WO2012138102A2 - Anticorps humains spécifiques de dlk1 et compositions pharmaceutiques les contenant - Google Patents

Anticorps humains spécifiques de dlk1 et compositions pharmaceutiques les contenant Download PDF

Info

Publication number
WO2012138102A2
WO2012138102A2 PCT/KR2012/002496 KR2012002496W WO2012138102A2 WO 2012138102 A2 WO2012138102 A2 WO 2012138102A2 KR 2012002496 W KR2012002496 W KR 2012002496W WO 2012138102 A2 WO2012138102 A2 WO 2012138102A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
dlk1
set out
heavy chain
light chain
Prior art date
Application number
PCT/KR2012/002496
Other languages
English (en)
Korean (ko)
Other versions
WO2012138102A3 (fr
Inventor
박영우
조기원
이동희
윤선하
손명호
김경진
김동진
이유라
박찬웅
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020120001457A external-priority patent/KR101438265B1/ko
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2012138102A2 publication Critical patent/WO2012138102A2/fr
Publication of WO2012138102A3 publication Critical patent/WO2012138102A3/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/485—Epidermal growth factor [EGF], i.e. urogastrone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man

Definitions

  • the present invention provides a fragment comprising a human antibody or antigen-binding site thereof that specifically binds to the extracellular domain water-soluble domain of a delta-like 1 homolog (DLK1), a polynucleotide encoding the human antibody or fragment thereof, the polynucleotide Recombinant vector comprising a, transformants transformed with the recombinant vector, a method for producing the human antibody or fragment thereof, pharmaceutical composition and diagnostic kit for preventing or treating a disease comprising the human antibody or fragment thereof It is about.
  • DLK1 delta-like 1 homolog
  • Cancer is characterized by "uncontrolled cell growth,” which results in the formation of cell masses called tumors that penetrate into surrounding tissues and, in severe cases, metastasize to other organs in the body. These cancers are intractable chronic diseases that, even if treated with surgery, radiation, and chemotherapy, in many cases fail to cure the underlying condition and cause pain to the patient and ultimately lead to death.
  • Cancer varies from country to country, but developed countries and Korea account for more than 20% of all deaths. Cancer is classified into blood cancer and solid cancer, and it occurs in almost every part of the body such as lung cancer, stomach cancer, breast cancer, oral cancer, liver cancer, uterine cancer, esophageal cancer, and skin cancer.
  • chemotherapy agents except surgery or radiation therapy, are collectively called anticancer agents, and most of them show anticancer activity by inhibiting the synthesis of nucleic acids.
  • the delta-like 1 homolog (DLK1) belonging to the notch / delta / serrate family is a transmembrane glycoprotein encoded by the dlk1 gene located on chromosome 14q32. It consists of.
  • the protein is divided into 280 extracellular regions, 24 membrane transmembrane regions, and 56 intracellular regions, and has six epidermal growth factor like repeat domains outside the double membrane, and three It has N-glycosylation and seven O-glycosylation sites.
  • DLK1 is a membrane protein, it is well known as a protein that sheds the outer part of the cell membrane by a tumor necrosis factor alpha converting enzyme (TACE) and functions separately.
  • TACE tumor necrosis factor alpha converting enzyme
  • DLK1 and cancer studies on the relationship between DLK1 and cancer include overexpression of DLK1 expression in brain cancer cells (glioma), and overexpression of cDNA of DLK1 in brain cancer cells increases the proliferation of brain cancer cells, leading to increased migration.
  • glioma brain cancer cells
  • cDNA of DLK1 in brain cancer cells increases the proliferation of brain cancer cells, leading to increased migration.
  • the expression of DLK1 in liver cancer is higher than that of normal hepatocytes, and the tumor size is reduced when the expression of DLK1 is reduced by siRNA experiment. It has been reported to decrease (Huang J et al., Carcinogenesis, 28 (5): 1094-1103, 2007).
  • the inventors of the present invention first identified that the DLK1-Fc fusion protein conjugated with the extracellular domain water-soluble domain of DLK1 and the Fc domain of the IgG antibody in the Republic of Korea Patent No. 10-0982170 can exhibit an anticancer effect. .
  • the anticancer action of the extracellular domain soluble domain of DLK1 is caused.
  • the present inventors have made diligent efforts to elucidate the anticancer mechanism of the extracellular domain soluble domain of DLK1.
  • the extracellular domain soluble domain of DLK1 binds to activin type II B competitively with activin.
  • the present invention was found to exhibit anticancer effects by blocking activin signaling, thereby completing the present invention.
  • human antibodies that specifically bind to the extracellular domain soluble domain of DLK1 not only inhibit cancer cell metastasis, but also significantly increase the binding ability of DLK1 to the activin receptor type 2B of the extracellular domain soluble domain. It was confirmed that the present invention was completed, and the present invention was completed.
  • Another object of the present invention is to provide a polynucleotide encoding a fragment comprising the human antibody or antigen-binding site thereof.
  • Another object of the present invention is to provide a recombinant vector comprising the polynucleotide.
  • Still another object of the present invention is to provide a transformant transformed with the recombinant vector.
  • Still another object of the present invention is to provide a method for preparing a fragment comprising the human antibody or antigen-binding site thereof.
  • Another object of the present invention to provide a pharmaceutical composition for preventing or treating cancer, comprising a fragment comprising the human antibody or antigen-binding site thereof.
  • the present invention provides a fragment comprising a human antibody or antigen-binding site thereof that specifically binds to the extracellular domain water-soluble domain of DLK1 (delta-like 1 homolog).
  • delta-like 1 homolog refers to a transmembrane glycoprotein consisting of 383 amino acids encoded in the dlk1 gene located on chromosome 14q32.
  • extracellular domain water-soluble domain of DLK1 refers to the water-soluble domain of the extracellular domain of DLK1 protein divided into extracellular, transmembrane and intracellular regions, and anticancer of the extracellular domain of the DLK1 extracellular domain. The effect was first identified by the inventors.
  • extracellular domain water-soluble domain of DLK1 may be expressed in combination with water-soluble DLK1.
  • the water-soluble DLK1 of the present invention may be composed of 200 to 300 amino acids having water-soluble DLK1 activity, more preferably may be composed of the amino acid sequence described in SEQ ID NO: 1, the amino acid sequence showing water-soluble DLK1 activity is not limited May be included.
  • human antibody refers to a molecule derived from human immunoglobulin, in which all of the amino acid sequences constituting the antibody including complementarity determining regions and structural regions are composed of human immunoglobulins.
  • one antibody molecule has two heavy chains and two light chains, each of which has a variable region at its N-terminus.
  • Each variable region consists of three complementarity determining regions (CDRs) and four framework regions (FRs), which determine the antigen binding specificity of the antibody and determine the structure of the variable region.
  • CDRs complementarity determining regions
  • FRs framework regions
  • the fragment comprising the human antibody or antigen-binding site thereof of the present invention has the activity of specifically binding to water-soluble DLK1.
  • the fragment comprising the human antibody or antigen-binding site thereof of the present invention may have an activity of specifically binding water-soluble DLK1, thereby ultimately increasing the binding capacity of the water-soluble DLK1 to activin receptor type 2B.
  • fragments comprising the human antibody or antigen-binding site thereof of the present invention can competitively bind DLK1 to activin receptor type 2B by elevating the binding ability of the extracellular domain soluble domain of DLK1 to activin receptor type 2B. Signaling can be inhibited by blocking the binding of other ligands.
  • the fragment comprising the human antibody or antigen-binding site thereof of the present invention can inhibit intracellular signaling in a hypoxic state.
  • the human antibody of the present invention specifically binds to the water-soluble DLK1 by confirming that the B09 antibody is typically capable of binding to the water-soluble DLK1 of the human antibodies of the present invention ( 21, 22 and 27), when the human antibody of the present invention was treated with water-soluble DLK1 it was confirmed that the binding capacity of water-soluble DLK1 to activin receptor type 2B significantly increased (Figs. 25, 27 and 29).
