WO2012134063A2 - 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도 - Google Patents

구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도 Download PDF

Info

Publication number
WO2012134063A2
WO2012134063A2 PCT/KR2012/001424 KR2012001424W WO2012134063A2 WO 2012134063 A2 WO2012134063 A2 WO 2012134063A2 KR 2012001424 W KR2012001424 W KR 2012001424W WO 2012134063 A2 WO2012134063 A2 WO 2012134063A2
Authority
WO
WIPO (PCT)
Prior art keywords
prevotella
atcc
primer
infectious diseases
streptococcus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2012/001424
Other languages
English (en)
French (fr)
Other versions
WO2012134063A3 (ko
Inventor
국중기
박순낭
임윤경
김민정
조유진
임채광
김동춘
박한오
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bioneer Corp
Chosun University Industry Academic Cooperation Foundation
Original Assignee
Bioneer Corp
Chosun University Industry Academic Cooperation Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020120018161A external-priority patent/KR101385733B1/ko
Application filed by Bioneer Corp, Chosun University Industry Academic Cooperation Foundation filed Critical Bioneer Corp
Publication of WO2012134063A2 publication Critical patent/WO2012134063A2/ko
Publication of WO2012134063A3 publication Critical patent/WO2012134063A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • the present invention can qualitatively and quantitatively detect a causative agent causing oral bacterial infections, and relates to a primer, a detection composition, a kit, and a microarray for detecting a causative agent of oral bacterial infections having excellent species-specificity.
  • bacterial species are known in the oral cavity of humans, and a large number of bacteria inhabit a mass to form a dental plaque or dental biofilm.
  • Dental plaques between teeth and between teeth and gums remain unremoved by brushing, and bacteria grow in the plaques remaining in these areas, acting directly on the gingival tissue to induce an immune response or cytotoxicity. It releases the substance, causing inflammation of the gingival tissue. This inflammation progresses to the alveolar bone, causing periodontitis.
  • Periodontal disease is a disease caused by inflammation of the supportive tissue of the tooth (C chalky, gingiva, alveolar bone, periodontal ligament) by the bacteria present in the bacterial plaque as described above. Periodontal disease can be classified into gingivitis, which is not accompanied by alveolar bone destruction and inflammation is present only in gingival tissue, and periodontitis accompanied by alveolar bone break.
  • gingivitis which is an early stage of periodontal disease, invades only soft gum tissue, and can be recovered only by removing the plaque and plaque. However, if not treated proceeds to periodontitis that the alveolar bone is destroyed, and if not treated, such as gum surgery will eventually lose teeth.
  • the periodontal disease to date based on clinical and radiological results, the diagnosis of the periodontal tissue changes according to the patient's age, for example, the degree of loss of alveolar bone, fluctuations, inflammation patterns.
  • the degree of loss of alveolar bone for example, the degree of loss of alveolar bone, fluctuations, inflammation patterns.
  • most of the periodontal alveolar bone loss is 50% or more in the hospital to visit the need for continuous treatment.
  • Dental caries begin to develop by demineralization of the tooth surface by organic acids, such as lactic acid, produced by the carbohydrate metabolism of bacteria in the dental plaque.
  • the main causative agents of dental caries include Streptococcus mutans , Streptococcus sobrinus , Actinomyces spp., And Lactobacillus spp. It is known.
  • the teeth are composed of enamel, dentin, and pulp from the surface, and can progress to dentin and pulp without early treatment of early dental caries in the enamel. In particular, when inflammation progresses to the pulp, pulp is called pulpitis, and root pulp is called root canalitis. Usually, the dimension is expressed as the dimension and the root canalitis because the crown and root canal are connected.
  • root root disease anterior root cyst, root root abscess, root root osteosarcoma, etc., which develops to the bone tissue beneath the root of the tooth (root).
  • root root disease anterior root cyst, root root abscess, root root osteosarcoma, etc.
  • people with weak immunity may progress to osteomyelitis.
  • Bacterial species causing such pulp and root canalitis, root root disease and jaw osteomyelitis are generally known to be closely related to bacteria causing periodontal disease, but the exact causative species have not been identified.
  • the causative species of bacterial oral disease can be detected in an efficient and highly sensitive manner. There is a need to develop a system that can be used.
  • the present inventors are well-organized to identify and detect pathogenic bacteria causing oral bacterial infections, and based on the rpoB gene having greater homology between bacterial species than 16S rDNA, pathogenic bacterial species of oral bacterial infections.
  • the present invention was completed by developing species-specific PCR primers and kits capable of detecting.
  • an object of the present invention is an oligonucleotide that can detect and detect the oral bacterial species in the oral cavity by the various bacteria closely related to oral bacterial infectious diseases, and can quickly and accurately detect and detect the bacterial species in the oral cavity. It is to provide a primer that is constructed.
  • Another object of the present invention is to provide a general PCR and quantitative PCR kit and microarray quantitative PCR kit that can selectively detect the causative agents of oral bacterial infections using the above-described primers.
  • Another object of the present invention is to determine whether the periodontal disease-causing bacteria of the target sample is infected by the hybridization reaction and / or amplification reaction between the primer and the target sample described above so as to diagnose the presence of oral bacterial infection causative bacteria To provide a way.
  • the present invention provides a primer for detecting the causative agent of oral bacterial infectious diseases which specifically binds to the polynucleotide base sequence of rpoB (DNA-directed RNA polymerase subunit beta: hereinafter simply referred to as “ rpoB” ) gene. to provide.
  • rpoB DNA-directed RNA polymerase subunit beta
  • the causative organism is Actinomyces georgiae (CCUG 32935 T ), Actinomyces israelii (ATCC 12102 T ), Actinomyces meyeri (CCUG 21024 T ), Actinomyces naeslundii (CCUG 35333 T ), Actinomyces odontolyticus (CCUG 20536 T ), Aggregatibacter actinomycetemcomitans (ATCC 33384 T ), Atopobium parvulum (KCTC 3663 T), Atopobium rimae (KCTC 5749 T), Campylobacter rectus (ATCC 33238 T), Capnocytophaga gingivalis (ATCC 33624 T), Capnocytophaga ochracea (KCTC 5787 T), Capnocytophaga sproda (KCTC 5789 T), Eikenella corrodens (KCOM 1378), Eubacterium limosum (KC
  • the primer may be composed of at least one polynucleotide selected from the group consisting of the base sequence of SEQ ID NO: 1 to SEQ ID NO: 88 or each base sequence complementary to these base sequences. .
  • the nucleotides consisting of the nucleotide sequence of SEQ ID NO: 1 and 2 or the nucleotide sequence complementary to these nucleotide sequences, respectively specifically hybridize with the genome of Aggregatibacter actinomycetemcomitans , SEQ ID NO: 3 and 4 Nucleotide sequence consisting of the base sequence of or each of the base sequence complementary to these base sequence is specifically hybridized to the genome of Atopobium rimae , and consists of the base sequence of SEQ ID NO: 5 to 6 or the base sequence complementary to these base sequence, respectively
  • the nucleotides are specifically hybridized with the genome of Capnocytophaga gingivalis
  • the nucleotides consisting of the base sequences of SEQ ID NOs: 7 and 8 or base sequences complementary to these base sequences are specifically hybridized with the genome of Capnocytophaga ochracea .
  • the oligonucleotide consisting of the nucleotide sequence is a nucleotide that is hybridized specifically with the Capnocytophaga spumblea genome ever, each composed of a base sequence complementary to the nucleotide sequence or those nucleotide sequences of the SEQ ID NO: 11, and 12 are specific and of Fusobacterium necrophorum genome enemy Nucleotides that are hybridized and composed of the nucleotide sequences of SEQ ID NO: 13 and 14 or nucleotides complementary to these nucleotide sequences, respectively, hybridize specifically with the genome of Fusobacterium nucleatum , and the nucleotide sequences of SEQ ID NOs: 15 and 16 or these nucleotide sequences Nucleotide consisting of the base sequence complementary to each other specifically hybridizes to the genome of Fusobacterium periodonticum , and the
  • Nucleotide consisting of specifically hybridized to the genome of Prevotella corporis and nucleotides consisting of the nucleotide sequence of SEQ ID NO: 35 and 36 or complementary to each of these nucleotide sequences are specifically hybridized to the genome of Prevotella disiens , Complementary to the base sequences of SEQ ID NOs: 37 and 38 or these base sequences, respectively
  • Oligonucleotide consisting of the nucleotide sequence is a nucleotide that is hybridized specifically with the Prevotella intermedia genome, each composed of a base sequence complementary to the nucleotide sequence or those nucleotide sequences of the SEQ ID NO: 39 and 40 is specific and of Prevotella marshii genome enemy Nucleotides that are hybridized and composed of the nucleotide sequences of SEQ ID NOs: 41 and 42, or base sequences complementary to these nucleotide sequences, respectively, hybridize specifically with the genome of Prevotella melaninogenic
  • nucleotides consisting of the nucleotide sequences of SEQ ID NOs: 67 and 68 or the nucleotide sequences complementary to these nucleotide sequences, respectively hybridize specifically with the genome of Actinomyces naeslundii , respectively, and the nucleotide sequences of SEQ ID NOs: 69 and 70 or these nucleotide sequences, respectively
  • Nucleotide consisting of complementary nucleotide sequences specifically hybridize with the genome of Campylobacter rectus , and nucleotides consisting of base sequences of SEQ ID NOs: 71 and 72 or complementary to each of these base sequences are specific for the genome of Eikenella corrodens .
  • the oral bacterial infectious disease may be selected from the group consisting of periodontal disease, dental caries, pulpitis, root canal disease, tooth root disease and jaw osteomyelitis.
  • the present invention also provides a composition for detecting oral bacterial infectious diseases causative bacteria comprising a primer for detecting oral bacterial infectious diseases causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene.
  • the present invention also provides a kit for detecting oral bacterial infectious diseases causative bacteria comprising a primer for detecting oral bacterial infectious diseases causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene.
  • the present invention also provides a microarray for detecting oral bacterial infectious diseases causative bacteria comprising a primer for detecting oral bacterial infectious diseases causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene.
  • the present invention is an oral bacterial infectious disease by a polymerase chain reaction (PCR) or microarray using a primer for detecting oral bacterial infectious disease causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene. It provides a method for detecting the cause bacteria oral bacterial infectious diseases comprising the step of detecting the cause bacteria.
  • PCR polymerase chain reaction
  • the PCR may be quantitative real-time PCR (qRT-PCR).
  • Primer for detecting oral bacterial infectious diseases causing bacteria is highly sensitive and excellent species-specificity, and whether or not the presence of oral bacterial species in the oral periodontal tissue caused by a variety of bacteria quickly and simply It can detect and detect, and can qualitatively and quantitatively detect the causative agent causing oral bacterial infections. Furthermore, there is an effect that can be used as a tool for identifying bacteriological prognosis through comparative analysis of bacterial species detection results before and after treatment of periodontal disease.
  • Figure 1 shows the standard curve and the minimum detection limit for A. actinomycetemcomitans according to an embodiment of the present invention.
  • FIG. 2 shows PCR results using 4 ng of each genetic material DNA to examine the species-specificity of Pg-F / Pg-R primers, and shows the results of electrophoresis of the PCR reaction with 1.5% agarose gel.
  • Figure 3 shows the standard curve and the minimum detection limit for P. gingivalis according to an embodiment of the present invention.
  • FIG. 4 shows a standard curve and a minimum detection limit for Atopobium rimae according to an embodiment of the present invention.
  • Figure 5 shows the standard curve and the minimum detection limit for Capnocytophaga gingivalis in accordance with an embodiment of the present invention.
  • Figure 6 shows the standard curve and the minimum detection limit for Capnocytophaga ochracea according to an embodiment of the present invention.
  • Figure 7 shows the standard curve and the minimum detection limit for Capnocytophaga spumblea according to an embodiment of the present invention.
  • FIG. 8 shows a standard curve and a minimum detection limit for Fusobacterium necrophorum according to one embodiment of the present invention.
  • Figure 10 shows the standard curve and the minimum detection limit for Fusobacterium periodonticum in accordance with an embodiment of the present invention.
  • FIG. 11 shows a standard curve and a minimum detection limit for Fusobacterium simiae according to an embodiment of the present invention.
  • Figure 12 shows a standard curve and the minimum detection limit for Leptotrichia buccalis according to an embodiment of the present invention.
  • Figure 13 shows the standard curve and the minimum detection limit for Neisseria meningitidis according to an embodiment of the present invention.
  • FIG. 14 shows a standard curve and a minimum detection limit for Neisseria subflava according to an embodiment of the present invention.
  • Figure 15 shows the standard curve and the minimum detection limit for Porphyromonas endodontalis according to an embodiment of the present invention.
  • Figure 16 shows a standard curve and the minimum detection limit for Prevotella baroniae according to an embodiment of the present invention.
  • 17 shows a standard curve and a minimum detection limit for Prevotella bivia according to an embodiment of the present invention.
  • 21 shows a standard curve and a minimum detection limit for Prevotella marshii according to an embodiment of the present invention.
  • Figure 23 shows the standard curve and the minimum detection limit for Prevotella nigrescens according to an embodiment of the present invention.
  • 25 shows a standard curve and a minimum detection limit for Prevotella oris according to an embodiment of the present invention.
  • Figure 26 shows a standard curve and the minimum detection limit for Prevotella oulorum in accordance with an embodiment of the present invention.
  • 29 shows a standard curve and a minimum detection limit for Selenomonas noxia according to an embodiment of the present invention.
  • FIG. 30 shows a standard curve and a minimum detection limit for Streptococcus constellatus according to one embodiment of the present invention.
  • 31 shows a standard curve and a minimum detection limit for Streptococcus intermidius according to an embodiment of the present invention.
  • Figure 35 shows a standard curve and the minimum detection limit for Actinomyces naeslundii according to an embodiment of the present invention.
  • 39 shows a standard curve and a minimum detection limit for Porphyromonas asaccharolytica according to an embodiment of the present invention.
  • 40 shows a standard curve and a minimum detection limit for Prevotella buccae according to an embodiment of the present invention.
  • 41 shows a standard curve and a minimum detection limit for Prevotella buccalis according to an embodiment of the present invention.
  • the present invention relates to a primer for detecting oral bacterial pathogens and a detection composition comprising the same, the first of which is characterized in that the rpoB gene was used to identify and detect pathogenic bacteria causing oral bacterial infections.
  • the present inventors have focused on the rpoB gene as a target gene for developing primers for identifying and detecting pathogenic bacteria causing oral bacterial infections.
  • the rpoB gene is a gene encoding the beta subunit of RNA polymerase. Homologous analysis of nucleic acid base sequences among various bacterial species based on the nucleic acid base sequence (4,026bp) of Escherichia coli , consisting of 5 kbp, showed nine well-conserved regions and eight between them. It is known that there are regions of low homology (Severinow et al., 1996).
  • rpoB is well conserved in nucleic acid base sequences among strains belonging to the same bacterial species in terms of bacteriology, such as 16S rDNA, but the nucleic acid base sequence is about three times larger than that of 16S rDNA, and the differences between bacterial species are relatively high. It is large. Therefore, to design a PCR primer capable of binding to all bacterial species of the rpoB gene and complementary within a particular bacterial genus (genus) in the rpoB gene, and species heterogeneity is that recognize various modifications to sites of bacterial species-specific PCR primers can be developed.
  • the present inventors have developed a real-time PCR kit that can detect pathogenic bacterial species of oral bacterial infectious diseases based on the rpoB gene, which is well preserved systematically and homology between bacterial species is greater than that of 16S rDNA, In the future, it is intended to be used in molecular epidemiology of oral bacterial infectious diseases such as periodontal disease.
  • the present invention includes bacterial species known to be highly related to oral bacterial infections, bacterial species known to be less related, and bacterial species that have not yet been found to be related to oral bacterial infections.
  • Nucleic acid base sequences were determined by cloning rpoB genes of standard strains of a total of 74 bacteria, and species-specific real-time PCR primers were developed based on nucleic acid base sequences of rpoB genes.
  • the present invention provides a primer for detecting oral bacterial infection causing bacteria, which specifically binds to the polynucleotide sequence of the rpoB gene.
  • Oral bacterial infectious agents that can be detected using the primers of the present invention include Actinomyces naeslundii (CCUG 35333 T ), Aggregatibacter actinomycetemcomitans (ATCC 33384 T ), Atopobium rimae (KCTC 5749 T ), Campylobacter rectus (ATCC 33238 T ), Capnocytophaga gingivalis (ATCC 33624 T), Capnocytophaga ochracea (KCTC 5787 T), Capnocytophaga spumble (KCTC 5789 T), Eikenella corrodens (KCOM 1378), Fusobacterium necrophorum (ATCC 25286 T), Fusobacterium nucleatum (ATCC 25586 T), Fusobacterium periodonticum ( ATCC 33693 T ), Fusobacterium simiae (CCUG 16798 T ), Leptotrichia buccalis (CCUG 34316 T
  • the primer is a single-stranded oligonucleotide capable of acting as a starting point for template-directed DNA synthesis under suitable conditions and in suitable buffers (ie four different nucleoside triphosphates and polymerases). Means. Suitable lengths of primers can vary depending on various factors, such as temperature and the use of the primer. In addition, the sequence of the primer need not have a sequence that is completely complementary to some sequences of the template, it is sufficient to have sufficient complementarity within the range that can hybridize with the template to perform the primer-specific action.
  • the primer in the present invention does not need to have a sequence that is perfectly complementary to the nucleotide sequence of the gene that is a template, and it is sufficient to have sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer.
  • the primer according to the present invention can be used for gene amplification reactions.
  • the amplification reaction refers to an amplification reaction of a nucleic acid molecule, and the amplification reactions of such genes are well known in the art, for example, polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), and Liga.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcriptase polymerase chain reaction
  • Liga Liga
  • Aze chain reaction LCR
  • TMA electron mediated amplification
  • NASBA nucleic acid sequence substrate amplification
  • Primer for detecting oral bacterial infectious diseases of the present invention has a sequence complementary to the nucleotide sequence of the rpoB gene, and consists of a base sequence of SEQ ID NO: 1 to SEQ ID NO: 88 or a base sequence complementary to these base sequences, respectively It is preferably composed of at least one nucleotide selected from.
  • the primer may be composed of a pair of primers having the following sequence list that can specifically detect the oral bacterial infectious agent causing bacteria described in Table 1 below.
  • Primer for detecting species-specific oral bacterial infectious diseases causative bacteria designed based on rpoB nucleic acid base sequence may be a primer pair consisting of different base sequences selected from SEQ ID NOs: 1 to 88, each primer pair
  • the bacterial species name, sequence, sequence number, PCR product size, and annealing temperature that can be specifically detected are shown in Table 2 below.
  • the name of each primer (eg Pg-F) shown in Table 2 and the attached sequence listing is forward, F with the abbreviation (Pg) of the species-specific detectable bacterium species name (eg Porphyromonas gingivalis ). ) Or reverse (R) primer.
  • Oral bacterial infectious diseases in the present invention may include all periodontal disease, gingivitis, dental caries, pulpitis and root canal disease, tooth root disease, jaw osteomyelitis.
  • the present invention provides a composition for detecting oral bacterial infectious diseases causative bacteria comprising a primer for detecting oral bacterial infectious diseases causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene.
  • the present invention also provides a kit for detecting oral bacterial infectious diseases causative bacteria comprising a primer for detecting oral bacterial infectious diseases causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene.
  • the primers have base sequences of SEQ ID NO: 1 to SEQ ID NO: 88 or base sequences complementary to these base sequences, respectively. It may be composed of at least one nucleotide selected from the group consisting of.
  • the kit of the present invention may optionally include reagents necessary for PCR amplification, such as buffers and DNA polymerases (eg, Thermus aquaticus (Taq)).
  • reagents necessary for PCR amplification such as buffers and DNA polymerases (eg, Thermus aquaticus (Taq)).
  • kits for detecting a causative organism may optionally include a secondary antibody and a substrate of a label.
  • kits according to the invention can be produced in a number of separate packaging or compartments comprising the reagent components described above.
  • the present invention also provides a microarray for detecting oral bacterial infectious diseases causative bacteria comprising a primer for detecting oral bacterial infectious diseases causative bacteria having a sequence complementary to the nucleotide sequence of the rpoB gene.
  • the primer is used as a hybridizable array element and is immobilized on a substrate.
  • Preferred substrates may include suitable rigid or semi-rigid supports, such as membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. have.
  • the hybridization array element is arranged and immobilized on the substrate, and such immobilization can be performed by a chemical bonding method or a covalent binding method such as UV.
  • the hybridization array element can be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bonded by UV at the polylysine coating surface.
  • the hybridization array element can be coupled to the substrate via a linker (eg, ethylene glycol oligomer and diamine).
  • the sample to be applied to the microarray of the present invention is a nucleic acid
  • it can be hybridized with the array element on the microarray.
  • Hybridization conditions may vary, and detection and analysis of the degree of hybridization may vary depending on the labeling substance.
  • the present invention it is possible to confirm whether or not the oral bacterial infectious agent of the target sample is infected by the hybridization reaction and / or amplification reaction between the primer and the target sample.
  • the present invention is used as a polymerase chain reaction (PCR) or a probe using a primer for detecting the cause of oral bacterial infectious diseases that specifically binds to the polynucleotide sequence of the rpoB gene. It provides a method for detecting oral bacterial infectious diseases causative bacteria comprising the step of detecting bacteria causing infectious diseases.
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • qRT-PCR quantitative real-time PCR
  • the Aa3-F / Aa3-R primers designed by the present inventors can identify PCR amplifications only in A. actinomycetemcomitans strains, unlike in other bacterial species in the oral cavity which were tested together with general PCR results. It was confirmed that the primers can specifically detect A. actinomycetemcomitans species.
  • qRT-PCR was further performed to confirm species-specific detection of A. actinomycetemcomitans genomic DNA up to 4 fg through the primers according to the present invention.
  • Aa3-F / Aa3-R primer pairs Was found to have excellent sensitivity to detect even bacterial genomic DNA corresponding to 1.7 strains of A. actinomycetemcomitans by qRT-PCR method (see Example 1).
  • primers according to the present invention have a characteristic of detecting only species causing specific oral bacterial infectious diseases through PCR method, and the presence of specific bacteria present in a sample through PCR methods known in the art.
  • the system and method for detecting the causative agent of oral bacterial infectious diseases with superior effect which can effectively check whether or not, and also can detect very high sensitivity, that is, even bacterial genomic DNA corresponding to a specific strain through a quantitative real-time PCR method. Can be provided.
  • the strains used in this example are shown in Table 3 below. These strains were purchased from ATCC (American Type Culture Collection, USA), CCUG (Culture Collection, University of G, Sweden) and KCTC (Korean Collection for Type Cultures, Biological Resource Center, Korea). In addition, the clinical strains isolated from Koreans were used by the Korea Oral Microbiology Bank (KCOM: Korean Collection for Oral Microbiology, Gwangju, Korea).
  • A. actinomycetemcomitans strains were cultured in tryptic soy broth (TSB, Difco Laboratories, USA) medium supplemented with 0.6% yeast extract, 5% horse serum, 75 ⁇ g / ml bacitracin and 5 ⁇ g / ml vancomycin (Sigma, USA).
  • Haemophilus spp. Strains were cultured in TSB medium containing 0.5% yeast extract, 0.5 mg / ml hemin and 2 ⁇ g / ml vitamin K 1 , and streptococci were cultured in Todd Hewitt broth (TH broth, Difco Diagnostics) medium.
  • strains were cultured in a medium containing 0.5% yeast extract, 0.05% cysteine HCl-H 2 O, 0.5 mg / ml hemin, and 2 ⁇ g / ml vitamin K 1 in trypticase soy broth (TSB).
  • TTB trypticase soy broth
  • Haemophilus spp. And Streptococcus spp. The strains were cultured in a 37 ° C. aerobic bacterial culture (ThermoForma, USA), and all other strains were 37 ° C. anaerobic bacteria (Bactron I, Sheldon Manufacturing Inc. supplied with 85% N 2 , 10% CO 2 , 5% H 2). , USA).
  • Bacterial genome DNAs were extracted using the G-spin TM Genomic DNA Extraction Kit (iNtRON Co., Seoul, Korea) according to the manufacturer's instructions. That is, 1.5 ml of bacterial culture was harvested using 10,000 ⁇ g centrifugal force, and then 50 ⁇ l of Pre-incubation solution and 3 ⁇ l of lysozyme solution were mixed well, followed by incubation at 37 ° C. for 1 hour. 250 ⁇ l of G-buffer solution was added thereto, mixed well, followed by reaction at 65 ° C. for 15 minutes, 250 ⁇ l of binding solution, mixed well, and then vortexed.
  • G-spin TM Genomic DNA Extraction Kit iNtRON Co., Seoul, Korea
  • the cell lysates were placed in a G-spin TM column and centrifuged for 1 minute at 13,000 rpm. 500 ⁇ l of washing buffer A was added to the column and centrifuged again for 1 minute. 500 ⁇ l of washing buffer B was added thereto, and centrifuged again for 1 minute.
  • the G-spin TM column was placed in a new eppendorf tube, 100 ⁇ l of elution buffer was added thereto, and allowed to stand at room temperature for 1 minute, followed by centrifugation at 13,000 rpm for 1 minute. .
  • the inventors performed the following to develop species-specific primers for quantitative detection at the species level of A. actinomycetemcomitans, one of the major pathogenic bacteria of oral bacterial infectious diseases.
  • Species-specific primers were designed according to the present invention using PrimerSelect program (DNASTAR Inc., USA) based on rpoB nucleic acid base sequence (GenBank accession no. AY362930) of A. actinomycetemcomitans , and the primer sequences are shown in Table 4 below. Indicated. The size of the PCR amplification was 113 bp.
  • reverse primer Aa3-R
  • PCR was performed using AccuPower PCR PreMix (Bioneer) and MyGenie TM 96 Gradient Thermal Block (Bioneer).
  • the species-specificity of the primer (Aa3-F / Aa3-R) according to the present invention designed for the detection of A. actinomycetemcomitans was examined by a general PCR method, and as shown in Table 5 below, A. actinomycetemcomitans strain (Reference strain 3). state and clinical strains 6 weeks) were only to see the complete PCR amplicons of 113bp Haemophilus spp three kinds (eight strains). And PCR amplification was not confirmed in other bacterial species in the oral cavity (40 species 40 strains).
  • qRT-PCR was performed using AccuPower GreenStar TM qPCR PreMix and Exicycler TM 96 Real-Time Quantitative Thermal Block from Bioneer, Korea.
  • PCR PreMix 60 pmoles and bacterial genomic DNA were added to PCR PreMix in PCR PreMix and PCR tubes, respectively, and DEPC water enclosed in PCR PreMix kit was added to make 50 ⁇ l of final reaction and then voltexed.
  • predenaturation was performed at 95 ° C for 10 minutes, denaturation at 95 ° C for 10 seconds, annealing and extension at 72 ° C for 30 seconds, and scanning were repeated 45 times.
  • the specificity of the reaction was confirmed by melting curve analysis by measuring the intensity of fluorescence when the temperature was gradually raised from 60 ° C. to 94 ° C. at 1 ° C./sec.
  • A. actinomycetemcomitans ATCC 33384 to the genomic DNA of T was diluted from 40 ng up to 4 fg by 10 step qRT-PCR The standard curve and the minimum detection limit were measured.
  • the Aa3-F / Aa3-R primer designed in the present invention can detect species-specific A. actinomycetemcomitans genomic DNA up to 4fg by qRT-PCR.
  • the bacterial genome size of A. actinomycetemcomitans is 2.1 Mb, it means that Aa3-F / Aa3-R primer pair can detect up to 1.7 bacterial genomic DNA of A. actinomycetemcomitans by qRT-PCR method. do.
  • Example 2 using a primer according to the present invention P. gingivalis Detection of
  • the inventors performed the following to develop a species-specific primer for quantitative detection at the species level of P. gingivalis, one of the major pathogenic bacteria of oral bacterial infectious diseases.
  • Species-specific primer pairs were designed using PrimerSelect program (DNASTAR Inc., USA) based on the rpoB nucleic acid base sequence of P. gingivalis (GenBank accession no. NC_010729), and the primer sequences are shown in Table 7 below.
  • the size of the PCR amplifier was 143 bp.
  • Primer sequence primer Primer sequence SEQ ID NO: forward primer (Pg-F) 5'-GGA AGA GAA GAC CGT AGC ACA AGG A-3 ' 27 reverse primer (Pg-R) 5'-GAG TAG GCG AAA CGT CCA TCA GGT C-3 ' 28
  • Species-specificity of P. gingivalis of primers (Pg-F / Pg-R) according to the present invention was first tested by general PCR methods. PCR was performed using AccuPower PCR PreMix (Bioneer, Korea) containing 5 nmole deoxynucleoside triphosphate, 0.8 ⁇ mole KCl, 0.2 ⁇ mole Tris-HCl (pH 9.0), 0.03 ⁇ mole MgCl 2 and 1 unit Taq DNA polymerase.
  • qRT-PCR was performed using AccuPower GreenStar TM qPCR PreMix and Exicycler TM 96 Real-Time Quantitative Thermal Block from Bioneer, Korea.
  • P. gingivalis-Pg F / Pg-R in order to investigate the sensitivity (sensitivity) of the primer, P. gingivalis ATCC 33277 genomic DNA of T diluted by 10 steps from 4 ng to 4 fg qRT-PCR of The standard curve and the minimum detection limit were measured.
  • Pg-F / Pg-R primer was detected up to 4 fg of the genomic DNA of P. gingivalis ATCC 33277 T (Table 8, Fig. 3).
  • the genome size of P. gingivalis ATCC 33277 T is 2.35 Mb, and the Pg-F / Pg-R primers can detect the P. gingivalis genome of 1.6 (see Table 8).
  • the Pg-F / Pg-R primer designed in the present invention can detect species-specific P. gingivalis genomic DNA up to 4fg by qRT-PCR. Considering that the bacterial genome size of P. gingivalis is 2.35 Mb, it means that Pg-F / Pg-R primer pair can detect even bacterial genomic DNA corresponding to P. gingivalis 1.6 strain by qRT-PCR method. do.
  • CT values sensitivity measurement results

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도에 관한 것으로, 보다 구체적으로 구강 세균감염성질환을 일으키는 원인균을 정성 및 정량적으로 검출할 수 있으며, 종-특이성이 뛰어난 구강 세균감염성질환 원인균 검출용 프라이머, 검출용 조성물, 키트 및 마이크로어레이에 관한 것이다. 본 발명에 따른 구강 세균감염성질환 원인균 검출용 프라이머는 민감도가 높고 종-특이성이 뛰어나며, 다양한 세균에 의한 구강 내 치주 조직의 감염 여부를 신속하고 간단하게 검출, 탐지할 수 있으며, 구강 세균감염성질환을 일으키는 원인균을 정성 및 정량적으로 검출할 수 있는 효과가 있다. 또한, 세균학적 예후평가를 규명하는 도구로 이용될 수 있다.

