. However, this concept has been vitiated in practice. In many species explants of various organs vary in their rates of growth and regeneration, while some do not grow at all. The choice of explant material also determines if the plantlets developed via tissue culture are haploid or diploid. Also the risk of microbial contamination is increased with inappropriate explants. Thus it is very important that an appropriate choice of explant be made prior to tissue culture.
- tissue explants are the meristematic ends of the plants like the stem tip, auxiliary bud tip and root tip. These tissues have high rates of cell division and either concentrate or produce required growth regulating substances including auxins and cytokinins.
- Some explants, like the root tip, are hard to isolate and are contaminated with soil microflora that become problematic during the tissue culture process. Certain soil microflora can form tight associations with the root systems, or even grow within the root.
- Soil particles bound to roots are difficult to remove without injury to the roots that then allows microbial attack. These associated microflora will generally overgrow the tissue culture medium before there is significant growth of plant tissue. Aerial (above soil) explants are also rich in undesirable microflora. However, they are more easily removed from the explant by gentle rinsing, and the remainder usually can be killed by surface sterilization. Most of the surface microflora do not form tight associations with the plant tissue. Such associations can usually be found by visual inspection as a mosaic, de- colorization or localized necrosis on the surface of the explant.
- An alternative for obtaining uncontaminated explants is to take explants from seedlings which are aseptically grown from surface-sterilized seeds.
- the hard surface of the seed is less permeable to penetration of harsh surface sterilizing agents, such as hypochlorite, so the acceptable conditions of sterilization used for seeds can be much more stringent than for vegetative tissues.
- Tissue cultured plants are clones, if the original mother plant used to produce the first explants is susceptible to a pathogen or environmental condition, the entire crop would be susceptible to the same problem, and conversely any positive traits would remain within the line also.
- Plant tissue culture is used widely in plant science; it also has a number of commercial applications. Applications include:
- Micropropagation is widely used in forestry and in floriculture. Micropropagation can also be used to conserve rare or endangered plant species.
- a plant breeder may use tissue culture to screen cells rather than plants for advantageous characters, e.g. pathogen resistance/tolerance.
- Certain techniques such as meristem tip culture can be used to produce clean plant material from infected stock, such as potatoes and many species of soft fruit.
- Non-limiting exemplary tissue culture methods for wheat, rice, maize have been described by Trione et al, Dodig, et al, O'Hara et al, Zaidi et al, Wang et al., Ting et al., Hawes et al, and Sheridan, each of which is incorporated by reference in its entirety.
- the present invention also provides a cutting, a rootstock, a scion, or an explant from the plants of the present invention.
- grafting is a method of asexual plant propagation widely used in agriculture and horticulture where the tissues of one plant are encouraged to fuse with those of another. It is most commonly used for the propagation of trees and shrubs grown commercially. In most cases, one plant is selected for its roots, and this is called the stock or rootstock. The other plant is selected for its stems, leaves, flowers, or fruits and is called the scion. The scion contains the desired genes to be duplicated in future production by the stock/scion plant.
- stem grafting a common grafting method, a shoot of a selected, desired plant cultivar is grafted onto the stock of another type. In another common form called budding, a dormant side bud is grafted on the stem of another stock plant, and when it has fused successfully, it is encouraged to grow by cutting out the stem above the new bud.
- vascular cambium tissues of the stock and scion plants must be placed in contact with each other. Both tissues must be kept alive until the graft has taken, usually a period of a few weeks. Successful grafting only requires that a vascular connection takes place between the two tissues. A physical weak point often still occurs at the graft, because the structural tissue of the two distinct plants, such as wood, may not fuse.
- Exemplary grafting techniques include, approach grafting, budding grafting (patch budding, chip budding, T-budding), cleft grafting, side grafting, whip grafting, stub grafting, awl grafting, veneer grafting, bark grafting, tongue grafting, et al.
- grafting methods for wheat and maize are described by Lacadena, 1968, and Katsumi et al., each of which is incorporated by reference in its entirety.
- the polynucleotides of the present invention can be transformed into a plant.
- the most common method for the introduction of new genetic material into a plant genome involves the use of living cells of the bacterial pathogen Agrobacterium tumefaciens to literally inject a piece of DNA, called transfer or T-DNA, into individual plant cells (usually following wounding of the tissue) where it is targeted to the plant nucleus for chromosomal integration.
- Agrobacterium-mediated plant transformation involves as a first step the placement of DNA fragments cloned on plasmids into living Agrobacterium cells, which are then subsequently used for transformation into individual plant cells.
- Agrobacterium- mediated plant transformation is thus an indirect plant transformation method.
- Methods of Agrobacterium-mediated plant transformation that involve using vectors with no T-DNA are also well known to those skilled in the art and can have applicability in the present invention. See, for example, U.S. Patent No. 7,250,554, which utilizes P-DNA instead of T-DNA in the transformation vector.
- a third direct method uses fibrous forms of metal or ceramic consisting of sharp, porous or hollow needle-like projections that literally impale the cells, and also the nuclear envelope of cells.
- silicon carbide and aluminum borate whiskers have been used for plant transformation (Mizuno et al., 2004; Petolino et al., 2000; US5302523 US Application 20040197909) and also for bacterial and animal transformation (Kaepler et al., 1992; Raloff, 1990; Wang, 1995).
- bacterial and animal transformation Korean epler et al.
- a selection method For efficient plant transformation, a selection method must be employed such that whole plants are regenerated from a single transformed cell and every cell of the transformed plant carries the DNA of interest.
- These methods can employ positive selection, whereby a foreign gene is supplied to a plant cell that allows it to utilize a substrate present in the medium that it otherwise could not use, such as mannose or xylose (for example, refer US 5767378; US 5994629). More typically, however, negative selection is used because it is more efficient, utilizing selective agents such as herbicides or antibiotics that either kill or inhibit the growth of nontransformed plant cells and reducing the possibility of chimeras. Resistance genes that are effective against negative selective agents are provided on the introduced foreign DNA used for the plant transformation.
- nptll neomycin phosphotransferase
- many different antibiotics and antibiotic resistance genes can be used for transformation purposes (refer US 5034322, US 6174724 and US 6255560).
- herbicides and herbicide resistance genes have been used for transformation purposes, including the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., Nucl Acids Res 18: 1062 (1990), Spencer et al, Theor Appl Genet 79: 625-631(1990), US 4795855, US 5378824 and US 6107549).
- the dhfr gene which confers resistance to the anticancer agent methotrexate, has been used for selection (Bourouis et al, EMBO J. 2(7): 1099-1 104 (1983).
- the expression control elements used to regulate the expression of a given protein can either be the expression control element that is normally found associated with the coding sequence (homologous expression element) or can be a heterologous expression control element.
- a variety of homologous and heterologous expression control elements are known in the art and can readily be used to make expression units for use in the present invention.
- Transcription initiation regions can include any of the various opine initiation regions, such as octopine, mannopine, nopaline and the like that are found in the Ti plasmids of Agrobacterium tumefaciens.
- plant viral promoters can also be used, such as the cauliflower mosaic virus 19S and 35S promoters (CaMV 19S and CaMV 35S promoters, respectively) to control gene expression in a plant (U.S. Patent Nos. 5,352,605; 5,530, 196 and 5,858,742 for example).
- Enhancer sequences derived from the CaMV can also be utilized (U.S. Patent Nos. 5,164,316; 5,196,525; 5,322,938; 5,530,196; 5,352,605; 5,359,142; and 5,858,742 for example).
- plant promoters such as prolifera promoter, fruit specific promoters, Ap3 promoter, heat shock promoters, seed specific promoters, etc. can also be used.
- Either a gamete specific promoter, a constitutive promoter (such as the CaMV or Nos promoter), an organ specific promoter (e.g., stem specific promoter), or an inducible promoter is typically ligated to the protein or antisense encoding region using standard techniques known in the art.
- the expression unit may be further optimized by employing supplemental elements such as transcription terminators and/or enhancer elements.
- the expression cassette can comprise, for example, a seed specific promoter (e.g. the phaseolin promoter (U.S. Pat. No. 5,504,200).