  • the human antibody of the present invention can react the cells in the hypoxic state It was confirmed that it can be suppressed (FIG. 28).
  • the fragment comprising the human antibody or antigen-binding portion thereof of the present invention is a part of the heavy chain variable region, SEQ ID NO: 2 (SYAMN), SEQ ID NO: 8 (DYAIH), SEQ ID NO: 14 (EHAMH), SEQ ID NO: 20 ( DYAMH), SEQ ID NO: 26 (LYGMS) and SEQ ID NO: 32 (DYYMS), any one heavy chain CDR1 sequence selected from the group consisting of; SEQ ID NO: 3 (TITATSGKTYYADSVKG), SEQ ID NO: 9 (WINPGSGNTKYSHNFEG), SEQ ID NO: 15 (GINWNSGKTGYADSVKG), SEQ ID NO: 21 (GISWNSGSIGYADSVKG), SEQ ID NO: 27 (SIPGSGTRTHYADSVKG), and SEQ ID NO: 33 (one of the groups selected from YISGSGITTYYADSVKG) CDR2 sequence; Or any one selected from the group consisting of SEQ ID NO: 4 (GESCSGG
  • Human antibody comprising a heavy chain CDR3 sequence or a fragment comprising an antigen binding site thereof, and also as part of a light chain variable region, SEQ ID NO: 5 (TGTSSDIGRYNRVS), SEQ ID NO: 11 (QASQDISNYLN), SEQ ID NO: 17 (IGTSSNIGVGYDVH), Any one light chain CDR1 sequence selected from the group consisting of SEQ ID NO: 23 (RASQRISSWLA), SEQ ID NO: 29 (RASQSIRHYLA) and SEQ ID NO: 35 (RASQSILTYLN); Any one light chain selected from the group consisting of SEQ ID NO: 6 (DVTTRPS), SEQ ID NO: 12 (STSNLQS), SEQ ID NO: 18 (GNNNRPS), SEQ ID NO: 24 (SASTLHN), SEQ ID NO: 30 (GASSRAT), and SEQ ID NO: 36 (AASSLQR) CDR2 sequence; Or any one selected from the group consisting of SEQ ID NO: 7 (GSYAGS
  • the fragment comprising the human antibody or antigen-binding portion thereof of the present invention comprises a heavy chain variable region, the heavy chain CDR1 of SEQ ID NO: 2, the heavy chain CDR2 of SEQ ID NO: 3, and the heavy chain CDR3 of SEQ ID NO: 4 Heavy chain variable region;
  • a heavy chain variable region comprising a heavy chain CDR1 as set out in SEQ ID NO: 8, a heavy chain CDR2 as set out in SEQ ID NO: 9, and a heavy chain CDR3 as set out in SEQ ID NO: 10;
  • a heavy chain variable region comprising a heavy chain CDR1 as set out in SEQ ID NO: 14, a heavy chain CDR2 as set out in SEQ ID NO: 15, and a heavy chain CDR3 as set out in SEQ ID NO: 16;
  • a heavy chain variable region comprising a heavy chain CDR1 as set out in SEQ ID NO: 20, a heavy chain CDR2 as set out in SEQ ID NO: 21, and a heavy chain CDR3 as set out in SEQ ID
  • a light chain variable region comprising a light chain CDR1 as set out in SEQ ID NO: 5, a light chain CDR2 as set out in SEQ ID NO: 6 and a light chain CDR3 as set out in SEQ ID NO: 7;
  • a light chain variable region comprising a light chain CDR1 as set out in SEQ ID NO: 11, a light chain CDR2 as set out in SEQ ID NO: 12, and a light chain CDR3 as set out in SEQ ID NO: 13;
  • a light chain variable region comprising a light chain CDR1 as set out in SEQ ID NO: 17, a light chain CDR2 as set out in SEQ ID NO: 18, and a light chain CDR3 as set out in SEQ ID NO: 19;
  • a light chain variable region comprising a light chain CDR1 as set out in SEQ ID NO: 23, a light chain CDR2 as set out in SEQ ID NO: 24, and a light chain CDR3 as set out in SEQ ID NO: 25;
  • a light chain variable region
  • the fragment comprising the human antibody or antigen-binding portion thereof of the present invention is a heavy chain variable region sequence, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46 or SEQ ID NO: 48 It may be a human antibody comprising the amino acid sequence described or a fragment comprising an antigen-binding portion thereof, and as the light chain variable region sequence, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47 or SEQ ID NO: 49 It may be a human antibody or a fragment comprising an antigen-binding site thereof comprising the amino acid sequence described.
  • the heavy and light chains may be used individually or together depending on the purpose, and a combination of a plurality of CDR sequences and light and heavy chains is possible according to conventional genetic engineering methods as desired by those skilled in the art.
  • fragment comprising the antigen-binding site of a human antibody refers to a fragment having immunological activity of the human antibody molecule of the present invention that can achieve antigen (water-soluble DLK1) -antibody binding and possesses antigen-binding function. It means the piece being done.
  • fragments include (i) a Fab fragment consisting of the variable region (VL) of the light chain and the variable region (VH) of the heavy chain, the constant region of the light chain (CL) and the first constant region of the heavy chain (CH1); (ii) a Fd fragment consisting of the VH and CH1 domains; (iii) a Fv fragment consisting of the VL and VH domains of a monoclonal antibody; (iv) dAb fragment consisting of the VH domain (Ward ES et al., Nature, 341: 544-546,1989); (v) isolated CDR regions; (vi) a F (ab ') 2 fragment that is a bivalent fragment comprising two linked Fab fragments; (vii) a single chain Fv molecule (scFv) bound by a peptide linker that binds the VH domain and the VL domain to form an antigen binding site; (viii) bispecific single-chain Fv dimers (PCT
  • Human antibodies of the present invention can be easily prepared by known monoclonal antibody production techniques.
  • methods for preparing monoclonal antibodies can be performed by preparing hybridomas using B lymphocytes obtained from immunized animals, or by using phage display technology, but are not limited thereto. It doesn't happen.
  • the human antibody of the present invention may be a human antibody produced from phage display.
  • the antibody library using phage display technology is a method of expressing an antibody on a phage surface by obtaining an antibody gene from B lymphocytes without producing hybridomas.
  • Phage display technology can overcome many of the existing difficulties associated with generating monoclonal antibodies by B-cell immortalization.
  • Typical phage display techniques of antibodies include the steps of: 1) inserting a sequence comprising an antibody variable region of a random sequence into a gene region corresponding to the coat protein p (or p) N-terminus of the phage; 2) expressing a portion of the native coat protein and a fusion protein of the antibody variable region encoded by the random sequence; 3) treating the antigen capable of binding with the antibody fusion protein library; 4) eluting antibody-phage particles bound to the antigen using low pH or binding competitive molecules; 5) amplifying the eluted phage in host cells; 6) repeating the method to obtain the desired amount; And 7) determining the sequence of the active antibody variable region from the DNA sequences of the phage clones selected by panning.
  • Phage that can be used to build antibody libraries in this step include fd, M13, f1, If1, Ike, Zj / Z, Ff, Xf, Pf1 or Pf3 phage, for example as filamentous phage.
  • the kind of phage that can be used in the present invention is not limited.
  • examples of vectors that can be used for expression of heterologous genes on the surface of the filamentous phage include phage vectors such as fUSE5, fAFF1, fd-CAT1 or fdtetDOG or pHEN1, pComb3, pComb8, pKRIBB-Fab or pSEX. Phagemid vectors of, but are not limited thereto.
  • helper phage that may be used to provide the wild type envelope protein required for successful reinfection of recombinant phage for amplification include, for example, M13K07 or VSCM13, but is not limited thereto.
  • the present invention provides a polynucleotide encoding a fragment (hereinafter, fragment thereof) comprising a human antibody or antigen-binding portion thereof according to the present invention and a recombinant vector comprising the polynucleotide.
  • the polynucleotide of the present invention is a polymer of nucleotides in which nucleotide monomers are long chained by covalent bonds, and are strands of DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) having a predetermined length or more, and according to the present invention, Polynucleotides encoding an antibody or fragment thereof.
  • the polynucleotide of the present invention may be a polynucleotide comprising a heavy chain variable region of SEQ ID NO: 50 and a light chain variable region of SEQ ID NO: 51.
  • the polynucleotide encoding the human antibody or fragment thereof of the present invention is a human expressed from a coding region due to the degeneracy of the codon or in view of the codons preferred in the organism in which the human antibody or fragment thereof is to be expressed.
  • Various modifications may be made to the coding region within the range of not changing the amino acid sequence of the antibody or fragment thereof, and various modifications or modifications may be made to the region except for the coding region without affecting the expression of the gene. Those skilled in the art will appreciate that such modified genes are also within the scope of the present invention.
  • nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, which are also included in the scope of the present invention.
  • the recombinant vector of the present invention is a means for introducing a DNA into a host cell to express a human antibody or fragment thereof of the present invention in a microorganism.
  • expression control sequences such as promoters, terminators, enhancers, etc., sequences for membrane targeting or secretion, etc. may be appropriately selected and variously combined according to the purpose.
  • Recombinant vectors of the invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like.
  • Suitable recombinant vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoters, operators, initiation codons, termination codons, polyadenylation signals and enhancers and can be prepared in various ways depending on the purpose.
  • the promoter of the recombinant vector may be constitutive or inducible.
  • As the signal sequence, MF ⁇ signal sequence, SUC2 signal sequence, etc. may be used when the host is a yeast, and insulin signal sequence, ⁇ -interferon signal sequence, antibody molecular signal sequence, etc.
  • the recombinant vector may include a selection marker for selecting a host cell containing the vector, and may include the origin of replication in the case of a replicable recombinant vector.
  • the present invention provides a method for producing a recombinant vector comprising a transformant transformed with a recombinant vector of the present invention and (a) a polynucleotide encoding a human antibody or fragment thereof of the present invention; (b) introducing the recombinant vector into a host cell and transforming the transformant with a transformant; And (c) provides a method for producing a human antibody or fragment thereof according to the present invention comprising the step of culturing the transformant.
  • the recombinant vector of the present invention may be transformed into an appropriate host cell, for example, a yeast cell, an animal cell, or the like, followed by culturing the transformed host cell, thereby producing a large amount of the human antibody or fragment thereof of the present invention.
  • an appropriate host cell for example, a yeast cell, an animal cell, or the like
  • the term "transformation” refers to introducing a gene into a host cell so that the gene can be expressed in the host cell, and if the transformed gene can be expressed in the host cell, the insertion into the chromosome of the host cell or Anything located outside the chromosome is included without limitation.
  • the gene also includes DNA and RNA as polynucleotides capable of encoding a polypeptide.
  • the gene may be introduced in any form as long as it can be expressed by being introduced into a host cell.
  • the gene may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct containing all the elements necessary for its expression.
  • the expression cassette typically includes a promoter, transcription termination signal, ribosomal binding site, and translation termination signal operably linked to the gene.
  • the method of transforming by introducing a recombinant vector of the present invention into a host cell is a method known in the art, such as, but not limited to, a transgenic vector comprising the DNA of the present invention, transient transfection, Microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE Dextran-mediated transfection, polybrene-mediated
  • the cell can be transformed by introducing into a host cell by a known method such as polybrene-mediated transfection or electroporation.
  • the host cell may be a eukaryotic cell derived from yeast, insect cells, plant cells, animal cells, such as Saccharomyces cerevisiae, preferably the animal cell may be an autologous or allogeneic animal cell. have. Transformants prepared by introducing into autologous or allogeneic animal cells may be used in cell therapies for administration to a subject to treat cancer.
  • the method of culturing the transformant of the present invention may be appropriately selected and used in any method known in the art for producing the human antibody or fragment thereof of the present invention.
  • the human antibody or fragment comprising the antigen-binding site thereof of the present invention specifically binds to the extracellular water soluble domain of DLK1, thereby activating the activin receptor type 2B of the extracellular domain water soluble domain of DLK1. It is useful for preventing or treating diseases related to the activin receptor type 2B signaling system by blocking the binding of other ligands capable of competitively binding DLK1 to activin receptor type 2B, thereby increasing the binding capacity. Can be used.
  • Ligands that bind to activin receptor type 2B include activin (activin A, activin B and inhibin A) (Derynck, Zhang et al. 1998), nodal (Oh and Li 2002), BMP6 (Ebisawa, Tada et al. 1999), BMP7 (Yamashita, ten Dijke et al. 1995), GDF5 (Nishitoh, Ichijo et al. 1996), GDF11 (Oh, Yeo et al. 2002) and the like.
  • activin activin A, activin B and inhibin A
  • nodal Oh and Li 2002
  • BMP6 Bisawa, Tada et al. 1999
  • BMP7 Yamashita, ten Dijke et al. 1995
  • GDF5 Neishitoh, Ichijo et al. 1996)
  • GDF11 Oh, Yeo et al. 2002
  • ACVR2B is phosphorylated to activate type I receptors.
  • Activated type I receptors activate Smad, a transcriptional regulator, to carry out cell signal transduction (Derynck, Zhang et al. 1998). These ligands perform a wide variety of signal transduction mechanisms through ACVR2B, and it is known that overregulation of signal transduction, particularly by overexpression of ligands, indicates various abnormalities if the signal transduction is misregulated.
  • the present invention provides a pharmaceutical composition for preventing or treating a disease, comprising a fragment comprising a human antibody or antigen-binding site thereof according to the present invention.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer, metabolic disease, immune system disease or liver disease, comprising a fragment comprising a human antibody or antigen-binding portion thereof according to the present invention.
  • the present invention provides a method of treating cancer, comprising administering a pharmaceutical composition according to the present invention to a subject having or likely to develop a cancer, metabolic disease, immune system disease, liver disease, or the like. To provide.
  • prevention means any action that inhibits or delays the onset of ACVR2B-related diseases including cancer by administration of the pharmaceutical composition of the present invention
  • treatment means the pharmaceutical composition of the present invention.
  • the term "individual” means any animal, including humans, who may develop or invent ACVR2B related diseases, including cancer.
  • the pharmaceutical composition of the present invention may improve or advantageously alter the symptoms caused by cancer through cancer metastasis or invasion inhibiting activity.
  • the pharmaceutical composition of the present invention may further comprise a water-soluble DLK1, the water-soluble DLK1 may exhibit an anticancer effect by binding to activin receptor type 2B competitively with activin to block activin signaling.
  • the activity of water-soluble DLK1 that inhibits the binding between activin receptor type 2B and activin can be significantly elevated by the human antibody of the present invention, which can effectively treat ACVR2B related diseases including cancer.
  • composition of the present invention may further comprise a DLK1-Fc fusion protein conjugated with the water-soluble DLK1 and the antibody Fc region, preferably the antibody Fc region may be a human antibody Fc.
  • the pharmaceutical composition of the present invention exhibits anti-cancer effects by inhibiting the binding between activin and activin receptor type 2B to block activin signaling, and thus may be useful for the prevention and treatment of cancer.
  • the pharmaceutical composition of the present invention can be used without limitation as long as the activin is overexpressed during the onset or progression of the cancer, or the cancer is grown or metastasized by activin / activin receptor type 2B signaling.
  • the metabolic disease may include diabetes or obesity
  • the immune system disease may include an autoimmune disease or rheumatoid arthritis
  • the liver disease is chronic hepatitis, alcoholic cirrhosis, acute liver failure, liver cancer or fatty liver It may include, but is not limited to diseases associated with signal transduction mechanisms due to the binding of the ligand and ACVR2B.
  • the route of administration of the pharmaceutical composition of the present invention may be administered via any general route as long as it can reach the desired tissue or cell.
  • the pharmaceutical composition of the present invention may be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, pulmonary, rectally, intracellularly or indirectly, as desired.