Description

[규칙 제26조에 의한 보정 27.04.2012]　구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
본 발명은 구강 세균감염성질환을 일으키는 원인균을 정성 및 정량적으로 검출할 수 있으며, 종-특이성이 뛰어난 구강 세균감염성질환 원인균 검출용 프라이머, 검출용 조성물, 키트 및 마이크로어레이에 관한 것이다.
인간의 구강 내에는 약 700여 세균 종이 있다고 알려져 있으며, 수많은 세균이 덩어리를 이룬 채로 서식하여 치면세균막(dental plaque 혹은 dental biofilm)을 이루고 있다. 치아와 치아 사이나 치아와 잇몸사이에 생긴 치면세균막은 칫솔질에 의해서도 제거되지 않고 잔류하며, 이러한 부위에 남아있는 치면세균막 내에서 세균들이 증식하면서 치은조직에 직접 작용하여 면역반응을 유발시키거나 세포 독성물질을 방출하여 치은조직에 염증을 일으킨다. 이러한 염증은 치조골까지 진행되면서 치주염을 일으키게 된다.
치주 질환(Periodontal Disease)은 위에서 기술한 것과 같이 치면세균막에 존재하는 세균에 의해 치아의 지지 조직(백악질, 치은, 치조골, 치주인대)에 염증이 발생하는 질환이다. 치주 질환은 크게 임상적으로 치조골 파괴가 동반되지 않고 치은 조직에만 염증이 존재하는 치은염(gingivitis)과, 치조골 파과까지 동반된 치주염(periodontitis)으로 분류할 수 있다.
이처럼, 치주질환의 초기단계인 치은염은 연한 잇몸조직에만 침범한 것으로 이 단계에서는 치면세균막과 치석의 제거만으로도 회복이 가능하다. 하지만, 치료를 받지 않으면 치조골이 파괴되는 치주염으로 진행되고, 잇몸 수술 등의 치료를 받지 않을 경우 결국 치아를 잃게 된다.
현재까지의 연구 결과에 의하면, 흡연 여부, 당뇨병 등의 전신 질환 및 면역 결핍을 동반하는 질병 등이 치주 질환으로의 발병에 영향을 주지만, 치은연하 치면세균막에 존재하는 그람-음성 세균 종들이 치주 질환을 일으키는 주요한 병인으로 알려져 있다. 여러 연구자들의 역학연구들에 의해, 치주질환의 주요한 원인균종으로 트로포네마 덴티콜라(Treponema denticola), 포필로모나스 진지발리스(Porphyromonas gingivalis), 테너넬라 포사이시아(Tannernella forsythia), 애그리거터박터 액티노마이세템코미탄스(Aggregatibacter actinomycetemcomitans) 프로보텔라 인터미디어(Prevotella intermedia), 캠파일로박터 렉터스(Campylobacter rectus), 퓨소박테리아 뉴크레아텀(Fusobacterium nucleatum) 등이라고 알려져 있지만, 아직까지 정확한 원인균종은 밝혀져 있지 않다. 또한, 어느 지역에 사는 사람인가에 따라 치주질환에 연관된 세균 종이 다르다는 연구도 있다. 그러므로, 치주질환의 원인균을 밝히기 위해서는 전 인류를 대상으로 하는 대단위 역학연구가 필요하고, 이때 모든 연구자들이 공동적으로 사용할 수 있으면서 정확성 및 재현성이 우수한 세균 검출법이 필요하다.
한편, 현재까지 치주 질환은 임상 및 방사선학적 결과를 토대로, 환자 연령에 따른 치주 조직의 변화, 예를 들어 치조골의 소실 정도, 동요도, 염증 양상 등을 종합하여 진단한다. 하지만, 치주 질환과 관련해서는 대부분 치조골 소실량이 50% 이상 진행된 상태에서 병원을 찾게 되므로 지속적인 처치를 요하게 된다.
그러나 지금까지 치주 질환과 관련하여 그 원인균에 의한 감염 여부 또는 원인균의 존재 여부를 조기에 탐지, 검색할 수 있는 검출방법 또는 분석 키트는 전무하였다. 그나마 지금까지 이와 관련한 치주질환에 관련된 병원성 세균 종을 찾기 위한 분자역학적 연구는 주로 16S rRNA gene(16S rDNA)을 표적으로 하여 PCR법을 이용하여 정성 분석한 것이 대부분이었다. 그러나 상기의 기존의 방법으로는 수많은 치주질환 병원성 세균 종을 종-특이적으로 검출해 낼 수 있는 PCR 프라이머 설계 및 개발이 불가능했으며, 치주질환 원인균의 분자역학적 연구를 위해 정성 및 정량 데이터를 동시에 얻을 수 있는 세균 종 검출기법의 개발에도 한계가 존재하였다.
치아우식증(dental caries)은 치면세균막에 서식하는 세균들의 당질 대사에 의해 생성된 젖산 등의 유기산에 의해 치아 표면의 탈회가 진행되어 발생하기 시작한다. 이러한 치아우식증의 주요한 원인균종으로는 스트렙토코커스 뮤탄스(Streptococcus mutans), 스트렙토코커스 소브라이너스(Streptococcus sobrinus), 악티노마이세스 종(Actinomyces spp.), 락토바실러스 종(Lactobacillus spp.) 등이 관여하는 것으로 알려져 있다. 치아는 표면으로부터 법랑질, 상아질, 및 치수로 구성되어 있고, 법랑질에 발생하는 초기 치아우식증을 조기에 치료를 하지 않을 경우 상아질 및 치수로 까지 진행될 수 있다. 특히 치수로까지 염증이 진행될 경우를 치수염이라고 하고, 치아뿌리쪽 치수 염증을 치근관염이라고 한다. 통상 치수는 치관과 치근관이 연결되어 있기 때문에 치수 및 치근관염이라고 표현한다. 이러한 치수 및 치근관염이 더 진행되면, 치아 뿌리(치근) 밑의 골조직까지 염증이 진행되는 치근단 낭종, 치근단 농양, 치근단 골육종 등이 발생할 수 있는 데, 이들을 치근단 질환이라고 한다. 또한 면역력이 약한 사람의 경우 악골 골수염까지 진행될 수 있다. 이러한 치수 및 치근관염, 치근단 질환들 및 악골 골수염을 유발시키는 세균 종들은 일반적으로 치주질환을 일으키는 세균들과 연관성이 깊은 것으로 알려져 있으나, 아직까지 정확한 원인균종은 밝혀져 있지 않고 있다.
따라서, 상기의 세균감염성 구강질환의 원인 세균 종을 밝히는 역학 연구와 특히 치주질환의 예방, 발병가능성 및 치료 후 예후 판정을 위해 세균감염성 구강질환의 원인균종을 효율적이면서도 민감도가 높은 방법으로 검출할 수 있는 시스템 개발의 필요성이 제기되고 있는 실정이다.
이에 본 발명자들은 구강 세균감염성질환을 일으키는 병원성 세균을 동정 및 검출하기 위하여 계통분류학적으로 잘 보존이 되어 있으며, 세균 종간의 상동성이 16S rDNA보다는 큰 rpoB 유전자를 바탕으로 구강 세균감염성질환 병원성 세균 종을 검출할 수 있는 종-특이적 PCR 프라이머 및 키트를 개발함으로써 본 발명을 완성하였다.
따라서 본 발명의 목적은 구강 세균감염성질환과 밀접한 관련이 있는 다양한 세균에 의한 구강 내 치주 조직의 감염 여부나 검체에 존재하는 구강 내 세균 종을 신속 정확하고 간단하게 검출 및 탐지할 수 있는 올리고뉴클레오티드로 구성되는 프라이머를 제공하고자 하는 것이다.
본 발명의 다른 목적은 상술한 프라이머를 이용하여 구강 세균감염성질환 원인균을 선택적으로 검출할 수 있는 일반 PCR 및 정량 PCR 키트 그리고 이들의 마이크로어레이 형태의 정량 PCR 키트를 제공하고자 하는 것이다.
본 발명의 또 다른 목적은 구강 세균감염성질환 원인균의 존재 유무를 진단할 수 있도록, 상술한 프라이머와 표적 샘플 사이의 교잡 반응 및/또는 증폭 반응에 의하여 표적 샘플의 치주 질환 원인균의 감염 여부를 확인하는 방법을 제공하고자 하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 rpoB(DNA-directed RNA polymerase subunit beta: 이하 간단하게 “rpoB”라 함) 유전자의 폴리뉴클레오티드염기서열에 특이적으로 결합하는 구강 세균감염성질환 원인균 검출용 프라이머를 제공한다.
본 발명의 일실시예에 있어서, 상기 원인균은 Actinomyces georgiae(CCUG 32935T), Actinomyces israelii(ATCC 12102T), Actinomyces meyeri(CCUG 21024T), Actinomyces naeslundii(CCUG 35333T), Actinomyces odontolyticus(CCUG 20536T), Aggregatibacter actinomycetemcomitans(ATCC 33384T), Atopobium parvulum(KCTC 3663T), Atopobium rimae(KCTC 5749T), Campylobacter rectus(ATCC 33238T), Capnocytophaga gingivalis(ATCC 33624T), Capnocytophaga ochracea(KCTC 5787T), Capnocytophaga sputigena(KCTC 5789T), Eikenella corrodens(KCOM 1378), Eubacterium limosum(KCTC 2487T), Filifactor alocis(ATCC 35896T), Fusobacterium canifelinum(CCUG 49733T), Fusobacterium naviforme(ATCC 50052), Fusobacterium necrophorum(ATCC 25286T), Fusobacterium nucleatum(ATCC 25586T), Fusobacterium periodonticum(ATCC 33693T), Fusobacterium simiae(CCUG 16798T), Gemella haemolysans(KCOM 1381), Haemophilus aphrophilus(ATCC 33389T), Haemophilus parainfluenzae(ATCC 33392T), Haemophilus paraphrophilus(ATCC 29242T), Leptotrichia buccalis(CCUG 34316T), Neisseria meningitidis(ATCC 13077T), Neisseria mucosa(ATCC 19696T), Neisseria sicca(ATCC 29256T), Neisseria subflava(ATCC 49275T), Porphyromonas asaccharolytica(ATCC 43037T), Porphyromonas endodontalis(ATCC 35406T), Porphyromonas gingivalis(ATCC 33277T), Prevotella baroniae(CCUG 50418T), Prevotella bivia(ATCC 29303T), Prevotella brevis(ATCC 19188T), Prevotella buccae(ATCC 33574T), Prevotella buccalis(CCUG 15557T), Prevotella corporis(ATCC 33547T), Prevotella dentalis(ATCC 49559T), Prevotella denticola(CCUG 29542T), Prevotella disiens(CCUG 9558T), Prevotella enoeca(ATCC 51261T), Prevotella heparinolytica(ATCC 35895T), Prevotella intermedia(ATCC 25611T), Prevotella loescheii(ATCC 15930T), Prevotella marshii(CCUG E9.34T), Prevotella melaninogenica(ATCC 25845T), Prevotella nigrescens(ATCC 33563T), Prevotella oralis(ATCC 33269TT), Prevotella oris(CCUG 15405T), Prevotella oulorum(ATCC 43324T), Prevotella pallens(ATCC 700821T), Prevotella ruminicola(ATCC 19189T), Prevotella veroralis(ATCC 33779T), Propionibacterium acnes(KCTC 3314T), Propionibacterium propionicum(KCTC 5342T), Rothia dentocariosa(KCTC 3204T), Selenomonas artemidis(KCTC 5742T), Selenomonas noxia(KCTC 5749T), Streptococcus anginosus(ATCC 700231T), Streptococcus constellatus(ATCC 27823T), Streptococcus gordonii(CCUG 33482T), Streptococcus intermedius(KCTC 3268T), Streptococcus mitis(KCTC 3556T), Streptococcus mutans(ATCC 25175T), Streptococcus oralis(CCUG 13229T) Streptococcus parasanguinis(CCUG 30417T), Streptococcus pneumoniae(CCUG 28588T), Streptococcus sanguinis(CCUG 17826T), Streptococcus sobrinus(ATCC 33478T), Tannerella forsythia(ATCC 43037T), Treponema denticola(ATCC 35405T), Veillonella dispar(KCOM 1301) 및 Veillonella parvula(KCTC 5019T)로 이루어진 군에서 선택되는 1종 이상일 수 있다.
본 발명의 일실시예에 있어서, 상기 프라이머는 서열번호 1 내지 서열번호 88의 염기서열 또는 이들 염기 서열에 각각 상보적인 염기서열로 구성되는 군에서 적어도 하나 이상 선택되는 폴리뉴클레오티드로 구성되는 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 서열번호 1 및 2의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Aggregatibacter actinomycetemcomitans의 게놈과 특이적으로 교잡하고, 상기 서열번호 3 및 4의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Atopobium rimae의 게놈과 특이적으로 교잡하고, 상기 서열번호 5 내지 6의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Capnocytophaga gingivalis의 게놈과 특이적으로 교잡하고, 상기 서열번호 7 및 8의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Capnocytophaga ochracea의 게놈과 특이적으로 교잡하고, 상기 서열번호 9 및 10의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Capnocytophaga sputigena의 게놈과 특이적으로 교잡하고, 상기 서열번호 11 및 12의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Fusobacterium necrophorum의 게놈과 특이적으로 교잡하고, 상기 서열번호 13 및 14 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Fusobacterium nucleatum의 게놈과 특이적으로 교잡하고, 상기 서열번호 15 및 16의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Fusobacterium periodonticum의 게놈과 특이적으로 교잡하고, 상기 서열번호 17 내지 18의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Fusobacterium simiae의 게놈과 특이적으로 교잡하고, 상기 서열번호 19 및 20의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Leptotrichia buccalis의 게놈과 특이적으로 교잡하고, 상기 서열번호 21 및 22의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Neisseria meningitidis의 게놈과 특이적으로 교잡하고, 상기 서열번호 23 및 24의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Neisseria subflava의 게놈과 특이적으로 교잡하고, 상기 서열번호 25 및 26의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Porphyromonas endodontalis의 게놈과 특이적으로 교잡하고, 상기 서열번호 27 및 28의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Porphyromonas gingivalis의 게놈과 특이적으로 교잡하고, 상기 서열번호 29 및 30의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella baroniae의 게놈과 특이적으로 교잡하고, 상기 서열번호 31 및 32의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella bivia의 게놈과 특이적으로 교잡하고, 상기 서열번호 33 및 34의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella corporis의 게놈과 특이적으로 교잡하고, 상기 서열번호 35 및 36의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella disiens의 게놈과 특이적으로 교잡하고, 상기 서열번37 및 38의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella intermedia의 게놈과 특이적으로 교잡하고, 상기 서열번호 39 및 40의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella marshii의 게놈과 특이적으로 교잡하고, 상기 서열번호 41 및 42의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella melaninogenica의 게놈과 특이적으로 교잡하고, 상기 서열번호 43 및 44의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella nigrescens의 게놈과 특이적으로 교잡하고, 상기 서열번호 45 및 46의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella oralis의 게놈과 특이적으로 교잡하고, 상기 서열번호 47 및 48의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella oris의 게놈과 특이적으로 교잡하고, 상기 서열번호 49 및 50의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella oulorum의 게놈과 특이적으로 교잡하고, 상기 서열번호 51 및 52의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella pallens의 게놈과 특이적으로 교잡하고, 상기 서열번호 53 및 54의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella veroralis의 게놈과 특이적으로 교잡하고, 상기 서열번호 55 및 56의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Selenomonas noxia의 게놈과 특이적으로 교잡하고, 상기 서열번호 57 및 58의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Streptococcus constellatus의 게놈과 특이적으로 교잡하고, 상기 서열번호 59 및 60의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Streptococcus intermidius의 게놈과 특이적으로 교잡하고, 상기 서열번호 61 및 62의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Streptococcus oralis의 게놈과 특이적으로 교잡하고, 상기 서열번호 63 및 64의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Streptococcus sanguinis의 게놈과 특이적으로 교잡하고, 상기 서열번호 65 및 66의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Veillonella parvula의 게놈과 특이적으로 교잡하는 것일 수 있다. 