- seed specific promoter means that a gene expressed under the control of the promoter is predominantly expressed in plant seeds with no or no substantial expression, typically less than 10% of the overall expression level, in other plant tissues.
- Seed specific promoters have been well known in the art, for example, US Patent Nos. 5,623,067, 5,717, 129, 6,403,371, 6,566,584, 6,642,437, 6,777,591 , 7,081 ,565, 7, 157,629, 7, 192,774, 7,405,345, 7,554,006, 7,589,252, 7,595,384, 7,619,135, 7,642,346, and US Application Publication Nos. 20030005485, 20030172403, 20040088754, 20040255350, 20050125861 , 20050229273, 20060191044, 20070022502, 200701 18933, 20070199098, 20080313771, and 20090100551.
- the expression units will typically contain, in addition to the protein sequence, a plant promoter region, a transcription initiation site and a transcription termination sequence.
- Unique restriction enzyme sites at the 5' and 3' ends of the expression unit are typically included to allow for easy insertion into a preexisting vector.
- the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
- the expression cassette can also contain a transcription termination region downstream of the structural gene to provide for efficient termination.
- the termination region may be Obtained from the same gene as the promoter sequence or may be obtained from different genes.
- DNA sequences which direct polyadenylation of the RNA are also commonly added to the vector construct.
- Polyadenylation sequences include, but are not limited to the Agrobacterium octopine synthase signal (Gielen et al, EMBO J 3:835-846 (1984)) or the nopaline synthase signal (Depicker et al, Mol. and Appl. Genet. 1 :561 -573 (1982)).
- the resulting expression unit is ligated into or otherwise constructed to be included in a vector that is appropriate for higher plant transformation.
- One or more expression units may be included in the same vector.
- the vector will typically contain a selectable marker gene expression unit by which transformed plant cells can be identified in culture.
- the marker gene will encode resistance to an antibiotic, such as G418, hygromycin, bleomycin, kanamycin, or gentamicin or to an herbicide, such as glyphosate (Round-Up) or glufosinate (BASTA) or atrazine.
- Replication sequences of bacterial or viral origin, are generally also included to allow the vector to be cloned in a bacterial or phage host, preferably a broad host range prokaryotic origin of replication is included.
- a selectable marker for bacteria may also be included to allow selection of bacterial cells bearing the desired construct. Suitable prokaryotic selectable markers include resistance to antibiotics such as ampicillin, kanamycin or tetracycline.
- Other DNA sequences encoding additional functions may also be present in the vector, as is known in the art. For instance, in the case of Agrobacterium transformations, T-DNA sequences will also be included for subsequent transfer to plant chromosomes.
- Genes can be introduced in a site directed fashion using homologous recombination. Homologous recombination permits site specific modifications in endogenous genes and thus inherited or acquired mutations may be corrected, and/or novel alterations may be engineered into the genome. Homologous recombination and site-directed integration in plants are discussed in, for example, U.S. Patent Nos. 5,451 ,513; 5,501 ,967 and 5,527,695.
- Transgenic plants can now be produced by a variety of different transformation methods including, but not limited to, electroporation; microinjection; microprojectile bombardment, also known as particle acceleration or biolistic bombardment; viral-mediated transformation; and Agrobacterium-mediated transformation. See, for example, U.S. Patent Nos. 5,405,765; 5,472,869; 5,538,877; 5,538,880; 5,550,318; 5,641 ,664; 5,736,369 and 5,736,369; International Patent Application Publication Nos.
- Agrobacterium tumefaciens is a naturally occurring bacterium that is capable of inserting its DNA (genetic information) into plants, resulting in a type of injury to the plant known as crown gall.
- Most species of plants can now be transformed using this method, including cucurbitaceous species.
- Microprojectile bombardment is also known as particle acceleration, biolistic bombardment, and the gene gun (Biolistic® Gene Gun).
- the gene gun is used to shoot pellets that are coated with genes (e.g., for desired traits) into plant seeds or plant tissues in order to get the plant cells to then express the new genes.
- the gene gun uses an actual explosive (.22 caliber blank) to propel the material. Compressed air or steam may also be used as the propellant.
- the Biolistic® Gene Gun was invented in 1983-1984 at Cornell University by John Sanford, Edward Wolf, and Nelson Allen. It and its registered trademark are now owned by E. I. du Pont de Nemours and Company. Most species of plants have been transformed using this method.
- a transgenic piant formed using Agrobacterium transformation methods typically contains a single gene on one chromosome, although multiple copies are possible. Such transgenic plants can be referred to as being hemizygous for the added gene. A more accurate name for such a plant is an independent segregant, because each transformed plant represents a unique T-DNA integration event (U.S. Patent No. 6,156,953).
- a transgene locus is generally characterized by the presence and/or absence of the transgene.
- a heterozygous genotype in which one allele corresponds to the absence of the transgene is also designated hemizygous (U.S. Patent No. 6,008,437).
- wheat seeds of tetraploid wheat are provided.
- the seeds were then rinsed under running water for about 1 hour. Finally, the mutagenized seeds were planted (96/tray) in potting soil and allowed to germinate indoors. Plants that were four to six weeks old were transferred to the field to grow to fully mature Ml plants. The mature Ml plants were allowed to self-pollinate and then seeds from the Ml plant were collected and planted to produce M2 plants.
- DNA from these M2 plants was extracted and prepared in order to identify which M2 plants carried a mutation at their KRP loci.
- the M2 plant DNA was prepared using the methods and reagents contained in the Qiagen ® (Valencia, CA) DNeasy ® 96 Plant Kit. Approximately 50 mg of frozen plant sample was placed in a sample tube with a tungsten bead, frozen in liquid nitrogen and ground 2 times for 1 minute each at 20 Hz using the Retsch ® Mixer Mill MM 300. Next 400 ⁇ of solution API [Buffer AP I , solution DX and RNAse (100 mg/ml)] at 80° C was added to the sample. The tube was sealed and shaken foi ⁇ ls seconds.
- the tube was shaken for 15 seconds.
- the samples were placed in a freezer at minus 20° C for at least 1 hour.
- the samples were then centrifuged for 20 minutes at 5,600 X g.
- a 400 ⁇ aliquot of supernatant was transferred to another sample tube.
- this sample tube was capped and shaken for 15 seconds.
- a filter plate was placed on a square well block and 1ml of the sample solution was applied to each well and the plate was sealed. The plate and block were centrifuged for 4 minutes at 5,600 X g.
- the M2 DNA was pooled into groups of two individual plants.
- the DNA concentration for each individual within the pool was approximately 1 to 2 ng/ ⁇ with a final concentration of 2 to 4 ng./ ⁇ for the entire pool.
- 5 or 10 ⁇ of the pooled DNA samples (or 10 to 40 ng) was arrayed on microtiter plates and subjected to gene-specific PCR.
- PCR amplification was performed in 15 or 20 ⁇ reaction volumes containing 10 to 40 ng pooled DNA.
- a reaction included 1.24 ⁇ of 10X ExTaq buffer (Takara ® '), 0.73 ⁇ of 25mM MgCl 2 , 1.98 ⁇ of 10 mM dNTPs, 0.066 ⁇ of 100 ⁇ primer mix, and 0.1 1 ⁇ of 5U/ ⁇ Ex-Taq (Takara ® ' ) DNA polymerase, with 6.87 ⁇ H 2 0.
- PCR additives such as dimethyl sulfoxide (DMSO), betaine or Polymer- Aide PCR Enhancer (Sigma Aldrich ® , St. Louis, MO) can be used to increase PCR efficiency.
- PCR amplification was performed using an MJ Research ® thermal cycler as follows: 95° C for 2 minutes; 8 cycles of "touchdown PCR" (94° C for 20 second, followed by annealing step starting at 70-68° C for 30 seconds and decreasing 1° C per cycle, then a temperature ramp of 0.5° C per second to 72° C followed by 72° C for 1 minute); 25-45 cycles of 94° C for 20 seconds, 63-67.5° C for 30 seconds, ramp 0.5° C/sec to 72° C, 72° C for 1 minute; 72° C for 8 minutes; 98° C for 8 minutes; 80° C for 20 seconds; 60 cycles of 80° C for 7 seconds -0.3 degrees/cycle.