  • the pharmaceutical compositions of the present invention may be administered by any device in which the active substance may migrate to the target cell.
  • the pharmaceutical composition of the present invention may comprise an acceptable carrier.
  • the pharmaceutical composition comprising a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid form preparations for oral administration include tablet pills, powders, granules, capsules, and the like, which form at least one excipient such as starch, calcium carbonate, sucrose or lactose in one or more compounds. ) And gelatin.
  • Liquid preparations for oral administration include suspensions, solution solutions, emulsions, and syrups, and various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be included.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the pharmaceutical composition of the present invention is selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories It can have any one formulation.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level is determined by the type and severity of the subject, age, sex, activity of the drug, drug Sensitivity, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of drugs, and other factors well known in the medical arts.
  • composition of the present invention can be used alone or in combination with methods using surgery, hormonal therapy, drug therapy and biological response modifiers for the treatment of cancer.
  • the present invention comprises a human antibody or a fragment comprising an antigen-binding site thereof that specifically binds to the extracellular domain water-soluble domain of the delta-like 1 homolog (DLK1), cancer, metabolic diseases ,
  • DLK1 delta-like 1 homolog
  • An immune system disease or liver disease diagnostic kit is provided.
  • the kit may include an enzyme immunoassay (ELISA) kit or a sandwich ELISA kit, but is not limited thereto.
  • ELISA enzyme immunoassay
  • a fragment of a human antibody or antigen-binding portion thereof that specifically binds to the extracellular domain water-soluble domain of DLK1 of the present invention exhibits anti-cancer effects, as well as the ability of DLK1 to bind to activin receptor type 2B of the extracellular domain water-soluble domain. Increase significantly.
  • FIG. 1 is a photograph and a graph showing a metastasis inhibitory effect in pancreatic cancer cell line (MIA-PaCa-2) by soluble DLK1.
  • Figure 2 is a photograph and graph showing the effect of inhibiting metastasis in uterine cancer cell line (HeLa) by water-soluble DLK1.
  • FIG. 3 is a photograph and graph showing the effect of inhibiting growth independent adhesion in pancreatic cancer cell line (MIA-PaCa-2) by water-soluble DLK1.
  • Figure 4 is a photograph and graph showing the effect of inhibiting growth independent adhesion in uterine cancer cell line (HeLa) by water-soluble DLK1.
  • FIG. 5 is a photograph showing the wound healing inhibitory effect in pancreatic cancer cell line (MIA-PaCa-2) and kidney cancer cell line (786-O) by water-soluble DLK1.
  • Figure 6 is a photograph showing the Western blot results to determine the effect of water-soluble DLK1 on the signaling of real cells.
  • FIG. 7 is a Western blot and RT-PCR photograph showing that soluble DLK1 was overexpressed in a cell line overexpressing soluble DLK1.
  • FIG. 8 is a photograph showing the effects of inhibiting metastasis, invasion, adhesion independence growth, and wound healing by water-soluble DLK1 using cell lines overexpressing water-soluble DLK1.
  • Figure 10 shows the results by enzyme immunoassay showing that water-soluble DLK1 specifically binds to activin receptor type 2B.
  • FIG. 11 shows the results by enzyme immunoassay showing that water soluble DLK1 does not bind to activin A.
  • Figure 12 shows the results by a competitive enzyme immunoassay showing that water soluble DLK1 binds to activin receptor type 2B competitively with activin.
  • FIG. 13 shows the results by surface plasmon resonance showing that water-soluble DLK1 specifically binds to activin receptor type 2B in various activin receptor families.
  • FIG. 14 is a Western blot photograph showing the activin receptor type 2B expression of cells used in flow cytometry migration assay.
  • FIG. 15 shows flow cytometry migration assay results showing that binding between water soluble DLK1 and activin receptor type 2B is occurring on real cells.
  • Figure 17 shows the results confirmed by fingerprinting the diversity of monophageclonal antibodies to water-soluble DLK1.
  • Figure 18 shows the results of analyzing the polypeptides in the CDRs of monophageclonal antibodies against water soluble DLK1.
  • Figure 21 shows the flow cytometry analysis results (top) and fluorescence immunostaining results (bottom) showing that the B09 antibody specifically binds to the water-soluble portion of DLK1.
  • Figure 22 shows the results of measuring the binding force between the water-soluble DLK1 and B09 antibody by the surface plasmon resonance method.
  • Figure 23 shows the results of the binding force measurement between activin A and activin receptor type 2B by surface plasmon resonance method.
  • Fig. 24 shows the result of binding force measurement between water-soluble DLK1 and activin receptor type 2B by surface plasmon resonance method.
  • Fig. 25 shows the results of measurement of the binding force between the water-soluble DLK1 and the activin receptor type 2B when the B09 antibody and the water-soluble DLK1 were treated together by the surface plasmon resonance method.
  • Fig. 26 is a schematic diagram showing the effect of the B09 antibody on the binding strength between water-soluble DLK1 and activin receptor type 2B.
  • FIG. 27 shows the results by competition enzyme immunoassay showing the effect of antibodies on binding between water soluble DLK1 and activin receptor type 2B.
  • FIG. 28 shows the results by competition enzyme immunoassay showing the effect of antibodies on the binding between activin A and activin receptor type 2B.
  • FIG. 29 shows the results by competitive enzyme immunoassay showing the effect of water soluble DLK1, DLK1 antibodies and activin receptor type 2B antibodies on binding between activin A and activin receptor type 2B.
  • Figure 31 shows the results of SEAP reporter analysis showing the effect of water-soluble DLK1 on Smad signaling.
  • Figure 32 shows the results of SEAP reporter analysis showing the effect of the B09 antibody on Smad signaling.
  • HRE hypoxia response element
  • Figure 34 shows the metastasis inhibitory effect of activin receptor type 2B antibody and DLK1 antibody.
  • 35 shows the effects of activin receptor type 2B antibody and DLK1 antibody on the metastasis inhibitory effect of water-soluble DLK1.
  • Figure 40 shows that the non-large band of the DLK1-Fc treatment group in pancreatic cancer in situ transplantation metastasis animal model experiments.
  • FIG. 41 shows in vivo images of pancreatic cancer in situ transplantation metastasis animal model.
  • the extracellular region water soluble domain (hereinafter referred to as water soluble DLK1) of DLK1 and the DLK1-Fc fusion protein (hereinafter referred to as DLK1-Fc) in which the water soluble DLK1 and the human antibody Fc region are conjugated as used in the Examples of the present specification are Prepared according to the method disclosed in 0982170.
  • a migration assay of cancer cell lines was performed using the method of Reference (Chen HC, Methods in molecular biology. 294: 15-22, 2005).
  • cells MIA-PaCa-2, HeLa cell line
  • the cells were changed to serum-free medium, and after 24 hours, the cells were detached through trypsin treatment, and the number of cells was measured. 100 ⁇ l of cells, serum-free medium and proteins to be treated were combined and incubated at 37 ° C. for 1 hour.
  • Soft agar assay was performed to determine the effect of water-soluble DLK1 on anchorage independence growth.
  • RPMI medium containing 10% FBS and 1% agar were mixed 1: 1 and placed on a 60 mm culture dish to form 0.5% agar, followed by 6 x 10 3 cells (MIA-PaCa-2 , HeLa cell line) with 5 ⁇ g / ml of DLK1-Fc or Fc, and then mixed with RPMI medium containing 10% FBS and 1% agar, the concentration of the final agar was 0.3%, followed by 0.5% agar. Laid on top. It was incubated in a 37 ° C.
  • Pancreatic cancer cell line MIA-PaCa-2 or kidney cancer cell line 786-O was grown in 6-well plates and then changed to serum-free medium for 16 hours when 90% of the cells grew. Thereafter, the cells were treated with DLK1-Fc or Fc at a concentration of 5 to 25 ⁇ g / ml for 1 hour, after which the cells were scratched and 5% FBS was added, and the 786-O cell line was 16 hours for MIA. The PaCa-2 cell line was cultured for 48 hours, and the wound was observed.
  • Harvested cells were prepared in RIPA buffer (50 mM TrisHCl pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP-40), protease inhibitor (Roche), phosphotase inhibitor cocktail I, II (phosphotase inhibitor cocktail I Cells were lysed using a buffer added with II, Sigma), and the concentration of lysed cell lysate was determined using a BCA quantitative kit (Thermo). 30 ⁇ g of the lysate on SDS-PAGE was denatured using 5 ⁇ sample buffer, electrophoresed, and transferred to NC membrane (Watman).