또한, 서열번호 67 및 68의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Actinomyces naeslundii의 게놈과 특이적으로 교잡하고, 서열번호 69 및 70의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Campylobacter rectus의 게놈과 특이적으로 교잡하고, 서열번호 71 및 72의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Eikenella corrodens의 게놈과 특이적으로 교잡하고, 서열번호 73 및 74의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Neisseria sicca의 게놈과 특이적으로 교잡하고, 서열번호 75 및 76의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Porphyromonas asaccharolytica의 게놈과 특이적으로 교잡하고, 서열번호 77 및 78의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella buccae의 게놈과 특이적으로 교잡하고, 서열번호 79 및 80의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Prevotella buccalis의 게놈과 특이적으로 교잡하고, 서열번호 81 및 82의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Rothia dentocariosa의 게놈과 특이적으로 교잡하고, 서열번호 83 및 84의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Streptococcus anginosus의 게놈과 특이적으로 교잡하고, 서열번호 85 및 86의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Tannerella forsythensis의 게놈과 특이적으로 교잡하고, 서열번호 87 및 88의 염기서열 또는 이들 염기서열에 각각 상보적인 염기 서열로 구성되는 뉴클레오티드는 Treponema denticola의 게놈과 특이적으로 교잡할 수 있다.
본 발명의 일실시예에 있어서, 상기 구강 세균감염성질환은 치주질환, 치아우식증, 치수염, 치근관질환, 치근단질환 및 악골 골수염으로 이루어진 군중에서 선택되는 것일 수 있다.
또한, 본 발명은 rpoB 유전자의 뉴클레오티드 염기서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 조성물을 제공한다.
또한, 본 발명은 rpoB 유전자의 뉴클레오티드 염기서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 키트를 제공한다.
또한, 본 발명은 rpoB 유전자의 뉴클레오티드 염기서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 마이크로어레이를 제공한다.
나아가, 본 발명은 rpoB 유전자의 뉴클레오티드 염기서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 이용한 중합효소연쇄반응(Polymerase chain reaction, PCR) 또는 마이크로어레이(microarray)로 구강 세균감염성질환 원인균를 탐지하는 단계를 포함하는 구강 세균감염성질환 원인균의 검출 방법을 제공한다.
본 발명의 일실시예에 있어서, 상기 PCR은 정량 실시간 PCR(qRT-PCR) 일 수 있다.
본 발명에 따른 구강 세균감염성질환 원인균 검출용 프라이머는 민감도가 높고 종-특이성(species-specificity)이 뛰어나, 다양한 세균에 의한 구강 내 치주 조직의 감염 여부 또는 구강 세균 종들의 존재여부를 신속하고 간단하게 검출, 탐지할 수 있으며, 구강 세균감염성질환을 일으키는 원인균을 정성 및 정량적으로 검출할 수 있다. 더 나아가, 치주질환 치료 전후의 세균 종 검출 결과 비교분석을 통해 세균학적 예후평가를 규명하는 도구로 이용될 수 있는 효과가 있다.
도 1은 본 발명의 일실시예에 따른 A. actinomycetemcomitans에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 2는 Pg-F/Pg-R 프라이머의 종-특이성을 살펴보기 위해 각각의 유전제 DNA 4ng을 사용하여 PCR을 수행하고, PCR 반응물을 1.5% 아가로스겔로 전기영동한 결과를 나타낸다.
도 3은 본 발명의 일실시예에 따른 P. gingivalis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 4는 본 발명의 일실시예에 따른 Atopobium rimae에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 5는 본 발명의 일실시예에 따른 Capnocytophaga gingivalis 에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 6은 본 발명의 일실시예에 따른 Capnocytophaga ochracea에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 7은 본 발명의 일실시예에 따른 Capnocytophaga sputigena에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 8은 본 발명의 일실시예에 따른 Fusobacterium necrophorum에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 9는 본 발명의 일실시예에 따른 Fusobacterium nucleatum 에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 10은 본 발명의 일실시예에 따른 Fusobacterium periodonticum에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 11은 본 발명의 일실시예에 따른 Fusobacterium simiae에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 12는 본 발명의 일실시예에 따른 Leptotrichia buccalis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 13은 본 발명의 일실시예에 따른 Neisseria meningitidis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 14는 본 발명의 일실시예에 따른 Neisseria subflava에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 15는 본 발명의 일실시예에 따른 Porphyromonas endodontalis 에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 16은 본 발명의 일실시예에 따른 Prevotella baroniae에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 17은 본 발명의 일실시예에 따른 Prevotella bivia에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 18은 본 발명의 일실시예에 따른 Prevotella corporis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 19은 본 발명의 일실시예에 따른 Prevotella disiens에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 20은 본 발명의 일실시예에 따른 Prevotella intermedia에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 21은 본 발명의 일실시예에 따른 Prevotella marshii에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 22은 본 발명의 일실시예에 따른 Prevotella melaninogenica에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 23은 본 발명의 일실시예에 따른 Prevotella nigrescens에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 24은 본 발명의 일실시예에 따른 Prevotella oralis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 25은 본 발명의 일실시예에 따른 Prevotella oris에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 26은 본 발명의 일실시예에 따른 Prevotella oulorum 에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 27은 본 발명의 일실시예에 따른 Prevotella pallens에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 28은 본 발명의 일실시예에 따른 Prevotella veroralis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 29은 본 발명의 일실시예에 따른 Selenomonas noxia에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 30은 본 발명의 일실시예에 따른 Streptococcus constellatus에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 31은 본 발명의 일실시예에 따른 Streptococcus intermidius에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 32은 본 발명의 일실시예에 따른 Streptococcus oralis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 33은 본 발명의 일실시예에 따른 Streptococcus sanguinis 에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 34은 본 발명의 일실시예에 따른 Veillonella parvula에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 35은 본 발명의 일실시예에 따른 Actinomyces naeslundii에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 36은 본 발명의 일실시예에 따른 Campylobacter rectus에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 37은 본 발명의 일실시예에 따른 Eikenella corrodens에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 38은 본 발명의 일실시예에 따른 Neisseria sicca에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 39은 본 발명의 일실시예에 따른 Porphyromonas asaccharolytica에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 40은 본 발명의 일실시예에 따른 Prevotella buccae에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 41은 본 발명의 일실시예에 따른 Prevotella buccalis에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 42는 본 발명의 일실시예에 따른 Rothia dentocariosa에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 43은 본 발명의 일실시예에 따른 Streptococcus anginosus에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 44는 본 발명의 일실시예에 따른 Tannerella forsythia에 대한 Standard curve 및 최소검출한도를 나타낸다.
도 45는 본 발명의 일실시예에 따른 Treponema denticola에 대한 Standard curve 및 최소검출한도를 나타낸다.
본 발명은 구강 세균감염성질환 원인균 검출용 프라이머 및 이를 포함하는 검출용 조성물에 관한 것으로, 최초로 구강 세균감염성질환을 일으키는 병원성 세균의 동정 및 검출에 rpoB 유전자를 이용하였다는 점에 그 특징이 있다.
본 발명자들은 구강 세균감염성질환을 일으키는 병원성 세균을 동정 및 검출하기 위한 프라이머를 개발하기 위한 표적 유전자로 rpoB 유전자에 주목하였는데, rpoB 유전자는 RNA 중합효소의 베타 서브유닛이 인코딩된 유전자로서, 약 4~5kbp로 구성되어 있으며, Escherichia coli의 핵산염기서열(4,026bp)을 기준으로 여러 세균 종들 간의 핵산염기서열의 상동성 분석을 한 결과 9개의 유전학적 상동성이 잘 보존된 영역과 그들 사이의 8개의 상동성이 떨어지는 영역이 있는 것으로 알려져 있다(Severinow et al., 1996).
또한, rpoB는 16S rDNA와 같이 세균분류학적 측면에서 같은 세균 종에 속하는 균주들 간에 핵산염기서열이 잘 보존되어 있으나, 16S rDNA보다 핵산염기서열이 약 3배 정도 크며, 세균 종간의 상이성이 비교적 크다는 특성이 있다. 그러므로 rpoB 유전자에서 특정 세균 속(genus)에 속한 모든 세균 종의 rpoB 유전자와 상보적으로 결합할 수 있는 PCR 프라이머를 설계할 수 있으며, 종간 상이성이 인정되는 부위를 다양하게 변형시킨 세균 종-특이성 PCR 프라이머를 개발할 수 있다.
구강 내에는 약 700여 세균 종이 존재하는 것으로 알려져 있으며, 현재까지구강 세균감염성질환에 관련된 병원성 세균 종을 찾기 위한 분자역학연구는 주로 16S rDNA를 표적으로 하여 PCR법을 이용하여 정성분석을 한 것이 대부분이었다. 그러나 16S rDNA로는 치주질환 병원성 세균 종을 특이적으로 정성 및 정량적으로 검출할 수 있는 real-time PCR 프라이머 개발에 한계가 있었다.
이에 본 발명자들은 계통분류학적으로 잘 보존이 되어 있으며, 세균 종간의 상동성이 16S rDNA보다는 큰 rpoB 유전자를 바탕으로 구강 세균감염성질환 병원성 세균 종을 검출할 수 있는 real-time PCR 키트를 개발하여, 향후 치주질환과 같은 구강 세균감염성질환 분자역학연구에 활용할 수 있도록 하고자 한다.
따라서 본 발명에서는 구강 내 치면세균막에 존재하는 세균 종 중에서 구강 세균감염성질환과 관련성이 높다고 알려진 세균 종, 관련성이 적다고 알려진 세균 종 및 아직까지 구강 세균감염성질환과 관련성이 밝혀지지 않은 세균 종들을 포함하여 총 74종의 세균들의 표준균주들의 rpoB 유전자를 클로닝하여 핵산염기서열을 결정하였으며, rpoB 유전자들의 핵산염기서열을 바탕으로 종-특이적 real-time PCR 프라이머를 개발하였다.
이에 본 발명은 구강 세균감염성 질환 원인균의 존재 여부를 확인하기 위한 프라이머로서, rpoB 유전자의 폴리뉴클레오티드 서열에 특이적으로 결합하는 구강 세균감염성질환 원인균 검출용 프라이머를 제공한다.
