WO2012139281A1

WO2012139281A1 - Adjuvant based on hiv tat and uses thereof

Info

Publication number: WO2012139281A1
Application number: PCT/CN2011/072665
Authority: WO
Inventors: 邵一鸣; 刘野
Original assignee: 中国疾病预防控制中心性病艾滋病预防控制中心
Priority date: 2011-04-12
Filing date: 2011-04-12
Publication date: 2012-10-18

Abstract

The invention provides a tat adjuvant, comprising: (a) a plasmid containing the nucleic acid sequence encoding HIV Tat, a fragment thereof or a variant thereof; or (b) HIV Tat, a fragment thereof or a variant thereof. The invention also provides a vaccine composition which includes a Tat adjuvant, wherein the tat adjuvant can increase the immune response elicited by the vaccine.

Description

Adjuvant based on HIV Tat and its use

Technical field

The present invention relates to the field of adjuvants, and methods and uses of adjuvants for modulating immune responses induced by a vaccine of interest. The invention particularly relates to an adjuvant comprising a HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof, and a method and use of the adjuvant to enhance an immune response induced by a vaccine of interest . Background technique

DNA vaccines are techniques that use genetically engineered DNA molecules to induce an immune response in an organism to protect the organism from infection by viruses, bacteria, and the like. One of the advantages of DNA vaccine technology is that it induces various types of immune responses. In addition, after more than a decade of development, clinical trials of DNA vaccines have provided exciting safety data. DNA vaccines are well tolerated by the body in preclinical and clinical trials, demonstrating good safety ( See, for example, Sandhya Vasan, Sarah J. Schlesinger. et. al. Phase 1 Safety and Immunogenicity Evaluation of AD VAX, a Multigenic, DNA-Based Clade C/B, HIV-1 Candidate Vaccine, PLoS One. 2010; 5(1) : e8617 and Thomas C. Greenough, Coleen K. Cunningham, et.al. "Safety and immunogenicity of recombinant poxvirus HIV-1 vaccines in young adults on highly active antiretroviral therapy". Vaccine. 2008 December 9; 26(52): 6883 —6893).

But most DNA vaccines are still in the experimental phase and there are not many clinical applications. A very important reason is that DNA vaccines are still proven to be less immunogenic in human experiments. As a result, DNA vaccines are used in large doses, and the number of immunizations is high or must be combined with other vaccines, which increases the cost of production and use of vaccines and greatly limits the application of DNA vaccines. The ability to significantly increase the immunogenicity of DNA vaccines is a critical factor in determining the future of DNA vaccine technology (Lu S, Wang S, Grimes-Serrano JM. Current progress of DNA vaccine studies in humans. Expert Rev Vaccines. 2008 Mar; 7(2): 175-91).

Application of adjuvant is one of the effective strategies to improve the immunogenicity of DNA vaccines. With the deepening of DNA vaccine research, people gradually realize the immunity induced by direct injection of naked DNA for immunization. Both response and immune memory are not ideal, but a stronger, more durable immune effect can be achieved by combining with an adjuvant (Barouch DH, Santra S, Schmitz JE, Kuroda MJ, et al. Control of viremia and prevention of clinical AIDS in rhesus Monkeys by cytokine-augmented DNA vaccination . Science, 2000, 290(5491): 486-92; Min W, Lillehoj HS, Bumside J, et al. Adjuvant effects of IL-lbeta, IL-2, IL-8, IL- 15, IFN-alpha, IFN-gamma TGF-beta4 and lymphotactin on DNA vaccination against Eimeria acervulina. Vaccine, 2001, 20(1-2): 267-74;

An immunological adjuvant refers to a substance which is applied to the same subject simultaneously or separately, and which can non-specifically enhance or change the body's specific immune response against the antigen. The adjuvant itself may or may not be antigenic, but the adjuvant must be safe according to the recommendations of the World Health Organization.

HIV Tat is a transcriptional transactivator of human immunodeficiency virus whose primary function is to regulate the transcription of HIV and promote the transcription of HIV genes by binding to the LTR region of the HIV genome. However, in recent years, studies have found that HIV Tat protein can promote the activation and maturation of DC cells, thereby enhancing the antigen presentation ability of the body and effectively improving the immune response level of the body (Emanude Fanales-Belasio, Sonia Moretti, Filomena Nappi, et al. Native HIV-1 Tat Protein Targets Monocyte-Derived Dendritic Cells and Enhances Their Maturation, Function, and Antigen-Specific T Cell Responses. The Journal of Immunology, 2002, 168: 197-206; Emanuele Fanales-Belasio, Sonia Moretti, Valeria Fiorelli, Et al. HIV-1 Tat Addresses Dendritic Cells to Induce a Predominant Thl-Type Adaptive Immune Response That Appears Prevalent in the Asymptomatic Stage of Infection. The Journal of Immunology, 2009, 182: 2888-2897).

The present invention is the first to use HIV Tat as an adjuvant in combination with a vaccine, and has confirmed its enhancement and regulation effect on the immune response induced by the vaccine in an animal model. Summary of invention

One aspect of the invention relates to the use of an adjuvant for enhancing an immune response induced by a vaccine of interest in a subject.