  • Western blot was performed using p-FAK, FAK, p-AKT, AKT, p-eNOS, eNOS, p-ERK1 / 2 and ERK1 / 2 antibody (Cell signaling).
  • beta-actin antibody Sigma
  • the blot was fluorescently developed using an ECL solution (Intron) to develop a film, as shown in FIG. 6.
  • a cell line overexpressing soluble DLK1 was constructed using the pancreatic cancer cell line MIA-PaCa-2 cell line.
  • the cell line was constructed by incorporating a DNA fragment encoding the extracellular domain region of DLK1 into a pcDNA 3.1 vector.
  • the cell line was screened at 500 ⁇ g / ml G418 (Geneticin, GIBCO / BRL), RT-PCR was performed to confirm that the cell line was well established, and the cultured cell was grown 10-fold using Centricon 15 (Millpore). After Western blot, it was confirmed whether the water-soluble DLK1 was well expressed.
  • Western blot used the DLK1 monoclonal antibody (R & D) product. In the comparison group, only the vector without the insert was used by transfection.
  • the cell line constructed in Example 5 was used to analyze metastasis and infiltration mechanism. First, the cells were changed to serum-free medium when the level was about 50%, and after 24 hours, the cells were detached through trypsin treatment, and the number of cells was measured. Place 5-10% FBS with 1 ml of chemo-attractant in a 24-well plate, place a transwell (Corning # 3422) with 8.0 ⁇ m pore on it, and then place 5 ⁇ 10 4 Cells were added and then cultured in a 37 ° C. carbon dioxide incubator for 24 to 48 hours.
  • the transwell medium was removed, the cells were stained with Diff Quick solution (Sysmex, Japan), and the cells that did not pass through the transwell were completely removed using a cotton swab. Then, after completely drying the transwell, the cells passing through the transwell were observed at a magnification of 400 times and photographed.
  • the experiment was performed after coating 100 ⁇ l of Matrigel (BD Science) at a concentration of 1 mg / ml on the lower side of the transwell.
  • Matrigel BD Science
  • RPMI medium containing 10% FBS and 1% agar were mixed 1: 1 and placed in a 60 mm culture dish to obtain 0.5% agar composition, followed by 6 ⁇ 10 3 cells in 10% FBS. After mixing 1% agar with RPMI medium containing the final concentration of agar to 0.3% and then laid on 0.5% agar. Incubated for 3 weeks in a 37 °C CO2 incubator, medium was added every 3 days to prevent agar from drying. After colonies were produced, photographs were taken to observe the results.
  • Wound healing assays were grown in 6-well plates and then changed to serum-free medium when 90% of the cells were grown. After culturing in serum-free medium for 16 hours, the cells were scraped and wounded, and the wound was filled after incubation for 48 hours with 5% FBS.
  • Co-immunoprecipitation was performed to identify receptors of water-soluble DLK1.
  • soluble DLK1 and ACVR2B were overexpressed in 293E cells by transfection using PEI (Polyscience) method.
  • Cells were washed three times with cold DPBS and lysed in modified RIPA buffer (50 mM TrisHCl pH7.4, 150 mM NaCl, 2 mM EDTA, 1% NP-40). This lysate was pre-cleared using human IgG (Jackson Lab) and protein G beads (GE). Immunoprecipitation was performed using human antibodies and protein G beads produced in the laboratory, and samples were separated on SDS-PAGE and Western blots were shown in FIG. 9.
  • Enzyme immunoassay confirmed the binding between ACVR2B and soluble DLK1.
  • water-soluble DLK1 tagged with 1 ⁇ g / ml FLAG was coated on immunoplate (Nunc) at 4 ° C. for 16 hours.
  • BSA was used as a control for measuring nonspecific binding.
  • the coated plate was washed three times with PBST (0.05% Tween 20) and then blocked with 5% skim milk PBST.
  • ACVR2B-Fc with Fc attached to the extracellular part of ACVR2B was subjected to serial dilution and allowed to react at room temperature for 1 hour.
  • 293E was also prepared.
  • the harvested cells were washed twice with cold DPBS and 1 ⁇ g of DLK1-Fc-FITC was added and reacted at 4 ° C. for 2 hours.
  • DLK1-Fc-FITC used for the reaction was prepared using the Pierce protein FITC labeling kit. After the reaction, washing was performed using 1% PBA (1% BSA in DPBS) buffer, and the degree of binding was determined by flow cytometry.
  • the cells used above confirmed the expression pattern of ACVR2B via Western blot (FIG. 14).
  • Example 2 30 ⁇ g of the purified DLK1-Fc obtained in Example 1 was added to an Immunosorb tube (Nunc 470319) in 4 ml of a coating buffer; 1.59 g of Na 2 CO 3 (sigma, S7795), 2.93 g of NaHCO 3 (sigma, S8875), NaN 3 ( sigma, S2002), 0.2 g], coated with a rotator at 4 ° C. for about 16 hours, followed by room temperature. It was dissolved in PBS for 2 hours at and blocked in immunotubes using skim milk [(BD, 232100) -4% in 1XPBS].
  • the cultured cells were centrifuged (4500 rpm, 15 min, 4 ° C.) and the supernatant (panned poly scFv-phage) was transferred to a new tube.
  • 96-well immune plates (NUNC 439454) were coated with antigen at 100 ng per well with coating buffer for 16 hours at 4 ° C., and then each well was blocked using skim milk (4%) dissolved in PBS. Wash each well with 0.2 ml of PBS-tween20 (0.05%), and add 100 ⁇ l of the diluted solution of panned poly scFV-phage and 5, 25, 125, 625, and 3125 times to each well. Reacted for a while.
  • the secondary antibody anti-M13-HRP (Amersham 27-9421-01) was diluted 1: 2000 and reacted at room temperature for 1 hour. It was.
  • Colonies obtained from the polyclonal phage antibody group having high binding capacity were incubated for 16 hours at 37 ° C. in a 96-deep well plate (Bionia 90030) containing 2 ml of YTCM, 2% glucose, and 1 ml of 5 mM MgCl 2 medium. It was. Take 100-200 ⁇ l of the cultured cells so that the OD600 value is 0.1 and dilute in 1 ml 2 ⁇ YTCM, 2% glucose, 5 mM MgCl 2 medium, and then measure the OD600 value at 37 ° C. in a 96-deep well plate. Incubated for 2-3 hours so as to be 0.5-0.7.
  • M1 helper phages were infected with a MOI of 1:20, and then incubated for 16 hours at a temperature of 30 ° C. in 2 ⁇ YTCMK, 5 mM MgCl 2 , and 1 mM IPTG medium. After culturing the cells were centrifuged (4500 rpm, 15 minutes, 4 °C), the supernatant was taken, dissolved by adding 4% PEG 6000 and 3% NaCl, and reacted for 1 hour on ice.
  • each well was washed with 0.2 ml of PBS-tween20 (0.05%), and 100 ⁇ l of monoclonal scFv-phage (each 100 scFv-phage) obtained by the above method was added to each well and allowed to react at room temperature for 2 hours. .
  • each well was washed four times with 0.2 ml of PBS-tween20 (0.05%), and the second antibody, anti-M13-HRP, was diluted to 1/2000 and reacted at room temperature for 1 hour. After washing with 0.2 ml of PBS-tween20 (0.05%), color development was measured at 490 nm. As a result, as shown in Table 2, 27 single phage clones having a binding capacity of 2 or more antigens were selected.
  • the colony PCR product was identified on 1% agarose gel (Seakem LE, CAMERES 50004), and 0.2 ⁇ l of BstNI (Roche11288075001, 10 U / ⁇ l) was added and reacted at 37 ° C. for 2-3 hours.
  • the reaction conditions are shown in Table 4 below.
  • the cleaved product was identified on an 8% DNA polyacrylamide gel.
  • the heavy chain was 1 ⁇ l of monoclonal DNA, 10 pmole / ⁇ l of heavy chain forward and reverse primers in Table 6, 5 ⁇ l of 10 ⁇ buffer, 1 ⁇ l of 10 mM dNTP mix.
  • Colony PCR iCycler iQ, BIO-RAD was performed by mixing 0.5 ⁇ l of pfu DNA polymerase (solgent, 2.5 U / ⁇ l) and distilled water.
  • Light Chain Colony PCR was performed in the same manner using the light chain forward and reverse primers in Table 6.
  • the heavy chain gene obtained by PCR was purified by DNA-gel extraction kit (Qiagen), and then 1 ⁇ l (10 ng) of pNATAB H vector (FIG. 19), 15 ⁇ l of heavy chain (100-200 ng), 2 ⁇ l of 10 ⁇ buffer, 1 ⁇ l of ligase (1 U / ⁇ l) and distilled water were mixed and left at room temperature for 1-2 hours to connect with the vector.
  • the vector was allowed to stand on ice with transformed cells (XL1-blue) for 30 minutes, and then transduced with heat shock at 42 ° C. for 90 seconds. After standing again on ice for 5 minutes, 1 ml of LB medium was injected and incubated at 37 ° C. for 1 hour.
  • the plate was plated on LB Amp solid medium, and then cultured at 37 ° C. for 16 hours. Single colonies were inoculated in 5 ml of LB Amp liquid medium and incubated at 37 ° C. for 16 hours. DNA-prep. DNA was extracted using the kit (Nuclogen). In addition, the light chain was extracted DNA in the same manner as above using the pNATAB L vector (Fig. 20).
  • the obtained DNA was requested for sequencing using CMV-proF primer (SEQ ID NO: 54: AAA TGG GCG GTA GGC GTG) (solgent). As a result, it was confirmed that the sequences of the heavy and light chains of the six clone phages for DLK1-Fc converted to total IgG match the sequences of the phage antibody.
  • the surface plasmon resonance method was performed using ProteOn XPR36 of Bio-Rad, and the method is summarized as follows.