본 발명의 프라이머를 이용하여 검출할 수 있는 구강 세균감염성 질환 원인균으로는 Actinomyces naeslundii(CCUG 35333T), Aggregatibacter actinomycetemcomitans(ATCC 33384T), Atopobium rimae(KCTC 5749T), Campylobacter rectus(ATCC 33238T), Capnocytophaga gingivalis(ATCC 33624T), Capnocytophaga ochracea(KCTC 5787T), Capnocytophaga sputigena(KCTC 5789T), Eikenella corrodens(KCOM 1378), Fusobacterium necrophorum(ATCC 25286T), Fusobacterium nucleatum(ATCC 25586T), Fusobacterium periodonticum(ATCC 33693T), Fusobacterium simiae(CCUG 16798T), Leptotrichia buccalis(CCUG 34316T), Neisseria meningitidis(ATCC 13077T), Neisseria sicca(ATCC 29256T), Neisseria subflava(ATCC 49275T), Porphyromonas asaccharolytica(ATCC 43037T), Porphyromonas endodontalis(ATCC 35406T), Porphyromonas gingivalis(ATCC 33277T), Prevotella baroniae(CCUG 50418T), Prevotella bivia(ATCC 29303T), Prevotella buccae(ATCC 33574T), Prevotella buccalis(CCUG 15557T), Prevotella corporis(ATCC 33547T), Prevotella disiens(CCUG 9558T), Prevotella intermedia(ATCC 25611T), Prevotella marshii(CCUG E9.34T), Prevotella melaninogenica(ATCC 25845T), Prevotella nigrescens(ATCC 33563T), Prevotella oralis(ATCC 33269TT), Prevotella oris(CCUG 15405T), Prevotella oulorum(ATCC 43324T), Prevotella pallens(ATCC 700821T), Prevotella veroralis(ATCC 33779T), Rothia dentocariosa(KCTC 3204T), Selenomonas noxia(KCTC 5749T), Streptococcus anginosus(ATCC 700231T), Streptococcus constellatus(ATCC 27823T), Streptococcus intermedius(KCTC 3268T), Streptococcus oralis(CCUG 13229T) Streptococcus sanguinis(CCUG 17826T), Tannerella forsythia(ATCC 43037T), Treponema denticola(ATCC 35405T), 및 Veillonella parvula(KCTC 5019T) 뿐만아니라 이들 균주들의 세균종에 해당하는 임상균주들을 포함한다.
본 발명에서 상기 프라이머는 적합한 온도 및 적합한 완충액 내에서 적합한 조건(즉, 4종의 다른 뉴클레오시드 트리포스페이트 및 중합반응 효소) 하에서 주형-지시 DNA 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오타이드를 의미한다. 프라이머의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변화가 있을 수 있다. 또한, 프라이머의 서열은 주형의 일부 서열과 완전하게 상보적인 서열을 가질 필요는 없으며, 주형과 혼성화되어 프라이머 고유의 작용을 할 수 있는 범위 내에서의 충분한 상보성을 가지면 충분하다. 따라서 본 발명에서의 프라이머는 주형인 유전자의 뉴클레오타이드 서열에 완벽하게 상보적인 서열을 가질 필요는 없으며, 이 유전자 서열에 혼성화되어 프라이머 작용을 할 수 있는 범위 내에서 충분한 상보성을 가지면 충분하다. 또한, 본 발명에 따른 프라이머는 유전자 증폭 반응에 이용될 수 있는 것이 바람직하다.
상기 증폭 반응은 핵산 분자를 증폭하는 반응을 말하며, 이러한 유전자의 증폭 반응들에 대해서는 당업계에 잘 알려져 있고, 예컨대, 중합효소 연쇄반응(PCR), 역전사 중합효소 연쇄반응(RT-PCR), 리가아제 연쇄반응(LCR), 전자 중재 증폭(TMA), 핵산 염기서열 기판 증폭(NASBA) 등이 포함될 수 있다.
본 발명의 구강 세균감염성질환 원인균 검출용 프라이머는 rpoB 유전자의 뉴클레오티드 서열에 대하여 상보적인 서열을 갖으며, 서열번호 1 내지 서열번호 88의 염기서열 또는 이들 염기 서열에 각각 상보적인 염기서열로 구성되는 군에서 적어도 하나 이상 선택되는 뉴클레오티드로 구성되는 것이 바람직하다.
상기 프라이머는 하기 표 1에 기재된 구강 세균감염성질환 원인균을 특이적으로 검출할 수 있는 하기의 서열목록을 가진 프라이머 쌍으로 구성될 수 있다.
표 1 본 발명에 따른 프라이머 쌍과 검출 가능한 세균 종의 이름
세균 종 이름 프라이머 서열목록 세균 종 이름 프라이머 서열목록
Aggregatibacter actinomycetemcomitans 1 Prevotella oralis 45
2 46
Atopobium rimae 3 Prevotella oris 47
4 48
Capnocytophaga gingivalis 5 Prevotella oulorum 49
6 50
Capnocytophaga ochracea 7 Prevotella pallens 51
8 52
Capnocytophaga sputigena 9 Prevotella veroralis 53
10 54
Fusobacterium necrophorum 11 Selenomonas noxia 55
12 56
Fusobacterium nucleatum 13 Streptococcus constellatus 57
14 58
Fusobacterium periodonticum 15 Streptococcus intermidius 59
16 60
Fusobacterium simiae 17 Streptococcus oralis 61
18 62
Leptotrichia buccalis 19 Streptococcus sanguinis 63
20 64
Neisseria meningitidis 21 Veillonella parvula 65
22 66
Neisseria subflava 23 Actinomyces naeslundii 67
24 68
Porphyromonas endodontalis 25 Campylobacter rectus 69
26 70
Porphyromonas gingivalis 27 Eikenella corrodens 71
28 72
Prevotella baroniae 29 Neisseria sicca 73
30 74
Prevotella bivia 31 Porphyromonas asaccharolytica 75
32 76
Prevotella corporis 33 Prevotella buccae 77
34 78
Prevotella disiens 35 Prevotella buccalis 79
36 80
Prevotella intermedia 37 Rothia dentocariosa 81
38 82
Prevotella marshii 39 Streptococcus anginosus 83
40 84
Prevotella melaninogenica 41 Tannerella forsythia 85
42 86
Prevotella nigrescens 43 Treponema denticola 87
44 88
본 발명의 일실시예에 따른 rpoB 핵산염기서열을 바탕으로 설계된 종-특이 구강 세균감염성질환 원인균 검출용 프라이머는 서열번호 1 내지 88 중에서 선택된 서로 다른 염기서열로 이루어진 프라이머 쌍일 수 있으며, 각각의 프라이머 쌍이 특이적으로 탐지할 수 있는 세균 종 이름, 염기서열, 서열번호, PCR 산물 크기, 어닐링 온도에 대해 하기 표 2에 나타내었다. 표 2 및 첨부한 서열목록에 나타난 각 프라이머의 이름(예:Pg-F)은 종-특이적으로 검출가능한 해당 세균 종 이름(예:Porphyromonas gingivalis)의 약자(Pg)와 함께 포워드(forward, F) 또는 리버스(reverse, R) 프라이머 임을 나타낸다.
표 2 본 발명에 따른 프라이머 쌍의 염기서열, 검출 가능한 세균 종, 서열번호, PCR 산물 크기, 어닐링 온도
순번 세균 종 이름 염기서열(5- to -3) 서열목록 PCR산물크기(base pair) 어닐링 온도() 민감도(DNA양/CT)
1 Aggregatibacter actinomycetemcomitans Aa3-F: GGCGAGCCTGTATTTGATGTGCG 1 113 72 2fg/35.3
Aa3-R: GTGCCCGGTGCTGCGTCTTTG 2
2 Atopobium rimae Ar-F5; CGCGCTCGGTACCGTTGATGATAA 3 101 72 20fg/37.9
Ar-R8; GAACAAGGAGACGGGCGAGAAAAAG 4
3 Capnocytophaga gingivalis Cg-F5: CTATCACCGACACCCGCAACCAG 5 96 72 2fg/32
Cg-R5: GTCCACGCTCTATACACTCCTCCAC 6
4 Capnocytophaga ochracea Co-F1: GACCCCGAGCACGAAGATTTTG 7 139 72 2fg/37.2
Co-R1: CCCCTGGTGAACGGTGTAACTGC 8
5 Capnocytophaga sputigena Cspu-F2: CACCGACCCTGAGCACGAA 9 156 68 2fg/35.0
Cspu-R2: TGACCGAAGAATACCCCAGGA 10
6 Fusobacterium necrophorum Fnc-F11: TGGAGCCGGGAGATATTTTGGTC 11 150 72 2fg/33.8
Fnc-R11: TTCCTTTTGATCCGTGAGGCATAC 12
7 Fusobacterium nucleatum Fn-F1: ACCTAAGGGAGAAACAGAACCA 13 171 66 20fg/37.7
Fn-R1: CCTGCCTTTAATTCATCTCCAT 14
8 Fusobacterium periodonticum Fp-F2: TTGCTGAAAAACGTAAGATAACTGTA 15 88 65 2fg/32.3
Fp-R2: TCTGCAGGTAATACTCTTGAAACA 16
9 Fusobacterium simiae Fsi-F1: AAGAGCAGGGTTTGAAGTAAGAGATGTC 17 115 70 2fg/35
Fsi-R2: AGCATAAGTAGCAAGCGATCCAATAAGC 18
10 Leptotrichia buccalis Lb-F1; GGACAAAATGCACGCCAGAGC 19 132 72 2fg/35.2
Lb-R1; GATGCACCGTAGGCTTCCAATG 20
11 Neisseria meningitidis Nmen-F4; GATGCTGCAACGGATACCACT 21 139 66 20fg/37.7
Nmen-R4; ATGCCGATTTGGATTCAGAT 22
12 Neisseria subflava Nsub-F6; TTGGCTCAATTGGCTGGAA 23 194 62 2fg/32.1
Nsub-R6; GTAATCGTCGTGTTCGTTCTGTG 24
13 Porphyromonas endodontalis Pe-F1: AGCAGAGTTCCGTCGTCGTATTCA 25 130 72 2fg/37.4
Pe-R1: GCGCCCTGCCATCTTGTCTC 26
14 Porphyromonas gingivalis Pg-F: GGAAGAGAAGACCGTAGCACAAGGA 27 143 72 2fg/37.3
Pg-R: GAGTAGGCGAAACGTCCATCAGGTC 28
15 Prevotella baroniae Pba-F4; GAAGATACGGGCGAAGTGGTGTCC 29 148 72 2fg/36.8
Pba-R4; ACTTATTAGCTGCTTCGGCGTCCTTG 30
16 Prevotella bivia Pbi-F1; CTGCGCTTGGTCCTGGTGGTT 31 105 72 2fg/33.4
Pbi-R1; CTTCAGGCGACTCAATAGGACACAAA 32
17 Prevotella corporis Pco-F3; TGGAGCAGAGCGTGTTGTTGTTTCA 33 108 72 2fg/37.8
Pco-R3; GGAATGATGCGGGCACTGTAAAGC 34
18 Prevotella disiens Pdi-F2; AAAGACCCAAGCCACTCAGAA 35 145 68 2fg/31.5
Pdi-R2; CTACTTCGCCAAGGTCATAACG 36
19 Prevotella intermedia Pi-F4; TTCGGAGACAAGGCAGGTGAT 37 117 70 20fg/33.4
Pi-R4; CTTGCTTTCGCGTGTCTTGATA 38
20 Prevotella marshii Pmh-F1; TGGCACAAATCCGTTATCACAA 39 98 70 2fg/38.5
Pmh-R1; AAAGGCCACCAGGACCAAGA 40
21 Prevotella melaninogenica Pm-F3; TGACCGTAAGAAGAAGTTGCCTGTA 41 141 71 2fg/37.1
Pm-R3; TTGCGACCGATAGCTGCCTTCATA 42
22 Prevotella nigrescens Pn-F1: CTCCACAGCAAATAGCCTCAGTA 43 150 72 2fg/33
Pn-R1: TTTCCAAACCGGTCCCTACAATA 44
23 Prevotella oralis Poral-F3; GTTACAACATTACTGCGTGCTATCGGG 45 130 72 2fg/37.1
Poral-R3; TTGCGGCGAGTCTTCTTCCCAC 46
24 Prevotella oris Pori-F1; AGAAGTTGGGGCTCGACACAGAC 47 141 72 2fg/31.9
Pori-R1; GCACACGGCGGTTACTCAAG 48
25 Prevotella oulorum Pou-F; TGAGCGCAACGAGGTGATTA 49 129 70 20fg/30.9
Pou-R; ATGGTGTATTTGCTTGCTGACTCG 50
26 Prevotella pallens Ppa-F2; TGCGTAATGCTGATGCTGCC 51 97 70 2fg/34
Ppa-R2; CGTCCTACTTCGCCTAAATCG 52
27 Prevotella veroralis Pv-F2; ACGATGCTCCGATTGTTGGT 53 86 68 2fg/34.4
Pv-R2; TACACCTTCACCTTCAGCCATAAT 54
28 Selenomonas noxia Sn-F5: GAGCGCAAAGGACTCAAAGGAA 55 115 72 2fg/36.3
Sn-R6: GCGCAGGAGCTATCAGTGGTTTC 56
29 Streptococcus constellatus Scon-F4; TTCCCGTATCGTTCCAGTTGAG 57 142 69 2fg/34.1
Scon-R4; GTTGCGAGCAGCCATACCA 58
30 Streptococcus intermidius Sin-F4; GGTATCCACATTGCAACGCCAGTC 59 138 72 2fg/34.6
Sin-R1; ACGGTTATCAAACGGTTCGCCA 60
31 Streptococcus oralis Sor-F2; GTTGACAGCCGATGAAGAAGATGAA 61 81 68 2fg/33.4
Sor-R2; TTCTCAGCAAAAGTACCGTCCTCG 62
32 Streptococcus sanguinis Ssa-F2; CGTGAAGATCTTTACCCGTGCT 63 135 68 2fg/36.6
Ssa-R2; ACCCCCTTGTTTCCGTGAC 64
33 Veillonella parvula Vp-F2; GAACGTTTGTTGCGTGCTATTTTTGGT 65 128 72 2fg/33.1
Vp-R2; TCGTCGCCATTTTCACGGGTAA 66
34 Actinomyces naeslundii An-F3; CTGCTGCTGACATCGCCGCTCGTA 67 144 72 2fg/37.6
An-R3; TCCGCTCGCGCCACCTCTCGTTA 68
35 Campylobacter rectus Cr-F2; GGTTTGGGCGCTTGAGGCATAC 69 146 70 20fg/34.9
Cr-R2; ACGTCTCGGGGATACCTGTTTCA 70
36 Eikenella corrodens Ec-F7; GGCTACCTGAAGGGCGATTTGATTAC 71 120 72 2fg/34.3
Ec-R7; CGAGGCGGCTACGGATACCACT 72
37 Neisseria sicca Nsi-F7; GCGTTACTTTACCTACCAACACATCACCT 73 111 72 20fg/34.7
Nsi-R7; GCGATATTCCGAACTTGTCCGAG 74
38 Porphyromonas asaccharolytica Pas-F2; GAGCCAATCGTAAGGGAGGTAT 75 150 72 200fg/34.8
Pas-R2; AGTCCGTTGCCGTGGTCTTGTG 76
39 Prevotella buccae Pbca-F2; CCGCCTGCCGAAGTGGACA 77 75 70 2fg/35.2
Pbca-R2; GAAAGGAATCAGACCGGCAGAGACT 78
40 Prevotella buccalis Pbcl-F2; TGGTGCTTCGACGCTCCTGTTA 79 142 68 2fg/35.2
Pbcl-R2; TTCGGCATTACGCAACTGACG 80
41 Rothia dentocariosa Rd-F8; CTGGGCAAAGCGTCTGGAAAAC 81 106 70 2fg/36.4
Rd-R8; GAAATCACGAATCGGGGAAATCTC 82
42 Streptococcus anginosus San-F9; GGTGCAGGGGTTGTCCGTGAT 83 137 72 2fg/33
San-R9; CGTCCAGCCATCTTATCCCCAACA 84
43 Tannerella forsythia Tf-F2; GGATTGACCACCGGCGAAGACA 85 134 72 2fg/35.4
Tf-R2; CGGACACGACGGTTACTCAAATGG 86
44 Treponema denticola Td-F2; CGGGCGTGCATCTTGTCGTCTAC 87 93 72 2fg/38.2
Td-R2; CTTAACCGGCCGCCTCTTTGAA 88
본 발명에서 구강 세균감염성질환으로는 치주질환, 치은염, 치아우식증, 치수염 및 치근관질환, 치근단질환, 악골 골수염 등을 모두 포함할 수 있다.
또한, 본 발명은 rpoB 유전자의 뉴클레오티드 서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 조성물을 제공한다.
또한, 본 발명은 rpoB 유전자의 뉴클레오티드 서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 키트를 제공한다.