In one embodiment, the invention relates to HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding HIV Tat protein or a fragment or variant thereof, for the preparation of an immune response induced in a subject for enhancing a vaccine of interest in a subject Use in a pharmaceutical or vaccine composition. In one embodiment, the vaccine of the invention comprises a DNA vaccine, and the adjuvant or vaccine composition comprises a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

In one embodiment, the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof is inserted into a vector. In some embodiments, the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudoviral particle, and a virus-like particle.

In one embodiment, the vaccine of the invention comprises a protein vaccine, and the adjuvant or vaccine composition comprises HIV Tat protein or a fragment or variant thereof.

In some embodiments, the vaccine of interest of the invention comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine of interest of the invention comprises an HIV encoding Polynucleotides of Env proteins, and/or HIV Gag proteins, and/or HIV Pol proteins, or fragments or variants thereof.

In another aspect, the invention also relates to a method of enhancing an immune response induced by a vaccine of interest in a subject.

In one embodiment, the method of the invention comprises administering the vaccine to a subject, and administering to the subject a HIV Tat protein or fragment or variant thereof or encoding an HIV Tat protein prior to, concurrently with, or after administration of the vaccine. An adjuvant of a polynucleotide of a fragment or variant thereof.

In one embodiment, the vaccine of the method of the invention comprises a DNA vaccine, and the adjuvant comprises a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

In one embodiment, the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof as described in the methods of the invention is inserted into a vector. In some embodiments, the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudoviral particle, and a virus-like particle.

In one embodiment, the vaccine of the method of the invention comprises a protein vaccine, and the adjuvant comprises HIV Tat protein or a fragment or variant thereof.

In some embodiments, the vaccine in the methods of the invention comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine comprises an HIV Env protein encoding And/or a polynucleotide of HIV Gag protein, and/or HIV Pol protein, or a fragment or variant thereof.

In some embodiments, the vaccines and/or adjuvants of the invention are administered by a muscle and/or intradermal route of administration.

In another aspect, the invention also relates to a vaccine composition.

In one embodiment, the vaccine composition of the invention comprises the following components: (a) a vaccine, A polynucleotide comprising an immunogen and/or encoding an immunogen; and (b) an adjuvant comprising an HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

In another embodiment, the vaccine in a vaccine composition of the invention comprises a DNA vaccine, and the adjuvant comprises a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof. In some embodiments, the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof is inserted into a vector. In some embodiments, the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudoviral particle, and a virus-like particle.

In another embodiment, the vaccine in the vaccine composition of the invention is a protein vaccine, and the adjuvant comprises HIV Tat protein or a fragment or variant thereof.

In some embodiments, the vaccine in a vaccine composition of the invention comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine of interest comprises a coding A polynucleotide of HIV Env protein, and/or HIV Gag protein, and/or HIV Pol protein, or a fragment or variant thereof.

In another aspect, the invention also relates to an adjuvant.

In one embodiment, an adjuvant of the invention comprises a HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof. In some embodiments, the polynucleotide encoding a HIV Tat protein or a fragment or variant thereof is inserted into a vector. In some embodiments, the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudovirus particle, and a virus-like particle. BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1: Schematic diagram of mouse immunization schedule and time of detection. The mice were immunized once every 0 and 4 weeks, and the mice were subjected to blood collection to separate the serum from the eyelids at 7 weeks (3 weeks after the 2-needle immunization), and the spleen lymphocytes were isolated after the mice were sacrificed.

Figure 2: ELISA results of Env-specific binding antibodies in serum of mice 3 weeks after 2-needle immunization. To avoid interference with the graph, the error bars are omitted. The ELISA results of the mice after 3 weeks of immunization showed that the DNA vaccine plus adjuvant group significantly increased the intensity of the vaccine-induced Env-specific binding antibody compared with the DNA alone immunization group.

Figure 3: Specific cellular immunity results of HIV-1 Env, Gag, Pol were detected by ELISPOT assay 3 weeks after 2-needle immunization. The results of cellular immunoassay were expressed by the number of cells secreting IFN-γ after stimulation of mouse spleen cells with Env, Gag, and Pol specific peptides, respectively. ELISPOT detection of mouse IFN-γ The results showed that the DNA vaccine plus adjuvant group significantly increased the level of vaccine-induced cellular immune response (PO.01) compared to the DNA alone immunization group.

Detailed description of the invention

All technical and scientific terms have their meanings as commonly understood by one of ordinary skill in the art, unless otherwise indicated. All patents, patent applications, publications, GenBank sequences, websites, and other published materials are hereby incorporated by reference in their entirety.

In one embodiment, the invention relates to HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding HIV Tat protein or a fragment or variant thereof, for the preparation of an immune response induced in a subject for enhancing a vaccine of interest in a subject Use in a pharmaceutical or vaccine composition.

The terms "vaccine" and "target vaccine" as used herein are used interchangeably and refer to: a class of organisms that prevent or treat infectious diseases in order to effectively prevent and control the occurrence, spread, and inoculation of infectious diseases. product. It can be classified into various types such as, but not limited to, DNA vaccines, protein vaccines, viral vector vaccines, attenuated vaccines, inactivated vaccines, and the like.