  • the sensor chip was activated by flowing 0.1 M EDC and 0.025 M sulfo-NHS for 60 seconds, and the protein to be coated was added to 10 mM sodium acetate (pH 5.0) at a rate of 30 ⁇ l / min for 240 seconds to attach to the chip.
  • the channel was blocked with 1 M ethanolamine-HCl (pH 8.5) for 200 seconds and then washed with DPBST (PBS with 0.005% tween 20).
  • DPBST DPBST
  • the serial dilution was performed twice, and the binding force was measured by flowing for 120 seconds at a rate of 30 ⁇ l / min.
  • a dissociation phase was taken for 240 seconds.
  • the binding force of the B09 antibody to the water-soluble DLK1 was measured with a Kd value of 1.90E-11 (FIG. 22).
  • the binding force of activin A to ACVR2B was measured with a Kd value of 1.96E-09 (FIG. 23)
  • the binding force of water-soluble DLK1 to ACVR2B was measured with a Kd value of 1.31E-09 (FIG. 24).
  • Pancreatic cancer cell line, MIA-PaCa-2 was grown to about 70% in culture vessels, exchanged with serum-free medium and incubated for 16 hours.
  • the DLK1-Fc treatment group was treated with 10 ⁇ g / ml DLK1-Fc, and 0.5 nM activin A was added and harvested 30 minutes later.
  • Harvested cells were prepared using RIPA buffer (50 mM TrisHCl pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP-40) with protease inhibitor (Roche) phosphatase inhibitor cocktail I, II (Sigma). After lysing the cells, the concentration of the lysed cell lysate was determined using a BCA quantitative kit (Thermo).
  • SEAP reporter analysis was performed to determine the effect of water-soluble DLK1 on Smad neurotransmission.
  • the vector used for SEAP reporter analysis has a Smad binding element (SBE) that is increased by activin signaling in front of the SEAP gene. have.
  • SBE Smad binding element
  • the vector was introduced by electroporation into the MIA-PaCa-2 cell line. The next day the transfected cell lines were transferred to 96-well plates, incubated for 24 hours and further incubated for 16 hours with serum free medium. Cells were pretreated with Fc or DLK1-Fc for 1 hour, treated with 0.5 nM of activin A, incubated for 48 hours, and cell culture was collected for reporter analysis. The analysis was performed using ABI's Phospha-Light system. In addition, the same experiment was performed using the B09 antibody.
  • a reporter assay was performed to determine the effect of B09 antibodies that specifically bind to the water-soluble portion of DLK1 on signal transduction in hypoxia conditions in which DLK1 is overexpressed.
  • the vector used for reporter analysis has a hypoxia response element (HRE) in front of the luciferase gene, and thus has a system in which the reporter gene is expressed when transcription control by hypoxia is performed in the cell.
  • HRE hypoxia response element
  • the vector was introduced into the MIA-PaCa-2 cell line by electroporation (Invitrogen). The next day the transfected cell lines were transferred to 96-well plates, incubated for 24 hours and further incubated for 16 hours with serum free medium.
  • CoCl 2 (Sigma) was treated to cause artificial hypoxia.
  • Cells were pretreated with DLK1 antibody for 1 hour and subjected to reporter analysis. Analysis was performed using ABI's Phospha-Light system.
  • metastasis experiments were performed using MIA-PaCa-2 cell line.
  • the cells were changed to serum-free medium when the level was about 70%, and after 24 hours, the cells were detached through trypsin treatment, and the number of cells was measured.
  • Cells, serum-free medium and each protein to be treated were combined to make 100 ⁇ l and incubated at 37 ° C. for 1 hour.
  • Example 19 orthotopic animal model of MIA-Paca-2 pancreatic cancer
  • MIA-Paca-2 pancreatic cancer In situ transplantation animal model experiment of MIA-Paca-2 pancreatic cancer was performed to confirm the ability of DLK1-Fc to metastasize cancer and inhibit the proliferation of cancer cells.
  • Nude mice used in the experiment were Can Cg-Foxnl-nu / CrljBgi, and 6-week-old females were purchased from Orient Co., Ltd.
  • 5 ⁇ 10 6 MIA-Paca-2 cell lines which are pancreatic cancer cell lines, were orally transplanted into the pancreas. Divided into two groups, one group injected DLK1-Fc at 5 mpk, the other group received 15 mpk, and PBS was used as a control. Protein was injected by injection twice a week via intraperitoneal injection. Five weeks after orthodontic transplantation, the results were observed through dissection.
  • SEQ. ID. NO. 1 extracellular water-soluble domain of DLK1: ECFPACNPQN GFCEDDNVCR CQPGWQGPLC DQCVTSPGCL HGLCGEPGQC ICTDGWDGEL CDRDVRACSS APCANNGTCV SLDDGLYECS CAPGYSGKDC QKKDGPCVIN GSPCQHGGTC VDDEGRASHA SCLCPPGFSG NFCEIVANSC TPNPCENDGV CTDIGGDFRC RCPAGFIDKT CSRPVTNCAS SPCQNGGTCL QHTQVSYECL CKPEFTGLTC VKKRALSPQQ VTRLPSGYGL AYRLTPGVHE LPVQQPEHRI LKVSMKELNK KTPLLTEG
  • SEQ. ID. NO. 2 (CDR1 of heavy chain): SYAMN
  • SEQ. ID. NO. 3 (CDR2 of heavy chain): TITATSGKTY YADSVKG
  • SEQ. ID. NO. 7 (CDR3 of light chain): GSYAGSYTY
  • SEQ. ID. NO. 9 (CDR2 of heavy chain): WINPGSGNTK YSHNFEG
  • SEQ. ID. NO. 10 (CDR3 of heavy chain): SVSAYGSNYF DP
  • SEQ. ID. NO. 16 (CDR3 of heavy chain): SGGYGGNTNW YFDL
  • SEQ. ID. NO. 18 (CDR2 of light chain): GNNNRPS
  • SEQ. ID. NO. 19 (CDR3 of light chain): QSYDSRLGV
  • SEQ. ID. NO. 21 (CDR2 of heavy chian): GISWNSGSIG YADSVKG
  • SEQ. ID. NO. 22 (CDR3 of heavy chain): GPGLATGKGY ADY
  • SEQ. ID. NO. 27 (CDR2 of heavy chain): SIPGSGTRTH YADSVKG
  • SEQ. ID. NO. 28 (CDR3 of heavy chain): STAYLFDY
  • SEQ. ID. NO. 33 (CDR2 of heavy chain): YISGSGITTY YADSVKG
  • SEQ. ID. NO. 34 (CDR3 of heavy chain): LQGHCSGGAC SNWFDA
  • SEQ. ID. NO. 38 (heavy chain VR of B09): QMQLVESGGR LVRPGGSLRL SCAASGFPFT SYAMNWVRQT PGKGLEWVST ITATSGKTYY ADSVKGRFTI SRDNSRNTLF LQMNSLRAED TAVYYCVRGE SCSGGACSDF DYWGQGALVT VSS
  • SEQ. ID. NO. 39 (light chain VR of B09): QLVLTQPASV SGSPGQSVTI SCTGTSSDIG RYNRVSWYQH HPGKAPKLIL NDVTTRPSGF SNRFSGSKSG NTASLTISGL QAEDEADYSC GSYAGSYTYV FGTGTKVTVL GGG
  • SEQ. ID. NO. 41 (light chain VR of A04): DIQMTQSPSS LSASVGDRVT ITCQASQDIS NYLNWYQQKP GKAPKLLIYS TSNLQSGVPS RFSGSGSGTD FTLTISSLQP EDFATYYCQQ LNSYPLTFGG GTKVDIKRGG
  • SEQ. ID. NO. 42 (heavy chain VR of A05): QMQLVESGGG LVQPGRSLRL SCAASGFTFD EHAMHWVRQA PGKGLEWVSG INWNSGKTGY ADSVKGRFTI SRDNGKNSLY LQMNSLRAED TAVYYCAKSG GYGGNTNWYF DLWGRGTLVT VSS
  • SEQ. ID. NO. 43 (light chain VR of A05): QFVLTQPPSV SGAPGQNVTI SCIGTSSNIG VGYDVHWYQQ VPGTAPKLLV YGNNNRPSGV PDRFSGSKSG TSASLAITGL QAEDEADYYC QSYDSRLGVV FGGGTKLTVL GGG
  • SEQ. ID. NO. 44 (heavy chain VR of A10): QVQLVESGGG LVQPGRSLRL SCAASGFTFD DYAMHWVRQA PGKGLEWVSG ISWNSGSIGY ADSVKGRFTI SRDNAKNSLY LQMNSLRAED TAVYYCARGP GLATGKGYAD YWGQGTLVTV SS
  • SEQ. ID. NO. 45 (light chain VR of A10): DIQMTQSPSS VSASVGDRVT ITCRASQRIS SWLAWYQQKP GRAPKLLIHS ASTLHNGVPS RFSGSASGTD FTLTISSLQP EDYAIYYCQQ GHSFPYTFGQ GTKLEIKRGG
  • SEQ. ID. NO. 46 (heavy chain VR of H06): QVQLVQSGGG LIQPGGSLRL SCAASGFTFS LYGMSWVRQA PGKGLEWVSS IPGSGTRTHY ADSVKGRFTI SRDNSKNTLF LQMNSLRAED TAVYYCAKST AYLFDYWGPG TLVTVSS
  • SEQ. ID. NO. 47 (light chain VR of H06): DIQMTQSPAT LSLSPGERAT LSCRASQSIR HYLAWYQQKP GQAPRLLIHG ASSRATGIPD RFSGSGSGTD FTLTISRLEP EDFAVYYCQH YGSPLHSFGP GTKVEIKRGG
  • SEQ. ID. NO. 48 (heavy chain VR of H12): QVQLVQSGGG LVKPGGSLRL SCAASEFTFS DYYMSWVRQA PGKGLEWLSY ISGSGITTYY ADSVKGRFTI SRDNGKKSLY LEMNSLRAED TAVYYCARLQ GHCSGGACSN WFDAWGQGTL ITVSS
  • SEQ. ID. NO. 49 (light chain VR of H12): DIQMTQSPSS LSASVGDRLT ITCRASQSIL TYLNWYQQKP GKAPKLLIYA ASSLQRGVPS RFSGSGTD FTLTISGLQP EDFATYYCQQ GYGTPYTFGQ GTKVDIKRGG
  • SEQ. ID. NO. 50 polynucleotide sequence coding heavy chain of B09 antibody: atgggatgga gctatatcat cctctttttg gtggccacag cggccgatgt ccactcgcag atgcagctgg tggagtctgg gggacgctta gtgcggcctg gggggtcctg gagactctcc tgtgcagcct ct cttaccagt tatgccatga actgggtccg ccagactcca gggaaggggc tggaatgggt ctctactatc actgctacta gtggtaagac atactacgca gactccgtgaaaggc tggaatgggt ctctactatc actgctacta gtggtaagac atactacg
  • SEQ. ID. NO. 51 polynucleotide sequence coding light chain of B09 antibody: atgggatgga gctatatcat cctctttttg gtggccacag cggccgatgt ccactcgcag ctcgtgctga ctcagcctgc ctccgtgtctg gacagtcggt caccatctcc tgcactggaa ccagcagtga cattggtcgt tataaccgtg tctcctggta ccaacaccac ccggcaagg ccccaaact cattctttaat gatgtcacta ctcggccctc agggttttct aatcgcttctccaa gtctggcaacggcggcccaaact cattcttaat gatgtcacta c
  • SEQ. ID. NO. 52 forward primer: ctagataacg agggcaaatc atg
  • SEQ. ID. NO. 56 (NATVH7-1 primer): ttggtggcca cagcggccga tgtccactcg cagatgcagc tggtggagtc
  • SEQ. ID. NO. 58 (NATJH-ALL primer): gaggaggcta gctgaggaga cggtga
  • SEQ. ID. NO. 60 (NATVL13 primer): ttggtggcca cagcggccga tgtccactcg cagttcgtgc tgactcagcc
  • SEQ. ID. NO. 61 (NATVL10 primer): ttggtggcca cagcggccga tgtccactcg cagctcgtgc tgactcagcc
  • SEQ. ID. NO. 62 (NATJK-R7 primer): gaggagagat cttttgatat ccaccttggt
  • SEQ. ID. NO. 63 (NATJL2-R primer): gaggagagat cttaggacgg tcagcttggt ccc
  • SEQ. ID. NO. 64 (NATJK-R5 primer): gaggagagat cttttgattt ccagcttggt
  • SEQ. ID. NO. 65 (NATJL1-R primer): gaggagagat cttaggacgg tgaccttggt ccc
  • SEQ. ID. NO. 66 (NATJK-R4 primer): gaggagagat cttttgattt ccaccttggt