- the PCR primers (Eurofms MWG/Operon, Huntsville, AL) were mixed as follows: 12.5% 100 ⁇ IRD-700 labeled left primer
- a label can be attached to each primer as described or to only one of the primers. Alternatively, Cy5.5 modified primers could be used. The label was coupled to the oligonucleotide using conventional phosphoramidite chemistry.
- PCR products (15 or 20 ⁇ ) were digested in 96-well plates.
- Reactions were stopped by addition of 10 ⁇ of a 2.5 M NaCl solution with 0.5 mg/ml blue dextran and 75 mM EDTA, followed by the addition of 80 ⁇ isopropanol.
- the reactions were precipitated at room temperature, spun at 4,000 rpm for 30 minutes in an Eppendorf Centrifuge 5810. Pellets were resuspended in 6 ⁇ of 33% formamide with 0.017%) bromophenol blue dye, heated at 80 0 C for 7 minutes and then at 95 0 C for 5 minutes.
- Samples were transferred to a membrane comb using a comb-loading robot (MWG Biotech). The comb was inserted into a slab aery lamide gel (6.5%) and electrophoresed for 4h 15min at 1 ,500-V, 40- W, and 40-mA limits at 50° C.
- the gel was imaged using a LI-COR ® (Lincoln, NE) scanner which was set at a channel capable of detecting the IR Dye 700 and 800 labels.
- the gel image showed sequence-specific pattern of background bands common to all 96 lanes. Rare events, such as mutations, create new bands that stand out above the background pattern. Plants with bands indicative of mutations of interest were evaluated by TILLING ® individual members of a pool mixed with wild type DNA and then sequencing individual PCR products.
- Genome-specific primers were designed and used to TILL for wheat KRPs (Table 1).
- TaKRP l B R TAATGCTTCTTTCCGGAGCATCTTTTTCC 9
- TaKRP I D L GGATACAATTCGAGATCTCCTTTTTGCTG 10
- TaKRP I D R TAATGCTTCTTTCCGGAGCATCTTTTTCC 1 1
- TaKRP2B2 altR GCCGTGGCCTAGTGAAAGGTAAAAAGAAA 15
- KRP4D L 2 3 NEW TTACGACCACGGATGATATCGATATGTG 20
- TaKRP5 ALL EST R GAGCTACTGCTGACTGCGGGCTAACTCTA 25
- ⁇ number after genome letter refers to the exons or the region of the KRP gene TILL'ed. i.e. 2-4 mean exons 2-4, and the number 2 means the latter half of the gene (includes the cyclin/CDK binding domains).
- the number 1 means the first part of the KRP gene, excluding the cyclin/CDK binding domains.
- the designation "2" indicates that exons 2-3 of wheat KRP4B were TILLed.
- Amino acid numbering does not start from the beginning Methionine.
- the designation "2" indicates that exons 2-4 of wheat KRP2B were TILLed.
- a Amino acid numbering does not start from the beginning Methionine.
- Amino acid numbering does not start from the beginning Methionine.
- ANucleotide numbering is dependent upon the location of TILLING ⁇ primers.
- Amino acid numbering does not start from the beginning Methionine.
- ANucleotide numbering is dependent upon the location of TILLING® primers. Table 11. Summar of Triticum aestivum hexa loid KRP5A mutants
- Amino acid numbering does not start from the beginning Methionine.
- ANucleotide numbering is dependent upon the location of TILLING® primers.
- Amino acid numbering does not start from the beginning Methionine.
- ANucleotide numbering is dependent upon the location of TILLING® primers.
- the wheat KRP TILLING® mutants are prioritized for the breeding program in the following manner: 1) Nonsense and splice mutants; 2) Type I severe missense; and 3) Type II severe missense.
- Type I severe missense mutations are non-conservative amino acid substitutions in regions of the KRP protein known to be essential for binding to cyclin or cyclin-dependent kinase (CDK) and are predicted by SIFT analysis to be deleterious to protein function.
- Type II severe missense mutations are non-conservative amino acid substitutions outside of the cyclin and CDK binding domains but which satisfy two additional criteria. First, they are in regions of the protein determined by BLOCKS analysis ⁇ Henikoff, S. and Henikoff, J. G.
- Tables 13 to 22 list wheat KRP TILLING® mutants that are in the breeding program and is a subset of the mutants listed in Tables 2 to 12.
- a given wheat (WH) group is a number that identifies a particular mutation in a particular gene.
- Wheat krp mutant alleles are introgressed into other spring and winter wheat to transfer the yield enhancement to commercial varieties.
- Crosses between mutants are done to generate multiple stack mutants within a given KRP gene (e.g. krplA/ ⁇ , krplB/krplD, krplA/lB/lD, etc., all possible combinations) or across different KRP genes (e.g. krplA/2A, krp2B/krp4B, krp4D/krp5A, krplB/krp2A/krp5D, etc., all possible combinations).
- KRP gene e.g. krplA/ ⁇ , krplB/krplD, krplA/lB/lD, etc., all possible combinations
- the overall grain yield per unit area is determined (e.g. lbs/acre) and yield components such as seed count, seed size/weight (thousand kernel weight), seed per spike, head (spike) number, spike length, awn length, and/or tiller number, are measured.
- nucleotide numbering is as given in Table 8.
- nucleotide numbering is as given in Table 9.
- Wheat KRP TILLING® mutations were genotyped by allelic discrimination primer/probe sets in a real-time PCR assay. First, genome-specific primers were used to amplify a given wheat KRP gene from a wheat genomic sample. The amplification product was then genotyped in a Taqman® allelic discrimination assay (AD assay, Applied Biosystems). The following is a specific example of an assay to genotype KRP4B2 P109L.
- PCR reaction contained 2 ⁇ L genomic DNA, 2.6 iL 10X Ex Taq reaction buffer, 2.0 2.5 mM dNTPs, 0.75 ⁇ each of 5 mM forward and reverse primers, 0.1 Ex Taq polymerase (5 units/ L, TaKaRa) and 17.8 ⁇ 3 ⁇ 40 in a total reaction volume of 26 iL.
- PCR amplification conditions were: initial denaturation at 94°C, 2 min; 40 cycles of 94°C, 30 sec, 58°C, 30 sec, 72°C, l min 30 sec; final extension at 72°C, 5 min.
- flanking forward primer TGTGTATGTATGTTTTGTGGCTAGCA, SEQ ID NO: 30
- flanking reverse primer CGTTCCCGAGTCCCTAATCAAG SEQ ID NO: 31
- FAM - C TGC AGA GCG TCG TC - MGB - NFQ SEQ ID NO: 33 FAM - C TGC AGA GCG TCG TC - MGB - NFQ SEQ ID NO: 33
- the PCR reaction contained 2 ⁇ , of KRP4B2 amplification product, 3 ⁇ ABI genotyping real time PCR master mix and 1 ⁇ ⁇ 6X (5.4 ⁇ each primer/1.2 ⁇ each probe) SNP-specific AD assay primer/probe mix in a total reaction volume of 6 ⁇ ⁇ .
- the real-time PCR was conducted on an ABI real-time machine per ABI PCR conditions.
- Figure 1 A- 1 C demonstrates that primer/probes can be designed to distinguish between wild type and mutant KRP4B alleles in an AD assay.
- a mutant heterozygous for the KRP4B P109L allele was confirmed by sequencing ( Figure ID).
- Figure 2 further shows that populations of samples homozygous for the wild type KRP4B allele, homozygous for the mutant KRP4B P109L allele, or heterozygous for the mutant KRP4B P 109L allele can be easily distinguished in an AD assay.
- Recombinant ZmCyclinD4 and ZmCDKA;l were produced in and the complex isolated from S. frugiperda Sf9 insect cells. All wild-type TaKRP genes were synthesized by DNA2.0.
- the baculovirus expression system is a versatile eukaryotic system for heterologous gene expression. This system provides correct protein folding, disulfide bond formation and other important post-translational modifications. All methods were taken from the Baculovirus expression vector system: Procedures and methods manual. (BD Biosciences, Pharmingen, San Diego, Calif. 6th Ed.). Sf9 insect cells were grown at 27° C. in TNM-FH insect cell media (BD Biosciences) for the reported studies. It should be noted that alternative media are well known to the skilled artisan and are also useful. Similarly, alternative insect cell lines such as Sf21 and High FiveTM cells will also work for virus production and protein production.