As used herein, the terms "vaccine" and "vaccine of interest" may include an antigen or a polynucleotide encoding an antigen. The antigen refers to an antigen that can induce an immune response in a subject, the immune response involving the alleviation, suppression, alleviation and/or treatment of certain diseases, and the disease mainly refers to an infectious disease involving certain viruses. For example, but not limited to, HIV virus, hepatitis A, hepatitis B, hepatitis C virus, human papilloma virus vaccine, yellow fever virus vaccine, etc., the disease may also include infectious diseases such as malaria. Therefore, the vaccines described herein may include HIV-related vaccines, as well as vaccines for infectious diseases such as hepatitis A, hepatitis B, hepatitis C virus vaccine, human papilloma virus vaccine, yellow fever virus vaccine, and malaria vaccine.

The term "vaccine composition" means a composition containing a vaccine, and may further contain an auxiliary ingredient such as a pharmaceutically acceptable carrier, adjuvant or the like.

As used herein, the term "adjuvant" refers to an immunomodulatory agent that is not itself immunogenic or has some immunogenicity, but can be used to stimulate the immune system to improve response to other immunogenic substances. . For example, when used together with an antigen of interest or separately administered to the same subject, the antigen-induced immune response or the type of immune response of the antigen can be directly or indirectly modulated. The immune response includes, for example, humoral immunity, cellular immunity, and the like. The term "HIV Tat" refers to a transcriptional transactivator of human immunodeficiency virus, and herein the HIV Tat protein can include its full length protein or a functional fragment or variant of the protein. As used herein, "fragment" and "functional fragment" are used interchangeably and are meant to refer to portions of a protein that achieve the objectives of the invention. As used herein, "variant" and "functional variant" are also used interchangeably and are meant to refer to a mutant of a protein that achieves the objectives of the invention, for example by using one or more insertions, deletions, or substitutions. A mutant obtained by a method such as amino acid.

In one embodiment, the vaccine of the invention comprises a DNA vaccine, and the adjuvant or vaccine composition comprises a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

The term "DNA vaccine" may also be referred to as a gene vaccine or a nucleotide vaccine or the like, which means that an expression vector containing a nucleotide sequence encoding an antigen is directly injected into an animal to make the nucleotide sequence in vivo. The resulting antigen thus activates the body's immune system, which can be used to induce specific humoral and cellular immune responses. The term "humoral immune response" "cell immune response" as used herein has the meanings well known in the art.

A vector as described herein refers to a system that is capable of carrying a foreign antigen and capable of being rendered in a host cell. These include plasmid vectors, recombinant viral vectors, recombinant bacterial vectors, pseudovirions, virus-like particles, and the like. The "plasmid" refers to a bacterial plasmid vector, including various commercial and laboratory-constructed plasmid vectors, such as but not limited to pDRVISVl.O (DNA constructed by the Chinese Medicine Center for Disease Control and Prevention, Center for Disease Control and Prevention, China) For vaccine vectors, see CN 1560259 A (Chinese Patent Application 200410028280.3)). The "recombinant viral vector" refers to a vector capable of carrying a foreign gene based on a recombinant virus, and includes, for example, a recombinant adenovirus vector, a recombinant poxvirus vector, a baculovirus vector, and the like. The "recombinant bacterial vector" refers to a vector capable of carrying a foreign gene constructed based on a recombinant bacterium, and includes, for example, a Listeria vector, an attenuated Salmonella vector, and the like. The "pseudovirus particle" refers to a virus having a single round of infection activity but not having a subsequent infection ability, which is produced by co-transfecting cells with HIV framework plasmid DNA and plasmid DNA carrying a membrane gene, including, for example, HIV pseudovirus. . The "viral-like particle" refers to a hollow particle which is one or more structural proteins containing a certain virus, which has no viral nucleic acid, cannot be autonomously replicated, and is identical or similar in morphology to a true virion, including, for example, an HIV virus. Sample particles, influenza virus-like particles. As used herein, "insertion" refers to the introduction of an antigen of interest into a vector of interest using techniques conventional in the art, such as the use of recombinant DNA techniques and the like.

As used herein, HIV Env protein refers to the HIV envelope and its functional fragments or variants such as, but not limited to, the extramembranous portion of the HIV envelope protein, such as gpl45; the HIV Gag protein described herein is Refers to the core protein or coat protein encoded by the HIV gene and its functional fragments or variants, such as but not limited to P55; HIV Pol protein as used herein refers to various enzyme proteins and fragments thereof encoded by the HIV pol gene. Or variants such as, but not limited to, reverse transcriptase, integrase, or protease, and the like.

Modulation of a vaccine-induced immune response as described herein includes directly or indirectly promoting, accelerating, augmenting, or prolonging the immune response, such as humoral and/or cellular immunity; or altering the type of immune response, such as innate Immunity or acquired immunity.

In a further aspect, the invention also relates to a method of enhancing an immune response induced by a vaccine of interest in a subject.

The adjuvant of the present invention may be used together with the vaccine or separately. Where used together can include applying the two directly together to apply to the subject. While being used alone may include pre-administering the adjuvant to a subject, and then administering the vaccine to the same subject. Alternatively, the adjuvant may be administered to the same subject before the vaccine is administered. The time interval for administration is, for example, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, or 4 weeks.