상기 구강 세균감염성질환 원인균 검출용 조성물 또는 키트에 포함되는 프라이머용어에 대해서는 앞서 기술된 바와 같으며, 바람직하게 상기 프라이머는 서열번호 1 내지 서열번호 88의 염기서열 또는 이들 염기 서열에 각각 상보적인 염기서열로 구성되는 군에서 적어도 하나 이상 선택되는 뉴클레오티드로 구성될 수 있다.
본 발명의 구강 세균감염성질환 원인균 검출용 키트가 만일 PCR 증폭 과정에 적용되는 경우, 본 발명의 키트는 선택적으로, PCR 증폭에 필요한 시약, 예컨대, 완충액, DNA 중합효소(예컨대, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis 또는 Pyrococcus furiosus(Pfu)로부터 수득한 열 안정성 DNA 중합효소), DNA 중합 효소 조인자 및 dNTPs를 포함할 수 있으며, 본 발명의 구강 세균감염성질환 원인균 검출용 키트가 면역 분석에 적용되는 경우, 본 발명의 키트는 선택적으로, 이차항체 및 표지의 기질을 포함할 수 있다. 나아가, 본 발명에 따른 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.
또한, 본 발명은 rpoB 유전자의 뉴클레오티드 서열에 대하여 상보적인 서열을 갖는 구강 세균감염성질환 원인균 검출용 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 마이크로어레이를 제공한다.
본 발명의 마이크로어레이에 있어서, 상기 프라이머는 혼성화 어레이 요소(hybridizable array element)로서 이용되며, 기질(substrate) 상에 고정화된다. 바람직한 기질은 적합한 견고성 또는 반-견고성 지지체로서, 예컨대, 막, 필터, 칩, 슬라이드, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함할 수 있다. 상기 혼성화 어레이 요소는 상기 기질 상에 배열되고 고정화되며, 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 수행될 수 있다. 예를 들어, 상기 혼성화 어레이 요소는 에폭시 화합물 또는 알데히드기를 포함하도록 변형된 글래스 표면에 결합될 수 있고, 또한 폴리라이신 코팅 표면에서 UV에 의해 결합될 수 있다. 또한, 상기 혼성화 어레이 요소는 링커(예: 에틸렌 글리콜 올리고머 및 디아민)를 통해 기질에 결합될 수 있다.
한편, 본 발명의 마이크로어레이에 적용되는 시료가 핵산일 경우에는 표지(labeling)될 수 있고, 마이크로어레이상의 어레이 요소와 혼성화 될 수 있다. 혼성화 조건은 다양할 수 있으며, 혼성화 정도의 검출 및 분석은 표지 물질에 따라 다양하게 실시될 수 있다.
따라서 본 발명에서는 구강 세균감염성 질환 원인균의 존재 유무를 진단할 수 있도록 상술한 프라이머와 표적 샘플 사이의 교잡 반응 및/또는 증폭 반응에 의하여 표적 샘플의 구강 세균감염성 질환 원인균의 감염 여부를 확인할 수 있다.
이에 본 발명은 rpoB 유전자의 폴리뉴클레오티드 서열에 대하여 특이적으로 결합하는 구강 세균감염성질환 원인균 검출용 프라이머를 이용한 중합효소연쇄반응(Polymerase chain reaction, PCR) 또는 프로브로 이용되어 마이크로어레이(microarray)로 구강 세균감염성질환 원인균를 탐지하는 단계를 포함하는 구강 세균감염성질환 원인균의 검출 방법을 제공한다.
상기 중합효소연쇄반응(PCR)은 당업계에 알려진 여러 종류의 PCR 방법을 모두 포함하는 것으로, 일반 PCR 방법을 비롯하여, 정량적 결과 도출이 가능한 정량 실시간 PCR(quantitative real-time PCR, qRT-PCR) 기법을 모두 포함한다.
본 발명의 일실시예에서는 구강 세균감염성 질환 원인균이 되는 세균 종 중 상기 44종류에 대한 종-특이적 및 정략적 검출효과를 확인하였다.
일 예로써, A. actinomycetemcomitans를 들어 설명한다.
A. actinomycetemcomitans의 프라이머로 본 발명자들이 설계한 Aa3-F/Aa3-R 프라이머는 일반 PCR 결과, 함께 실험한 다른 구강 내 다른 세균 종들에서 와는 달리, A. actinomycetemcomitans 균주에서만 PCR 증폭물들을 확인할 수 있어, 상기 프라이머를 통해 A. actinomycetemcomitans 종을 특이적으로 검출할 수 있음을 확인하였다. 또한, qRT-PCR을 추가적으로 시행하여, 본 발명에 따른 상기 프라이머를 통해 A. actinomycetemcomitans 유전체 DNA를 4 fg까지 종-특이적으로 검출할 수 있음을 확인하였는 바, Aa3-F/Aa3-R 프라이머 쌍은 qRT-PCR법에 의해 A. actinomycetemcomitans 1.7 균주에 해당하는 세균 유전체 DNA까지도 검출이 가능한 탁월한 민감도를 지니고 있음을 알 수 있었다(실시예 1 참조).
또한, 또 다른 예로써, 구강 감염성질환 원인균인 P. gingivalis 종의 프라이머인 Pg-F/Pg-R 프라이머를 이용한 PCR 실험 결과, 상기 A. actinomycetemcomitans 균주에서와 동일하게, 일반 PCR 결과 P. gingivalis 종에서만 PCR 증폭물이 발견되어, 종-특이적임을 확인할 수 있었으며, qRT-PCR을 통해서는 P. gingivalis 1.6 균주에 해당하는 세균 유전체 DNA까지도 검출이 가능함을 역시 알 수 있었다(실시예 2 참조).
이렇듯, 본 발명에 따른 프라이머들은 PCR 방법을 통해 종-특이적으로 특정 구강 세균감염성질환 원인균만을 검출할 수 있는 특성을 지녀, 일반적으로 당업계에 알려진 PCR 방법을 통해 검체에 존재하는 특정 세균들의 존재여부를 효과적으로 확인할 수 있을 뿐만 아니라, 특별히 정량 실시간 PCR 방법을 통해서는 매우 뛰어난 민감도, 즉 특정한 한 균주에 해당하는 세균 유전체 DNA까지도 검출이 가능한, 월등한 효과의 구강 세균감염성질환의 원인균 검출 시스템 및 방법을 제공할 수 있다.
이하, 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
<실시예>
세균 및 세균 배양
본 실시예에서 사용된 균주들은 하기 표 3에 나타내었다. 이들 균주들은 ATCC(American Type Culture Collection, USA), CCUG(Culture Collection, University of G, Sweden) 및 KCTC(Korean Collection for Type Cultures, Biological Resource Center, Korea)에서 구입하여 사용하였다. 그리고, 한국인에서 분리된 임상균주들은 한국구강미생물자원은행(KCOM : Korean Collection for Oral Microbiology, Gwangju, Korea)에서 분양받아 사용하였다.
표 3
No Species strains No Species strains
1 Actinomyce naeslundii CCUG35333T 38 Streptococcus constellatus ATCC27823T
2 Aggregatibacter actinomycetemcomitans ATCC33384T 39 Streptococcus intermedius KCTC3268T
3 Atopobium rimae KCTC5749T 40 Streptococcus oralis CCUG13229T
4 Campylobacter rectus ATCC33238T 41 Streptococcus sanguinis CCUG17826T
5 Capnocytophaga gingivalis ATCC33624T 42 Tannerella forsythia ATCC43037T
6 Capnocytophaga ochracea KCTC5787T 43 Treponema denticola ATCC35405T
7 Capnocytophaga sputigena KCTC5789T 44 Veillonella parvula KCTC5019T
8 Eikenella corrodens KCOM 1378 45 Actinomyces georgiae CCUG32935T
9 Fusobacterium necrophorum ATCC25286T 46 Actinomyce sisraelii ATCC12102T
10 Fusobacterium nucleatum ATCC25586T 47 Actinomyces meyeri CCUG21024T
11 Fusobacterium periodonticum ATCC33693T 48 Actinomyces odontolyticus CCUG20536T
12 Fusobacterium simiae CCUG16798T 49 Atopobium parvulum KCTC3663T
13 Leptotrichia buccalis CCUG34316T 50 Eubacterium limosum KCTC2487T
14 Neisseria meningitidis ATCC13077T 51 Filifactor alocis ATCC35896T
15 Neisseria sicca ATCC29256T 52 Fusobacterium canifelinum CCUG49733T
16 Neisseria subflava ATCC49275T 53 Gemella haemolysans KCOM 1381
17 Porphyromonas asaccharolytica KCTC5471T 54 Haemophilus aphrophilus ATCC33389T
18 Porphyromonas endodontalis ATCC35406T 55 Haemophilus parainfluenzae ATCC33392T
19 Porphyromonas gingivalis ATCC33277T 56 Haemophilus paraphrophilus ATCC29242T
20 Prevotella baroniae CCUG50418T 57 Neisseria mucosa ATCC19696T
21 Prevotella bivia ATCC29303T 58 Prevotella brevis ATCC19188T
22 Prevotella buccae ATCC33574T 59 Prevotella dentalis ATCC49559T
23 Prevotella buccalis CCUG15557T 60 Prevotella denticola CCUG29542T
24 Prevotella corporis ATCC33547T 61 Prevotella enoeca ATCC51261T
25 Prevotella disiens CCUG9558T 62 Prevotella heparinolytica ATCC35895T
26 Prevotella intermedia ATCC25611T 63 Prevotella loescheii ATCC15930T
27 Prevotella marshii CCUGE9.34T 64 Prevotella ruminicola ATCC19189T
28 Prevotella melaninogenica ATCC25845T 65 Propionibacterium acnes KCTC3314T
29 Prevotella nigrescens ATCC33563T 66 Propionibacterium propionicum KCTC5342T
30 Prevotella oralis ATCC33269T 67 Selenomonas artemidis KCTC5742T
31 Prevotella oris CCUG15405T 68 Streptococcus gordonii CCUG33482T
32 Prevotella oulorum ATCC43324T 69 Streptococcus mitis KCTC3556T
33 Prevotella pallens ATCC700821T 70 Streptococcus mutans ATCC25175T
34 Prevotella veroralis ATCC33779T 71 Streptococcus parasanguinis CCUG30417T
35 Rothia dentocariosa KCTC3204T 72 Streptococcus pneumoniae CCUG28588T
36 Selenomona snoxia KCTC5749T 73 Streptococcus sobrinus ATCC33478T
37 Streptococcus anginosus ATCC700231T 74 Veillonella dispar KCOM 1301
A. actinomycetemcomitans 균주들은 0.6% yeast extract, 5% horse serum, 75㎍/ml bacitracin 및 5㎍/ml vancomycin(Sigma, USA)이 첨가된 tryptic soy broth(TSB, Difco Laboratories, USA) 배지에서 배양하였다. Haemophilus spp. 균주들은 0.5% yeast extract, 0.5 mg/ml hemin 및 2 ㎍/ml vitamin K1가 첨가된 TSB 배지에서 배양하였고, 연쇄상구균들은 Todd Hewitt broth(TH broth, Difco Diagnostics)배지에서 배양하였다. 그 외 균주들은 TSB(trypticase soy broth)에 0.5% yeast extract, 0.05% cysteine HCl-H2O, 0.5 ㎎/㎖ hemin 및 2 ㎍/㎖ vitamin K1가 첨가된 배지에 배양하였다.
Haemophilus spp. 및 Streptococcus spp. 균주들은 37℃ 호기성 세균배양기(ThermoForma, USA)에서 배양하였으며, 그 외 모든 균주들은 85% N2, 10% CO2, 5% H2가 공급되는 37℃ 혐기성 세균배양기(Bactron I, Sheldon Manufacturing Inc., USA)에서 배양하였다.
세균 지놈 DNA 추출
세균의 지놈 DNA들은 G-spinTM Genomic DNA Extraction Kit(iNtRON Co., Seoul, Korea)를 이용하여 제조회사의 지시에 따라 추출하였다. 즉, 세균 배양액 1.5 ㎖를 10,000×g의 원심력을 이용하여 세균을 수확한 다음 50 ㎕의 Pre-incubation solution과 3 ㎕의 lysozyme solution을 넣고 잘 혼합한 다음 37℃에서 1시간 동안 배양하였다. 여기에 250 ㎕의 G-buffer solution을 넣고 잘 혼합한 다음 65℃에서 15분간 반응시키고, 250 ㎕의 Binding solution을 넣고 잘 혼합한 다음 vortexing하였다. 이러한 cell lysates를 G-spinTM column에 넣고 13,000rpm에서 1분간 원심분리하였다. Column에 500㎕의 washing buffer A를 넣고 다시 1분간 원심분리하였다. 여기에 500 ㎕의 washing buffer B를 넣고 다시 1분간 원심분리하고, G-spinTM column을 새로운 eppendorf tube에 넣고 100 ㎕의 elution buffer를 넣고 1분간 실온에 방치한 다음 13,000rpm에서 1분간 원심분리하였다.
실시예 1 : 본 발명에 따른 프라이머를 이용한 A. actinomycetemcomitans 의 검출
본 발명자들은 구강 세균감염성질환의 주요한 병원성 세균 중 하나인 A. actinomycetemcomitans의 종 수준에서의 정량적 검출을 위한 종-특이적 프라이머를 개발하기 위하여 다음과 같이 수행하였다.
1-1. A. actinomycetemcomitans 의 종 특이적 프라이머의 설계
A. actinomycetemcomitans의 rpoB 핵산염기서열(GenBank accession no. AY362930)을 바탕으로 PrimerSelect 프로그램(DNASTAR Inc., USA)을 이용하여 본 발명에 따른 종-특이적 프라이머를 설계하였으며, 프라이머 서열은 하기 표 4에 나타내었다. PCR 증폭물의 크기는 113 bp이었다.
표 4 프라이머 서열
프라이머 프라이머 서열 서열번호
forward primer(Aa3-F) 5'-GGC GAG CCT GTA TTT GAT GTG CG-3' 1
reverse primer(Aa3-R) 5'-GTG CCC GGT GCT GCG TCT TTG-3' 2
1-2. A. actinomycetemcomitans 에 대한 프라이머의 종-특이성 검증
(1) 일반적인 PCR 방법을 통한 분석
Aa3-F/Aa3-R 프라이머의 A. actinomycetemcomitans에 대한 종-특이성을 우선 일반적인 PCR 방법으로 테스트하였다. PCR은 AccuPower PCR PreMix(Bioneer) 및 MyGenie TM 96 Gradient Thermal Block(Bioneer)을 이용하여 실시하였다.
먼저, PCR 반응 혼합용액이 20 ㎕가 되도록 20 pmoles씩의 Aa3-F/Aa3-R 프라이머와 4 ng의 세균 유전체 DNA를 넣고 95℃에서 10분간 predenaturation, 95℃에서 10초간 denaturation, 72℃에서 30초간 annealing과 extension 과정을 30회 시행하였다. PCR이 끝난 후 20㎕의 반응물 중 10㎕를 Tris-acetate buffer(0.04M Tris-acetate, 0.001M EDTA, pH 8.0)를 전해질로 사용하고 1.5% 아가로스 젤을 매질로 이용하여 100V에서 15분간 전기영동하였다. 증폭물을 ethidium bromide로 염색하여 UV transilluminator로 발색 여부를 확인하였다.
A. actinomycetemcomitans의 검출을 위해 설계된 본 발명에 따른 프라이머(Aa3-F/Aa3-R)의 종-특이성을 일반적인 PCR법으로 조사한 결과, 하기 표 5에 나타낸 바와 같이, A. actinomycetemcomitans 균주(참고균주 3주 및 임상균주 6주)에서만 113bp의 PCR 증폭물을 모두 확인할 수 있었고 3종(8균주)의 Haemophilus spp. 및 구강 내 다른 세균 종(40 종 40균주)에서는 PCR 증폭물은 확인되지 않았다.
표 5 Aa3-F/Aa3-R 프라이머의 종-특이성 결과
Genus and species(no. of strains tested /no. species) rpoB
Aggregatibacter atinomycetemcomitans (9/1) +
Haemophilus spp. (8/3) -
Neisseria spp. (4/4) -
Actinomyces spp. (5/5) -
Porphyromonas spp. (2/2) -
Prevotella spp. (2/2) -
Tannerella forsythia (1/1) -
Campylobacter rectus (1/1) -
Capnocytophaga spp. (3/3) -
Propionibacterium spp. (2/2) -
Eubacterium limosum (1/1) -