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne les anticorps humains qui se lient spécifiquement au domaine soluble dans l'eau extracellulaire de DLK1 et des fragments de ceux-ci qui comprennent des sites de liaison à un antigène ; un polynucléotide qui code pour les anticorps humains ou des fragments de ceux-ci ; un vecteur recombinant contenant le polynucléotide ; des transformants transformés par le vecteur recombinant ; un procédé de fabrication des anticorps humains ou des fragments de ceux-ci ; une composition pharmaceutique, pour la prévention ou le traitement d'une maladie, qui comprend les anticorps humains ou un fragment de ceux-ci ; des nécessaires de diagnostic. Les anticorps humains et des fragments qui comprennent des sites de liaison à un antigène qui se lient de façon spécifique au domaine soluble dans l'eau extracellulaire de DLK1 de la présente invention présentent une activité antinéoplasique. En augmentant de façon significative la capacité de liaison du domaine soluble dans l'eau extracellulaire de DLK1 au récepteur de type II B de l'Activine (ACVR2B), son utilité est démontrée pour la prévention et le traitement de maladies associées à la transduction de signal par ACVR2B, comprenant des troubles métaboliques associés, une maladie immunitaire, les maladies hépatiques et le cancer.
PCT/KR2012/002496 2011-04-04 2012-04-03 Anticorps humains spécifiques de dlk1 et compositions pharmaceutiques les contenant WO2012138102A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2011-0030871 2011-04-04
KR20110030871 2011-04-04
KR1020120001457A KR101438265B1 (ko) 2011-04-04 2012-01-05 Ｄｌｋ１ 특이적 인간 항체 및 이를 포함하는 약학적 조성물
KR10-2012-0001457 2012-01-05