Methods and techniques for immunizing a subject are well known in the art. Those skilled in the art can select an appropriate immunization strategy to enhance the immune effect according to the needs of the present invention. For example, different immunization sequences, different immunization frequencies, different immunization doses, different target animals, immunization at different sites, and the like are used. The dosage range of the adjuvant used therein may, for example, Yes: From lg to 100μ _§ . The dose as an example may be, for example, lg, 5 μg, 10 μ _§ , 25 μg, 50 μg, or 100 μ ₈ . It should be understood that these choices are within the skill of the art and are within the skill of the art. The technical solution of the present invention therefore covers these options.

In an embodiment of the invention, immunizing a subject can be carried out by any method known in the art. The subject for immunization of the present invention may be a human or an animal commonly used in the art, such as, but not limited to, a mouse, a rat, a monkey, a rabbit, a cotton sheep, a goat, a horse, a cow, and the like.

In some embodiments, the vaccine in the methods of the invention comprises an HIV Εην protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine comprises an HIV Env protein encoding And/or a polynucleotide of HIV Gag protein, and/or HIV Pol protein, or a fragment or variant thereof.

In another aspect, the invention also relates to a vaccine composition.

In one embodiment, the vaccine composition of the invention comprises the following components: (a) a vaccine comprising an immunogen and/or a polynucleotide encoding an immunogen; and (b) comprising an HIV Tat protein or fragment thereof or A variant or an adjuvant encoding a polynucleotide of HIV Tat protein or a fragment or variant thereof.

In another embodiment, the vaccine in a vaccine composition of the invention is a protein vaccine, and the adjuvant comprises an HIV Tat protein or a fragment or variant thereof. In some embodiments, the vaccine in a vaccine composition of the invention comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine of interest comprises a coding A polynucleotide of HIV Env protein, and/or HIV Gag protein, and/or HIV Pol protein, or a fragment or variant thereof.

In another aspect, the invention also relates to an adjuvant.

In one embodiment, an adjuvant of the invention comprises a HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof. In some embodiments, the polynucleotide encoding a HIV Tat protein or a fragment or variant thereof is inserted into a vector. In some embodiments, the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudovirus particle, and a virus-like particle. The invention is further illustrated below in conjunction with specific embodiments.

Example

Unless otherwise stated, the molecular techniques used in the following examples are conventional techniques well known to those skilled in the art. Specific implementation steps for such techniques can be found in various laboratory manuals and textbooks, such as J. Sambrook's Molecular Cloning: A Laboratory Manual (Cold Spring Harbour Laboratory Press, 1989), J. Perbal's A Practical Guide to Molecular Cloning ( John Wiley and Sons, 1984), TA Brown et al., Essential Molecular Biology: A Practical Approach (IRL Press, 1991), and DM Glover et al., DNA Cloning: A Practical Approach (IRL Press, 1995 and 1996), and the like.

Experimental materials used in the present invention: pDRVISVl.O is a DNA vaccine vector constructed by the Virus Immunology Room of the Center for STD/AIDS Prevention and Control of the Chinese Center for Disease Control and Prevention. The vector pDRVISVl.O can be constructed in accordance with the method described in CN 1560259 A (Chinese Patent Application No. 200410028280.3), which is incorporated herein by reference. A vaccine plasmid for the HIV BVC recombinant strain Env, Gag, Pol gene constructed on the basis of the DNA vaccine vector pDRVISV1.O. The Endofree Plasmid Giga Kit for the preparation of endotoxin-free plasmid DNA is a Qiagen product; the Mouse lFN-y ELISPOT assay kit is a product of U-CyTech. Cell culture fluid was purchased from Hyclone Corporation. Fetal bovine serum was purchased from Hangzhou Sijiqing Bioengineering Materials Co., Ltd. Anti-HIV-1 positive serum was obtained from the Reference Room of the STD/AIDS Prevention and Control Center (available through standard procedures); horseradish peroxidase HRP-labeled goat anti-mouse IgG was purchased from Beijing Zhongshan Company; derived from BVC recombinant subtype HIV-1 Synthetic peptide of the strain Env for ELISPOT analysis, by the National Institutes of Health The NIH AIDS Research & Reference Reagent Program is a gift (available free of charge); the HIV-1 Env antigen used in the ELISA test is provided by the HIV/AIDS Room of the STD HIV/AIDS Prevention and Control Center, which is based on conventional techniques. For expression; Laborzentrifugen desktop refrigerated centrifuge is Sigma product, Beckman J2-MC high speed refrigerated centrifuge; carbon dioxide incubator is SANYO product; ELISPOT reading instrument is BIOSIS company product; experimental animal is 6-8 week old BALB/ c H-2d female mice, weighing 18-25 grams, purchased from the Animal Breeding Center of the Chinese Academy of Medical Sciences, clean grade at Beijing Zhaoyan New Drug Research Center

Example 1 : Construction of plasmid

All the plasmids used in this example were pDRVISVl.O, abbreviated as pl.0.