- the recombinant protein expressed in insect cells was monitored by Western blot.
- Protein extracts 35 ⁇ g were boiled in the presence of Laemmli buffer, run on 10% or 12% SDS-PAGE gels and transferred to a PVDF membrane using a submerged transfer apparatus (BioRad). Following the transfer, the membrane was blocked in TBS-T (25 raM Tris pH 7.5; 75 mM NaCl; 0.05% Tween) containing 5% non-fat dry milk powder.
- Primary antibody was used at 1 : 1000 dilution overnight in TBS-T blocking buffer. Blots were washed three times 15 minutes at room temperature.
- HRP horse radish peroxidase
- the Baculovirus system was Bac-to-bac (Invitrogen). Alternative Baculovirus genomes can also be used. All bacmids containing our genes of interest were independently transfected into 293 cells using lipid based transfection reagents such as Fugene or Lipofectamine. S. frugiperda Sf9 cells were seeded at 9 x 10 6 cells on 60 mm dish and transiently transfected with 1 ⁇ g bacmid using 3 ⁇ 1 Fugene 6 transfection reagent according to the manufacturer's protocol (Roche Diagnostics). After 4 hours of transfection the Fugene/DNA solution was removed and replaced with 3 ml of TNM-FH media.
- lipid based transfection reagents such as Fugene or Lipofectamine.
- S. frugiperda Sf9 cells were seeded at 9 x 10 6 cells on 60 mm dish and transiently transfected with 1 ⁇ g bacmid using 3 ⁇ 1 Fugene 6 transfection reagent according to the manufacturer
- the virus titer was amplified by infecting Sf9 cells at a multiplicity of infection (moi) of ⁇ 1. The virus titer was monitored using light and fluorescence microscopy.
- Phosphate lysis buffer 100 mM Phosphate buffer pH 7.0, 150 mM NaCl, 1 % Triton XI 00
- the resuspended bacterial culture was lysed via a French press or repeated sonication. Lysed cells were centrifuged at 14,000 rpm in a Beckman JA20.1 rotor for 15 minutes at 4°C.
- Tagged KRP molecules were mainly insoluble. Insoluble tagged KRPs were solubilized in Urea buffer (8M Urea, 100 mM Phosphate buffer pH 7.0) manually with a pipette aid.
- .Urea-insoluble proteins were eliminated by centrifugation at 14,000 rpm in a Beckman JA20.1 rotor for 15 minutes at 4°C.
- Tagged KRPs were purified in batch using BD Talon Co 2+ metal affinity resin equilibrated in Urea buffer. Batch purification was incubated at 4°C 3 hrs to overnight under slow rotation. Slurry was loaded on a column and resin was washed with 36 bed volumes of Urea buffer followed by 12 bed volumes of Urea buffer containing 5 mM Imidazole pH 7.0. Bound tagged KRP protein was eluted using Urea buffer containing 300 mM Imidazole pH 7.0.
- Fractions were monitored for tagged KRP by SDS-PAGE and/or by Bradford protein assay (BioRad). Refolding of the denatured tagged KRPl was carried out using step-wise dilution dialysis. Fractions containing the majority of tagged KRP protein were combined and dialyzed in a 1 M Urea, 100 mM Phosphate buffer pH 7.0, and ImM Dithiothreitol for 20 hrs at 4°C. Dialysis buffer was then changed to 0.5 M Urea, 100 mM Phosphate buffer pH 7.0, and ImM Dithiothreitol and continued for an additional 12 hrs. Recombinant protein was collected, quantified by Bradford assay and stored at 4°C.
- TaKRP4A W186* ( Figures 4 and 6A)
- TaKRP 5 A W199* ( Figure 5) did not inhibit the kinase activity of ZmCyclinD4/ZmCDKA; 1 at 0.1 , 0.25 or 0.5 ⁇ g.
- TaKRP 1 A W240* also did not inhibit the kinase activity of ZmCyclinD4/ZmCDKA; 1 at 0.1 , 0.25 or 0.5 ⁇ g, although its inhibitory activity was not as compromised at 0.25 and 0.5 g ( Figures 4 and 6 A).
- TaKRP 1 A G236S could only strongly inhibit ZmCyclinD4/ZmCDKA; l at 0.5 ⁇ g and weakly at 0.25 ⁇ g ( Figure 4).
- TaKRP2D P228S could only strongly inhibit ZmCyclinD4/ZmCDKA;l at 0.5 g and very weakly at 0.25 ⁇ g ( Figure 4).
- TaKRP4A W186*, TaKRP5A W199* and TaKRP 1 A W240* contain premature stop codons very close to the end of the KRP proteins and thus still retain the cyclin- and CDK-binding domains.
- the elimination of the last 8 amino acids for TaKRP 1 A W240*, the last 6 amino acids for TaKRP5A W199* and the last 5 amino acids for TaKRP4A W186* compromises the ability of the mutant KRPs to inhibit the kinase complex.
- mutants such as TaKRP 1 A P232L ( Figure 4), TaKRP2D A238V (Figure 5), TaKRP2D A239T ( Figure 5), TaKRP2D D254N ( Figure 4) and TaKRP2D R257C ( Figure 4), inhibit the ZmCyclinD4/ZmCDKA;l complex as well as their wild-type counterparts at the indicated protein concentrations.
- the M5 generation of selected wheat KRP TILLING ⁇ mutants were grown in Yuma, AZ in fall 2009-winter 2010 to determine yield. Sixty entries (Table 24) were in the yield trial, with each entry being replicated three times randomly throughout the trial. Each plot was 4 ft by 10 ft with 7 rows per plot and 7 inches between rows. About 75g of seed were planted per plot, or about 2500 seeds/plot or about 360 seeds per 10-ft row. Planting took place in October.
- the wild type segregant of a given homozygous or heterozygous KRP TILLING® mutant was planted for comparison.
- the parent variety, Express was also included in the trial. The stand rate was taken prior to harvest, the maturity rate was taken at flowering, and the peduncle rate, head number, kernel number, spike length and awn length were taken after harvest from subsamples. Maturity rate and peduncle rate were on a comparative scoring system, relative to the Express background parent. Maturity: 1 is early, 3 is similar to Express, 5 is late/vegetative. Peduncle: 1 is very thin, 3 is similar to Express, 5 is very thick (Table 24).
- WH3, WH91 , WH124, WH4 and WH16 (Table 24).
- WH68 (KRP4D, P146L) was ranked first in yield at 3584.90 lbs/acre.
- a mutant, WH16, ranked seventh in yield interestingly has two mutations within the KRP2A gene (V258M and G169S).
- a rice TILLING® library was screened for mutations in rice KRPs 1, 2, 4 and 5 (SEQ ID NOs: 100-107).
- a mutant containing a premature stop codon in OsKRP4 was identified (Table 25).
- M3 seeds from two distinct M2 sibling plants heterozygous for the R167* mutation were planted in the greenhouse and genotyped to identify plants homozygous for the R167* allele or homozygous for the wild type allele. Homozygous R167* and wild type plants were selfed to obtain homozygous mutant and wild type M4 seed. Additionally, homozygous R167* plants were backcrossed to the recurrent Cypress parent to obtain Fl seed.
- Seed number and seed weight were determined for the homozygous R167* and homozygous wild type M4 seed (Table 26). There is an indication that RI527 R167* homozygotes have at least a general increase in thousand kernel weight (TKW) compared to their wild type siblings (Table 27), and the RI526 R167* homozygotes may be better than their control for seed number. These same measurements will be taken again on seed from successive backcrossed generations.
- Fl and M4 seeds were planted in the greenhouse in the next cycle.
- Fl plants were genotyped to confirm the heterozygosity of R167* .
- Heterozygous R167* plants are backcrossed a second time to the recurrent parent to obtain BC1 F1 seed.
- heterozygous R167* Fl plants are selfed to obtain segregating F2 seed.
- Homozygous R167* F2 plants are identified by genotyping and seed expanded to F3 for field trials.