Rothia dentocariosa (1/1) -
Selenomonas spp. (2/2) -
Fusobacterium spp. (5/5) -
Leptotrichia buccalis (1/1) -
Streptococcus spp. (11/11) -
Veillonella parvula (1/1) -
(2)qRT-PCR 방법을 통한 분석
qRT-PCR은 바이오니아사(Bionner, Korea)의 AccuPower GreenStarTM qPCR PreMix 및 Exicycler TM 96 Real-Time Quantitative Thermal Block를 사용하여 실시하였다.
PCR PreMix에 forward 및 reverse 프라이머 각각 60 pmoles와 세균 유전체 DNA를 PCR 튜브에 넣고, PCR PreMix kit에 동봉된 DEPC water를 넣어 최종 반응물이 50㎕가 되도록 한 후 충분히 voltexing하였다. qRT-PCR 조건은 95℃에서 10분간 predenaturation 시행한 후 95℃에서 10초간 denaturation, 72℃에서 30초간 annealing과 extension하고, scanning하는 과정을 45회 반복하였다. 반응 특이성은 60℃에서 94℃까지 1℃/sec로 온도를 서서히 올렸을 때 형광의 세기를 측정하여 나타낸 melting curve 분석을 통해 확인하였다.
A. actinomycetemcomitans의 검출을 위해 설계된 Aa3-F/Aa3-R 프라이머의 민감도(sensitivity)를 조사하기 위해, A. actinomycetemcomitans ATCC 33384T의 유전체 DNA를 40 ng부터 4 fg까지 10단계씩 희석해 qRT-PCR을 수행하여 Standard curve와 최소검출한도를 측정하였다.
그 결과, Aa3-F/Aa3-R 프라이머는 A. actinomycetemcomitans ATCC 33384T의 유전체 DNA 4 fg까지 검출되는 것을 확인할 수 있었다(표 6, 도 1)
표 6 A. actinomycetemcomitans ATCC 33384T의 CT 값
Genomic DNA amount Cell number corresponding to genomic DNA amount CT
40 ng 1.7 x 107 11.43
4 ng 1.7 x 106 14.47
400 pg 1.7 x 105 17.91
40 pg 1.7 x 104 21.15
4 pg 1.7 x 103 24.61
400 fg 1.7 x 102 28.42
40 fg 1.7 x 101 31.63
4 fg 1.7 x 100 36.13
0 0 ND
상기와 같은 결과들을 통해, 본 발명에서 설계된 Aa3-F/Aa3-R 프라이머는 qRT-PCR에 의해 A. actinomycetemcomitans 유전체 DNA를 4fg까지 종-특이적으로 검출할 수 있음을 알 수 있었다. A. actinomycetemcomitans의 세균 유전체 크기가 2.1 Mb인 점을 고려하면, Aa3-F/Aa3-R 프라이머 쌍은 qRT-PCR법에 의해 A. actinomycetemcomitans 1.7 마리에 해당하는 세균 유전체 DNA까지도 검출이 가능하다는 것을 의미한다.
실시예 2: 본 발명에 따른 프라이머를 이용한 P. gingivalis 의 검출
본 발명자들은 구강 세균감염성질환의 주요한 병원성 세균 중 하나인 P. gingivalis의 종 수준에서의 정량적 검출을 위한 종-특이적 프라이머를 개발하기 위하여 다음과 같이 수행하였다.
2-1. P. gingivalis 의 종-특이적 프라이머의 설계
P. gingivalis(GenBank accession no. NC_010729)의 rpoB 핵산염기서열을 바탕으로 PrimerSelect 프로그램(DNASTAR Inc., USA)을 이용하여 종-특이적 프라이머 쌍을 설계하였으며, 프라이머 서열은 하기 표 7에 나타내었다. PCR 증폭물의 크기는 143 bp이었다.
표 7 프라이머 서열
프라이머 프라이머 서열 서열번호
forward primer(Pg-F) 5'-GGA AGA GAA GAC CGT AGC ACA AGG A-3' 27
reverse primer(Pg-R) 5'-GAG TAG GCG AAA CGT CCA TCA GGT C-3' 28
2-2 P. gingivalis 에 대한 프라이머의 종-특이성 검증
(1) 일반적인 PCR 방법을 통한 분석
본 발명에 따른 프라이머(Pg-F/Pg-R)의 P. gingivalis에 대한 종-특이성을 우선 일반적인 PCR 방법으로 테스트하였다. PCR은 5 nmole deoxynucleoside triphosphate, 0.8μmole KCl, 0.2μmole Tris-HCl(pH 9.0), 0.03μmole MgCl2 및 1 unit Taq DNA polymerase를 포함하는 AccuPower PCR PreMix(Bioneer, Korea)를 이용하여 실시하였다.
PCR 반응 혼합용액이 20 ㎕가 되도록 PCR PreMix 튜브에 4 ng의 세균 유전체 DNA와 20 pmoles씩의 Pg-F/Pg-R 프라이머를 넣고, Peltier thermal cycler(Model PTC-200 DNA EngineTM, MJ Research Inc., USA)를 사용하여 95℃에서 10분간 초기 변성(initial denaturation)시키고, 95℃에서 30초간 변성(denaturation), 72℃에서 30초간 어닐링(annealing) 및 신장(extension) 과정을 30회 반복 수행하였다. PCR이 끝난 후 20 ㎕의 반응물 중 6 ㎕를 Tris-acetate buffer(0.04M Tris-acetate, 0.001M EDTA, pH 8.0)를 전해질로 사용하고 1.5% 아가로스 젤을 매질로 이용하여 100V에서 30분간 전기영동하였다. 증폭물을 ethidium bromide로 염색하여 UV transilluminator로 발색 여부를 확인하였다.
그 결과, 도 2에 나타낸 바와 같이, P. gingivalis의 검출을 위해 설계된 프라이머(Pg-F/Pg-R)의 종-특이성을 일반적인 PCR법으로 P. gingivalis 균주(4균주)와 유전자 레벨에서 P. gingivalis와 가장 밀접하게 관련있는 종인 P. endodontalis를 포함하는 구강 내 다른 세균 종(46균주)에 대해 일반적인 PCR 방법으로 테스트한 결과, PCR 증폭물을 확인할 수 있었다(도 2 참조).
(2) qRT-PCR 방법을 통한 분석
qRT-PCR은 바이오니아사(Bionner, Korea)의 AccuPower GreenStarTM qPCR PreMix 및 Exicycler TM 96 Real-Time Quantitative Thermal Block을 사용하여 실시하였다.
PreMix PCR 튜브에 3㎕씩의 forward 및 reverse 프라이머(최종 농도는 각각 500nM)와, 5 ㎕의 세균 유전체 DNA를 넣은 후, 살균된 DNase-RNase-free water를 넣어 최종 반응물이 50 ㎕가 되도록 한 후 충분히 voltexing하였다. qRT-PCR 조건은 95℃에서 10분간 initial denaturation 시행한 후 95℃에서 10초간 denaturation, 72℃에서 30초간 annealing 및 extension하는 과정을 40회 반복하였으며, 25℃에서 1분간 냉각시켰다. 반응 특이성은 65℃에서 94℃까지 1℃/sec로 온도를 서서히 올렸을 때 형광의 세기를 측정하여 나타낸 melting curve 분석을 통해 확인하였다.
P. gingivalis의 검출을 위해 설계된 Pg-F/Pg-R 프라이머의 민감도(sensitivity)를 조사하기 위해, P. gingivalis ATCC 33277T의 유전체 DNA를 4 ng부터 4 fg까지 10단계씩 희석해 qRT-PCR을 수행하여 Standard curve와 최소검출한도를 측정하였다.
그 결과, Pg-F/Pg-R 프라이머는 P. gingivalis ATCC 33277T의 유전체 DNA 4 fg까지 검출되는 것을 확인할 수 있었다(표 8, 도3 참조). P. gingivalis ATCC 33277T의 게놈 사이즈는 2.35Mb이고, Pg-F/Pg-R 프라이머는 1.6의 P. gingivalis 유전체를 검출할 수 있다(표 8 참조).
표 8 P. gingivalis ATCC 33277T의 CT 값
Genomic DNA amount Cell number corresponding to DNA amout CT
4 ng 1.6 x 106 14.66
400 pg 1.6 x 105 18.57
40 pg 1.6 x 104 22.35
4 pg 1.6 x 103 26.19
400 fg 1.6 x 102 29.93
40 fg 1.6 x 101 33.54
4 fg 1.6 x 100 38.46
0 0 ND
상기와 같은 결과들을 통해, 본 발명에서 설계된 Pg-F/Pg-R 프라이머는 qRT-PCR에 의해 P. gingivalis 유전체 DNA를 4fg까지 종-특이적으로 검출할 수 있음을 알 수 있었다. P. gingivalis의 세균 유전체 크기가 2.35 Mb인 점을 고려하면, Pg-F/Pg-R 프라이머 쌍은 qRT-PCR법에 의해 P. gingivalis 1.6 균주에 해당하는 세균 유전체 DNA까지도 검출이 가능하다는 것을 의미한다.
실시예 3 ~ 44 : 다양한 구강 세균감염성질환의 병원성 세균 검출
상기 실시예 1 및 2와 유사한 방법을 이용하여, 본 발명의 프라이머를 이용한 하기 병원성 세균들에 대해서 검출하였다. 이들의 결과에 대해서는 각각 도 3 ~ 45에 나타내었다.
표 9
세균 종 이름 실시예 프라이머 서열목록
Atopobium rimae 실시예3 3
4
Capnocytophaga gingivalis 실시예4 5
6
Capnocytophaga ochracea 실시예5 7
8
Capnocytophaga sputigena 실시예6 9
10
Fusobacterium necrophorum 실시예7 11
12
Fusobacterium nucleatum 실시예8 13
14
Fusobacterium periodonticum 실시예9 15
16
Fusobacterium simiae 실시예10 17
18
Leptotrichia buccalis 실시예11 19
20
Neisseria meningitidis 실시예12 21
22
Neisseria subflava 실시예13 23
24
Porphyromonas endodontalis 실시예14 25
26
Prevotella baroniae 실시예15 29
30
Prevotella bivia 실시예16 31
32
Prevotella corporis 실시예17 33
34
Prevotella disiens 실시예18 35
36
Prevotella intermedia 실시예19 37
38
Prevotella marshii 실시예20 39
40
Prevotella melaninogenica 실시예21 41
42
Prevotella nigrescens 실시예22 43
44
Prevotella oralis 실시예23 45
46
Prevotella oris 실시예24 47
48
Prevotella oulorum 실시예25 49
50
Prevotella pallens 실시예26 51
52
Prevotella veroralis 실시예27 53
54
Selenomonas noxia 실시예28 55
56
Streptococcus constellatus 실시예29 57
58
Streptococcus intermidius 실시예30 59
60
Streptococcus oralis 실시예31 61
62
Streptococcus sanguinis 실시예32 63
64
Veillonella parvula 실시예33 65
66
Actinomyces naeslundii 실시예34 67
68
Campylobacter rectus 실시예35 69
70
Eikenella corrodens 실시예36 71
72
Neisseria sicca 실시예37 73
74
Porphyromonas asaccharolytica 실시예38 75
76
Prevotella buccae 실시예39 77
79
Prevotella buccalis 실시예40 78
80
Rothia dentocariosa 실시예41 81
82
Streptococcus anginosus 실시예42 83
84
Tannerella forsythensis 실시예43 85
86
Treponema denticola 실시예44 87
88
qRT-PCR을 수행하여 얻은 각 프라이머의 Standard curve 및 최소검출한도는 도 3에서 도 45에 나타나 있는 바와 같다.
특히, 설계된 종-특이 qRT-PCR 프라이머의 각 세균종의 지놈 DNA에 대한 CT 값 (민감도 측정 결과)은 다음과 같이 나타났다.
표 10
순번 세균 종 이름 Genomic DNA amount
2 ng 200 pg 20 pg 2 pg 200 fg 20 fg 2 fg 0
1 Actinomyces naeslundii 16.5 19.6 23.1 26.5 30.0 33.6 37.6 0
2 Aggregatibacter actinomycetemcomitans 15.1 18.5 21.8 25.0 28.5 31.7 35.3 0
3 Atopobium rimae 17.6 21.0 24.9 29.5 33.4 37.98 ND 0
4 Campylobacter rectus 18.7 21.9 25.3 28.6 32.5 34.9 ND 0
5 Capnocytophaga gingivalis 11.9 15.0 18.5 21.7 25.0 28.4 32.0 0
6 Capnocytophaga ochracea 15.5 18.9 22.6 26.1 29.3 33.1 37.2 0
7 Capnocytophaga sputigena 13.7 16.8 20.1 23.4 26.7 30.3 33.7 0
8 Eikenella corrodens 14.9 18.3 21.5 25.0 28.7 32.4 34.3 0
9 Fusobacterium necrophorum 11.1 15.0 18.7 22.3 26.3 30.1 33.8 0
10 Fusobacterium nucleatum 15.1 20.2 24.6 29.5 33.8 37.7 ND 0
11 Fusobacterium periodonticum 12.3 16.6 19.1 22.5 26.3 30.0 32.3 0
12 Fusobacterium simiae 13.8 17.1 20.6 23.9 27.6 31.4 35.0 0
13 Leptotrichia buccalis 13.3 17.0 20.3 24.0 27.7 31.6 35.2 0
14 Neisseria meningitidis 23.3 26.6 29.9 33.2 36.0 37.7 ND 0
15 Neisseria sicca 17.6 21.5 24.8 28.4 31.8 34.7 ND 0
16 Neisseria subflava 17.3 20.3 23.4 27.0 30.2 31.1 32.1 0
17 Porphyromonas asaccharolytica 21.1 22.9 27.3 30.9 34.8 ND ND 0
18 Porphyromonas endodontalis 15.1 18.0 21.3 25.2 29.1 33.0 37.4 0
19 Porphyromona gingivalis 15.9 19.5 23.4 26.3 29.8 33.6 37.3 0
20 Prevotella baroniae 16.6 20.2 24.1 27.4 30.9 35.0 36.8 0
21 Prevotella bivia 15.1 18.6 22.1 25.4 29.3 32.2 33.4 0
22 Prevotella buccae 15.3 18.7 21.9 25.3 28.6 32.4 35.2 0
23 Prevotella buccalis 14.0 17.3 20.7 24.0 27.6 31.5 35.2 0
24 Prevotella corporis 15.6 19.5 23.2 26.9 30.6 34.3 37.8 0
25 Prevotella disiens 13.8 17.2 20.4 23.9 27.0 29.9 31.5 0
26 Prevotella intermedia 15.3 19.5 23.0 26.7 30.6 33.4 ND 0
27 Prevotella marshii 16.4 20.2 23.5 27.2 31.4 34.9 38.5 0
28 Prevotella melaninogenica 17.1 20.5 24.3 28.0 32.4 35.6 37.1 0
29 Prevotella nigrescens 14.5 18.0 21.3 24.6 28.1 31.2 33.0 0
30 Prevotella oralis 15.5 19.1 22.7 26.1 29.5 33.6 37.1 0
31 Prevotella oris 13.9 17.2 20.5 23.3 27.0 30.5 31.9 0
32 Prevotella oulorum 14.5 17.5 21.0 23.9 27.5 30.9 ND 0
33 Prevotella pallens 13.6 16.8 20.0 23.7 27.0 30.5 34.0 0
34 Prevotella veroralis 15.8 19.1 22.4 25.7 29.2 32.6 34.4 0
35 Rothia dentocariosa 15.7 19.2 22.6 26.4 30.7 35.0 36.4 0
36 Selenomonas noxia 17.8 21.5 25.5 29.7 33.4 35.6 36.3 0
37 Streptococcus anginosus 13.5 16.7 20.3 23.4 27.1 30.8 33.0 0
38 Streptococcus constellatus 15.0 18.4 21.9 25.6 28.9 32.4 34.1 0
39 Streptococcus intermidius 13.0 16.6 20.3 23.9 27.8 31.4 34.6 0
40 Streptococcus oralis 13.0 16.2 19.5 22.8 26.3 29.5 33.4 0
41 Streptococcus sanguinis 15.6 19.1 22.5 26.0 29.4 32.6 36.6 0
42 Tannerella forsythia 15.4 18.4 21.9 25.1 28.8 32.7 35.4 0
43 Treponema denticola 16.3 19.3 22.5 26.0 29.8 33.9 38.2 0
44 Veillonella parvula 14.0 17.3 20.5 24.0 27.4 30.4 33.1 0
ND: not detected
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (10)