The HIV Tat sequence was inserted into the DRVISVl.O vector using the following primers:

Rv-Tat: GAAGATCTTTAGTCGAATGGGTCTGTCTCTG (SEQ ID NO: 2) The template used for the Tat sequence was synthesized by Invitra en, and its specific sequence is:

1. PCR (PCR instrument purchased from Takara) conditions are as follows

(All PCR reagents were purchased from Takara

lOx polymerase buffer containing Mg2+ 5μ1

dNTP (10mmol/L) 4μ1

Upstream primer (50μηιο1/:0 Ιμΐ

Downstream primer (50μηιο1/:0 Ιμΐ

Template DNA 0.5μ1

DNA polymerase Ιμΐ Pyrobest DNA Polymerase

Add ddH20 to total volume 50μ1

After mixing, carry out a cyclic reaction on the PCR machine. First, denaturation at 94 ° C for 5 min; then 94 ° C for 30 sec, 52 ° C for 30 sec, 72 ° C for 30 sec, 29 cycles; and finally 72 ° C for 10 min. After the completion of the reaction, the Ιμΐ amplification product was subjected to electrophoresis on a 1.0% agarose gel. 2. Gel recovery of PCR products (using E.Z.N.A Cycle-Pure Kit from Omega)

(a) Cut an agarose gel containing the DNA of interest.

(b) Weigh the weight of the gel by adding 3-6 volumes of Binding Buffer.

(c) Warm bath at 55-65 ° C until the gel is completely dissolved.

(d) Transfer the gel solution to a DNA preparation tube and place it in a 2 ml centrifuge tube at 14,000 rpm for 10 seconds to discard the filtrate.

(e) Place the preparation tube back into the centrifuge tube and add 750 ml of DNA Wash Buffer at 14,000 rpm for 10 seconds to discard the filtrate.

(f) Repeat step (e) - times.

(g) Place the preparation tube back into the centrifuge tube and centrifuge at 14000 rpm for 2 min. Transfer the preparation tube into a new 1.5 ml centrifuge tube, and add 50 μl of double distilled water to the center of the DNA preparation membrane for 1 min at room temperature.

The DNA was eluted by centrifugation at 14,000 rpm for 2 min.

3. Enzyme digestion (the enzymes used were purchased from Takara)

The gel recovery gene fragment and the expression plasmid vector are separately digested, and the system is as follows:

Sai l Ιμΐ

Bgl ll Ιμΐ

ΙΟχΗ buffer 2μ1

Plasmid vector or Tat fragment Ιμΐ

Add ddH20 to total volume 20μ1

37 ° C water bath, overnight.

4. Connection (kit purchased from Takara)

The connection system is as follows:

After digestion, the vector Ιμΐ Digested Tat fragment Ιμΐ

10χ enzyme buffer 2μ1

Ligase 0.5μ1

20μ1

5. Conversion

(a) Remove the E coli (DH5a) competent cells frozen at -70 °C and place on ice; (b) Add the ΙΟμΙ ligation product, mix gently, place in an ice bath for 30 min, set a plasmid and not Competent cell experimental control with plasmid DNA;

(c) Heat shock at 42 °C for 90 sec, do not shake the test tube, and quickly put it into the ice bath for 2 min;

(d) Add 800 μl of 37 ° C pre-warmed LB medium to each tube, incubate at 37 ° C for 1 hr, resuspend the cells, and express the plasmid-encoded antibiotic marker gene.

(e) The transformed cells were separately applied to an LB agar plate containing kanamycin, and cultured at 37 ° C for 16 hrs or more.

6. Plasmid extraction (kits were purchased from Omega:). The plasmid was named: pl.0-Tat. 7. The final plasmid was sent to Invitrogen for sequencing.

8. The various DNA vaccines used in the examples of the present invention can be constructed by conventional techniques with reference to the above process. The resulting plasmids were named pl. 0-Gag, pl. O-Env, and pl. 0-Pol, respectively. In this paper, the naming method of "plasmid name + target gene name" is used uniformly. The following template is used:

Env template: plasmid pDRVI3.1-env with the accession number CGMCC No. 2112 (see Chinese Patent Application No. 200710129786.7, publication No. CN101353665A, incorporated herein by reference).

Pol template: plasmid pCRScript-gpnef with the accession number CGMCC No. 1003 (see Chinese Patent Application No. 200710088735.4, Publication No. CN 101270363A, the disclosure of which is incorporated herein by reference).

Gag template: plasmid pCRScript-gpnef with accession number CGMCC No.1003 (see National Patent Application No. 200710088735.4, Publication No. CN 101270363A, the disclosure of which is incorporated herein by reference. The primers used therein are:

Primers constructed by pl.O-Gag:

Fwd-Gag: ACGCGTCGACGCCACCATGGCCGCCAGGGCCAG (SEQ ID NO: 4) Rv-Gag: CGGGATCCTCACTGGCTGCTGGGGTCGTTG (SEQ ID NO: 5)

The annealing temperature was 60 ° C and the temperature was extended at 72 ° C for 2 minutes. Primers constructed by pl.O-Pol:

Fwd-Pol: ACGCGTCGACGCCACCATGGCCGCCAGGGCCAGC (SEQ ID NO: 6) Rv-Pol: GATATCTTACTTGGTCCTGTGCTGGCCGATC (SEQ ID NO: 7)

The annealing temperature was 63 ° C and the elongation at 72 ° C was 4 and a half. Primers constructed by pl.O-Env:

Rv-Env: GATATCTCAGTAGCCCTGCCTCACCCTG (SEQ ID NO: 9)

The annealing temperature was 60 ° C and extended at 72 ° C for 4 minutes.

The remaining steps are similar to the above process.