- BC 1 F1 seed are grown in the greenhouse and the plants genotyped to identify ones heterozygous for the R167* allele or wild type allele.
- Heterozygous R167* plants are backcrossed to obtain BC2F1 and selfed to obtain BC 1F2.
- Homozygous R167* BC 1F2 plants are identified by genotyping and seed expanded to BC1F3 for field trials. Backcrossing may be continued to the BC3 or BC4 level. Throughout the backcrossing and selfmg, wild type siblings are carried forward to serve as controls. Backcrosses are also done to Nipponbare to move the mutation into short grain rice. Table 25. Oi za sativa KRP4 TILLING® Mutant in breedin ro ram
- Candidate Glycine max (soybean) KRP genes were searched on the Phytozome and nine KRP genes (SEQ ID NOs: 1 1 1-128) were identified. A soy TILLING® library was screened for mutations in these soy KRPs.
- Glycine max KRPs are displayed in Tables 29 to 37 below (* indicates the mutation results in a stop codon). This is only a representative list and should not be construed to be limiting in any way.
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA2867139A CA2867139A1 (en) | 2011-04-11 | 2012-04-11 | Identification and the use of krp mutants in plants |
AU2012242991A AU2012242991B2 (en) | 2011-04-11 | 2012-04-11 | Identification and the use of KRP mutants in plants |
RU2013150150A RU2631790C2 (en) | 2011-04-11 | 2012-04-11 | Identification and application of mutantial krp in plants |
US14/111,292 US9556448B2 (en) | 2011-04-11 | 2012-04-11 | Identification and the use of KRP mutants in plants |
EP12771677.7A EP2697378A4 (en) | 2011-04-11 | 2012-04-11 | Identification and the use of krp mutants in plants |
US15/365,544 US10070601B2 (en) | 2011-04-11 | 2016-11-30 | Identification and the use of KRP mutants in plants |
AU2017203734A AU2017203734A1 (en) | 2011-04-11 | 2017-06-02 | Identification and the use of krp mutants in plants |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201161474201P | 2011-04-11 | 2011-04-11 | |
US61/474,201 | 2011-04-11 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/111,292 A-371-Of-International US9556448B2 (en) | 2011-04-11 | 2012-04-11 | Identification and the use of KRP mutants in plants |
US15/365,544 Continuation US10070601B2 (en) | 2011-04-11 | 2016-11-30 | Identification and the use of KRP mutants in plants |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2012142106A1 true WO2012142106A1 (en) | 2012-10-18 |
Family
ID=47009669
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2012/033047 WO2012142106A1 (en) | 2011-04-11 | 2012-04-11 | Identification and the use of krp mutants in plants |
Country Status (6)
Country | Link |
---|---|
US (2) | US9556448B2 (en) |
EP (2) | EP2927323A3 (en) |
AU (2) | AU2012242991B2 (en) |
CA (1) | CA2867139A1 (en) |
RU (2) | RU2017129844A (en) |
WO (1) | WO2012142106A1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10070601B2 (en) | 2011-04-11 | 2018-09-11 | Targeted Growth, Inc. | Identification and the use of KRP mutants in plants |
CN114262750A (en) * | 2022-02-11 | 2022-04-01 | 中国农业科学院蔬菜花卉研究所 | Nucleic acid for detecting kalp marker linked with leaf splitting gene of mustard and application thereof |
CN116941531A (en) * | 2023-08-24 | 2023-10-27 | 吉林省农业科学院 | Peanut tissue in-vitro mutagenesis grafting method |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1924136A4 (en) | 2005-07-29 | 2009-05-13 | Targeted Growth Inc | Dominant negative mutant krp protein protection of active cyclin-cdk complex inhibition by wild-type krp |
WO2012142116A2 (en) | 2011-04-11 | 2012-10-18 | Targeted Growth, Inc. | Identification and use of krp mutants in wheat |
CN108977439B (en) * | 2018-09-03 | 2022-05-10 | 中国农业科学院作物科学研究所 | Method for assisting in identifying temperature character of wheat canopy and special primer group thereof |
CN110384044B (en) * | 2019-08-16 | 2023-01-24 | 江西农业大学 | Cultivation method of virus-free seed stems of taros |
CN111937745A (en) * | 2020-08-13 | 2020-11-17 | 江苏宝德农业科技有限公司 | Tissue culture method for rapid propagation of tissue culture seedlings for field planting in production process of detoxified miniature potatoes |
CN111972284A (en) * | 2020-09-04 | 2020-11-24 | 彭晓燕 | Method for cultivating high-mountain dry rice |
CN114606341B (en) * | 2022-04-12 | 2023-10-13 | 山东省农业科学院作物研究所 | dCAPS molecular marker of aegilops sieboldii based on genome resequencing SNP and application |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040019926A1 (en) * | 2000-07-14 | 2004-01-29 | Frankard Valerie Marie-Noelle S. | Novel plant cyclin-dependent kinase inhibitors |
WO2005007829A2 (en) * | 2003-07-14 | 2005-01-27 | Monsanto Technology, Llc | Materials and methods for the modulation of cyclin-dependent kinase inhibitor-like polypeptides in maize |
US20070044171A1 (en) * | 2000-12-14 | 2007-02-22 | Kovalic David K | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
US20070056058A1 (en) * | 2005-07-29 | 2007-03-08 | Paul Olivier | Dominant negative mutant krp protein protection of active cyclin-cdk complex inhibition by wild-type krp |
US20090070894A1 (en) * | 2005-12-01 | 2009-03-12 | Cropdesign N.V. | Plants having improved growth characteristics and methods for making the same |
WO2010099083A1 (en) * | 2009-02-27 | 2010-09-02 | Monsanto Technology Llc | Isolated novel nucleic acid and protein molecules from soybeans and methods of using those molecules |
Family Cites Families (129)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4399216A (en) | 1980-02-25 | 1983-08-16 | The Trustees Of Columbia University | Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials |
ZA824205B (en) | 1981-06-18 | 1983-04-27 | Lucas Ind Plc | Engine auxilliary drive and an engine auxiliary fitted therewith |
DE3382068D1 (en) | 1982-03-15 | 1991-01-31 | Univ Columbia | METHOD FOR INTRODUCING CLONED AMPLIFICABLE GENES IN EUKARYOTIC CELLS AND FOR THE PRODUCTION OF PROTEIN PRODUCTS. |
US4536475A (en) | 1982-10-05 | 1985-08-20 | Phytogen | Plant vector |
US6051757A (en) | 1983-01-14 | 2000-04-18 | Washington University | Regeneration of plants containing genetically engineered T-DNA |
US6174724B1 (en) | 1983-01-17 | 2001-01-16 | Monsanto Company | Chimeric genes suitable for expression in plant cells |
US5034322A (en) | 1983-01-17 | 1991-07-23 | Monsanto Company | Chimeric genes suitable for expression in plant cells |
US5352605A (en) | 1983-01-17 | 1994-10-04 | Monsanto Company | Chimeric genes for transforming plant cells using viral promoters |
NL8300699A (en) | 1983-02-24 | 1984-09-17 | Univ Leiden | METHOD FOR BUILDING FOREIGN DNA INTO THE NAME OF DIABIC LOBAL PLANTS; METHOD FOR PRODUCING AGROBACTERIUM TUMEFACIENS BACTERIEN; STABLE COINTEGRATE PLASMIDS; PLANTS AND PLANT CELLS WITH CHANGED GENETIC PROPERTIES; PROCESS FOR PREPARING CHEMICAL AND / OR PHARMACEUTICAL PRODUCTS. |
NL8300698A (en) | 1983-02-24 | 1984-09-17 | Univ Leiden | METHOD FOR BUILDING FOREIGN DNA INTO THE NAME OF DIABIC LOBAL PLANTS; AGROBACTERIUM TUMEFACIENS BACTERIA AND METHOD FOR PRODUCTION THEREOF; PLANTS AND PLANT CELLS WITH CHANGED GENETIC PROPERTIES; PROCESS FOR PREPARING CHEMICAL AND / OR PHARMACEUTICAL PRODUCTS. |