  1. rpoB(DNA-directed RNA polymerase subunit beta) 유전자의 폴리뉴클레오티드에 특이적으로 결합하는 구강 세균감염성질환 원인균 검출용 프라이머.
  2. 제1항에 있어서,
    상기 원인균은 Actinomyces naeslundii(CCUG 35333T), Aggregatibacter actinomycetemcomitans(ATCC 33384T), Atopobium rimae(KCTC 5749T), Campylobacter rectus(ATCC 33238T), Capnocytophaga gingivalis(ATCC 33624T), Capnocytophaga ochracea(KCTC 5787T), Capnocytophaga sputigena(KCTC 5789T), Eikenella corrodens(KCOM 1378), Fusobacterium necrophorum(ATCC 25286T), Fusobacterium nucleatum(ATCC 25586T), Fusobacterium periodonticum(ATCC 33693T), Fusobacterium simiae(CCUG 16798T), Leptotrichia buccalis(CCUG 34316T), Neisseria meningitidis(ATCC 13077T), Neisseria sicca(ATCC 29256T), Neisseria subflava(ATCC 49275T), ,Porphyromonas asaccharolytica(ATCC 43037T), Porphyromonas endodontalis(ATCC 35406T), Porphyromonas gingivalis(ATCC 33277T), Prevotella baroniae(CCUG 50418T), Prevotella bivia(ATCC 29303T), Prevotella buccae(ATCC 33574T), Prevotella buccalis(CCUG 15557T), Prevotella corporis(ATCC 33547T), Prevotella disiens(CCUG 9558T), Prevotella intermedia(ATCC 25611T), Prevotella marshii(CCUG E9.34T), Prevotella melaninogenica(ATCC 25845T), Prevotella nigrescens(ATCC 33563T), Prevotella oralis(ATCC 33269TT), Prevotella oris(CCUG 15405T), Prevotella oulorum(ATCC 43324T), Prevotella pallens(ATCC 700821T), Prevotella veroralis(ATCC 33779T), Rothia dentocariosa(KCTC 3204T), Selenomonas noxia(KCTC 5749T), Streptococcus anginosus(ATCC 700231T), Streptococcus constellatus(ATCC 27823T), Streptococcus intermedius(KCTC 3268T), Streptococcus oralis(CCUG 13229T) Streptococcus sanguinis(CCUG 17826T), Tannerella forsythia(ATCC 43037T), Treponema denticola(ATCC 35405T), 및 Veillonella parvula(KCTC 5019T) 로 이루어진 군에서 선택되는 1종 이상인 것을 특징으로 하는 구강 세균감염성질환 원인균 검출용 프라이머.
  3. 제1항에 있어서,
    상기 프라이머는 서열번호 1 내지 서열번호 88의 염기서열 또는 이들 염기서열에 각각 상보적인 염기서열로 구성되는 군에서 적어도 하나 이상 선택되는 폴리뉴클레오티드로 구성되는 것을 특징으로 하는 구강 세균감염성질환 원인균 검출용 프라이머.
  4. 제3항에 있어서,
    상기 프라이머는 하기 표에 기재된 구강 세균감염성질환 원인균을 특이적으로 검출할 수 있는 프라이머 쌍으로 구성되는 것을 특징으로 하는 구강 세균감염성질환 원인균 검출용 프라이머
    표 11 세균 종 이름 프라이머 서열목록 세균 종 이름 프라이머 서열목록 Aggregatibacter actinomycetemcomitans 1 Prevotella oralis 45 2 46 Atopobium rimae 3 Prevotella oris 47 4 48 Capnocytophaga gingivalis 5 Prevotella oulorum 49 6 50 Capnocytophaga ochracea 7 Prevotella pallens 51 8 52 Capnocytophaga sputigena 9 Prevotella veroralis 53 10 54 Fusobacterium necrophorum 11 Selenomonas noxia 55 12 56 Fusobacterium nucleatum 13 Streptococcus constellatus 57 14 58 Fusobacterium periodonticum 15 Streptococcus intermidius 59 16 60 Fusobacterium simiae 17 Streptococcus oralis 61 18 62 Leptotrichia buccalis 19 Streptococcus sanguinis 63 20 64 Neisseria meningitidis 21 Veillonella parvula 65 22 66 Neisseria subflava 23 Actinomyces naeslundii 67 24 68 Porphyromonas endodontalis 25 Campylobacter rectus 69 26 70 Porphyromonas gingivalis 27 Eikenella corrodens 71 28 72 Prevotella baroniae 29 Neisseria sicca 73 30 74 Prevotella bivia 31 Porphyromonas asaccharolytica 75 32 76 Prevotella corporis 33 Prevotella buccae 77 34 78 Prevotella disiens 35 Prevotella buccalis 79 36 80 Prevotella intermedia 37 Rothia dentocariosa 81 38 82 Prevotella marshii 39 Streptococcus anginosus 83 40 84 Prevotella melaninogenica 41 Tannerella forsythia 85 42 86 Prevotella nigrescens 43 Treponema denticola 87 44 88
  5. 제1항에 있어서,
    상기 구강 세균감염성질환은 치주질환, 치은염, 치아우식증, 치수, 치근관질환, 치근단질환 및 악골 골수염으로 이루어진 군 중에서 선택되는 것을 특징으로 하는 구강 세균감염성질환 원인균 검출용 프라이머.
  6. 제1항 내지 제5항 중 어느 한 항에 따른 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 조성물.
  7. 제1항 내지 제5항 중 어느 한 항에 따른 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 키트.
  8. 제1항 내지 제5항 중 어느 한 항에 따른 프라이머를 포함하는 구강 세균감염성질환 원인균 검출용 마이크로어레이.
  9. 제1항 내지 제5항 중 어느 한 항에 따른 프라이머를 이용한 중합효소연쇄반응(Polymerase chain reaction, PCR) 또는 마이크로어레이(microarray)로 구강 세균감염성질환 원인균를 탐지하는 단계를 포함하는 구강 세균감염성질환 원인균의 검출 방법.
  10. 제9항에 있어서,
    상기 PCR은 정량 실시간 PCR(quantitative real-time PCR, qRT-PCR)인 것을 특징으로 하는 구강 세균감염성질환 원인균의 검출방법.
PCT/KR2012/001424 2011-03-29 2012-02-24 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도 Ceased WO2012134063A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20110028406 2011-03-29
KR10-2011-0028406 2011-03-29
KR1020120018161A KR101385733B1 (ko) 2011-03-29 2012-02-22 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
KR10-2012-0018161 2012-02-22