Example 2: HIV Tat combined with DNA vaccine immunized mice

Groups of experimental animals: 42 6-8 week old Balb/c female mice were divided into 6 immunized groups (three DNA vaccines each containing a single administration group and one additional adjuvant group), and one empty vector control group. The grouping and immunization programs are shown in Table 1:

Table 1. DNA vaccine immunization mice experimental protocol

6/group

Gag+ adjuvant pl.O-Gag 50μ _§ pl.O-Tat muscle 2 times

6 / group

Pol alone pl.O-Pol 50μ _§ no muscle 2 times

6 / group

Pol+ adjuvant pl.O-Pol 50μ _§ pl.O-Tat muscle 2 times

6/group empty vector control pl.O 50μ _§ pl.O-Tat muscle 2 times

Immunization method: For the DNA vaccine plus adjuvant immunization group, take 5 (^L concentration of lg / L DNA vaccine and 5 (^L concentration of lg / L pl. O-Tat mixed, then inject the mouse. For none In the DNA vaccine immunization group of adjuvant, 5 (^L concentration of lg/L DNA and 50 μΙ^ lg/L empty vector plasmid were mixed and injected into the mice. The empty vector group was taken as 5 (^L concentration was The lg/L pDRVI1.O empty plasmid vector and 5 (L concentration of lg/L DNA Tat were mixed, and then injected into the mouse. The injection site was Balb/C mouse tibialis anterior muscle, and the left and right legs were each injected with 50 μM.

The immunization program and test time are shown in Figure 1: The immunization program is immunized once every 0 and 4 weeks. At the 7th week, the rats were anesthetized with barbital, and the blood was separated by eyelid collection. After the mice were sacrificed, the spleen lymphocytes were isolated. Example 3: Humoral immunization with HIV Tat and Env antigen DNA vaccine The mice were immunized once every 0 and 4 weeks, and the rats were anesthetized with barbital after the 7th week, and the serum was separated by eyelid extraction. Env was detected by ELISA. The antigen) specifically binds to the antibody titer. The Env antigen protein was obtained by expressing the plasmid pl. O-Env for immunizing mice constructed above in a 293 suspension cell expression system (purchased from Invitrogen).

Step 1: Recombinant Env antigen protein coated ELISA plate (O.l g/ml) with HIV-1 BVC recombinant strain with a purity greater than 95%, and 0.1 ml of the corresponding protein antigen per well, overnight at 4 °C. The next day, the washing buffer was washed 3 times, and the residual liquid was drained. The antibody was diluted with antibody dilution for 60 min, washed with buffer for 3 times, dried for testing, or dried at 4 ° C;

Step 2: Serially dilute the antibody dilution to the sample to be tested (diluted sample is mouse serum:) (starting at JA 1:100, diluted to 1: 12800) 0.1 ml added to the above coated reaction well Incubate at 37 ° C for 60 min, wash 8 times (while doing blank, negative and positive well control. Blank: no serum added; negative: blank mouse serum; positive: previously positive reaction has been identified Mouse serum:);

Step 3: Add the enzyme (horseradish peroxidase:)-labeled secondary antibody (anti-antibody) diluted in fresh 1:5000 antibody dilution in the well (all secondary antibodies in ELISA are anti-rat spicy) Root Peroxidase 0.1 ml, incubate at 37 ° C for 60 min, wash 8 times, remove residual liquid, pat dry on paper;

Step 4: Add color to the substrate solution: Add 0.1 ml of the temporarily prepared TMB substrate solution to each reaction well, and react at 37 ° C for 10 min in the dark. After the color is complete, add 50 μl of 2 M sulfuric acid to terminate the reaction; Step 5: Judgment of results: On the ELISA detector, at 450 nm (630 is the reference wavelength:), the 0D value of each well was measured by zeroing the blank control well, and if it was greater than 2.1 times the 0D value of the negative control, it was judged to be positive.

The detection results for the Εην antigen are shown in Fig. 2. Serum ELISA assays (shown in Figure 2) 3 weeks after the 2 immunizations of the mice showed that the DNA vaccine plus adjuvant group significantly increased the vaccine-induced Env-specific binding antibody strength compared to the DNA vaccine alone. The results of the test indicate that the HIV Tat adjuvant can significantly increase the intensity of the humoral immune response induced by the DNA vaccine.

For Env-specific binding antibodies: Compare the antibody titer in the serum of mice with "immunized pl. O-Env group" and "immunized pl. O-Env+pl.O-Tat group" in the corresponding group The mouse serum was diluted 200-fold, 400-fold, and 800-fold, and the absorbance (OD value) was measured by a microplate reader. The mice in the "immune pl. O-Env+pl.O-Tat group" were observed. The binding antibody titer in serum was nearly 2-fold higher than that of the "immunized pl. O-Env group" mice. The specific values are greater than 2.1 of the negative control value. Example 4: Cellular immunodetection after immunization of mice with HIV Tat and DNA vaccine

(1) Extraction of mouse spleen lymphocytes (RPMI1640 used in this experiment was purchased from Hyclone:).