US5504200A (en) | 1983-04-15 | 1996-04-02 | Mycogen Plant Science, Inc. | Plant gene expression |
JPS61502166A (en) | 1984-04-19 | 1986-10-02 | アグラシタス | Improved methods and vectors for transformation of plant cells |
US5149645A (en) | 1984-06-04 | 1992-09-22 | Rijksuniversiteit Leiden | Process for introducing foreign DNA into the genome of plants |
EP0207965A4 (en) | 1984-12-13 | 1987-06-17 | Bioteknika International | Plant tranformation vector. |
WO1986003776A1 (en) | 1984-12-21 | 1986-07-03 | Plant Genetic Systems N.V. | Process for preparing genetically stably transformed monocotyledonous plant cells |
US4795855A (en) | 1985-11-14 | 1989-01-03 | Joanne Fillatti | Transformation and foreign gene expression with woody species |
US5107065A (en) | 1986-03-28 | 1992-04-21 | Calgene, Inc. | Anti-sense regulation of gene expression in plant cells |
US5378824A (en) | 1986-08-26 | 1995-01-03 | E. I. Du Pont De Nemours And Company | Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase |
EP0265556A1 (en) | 1986-10-31 | 1988-05-04 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Stable binary agrobacterium vectors and their use |
GB8626879D0 (en) | 1986-11-11 | 1986-12-10 | Ici Plc | Dna |
US5015580A (en) | 1987-07-29 | 1991-05-14 | Agracetus | Particle-mediated transformation of soybean plants and lines |
US5359142A (en) | 1987-01-13 | 1994-10-25 | Monsanto Company | Method for enhanced expression of a protein |
US5196525A (en) | 1987-01-13 | 1993-03-23 | University Of British Columbia | DNA construct for enhancing the efficiency of transcription |
US5322938A (en) | 1987-01-13 | 1994-06-21 | Monsanto Company | DNA sequence for enhancing the efficiency of transcription |
US5164316A (en) | 1987-01-13 | 1992-11-17 | The University Of British Columbia | DNA construct for enhancing the efficiency of transcription |
DE3856589D1 (en) | 1987-10-20 | 2006-04-06 | Bayer Bioscience Nv | 5'-flanking region of a gene from Arabidopsis encoding a 2S albumin precursor |
ATE105585T1 (en) | 1987-12-21 | 1994-05-15 | Univ Toledo | TRANSFORMATION OF GERMINATED PLANT SEEDS USING AGROBACTERIUM. |
US5416011A (en) | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
US5302523A (en) | 1989-06-21 | 1994-04-12 | Zeneca Limited | Transformation of plant cells |
US5501967A (en) | 1989-07-26 | 1996-03-26 | Mogen International, N.V./Rijksuniversiteit Te Leiden | Process for the site-directed integration of DNA into the genome of plants |
US5550318A (en) | 1990-04-17 | 1996-08-27 | Dekalb Genetics Corporation | Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof |
US5484956A (en) | 1990-01-22 | 1996-01-16 | Dekalb Genetics Corporation | Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin |
US5451513A (en) | 1990-05-01 | 1995-09-19 | The State University of New Jersey Rutgers | Method for stably transforming plastids of multicellular plants |
US5204253A (en) | 1990-05-29 | 1993-04-20 | E. I. Du Pont De Nemours And Company | Method and apparatus for introducing biological substances into living cells |
EP0558676B1 (en) | 1990-11-23 | 2000-04-19 | Plant Genetic Systems, N.V. | Process for transforming monocotyledonous plants |
WO1992009685A1 (en) | 1990-11-29 | 1992-06-11 | The Australian National University | Control of plant cell proliferation and growth |
US5384253A (en) | 1990-12-28 | 1995-01-24 | Dekalb Genetics Corporation | Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes |
US7034208B1 (en) | 1991-04-08 | 2006-04-25 | Basf Aktiengellschaft | Ahas inhibiting herbicide resistant wheat and method for selection thereof |
AU2515592A (en) | 1991-08-23 | 1993-03-16 | University Of Florida | A novel method for the production of transgenic plants |
US5994629A (en) | 1991-08-28 | 1999-11-30 | Novartis Ag | Positive selection |
GB9304200D0 (en) | 1993-03-02 | 1993-04-21 | Sandoz Ltd | Improvements in or relating to organic compounds |
ATE201236T1 (en) | 1992-02-26 | 2001-06-15 | Zeneca Mogen B V | AGROBACTERIUM STRAINS CAPABILITY FOR SITE-SPECIFIC RECOMMINATION |
DE69334225D1 (en) | 1992-07-07 | 2008-07-31 | Japan Tobacco Inc | METHOD FOR TRANSFORMING A MONOCOTYLEDONE PLANT |
BR9306802A (en) | 1992-07-27 | 1998-12-08 | Pioneer Hi Bred Int | Independent genotype process for the production of transgenic soybean plant and soybean plant regeneration process from cotyledon nodes |
US5712112A (en) | 1992-11-04 | 1998-01-27 | National Science Council Of R.O.C. | Gene expression system comprising the promoter region of the alpha-amylase genes |
US5527695A (en) | 1993-01-29 | 1996-06-18 | Purdue Research Foundation | Controlled modification of eukaryotic genomes |
WO1994019930A1 (en) | 1993-03-11 | 1994-09-15 | National Research Council Of Canada | Enhanced regeneration system for cereals |
AU687863B2 (en) | 1993-09-03 | 1998-03-05 | Japan Tobacco Inc. | Method of transforming monocotyledon by using scutellum of immature embryo |
PT687730E (en) | 1993-12-08 | 2007-07-02 | Japan Tobacco Inc | Method of transforming plant and vector therefor |
US5736369A (en) | 1994-07-29 | 1998-04-07 | Pioneer Hi-Bred International, Inc. | Method for producing transgenic cereal plants |
US6114608A (en) | 1997-03-14 | 2000-09-05 | Novartis Ag | Nucleic acid construct comprising bacillus thuringiensis cry1Ab gene |
US5717129A (en) | 1995-02-16 | 1998-02-10 | Pioneer Hi-Bred International, Inc. | Methods for maintaining sterility in plants |
US6008437A (en) | 1995-06-06 | 1999-12-28 | Plant Genetic Systems | Use of anthocyanin genes to maintain male sterile plants |
WO1997013843A1 (en) | 1995-10-12 | 1997-04-17 | Cornell Research Foundation, Inc. | Production of water stress or salt stress tolerant transgenic cereal plants |
US5958769A (en) | 1996-01-18 | 1999-09-28 | Fred Hutchinson Cancer Research Center | Compositions and methods for mediating cell cycle progression |
WO1997029200A1 (en) | 1996-02-08 | 1997-08-14 | Institut für Pflanzengenetik und Kulturpflanzenforschung | Cassettes for the expression of storable proteins in plants |
US5693512A (en) | 1996-03-01 | 1997-12-02 | The Ohio State Research Foundation | Method for transforming plant tissue by sonication |
US5959179A (en) | 1996-03-13 | 1999-09-28 | Monsanto Company | Method for transforming soybeans |
US5994075A (en) | 1996-05-17 | 1999-11-30 | Hexagen Technology Limited | Methods for identifying a mutation in a gene of interest without a phenotypic guide |
JPH10117776A (en) | 1996-10-22 | 1998-05-12 | Japan Tobacco Inc | Transformation of indica rice |
US5981840A (en) | 1997-01-24 | 1999-11-09 | Pioneer Hi-Bred International, Inc. | Methods for agrobacterium-mediated transformation |
EA003425B1 (en) | 1997-03-26 | 2003-04-24 | Кембридж Юниверсити Текникал Сервисиз Лимитед | Plants with modified growth |
US5968830A (en) | 1997-03-28 | 1999-10-19 | Mississippi State University | Soybean transformation and regeneration methods |
US6369298B1 (en) | 1997-04-30 | 2002-04-09 | Pioneer Hi-Bred International, Inc. | Agrobacterium mediated transformation of sorghum |
IL120835A0 (en) | 1997-05-15 | 1997-09-30 | Yeda Res & Dev | Method for production of hybrid wheat |
US6162965A (en) | 1997-06-02 | 2000-12-19 | Novartis Ag | Plant transformation methods |