Publications (2)

Publication Number Publication Date
WO2012138102A2 true WO2012138102A2 (fr) 2012-10-11
WO2012138102A3 WO2012138102A3 (fr) 2013-01-10

Family

ID=46969663

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/002496 WO2012138102A2 (fr) 2011-04-04 2012-04-03 Anticorps humains spécifiques de dlk1 et compositions pharmaceutiques les contenant

Country Status (1)

Country Link
WO (1) WO2012138102A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3657176A1 (fr) * 2018-11-23 2020-05-27 Syddansk Universitet Dlk1 comme marqueur prédictif pour la résistance à l'insuline et/ou le diabète de type 2 et/ou un syndrome métabolique
CN111278860A (zh) * 2017-09-08 2020-06-12 Y生物股份有限公司 抗人dlk1的抗体及其用途
CN112135638A (zh) * 2019-03-06 2020-12-25 乐高化学生物科学股份有限公司 包含抗人dlk1抗体的抗体-药物偶联物及其用途
EP3936150A4 (fr) * 2019-03-06 2023-03-29 LegoChem Biosciences, Inc. Conjugués anticorps-médicament comprenant un anticorps contre dlk1 humain et utilisation associée
US11827703B2 (en) 2018-05-09 2023-11-28 Legochem Biosciences, Inc. Compositions and methods related to anti-CD19 antibody drug conjugates
US11975076B2 (en) 2015-11-25 2024-05-07 Legochem Biosciences, Inc. Antibody-drug conjugates comprising branched linkers and methods related thereto

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1702982A1 (fr) * 2003-11-28 2006-09-20 Kanagawa Academy Of Science And Technology Methode de detection, diagnostic et remede contre le cancer du foie
EP1394263B1 (fr) * 2001-05-16 2008-10-08 Kanagawa Academy Of Science And Technology Procede pour detecter et isoler des cellules hepatiques indifferenciees au moyen de dlk
KR20090088893A (ko) * 2006-11-10 2009-08-20 가부시키가이샤 리부텍쿠 ｉｎ ｖｉｖｏ 에서 항종양 활성을 갖는 항인간 Ｄｌｋ－１ 항체
KR100982170B1 (ko) * 2010-03-16 2010-09-15 한국생명공학연구원 ＤＬＫ１―Ｆｃ 융합 단백질을 유효성분으로 함유하는 암 전이 억제용 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1394263B1 (fr) * 2001-05-16 2008-10-08 Kanagawa Academy Of Science And Technology Procede pour detecter et isoler des cellules hepatiques indifferenciees au moyen de dlk
EP1702982A1 (fr) * 2003-11-28 2006-09-20 Kanagawa Academy Of Science And Technology Methode de detection, diagnostic et remede contre le cancer du foie
KR20090088893A (ko) * 2006-11-10 2009-08-20 가부시키가이샤 리부텍쿠 ｉｎ ｖｉｖｏ 에서 항종양 활성을 갖는 항인간 Ｄｌｋ－１ 항체
KR100982170B1 (ko) * 2010-03-16 2010-09-15 한국생명공학연구원 ＤＬＫ１―Ｆｃ 융합 단백질을 유효성분으로 함유하는 암 전이 억제용 조성물

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11975076B2 (en) 2015-11-25 2024-05-07 Legochem Biosciences, Inc. Antibody-drug conjugates comprising branched linkers and methods related thereto
CN111278860A (zh) * 2017-09-08 2020-06-12 Y生物股份有限公司 抗人dlk1的抗体及其用途
EP3683236A4 (fr) * 2017-09-08 2021-10-13 Y-Biologics Inc. Anticorps dirigé contre dlk1 humain et utilisation associée
US11306141B2 (en) 2017-09-08 2022-04-19 Y-Biologics Inc. Antibody against human DLK1 and use thereof
CN111278860B (zh) * 2017-09-08 2024-03-29 Y生物股份有限公司 抗人dlk1的抗体及其用途
US11827703B2 (en) 2018-05-09 2023-11-28 Legochem Biosciences, Inc. Compositions and methods related to anti-CD19 antibody drug conjugates
EP3657176A1 (fr) * 2018-11-23 2020-05-27 Syddansk Universitet Dlk1 comme marqueur prédictif pour la résistance à l'insuline et/ou le diabète de type 2 et/ou un syndrome métabolique
CN112135638A (zh) * 2019-03-06 2020-12-25 乐高化学生物科学股份有限公司 包含抗人dlk1抗体的抗体-药物偶联物及其用途
EP3936150A4 (fr) * 2019-03-06 2023-03-29 LegoChem Biosciences, Inc. Conjugués anticorps-médicament comprenant un anticorps contre dlk1 humain et utilisation associée

Also Published As

Publication number Publication date
WO2012138102A3 (fr) 2013-01-10

Similar Documents

Publication Publication Date Title
KR101438265B1 (ko) Ｄｌｋ１ 특이적 인간 항체 및 이를 포함하는 약학적 조성물
WO2012138102A2 (fr) Anticorps humains spécifiques de dlk1 et compositions pharmaceutiques les contenant
WO2020096381A1 (fr) Anticorps humain présentant une affinité élevée vis-à-vis du récepteur alpha d'il -4 humain, et son utilisation
AU2019386549B2 (en) Anti-4-1BB antibody and use thereof
WO2019098682A1 (fr) Anticorps anti-her2 ou fragment de liaison à l'antigène de celui-ci, et récepteur antigénique chimérique le comprenant
WO2019225777A1 (fr) Anticorps anti-ror1 et son utilisation
WO2016137108A1 (fr) Nouvel anticorps se liant à la tfpi et composition le comprenant
WO2014077648A1 (fr) Anticorps se liant spécifiquement à la protéine l1cam humaine et murine, et son utilisation
WO2016114567A1 (fr) Procédé de préparation d'une nouvelle bibliothèque d'anticorps et bibliothèque ainsi préparée
WO2014030780A1 (fr) Procédé de criblage et de fabrication de domaines variables d'immunoglobulines super-stables et applications associées
WO2014090053A1 (fr) Anticorps monoclonal pour l'antagonisation et l'inhibition de la liaison du facteur de croissance cellulaire endothélial vasculaire et de son récepteur, et sa séquence codante et son utilisation
WO2015058573A1 (fr) Anticorps monoclonal pour l'antagonisme et l'inhibition de la liaison de mort programmée (pd-1) à son ligand et sa séquence codante et son utilisation
WO2022039490A1 (fr) Anticorps bispécifiques anti-b7-h4/anti-4-1bb et leurs utilisations
WO2015133882A1 (fr) Banque d'anticorps scfv, son procédé de préparation et procédé de criblage d'anticorps scfv l'utilisant
WO2016013870A1 (fr) Procédé pour positionner, dans le cytoplasme, un anticorps au format immunoglobuline complète par pénétration de l'anticorps à travers la membrane cellulaire, et son utilisation
WO2020080908A1 (fr) Anticorps anti-l1cam ou fragment de liaison à l'antigène de celui-ci, et récepteur antigénique chimérique le comprenant
WO2022177394A1 (fr) Anticorps bispécifique à domaine unique dirigé contre pd-l1 et cd47 et son utilisation
WO2020251316A1 (fr) ANTICORPS BISPÉCIFIQUE DIRIGÉ CONTRE α-SYN/IGF1R ET UTILISATION ASSOCIÉE
WO2021210939A1 (fr) Afficorps anti-her2 et récepteur antigénique chimérique commutable utilisant celui-ci en tant que molécule de commutation
WO2022103245A1 (fr) Anticorps à domaine unique dirigé contre sars-cov-2 et son utilisation
WO2022149837A1 (fr) Anticorps anti-fgfr3 et son utilisation
WO2016013871A1 (fr) Procédé d'inhibition de la protéine ras activée dans une cellule utilisant un anticorps ayant la capacité de pénétrer dans le cytoplasme et se présentant sous la forme d'une immunoglobuline complète, et son utilisation
WO2022124866A1 (fr) Anticorps anti-pd-1 et ses utilisations
WO2021101346A1 (fr) Anticorps bispécifiques anti-ror1/anti-4-1bb et leurs utilisations
WO2022085905A1 (fr) Anticorps se liant spécifiquement à la protéine de spicule du sars-cov-2 et utilisation associée

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12768656

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12768656

Country of ref document: EP

Kind code of ref document: A2