1) After the mice were sacrificed, the mice were immersed in 75% alcohol for disinfection, and operated under sterile ultra-clean bench conditions;

2) Remove the mouse spleen under aseptic conditions, and grind and disperse the spleen cells in a double-layer gauze in 5 ml of Hanks lotion (provided by the Chinese Disease Prevention and Control Center for Virus Disease Prevention and Control), and transfer to 15 ml of sterile centrifuge. Tube, centrifuged at 4 ° C, lOOOOrpm for 5 min;

3) Discard most of the Hanks lotion in the supernatant, resuspend the cells with a small amount of residual liquid, add 2 ml of pre-warmed red blood cell lysate (purchased from Hyclone) at 37 °C per tube, and start timing from the first tube. After 4 min, the lysis reaction was terminated by adding 5 ml of RPMI1640 washing solution, and immediately centrifuged at 4 ° C, 1000 rpm for 5 min;

4) Discard most of the supernatant, resuspend the cells with a small amount of residual liquid, and add 5 ml to each tube. Wash the cells with RPMI1640 wash solution, centrifuge at 5 ° C, lOOOrpm for 5 min;

5) Discard most of the supernatant, resuspend the cells with a small amount of residual liquid, and add 2 ml of RPMI1640 complete medium containing 10% fetal bovine serum (purchased from Hangzhou Sijiqing Bioengineering Materials Co., Ltd.) to each tube (; From Hyclone), after mixing, the cell suspension ΙΟΟμΙ was added to 900 μl of PBS, and the cells were counted in a cytometer, and the cell concentration was adjusted to 1 × 10 ⁷ /ml according to the number of cells obtained.

(2) ELISPOT detects spleen lymphocyte reaction level

1) Coat: Add 50 μl of coated antibody (purified anti-IFN-γ monoclonal antibody) to each well of ELISPOT plate, supplement the volume to ΙΟΟμΙ with PBS, and cover at 37 °C for 2 h.

2) Blocking of the ELISPOT board.

3) Remove the coated ELISPOT plate, and aspirate and discard the coated antibody solution in each well.

4) Wash 6 times with PBST (PBS + Tween 20) under sterile conditions through a 300 μl pipette.

5) In the ELISPOT plate, add 200 μl of PBS containing 1% BSA (or blocking buffer) to each well at 37 °C for 1 h.

6) Remove the ELISPOT plate sealed at 37 °C for lh, and aspirate the blocking solution in each well.

7) In the ELISPOT plate, add the corresponding antigenic protein of ΙΟΟμΙ (concentration of 10 g/ml), and finally add the lymphocytes obtained above to μμΙ, the total volume to 200μ1 (the final concentration of the cells is lx l0 ⁷ / Ml, the total number of cells per well is lx l0 ⁶ ). The negative control was given no peptide and ΙΟΟμΙ RPMI1640 complete medium was added. The positive control was not added with polypeptide, and ΡΜΑ2.5μ1 (25ι3⁄4/ηι1), myomycin (Inomycin) Ιμΐ (lg/ml^ immunized group were in duplicate).

8) Cover the ELISPOT plate and incubate it in a 37°C incubator with 5% CO 2 for 30 h.

9) After incubation for 30 hours, remove the ELISPOT plate. After removing the cells, add 200 μM of deionized water to each well. Place the ELISPOT plate in an ice bath for 10 minutes.

10) Wash the ELISPOT plate 8 times with PBST.

11) Add ΙΟΟμΙ biotinylated detection antibody (ie, biotinylated anti-IFN-γ monoclonal antibody) to each well. After sealing the ELISPOT plate with a membrane, place the ELISPOT plate in a 37 °C incubator for 1 h.

12) Remove the ELISPOT plate, pour the detection antibody solution, and wash it 8 times with PBST.

13) Add 50 μl of GABA solution to each well. After sealing the ELISPOT plate with a membrane, place the ELISPOT plate in a 37 ° C incubator for 1 h. 14) Remove the ELISPOT plate and pour the GABA solution. Wash 8 times with PBST. After washing, gently pat the ELISPOT plate on absorbent paper.

15) Add 30 μΐ of color solution per well (commercially available for purchase:). Incubate in the dark at room temperature (15 to 40 minutes).

16) After the spots appear, rinse with distilled water and stop the reaction.

17) Light-drying at room temperature, BIOSIS plate reader test to evaluate the level of lymphocyte immune response.

The results are shown in Figure 3. Three weeks after immunization of mice, ELISPOT assay was used to detect the specific cellular immunity of HIV-1 Env, Gag, and Pol. Since the Tat sequence, the Gag sequence, the Pol sequence, and the Env sequence do not have sequence similarity to each other, and both the ELISpot and ELISA experiments are highly specific in antigenicity. Therefore, the above results indicate that the DNA vaccine plus adjuvant group can significantly increase the specific cellular immune response of Env, Gag, Pol (P<0.01) compared with the DNA immunization group alone. These tests show that HIV Tat adjuvant can significantly increase the intensity of cellular immune responses induced by DNA vaccines.

"Improved pl. O-Env group alone" and "immunized pl. O-Env + pl. O-Tat group", "individually immunized pl. O-Gag group" and "immunized pl. O-Gag + pl. O- The ELISPOT results of the Tat group, the "immunized pl. O-Pol group" and the "immunized pl. O-Pol + pl. O-Tat group" are as follows:

"Individual immunization of pl. O-Env group" and "immune pl. O-Env + pl. O-Tat group": 1 SFU value (per million cells) greater than 50 as a criterion for determining positive reaction; One-way analysis of variance was used to detect statistical differences between groups. The results showed that the average SFU <50 of the "immunized pl. O-Env group" was negative; the average SFU of the "immunized pl. O-Env+pl. O-Tat group" was 50, which was positive. And the statistical analysis between the two groups shows: Value <0.05. Therefore, the conclusion is: Under the experimental conditions, the Tat adjuvant can make the Env-specific T cell response change from negative to positive, and the enhancement factor is up to 3 times, and there is significant statistical difference.