EP2000538A3 (en) | 1997-06-03 | 2010-06-23 | The University of Chicago | Plant artificial chromosome (PLAC) compositions and methods for using them |
JP2001516582A (en) | 1997-09-16 | 2001-10-02 | クロップデザイン エヌ.ブイ. | Cyclin-dependent kinase inhibitors and uses thereof |
US6710227B1 (en) | 1998-09-16 | 2004-03-23 | Cropdesign N.V. | Cyclin-dependent kinase inhibitors and uses thereof |
EP1019517B2 (en) | 1997-09-30 | 2014-05-21 | The Regents of The University of California | Production of proteins in plant seeds |
US6107549A (en) | 1998-03-10 | 2000-08-22 | Monsanto Company | Genetically engineered plant resistance to thiazopyr and other pyridine herbicides |
CA2256121A1 (en) | 1998-06-08 | 1999-12-08 | Hong Wang | Cyclin-dependent kinase inhibitors as plant growth regulators |
US6037522A (en) | 1998-06-23 | 2000-03-14 | Rhone-Poulenc Agro | Agrobacterium-mediated transformation of monocots |
CA2335379A1 (en) * | 1998-08-18 | 2000-03-02 | Zeneca Limited | Genetic method for the expression of polyproteins in plants |
WO2000011199A1 (en) | 1998-08-20 | 2000-03-02 | Pioneer Hi-Bred International, Inc. | COMPOSITIONS AND METHODS FOR ALTERING AN ACETYL-CoA METABOLIC PATHWAY OF A PLANT |
EP1117816B1 (en) | 1998-10-01 | 2005-12-21 | Pioneer Hi-Bred International, Inc. | Method of plant transformation |
US6420630B1 (en) | 1998-12-01 | 2002-07-16 | Stine Biotechnology | Methods for tissue culturing and transforming elite inbreds of Zea mays L. |
EP1165793A2 (en) * | 1999-04-07 | 2002-01-02 | E.I. Du Pont De Nemours And Company | Cyclin dependent kinase inhibitor genes from plants |
US7531723B2 (en) | 1999-04-16 | 2009-05-12 | Pioneer Hi-Bred International, Inc. | Modulation of cytokinin activity in plants |
US20090087878A9 (en) | 1999-05-06 | 2009-04-02 | La Rosa Thomas J | Nucleic acid molecules associated with plants |
US6197518B1 (en) | 1999-06-17 | 2001-03-06 | Her Majesty The Queen In Right Of Canada, As Represented By The Department Of Agriculture | Markers for fusarium head blight (FHB) disease resistance |
US7642346B2 (en) | 1999-08-27 | 2010-01-05 | Sembiosys Genetics Inc. | Flax seed specific promoters |
US6777591B1 (en) | 1999-08-27 | 2004-08-17 | Sembiosys Genetics Inc. | Legume-like storage protein promoter isolated from flax and methods of expressing proteins in plant seeds using the promoter |
US7553954B2 (en) | 1999-09-22 | 2009-06-30 | Monsanto Technology Llc | Nucleic acid molecules and other molecules associated with plants |
US6384304B1 (en) | 1999-10-15 | 2002-05-07 | Plant Genetic Systems N.V. | Conditional sterility in wheat |
IL151928A0 (en) | 2000-03-30 | 2003-04-10 | Whitehead Biomedical Inst | Rna sequence-specific mediators of rna interference |
AU2001255797A1 (en) | 2000-05-02 | 2001-11-12 | Applied Phytologics, Inc. | Enhanced gene expression in plants using transcription factors |
CA2436805A1 (en) | 2000-11-07 | 2002-10-17 | Pioneer Hi-Bred International, Inc. | Cell cycle nucleic acids, polypeptides and uses thereof |
FI110009B (en) | 2000-11-13 | 2002-11-15 | Unicrop Ltd | A transformation system in Camelina sativa |
US7122658B1 (en) | 2000-11-22 | 2006-10-17 | Pioneer Hi-Bred International, Inc. | Seed-preferred regulatory elements and uses thereof |
WO2003014347A2 (en) | 2000-12-01 | 2003-02-20 | Michigan State University | Plant seed specific promoters |
GB0101513D0 (en) * | 2001-01-19 | 2001-03-07 | Scottish Crop Res Inst | 'Gene silencing suppressor' |
US20040053236A1 (en) | 2001-03-30 | 2004-03-18 | Mccallum Claire M. | Reverse genetic strategy for identifying functional mutations in genes of known sequences |
AU2002325266A1 (en) | 2001-06-22 | 2003-01-08 | Syngenta Participations Ag | Identification and characterization of plant genes |
MXPA04001056A (en) | 2001-08-09 | 2005-02-17 | Northwest Plant Breeding Compa | Wheat plants having increased resistance to imidazolinone herbicides. |
WO2003033736A2 (en) | 2001-10-17 | 2003-04-24 | International Centre For Genetic Engineering And Biotechnology | Fine mapping and application of dna markers linked to a gall midge resistance gene for marker-aided selection in rice |
WO2003057848A2 (en) | 2001-12-31 | 2003-07-17 | Yeda Research And Development Co., Ltd | A method to maintain a genic male-sterile female parental line of wheat through selfing of the maintainer line |
WO2003069980A2 (en) | 2002-02-20 | 2003-08-28 | J.R. Simplot Company | Precise breeding |
AU2003213815A1 (en) | 2002-03-08 | 2003-09-22 | Prodigene, Inc. | Production of insulin and insulin-like proteins in plants |
US20040168232A1 (en) | 2003-02-25 | 2004-08-26 | Groth Donald E. | Rice resistant to sheath blight, bacterial panicle blight, and other diseases |
DE602004011035T2 (en) | 2003-03-24 | 2008-12-18 | Syngenta Ltd., Guildford | INCREASED COLLECTION OF CARROTOTOIDS IN PLANTS |
US8993327B2 (en) | 2003-04-07 | 2015-03-31 | Ut-Battelle, Llc | Parallel macromolecular delivery and biochemical/electrochemical interface to cells employing nanostructures |
US7732667B2 (en) | 2003-08-27 | 2010-06-08 | Syngenta Participations Ag | Transgenic plants and progeny and seed thereof |
BRPI0413329A (en) | 2003-09-05 | 2006-10-10 | Cropdesign Nv | plants having modified growth characteristics and method for producing the same |
US8361928B2 (en) | 2003-10-28 | 2013-01-29 | Washington State University Research Foundation | Suppression of foliar and soilborne pathogens |
JP4019147B2 (en) | 2003-10-31 | 2007-12-12 | 独立行政法人農業生物資源研究所 | Seed-specific promoter and its use |
EP1689862A4 (en) | 2003-11-17 | 2007-02-07 | Arcadia Biosciences Inc | Tomatoes having reduced deoxyhypusine synthase activity caused by non-transgenic alterations in a deoxyhypusine synthase gene |
CA2548030C (en) | 2003-12-03 | 2017-05-09 | Arcadia Biosciences, Inc. | Wheat having reduced waxy protein due to non-transgenic alterations of a waxy gene |
US7652204B2 (en) | 2004-06-08 | 2010-01-26 | Ndsu Research Foundation | Breeding of fusarium resistant tetraploid durum wheat |
EP1765056A4 (en) | 2004-06-14 | 2008-05-28 | Commw Scient Ind Res Org | Markers for salinity tolerance in wheat plants and the use thereof in breeding programs |
UA90279C2 (en) | 2004-08-03 | 2010-04-26 | Грэйн Биотек Австралия Пти Лтд | Stress-tolerant transgenic wheat plant |
CA2573775C (en) * | 2004-08-11 | 2017-08-15 | Orf Liftaekni Hf. | Traceability of transgenic plant seeds in upstream and downstream processing |
BRPI0516628A (en) | 2004-12-01 | 2008-09-16 | Cropdesign Nv | method for improving plant, plant, plant part or plant cell growth characteristics, construct, method for producing a transgenic plant, transgenic plant, plant part or plant cell, cultivable parts, uses of a type cdk -a and nucleic acid encoding a type-a cdk, isolated nucleic acid molecule, isolated type-a cdk mutant, and, composition |
WO2006081029A2 (en) * | 2004-12-22 | 2006-08-03 | Ceres, Inc. | Nucleotide sequences and corresponding polypeptides conferring modulated plant size and biomass and other characteristics in plants |
EP2166100B1 (en) | 2005-03-08 | 2012-07-18 | BASF Plant Science GmbH | Expression enhancing intron sequences |
WO2007092505A2 (en) | 2006-02-07 | 2007-08-16 | Washington State University Research Foundation | Glyphosate-tolerant wheat genotypes |