"Individual immunization of p 1.0-Gag group" and "Immune p 1.0-Gag+p 1.0-Tat group": 1 SFU value (per million cells) greater than 50 as a criterion for positive reaction; 2 Single factor variance The analytical method detects statistical differences between the data between the groups. The results showed that the average SFU>50 of the “immunized pl. O-Gag group” was positive; the average SFU>50 of the “immunized pl.0-Gag+pl.0-Tat group” was positive. However, statistical analysis between the two groups showed: Value <0.01. Therefore, the conclusion is: Under the experimental conditions, the adjuvant of Tat adjuvant can significantly enhance the Gag-specific T cell response, and the enhancement ratio is up to 6 times, and there is significant statistical difference. "Improved pl. O-Pol group alone" and "Immune pl. O-Pol + pl. O-Tat group": 1 SFU value (per million cells) greater than 50 as a criterion for determining positive reaction; One-way analysis of variance was used to detect statistical differences between groups. The results showed that the average SFU>50 of the “immunized pl.O-Pol group” was positive; the average SFU>50 of the “immunized pl.O-Pol+pl.O-Tat group” was positive. However, statistical analysis between the two groups showed: Value <0.01. Therefore, the conclusion is: Under the experimental conditions, the adjuvant of Tat adjuvant can significantly enhance the specific T cell response of Pol, and the enhancement ratio is up to 6 times, and there is significant statistical difference. The above examples are merely illustrative of the invention and are not intended to limit the scope of the invention. It is apparent that various modifications and changes can be made to the invention without departing from the spirit and scope of the invention, and such modifications and variations are also within the scope of the invention.

Claims

1. An HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof, in the preparation of an adjuvant or vaccine composition for enhancing an immune response induced by a vaccine of interest in a subject use.

2. The use of claim 1, wherein the vaccine comprises a DNA vaccine and the adjuvant or vaccine composition comprises a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

3. The use of claim 2, wherein the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof is inserted into a vector.

4. The use of claim 3, wherein the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, pseudoviral particles, and virus-like particles.

5. The use of claim 1, wherein the vaccine comprises a protein vaccine and the adjuvant or vaccine composition comprises an HIV Tat protein or a fragment or variant thereof.

6. The use of claim 1, wherein the vaccine comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine comprises an HIV Env protein, and/or Or a polynucleotide of HIV Gag protein, and/or HIV Pol protein, or a fragment or variant thereof.

7. A method of enhancing an immune response induced by a vaccine of interest in a subject, comprising administering the vaccine to a subject, and administering to the subject an HIV Tat protein or the same or before or after administering the vaccine A fragment or variant or an adjuvant encoding a polynucleotide of HIV Tat protein or a fragment or variant thereof.

8. The method of claim 7, wherein the vaccine comprises a DNA vaccine, and the adjuvant comprises a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

9. The method of claim 8, wherein the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof is inserted into a vector.

10. The method of claim 9, wherein the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudoviral particle, and a virus-like particle.

11. The method of claim 7, wherein the vaccine comprises a protein vaccine, and the adjuvant comprises an HIV Tat protein or a fragment or variant thereof.

12. The method of claim 7, wherein the vaccine of interest comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine comprises a HIV Env protein, and / or HIV Gag protein, and / or HIV Pol protein, or a polynucleotide of a fragment or variant thereof.

13. The method of any of claims 7-12, wherein the administering is by a muscle and/or intradermal route of administration.

14. A vaccine composition comprising the following components:

(a) a vaccine comprising an immunogen and/or a polynucleotide encoding an immunogen;

(b) An adjuvant comprising a HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding an HIV Tat protein or a fragment or variant thereof.

15. The vaccine composition of claim 14, wherein the vaccine comprises a DNA vaccine and the adjuvant comprises a polynucleotide encoding a HIV Tat protein or a fragment or variant thereof.

16. The vaccine composition of claim 15, wherein the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof is inserted into a vector.

17. The vaccine composition of claim 16, wherein the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, a pseudoviral particle, and a virus-like particle.

18. The vaccine composition of claim 14, wherein the vaccine comprises a protein vaccine and the adjuvant comprises an HIV Tat protein or a fragment or variant thereof.

19. The vaccine composition of claim 14, wherein the vaccine of interest comprises an HIV Env protein, and/or an HIV Gag protein, and/or an HIV Pol protein, or a fragment or variant thereof; or the vaccine of interest comprises an HIV Env encoding Protein, and/or HIV Gag protein, and/or HIV Pol protein, Or a polynucleotide of a fragment or variant thereof.

20. An adjuvant comprising a HIV Tat protein or a fragment or variant thereof or a polynucleotide encoding a HIV Tat protein or a fragment or variant thereof.

21. The adjuvant of claim 20, wherein the polynucleotide encoding the HIV Tat protein or a fragment or variant thereof is inserted into a vector.

22. The adjuvant of claim 20, wherein the vector is selected from the group consisting of a plasmid, a recombinant viral vector, a recombinant bacterial vector, pseudovirions, and virus-like particles.