US9491916B2 (en) | 2006-02-07 | 2016-11-15 | Washington State University | Mutation breeding for resistance to fungal disease and for drought tolerance |
WO2007098001A2 (en) | 2006-02-16 | 2007-08-30 | The Texas A & M University System | Cotton plant with seed-specific reduction in gossypol |
AR061211A1 (en) | 2006-05-31 | 2008-08-13 | Basf Agrochemical Products Bv | METHODS TO PREPARE AND USE WHEAT PLANTS WITH INCREASED CONTENT OF GRAIN PROTEIN |
EP2057187B1 (en) | 2006-08-10 | 2016-12-28 | Oncotherapy Science, Inc. | Genes and polypeptides relating to breast cancers |
WO2008025097A1 (en) | 2006-08-31 | 2008-03-06 | Commonwealth Scientific And Industrial Research Organisation | Salt tolerant plants |
US20110179529A1 (en) | 2008-01-18 | 2011-07-21 | Shing Kwok | Modulating light response pathways in plants |
US8779238B2 (en) | 2008-03-21 | 2014-07-15 | Global Clean Energy Holdings, Inc. | Floral dip method for transformation of camelina |
KR100990370B1 (en) | 2008-07-18 | 2010-10-29 | 경희대학교 산학협력단 | Genes enhancing resistance to Magnaporthe oryzae and uses thereof |
US8431775B2 (en) | 2008-12-04 | 2013-04-30 | Pioneer Hi Bred International Inc | Methods and compositions for enhanced yield by targeted expression of knotted1 |
US8241889B2 (en) | 2009-07-29 | 2012-08-14 | The United States Of America As Represented By The Secretary Of State | Prothioconazole tolerant Cryptococcus flavescens strains for biological control of fusarium head blight |
WO2012065166A2 (en) | 2010-11-12 | 2012-05-18 | Targeted Growth, Inc. | Dominant negative mutant kip-related proteins (krp) in zea mays and methods of their use |
CA2867139A1 (en) | 2011-04-11 | 2012-10-18 | Targeted Growth, Inc. | Identification and the use of krp mutants in plants |
WO2012142116A2 (en) * | 2011-04-11 | 2012-10-18 | Targeted Growth, Inc. | Identification and use of krp mutants in wheat |
-
2012
- 2012-04-11 CA CA2867139A patent/CA2867139A1/en not_active Abandoned
- 2012-04-11 WO PCT/US2012/033047 patent/WO2012142106A1/en active Application Filing
- 2012-04-11 RU RU2017129844A patent/RU2017129844A/en not_active Application Discontinuation
- 2012-04-11 US US14/111,292 patent/US9556448B2/en not_active Expired - Fee Related
- 2012-04-11 AU AU2012242991A patent/AU2012242991B2/en not_active Ceased
- 2012-04-11 EP EP15161572.1A patent/EP2927323A3/en not_active Withdrawn
- 2012-04-11 EP EP12771677.7A patent/EP2697378A4/en not_active Withdrawn
- 2012-04-11 RU RU2013150150A patent/RU2631790C2/en not_active IP Right Cessation
-
2016
- 2016-11-30 US US15/365,544 patent/US10070601B2/en not_active Expired - Fee Related
-
2017
- 2017-06-02 AU AU2017203734A patent/AU2017203734A1/en not_active Abandoned
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040019926A1 (en) * | 2000-07-14 | 2004-01-29 | Frankard Valerie Marie-Noelle S. | Novel plant cyclin-dependent kinase inhibitors |
US20070044171A1 (en) * | 2000-12-14 | 2007-02-22 | Kovalic David K | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
WO2005007829A2 (en) * | 2003-07-14 | 2005-01-27 | Monsanto Technology, Llc | Materials and methods for the modulation of cyclin-dependent kinase inhibitor-like polypeptides in maize |
US20070056058A1 (en) * | 2005-07-29 | 2007-03-08 | Paul Olivier | Dominant negative mutant krp protein protection of active cyclin-cdk complex inhibition by wild-type krp |
US20090070894A1 (en) * | 2005-12-01 | 2009-03-12 | Cropdesign N.V. | Plants having improved growth characteristics and methods for making the same |
WO2010099083A1 (en) * | 2009-02-27 | 2010-09-02 | Monsanto Technology Llc | Isolated novel nucleic acid and protein molecules from soybeans and methods of using those molecules |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10070601B2 (en) | 2011-04-11 | 2018-09-11 | Targeted Growth, Inc. | Identification and the use of KRP mutants in plants |
CN114262750A (en) * | 2022-02-11 | 2022-04-01 | 中国农业科学院蔬菜花卉研究所 | Nucleic acid for detecting kalp marker linked with leaf splitting gene of mustard and application thereof |
CN116941531A (en) * | 2023-08-24 | 2023-10-27 | 吉林省农业科学院 | Peanut tissue in-vitro mutagenesis grafting method |
Also Published As
Publication number | Publication date |
---|---|
EP2927323A2 (en) | 2015-10-07 |
EP2697378A4 (en) | 2014-10-01 |
US10070601B2 (en) | 2018-09-11 |
EP2697378A1 (en) | 2014-02-19 |
CA2867139A1 (en) | 2012-10-18 |
US20140143900A1 (en) | 2014-05-22 |
US20170142919A1 (en) | 2017-05-25 |
AU2012242991A1 (en) | 2013-10-31 |
RU2013150150A (en) | 2015-05-20 |
RU2631790C2 (en) | 2017-09-26 |
AU2017203734A1 (en) | 2017-06-22 |
EP2927323A3 (en) | 2015-12-09 |
RU2017129844A (en) | 2019-02-06 |
US9556448B2 (en) | 2017-01-31 |
AU2012242991B2 (en) | 2017-03-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10070601B2 (en) | Identification and the use of KRP mutants in plants | |
US9745596B2 (en) | Identification and use of KRP mutants in wheat | |
US11732270B2 (en) | Compositions and methods for manipulating the development of plants | |
CN107429259A (en) | By increasing scopoletin content, increase the method for Soybean rust resistant in genetically modified plants | |
CN107287208A (en) | Florescence control gene and relevant carriers and its application | |
US20200190530A1 (en) | Identification and use of grape genes controlling salt/drought tolerance and fruit sweetness | |
CN117904170A (en) | Novel genetic loci associated with soybean rust resistance | |
JP2010538679A (en) | Compositions and methods for modifying plant morphology | |
WO2013177376A2 (en) | Dirigent gene eg261 and its orthologs and paralogs and their uses for pathogen resistance in plants | |
WO2014150879A1 (en) | Compositions and methods for increasing plant seed number and/or yield | |
WO2014164668A1 (en) | Compositions of methods for increasing seed number, seed weight and/or yield in plants | |
WO2012065166A2 (en) | Dominant negative mutant kip-related proteins (krp) in zea mays and methods of their use | |
CN110628783A (en) | Non-transgenic herbicide-resistant rape gene and application thereof | |
US11932862B1 (en) | Genetic regulatory elements | |
US11795469B2 (en) | Scaevola plants with radially symmetrical flowers | |
US20230151382A1 (en) | Plant pathogen effector and disease resistance gene identification, compositions, and methods of use | |
US20150259700A1 (en) | Transgenic Plants With RNA Interference-Mediated Resistance Against Root-Knot Nematodes | |
WO2023073224A1 (en) | Methods of increasing root endosymbiosis | |
O'Keefe | Differential Expression of Isopentenyl Transferase and Cytokinin Oxidase/Dehydrogenase During Pod and Seed Development in Brassica |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12771677 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2012242991 Country of ref document: AU Date of ref document: 20120411 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2012771677 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2013150150 Country of ref document: RU Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 14111292 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: 2867139 Country of ref document: CA |