Publications (2)

Publication Number Publication Date
WO2012134063A2 true WO2012134063A2 (ko) 2012-10-04
WO2012134063A3 WO2012134063A3 (ko) 2012-11-29

Family

ID=46932038

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/001424 Ceased WO2012134063A2 (ko) 2011-03-29 2012-02-24 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2012134063A2 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015188178A1 (en) 2014-06-06 2015-12-10 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
CN113924492A (zh) * 2019-05-06 2022-01-11 宝洁公司 使用适配体检测口腔样品中的微生物内毒素
CN114317783A (zh) * 2021-12-08 2022-04-12 上海锐翌医学检验实验室有限公司 龋齿标志微生物及其应用

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ALIYU, S. H. ET AL.: 'Real-time PCR investigation into the importance of Fusobacterium necrophorum as a cause of acute pharyngitis in general practice' JOURNAL OF MEDICAL MICROBIOLOGY. vol. 53, October 2004, pages 1029 - 1035 *
HENSSGE, U. ET AL.: 'Emended description of Actinomyces naeslundii and descriptions of Actinomyces oris sp. nov. and Actinomyces johnsonii sp. no., previously identified as Actinomyces naeslundii genospecies 1, 2 and WVA 963' INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY. vol. 59, March 2009, pages 509 - 516 *
PARK, S. N. ET AL.: 'Development of quantitative real-time PCR primers for the detection of Aggregatibacter actinomycetemcomitans' INTERNATIONAL JOURNAL OF ORAL BIOLOGY. vol. 36, no. L, 31 March 2011, pages 1 - 6 *
PARK, S. N. ET AL.: 'Development ofPorphyromonas gingivalis-specific quantitative real- time PCR primers based on the nucleotide sequence ofrpoB' JOURNAL OF MICROBIOLOGY. vol. 49, no. 2, 03 May 2011, pages 315 - 319 *
TANG, G. ET AL.: 'Direct detection of Actinomyces spp. from infected root canals in a Chinese population: a study using PCR-based, oligonucleotide-DNA hybridization technique' JOURNAL OF DENTISTRY. vol. 31, no. 8, November 2003, pages 559 - 568 *
TRAN-HUNG, L. ET AL.: 'A new method to extract dental pulp DNA: application to universal detection of bacteria' PLOS ONE. vol. 2, no. 10, 24 October 2007, page E1062 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015188178A1 (en) 2014-06-06 2015-12-10 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
EP3151733A4 (en) * 2014-06-06 2018-01-10 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
US10760109B2 (en) 2014-06-06 2020-09-01 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
US11713478B2 (en) 2014-06-06 2023-08-01 The Regents Of The University Of Michigan Compositions and methods for characterizing and diagnosing periodontal disease
CN113924492A (zh) * 2019-05-06 2022-01-11 宝洁公司 使用适配体检测口腔样品中的微生物内毒素
CN114317783A (zh) * 2021-12-08 2022-04-12 上海锐翌医学检验实验室有限公司 龋齿标志微生物及其应用
CN114317783B (zh) * 2021-12-08 2023-07-28 上海锐翌医学检验实验室有限公司 龋齿标志微生物及其应用

Also Published As

Publication number Publication date
WO2012134063A3 (ko) 2012-11-29

Similar Documents

Publication Publication Date Title
KR101385733B1 (ko) 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
Missailidis et al. Distribution of fimA genotypes of Porphyromonas gingivalis in subjects with various periodontal conditions
Chen et al. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples
Gierczyński et al. Intriguing diversity of Bacillus anthracis in eastern Poland–the molecular echoes of the past outbreaks
Siqueira Jr et al. Catonella morbi and Granulicatella adiacens: new species in endodontic infections
Conrads et al. Simultaneous detection of Bacteroides forsythus and Prevotella intermedia by 16S rRNA gene-directed multiplex PCR
Rôças et al. Characterization of Dialister species in infected root canals
Saito et al. Real-time polymerase chain reaction quantification of Porphyromonas gingivalis and Tannerella forsythia in primary endodontic infections
Machado de Oliveira et al. On the use of denaturing gradient gel electrophoresis approach for bacterial identification in endodontic infections
Kato et al. Loop‐mediated isothermal amplification method for the rapid detection of Enterococcus faecalis in infected root canals
WO2020101194A1 (ko) 카바페넴아제 생성 장내세균 진단을 위한 루프 매개 등온증폭 반응용 프라이머 세트 및 이의 용도
Goto et al. Rapid identification of Streptococcus intermedius by PCR with the ily gene as a species marker gene
Hayashi et al. PCR detection of Capnocytophaga species in dental plaque samples from children aged 2 to 12 years
Bahrani-Mougeot et al. Identification of oral bacteria in blood cultures by conventional versus molecular methods
Stubbs et al. Direct detection of Prevotella intermedia and P. nigrescens in suppurative oral infection by amplification of 16S rRNA gene
WO2009093856A2 (ko) 생물학적 의약품으로부터 마이코플라즈마를 검출하기 위한 ｐｃｒ 프라이머 세트 및 이를 포함하는 마이코플라즈마 검출용 키트
Torigoe et al. Detection of Haemophilus influenzae by loop-mediated isothermal amplification (LAMP) of the outer membrane protein P6 gene
Hamzan et al. Simple and rapid detection of Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans by loop-mediated isothermal amplification assay
US20130295557A1 (en) Selective detection of haemophilus influenzae
WO2022114940A1 (ko) 치아 우식증의 진단을 위한 정보제공방법 및 키트
EP3006565B1 (en) Selective detection of bordetella parapertussis
US20090305252A1 (en) Methods and species-specific primers for detection and quantification of Streptococcus mutans and Streptococcus sanguinis in mixed bacterial samples
WO2022244923A1 (ko) 한국인의 치주질환 진단을 위한 정보제공 방법 및 키트
Myriam et al. Detection of Porphyromonas gingivalis and Streptococcus intermedius in chronic periodontitis patients by multiplex PCR
Afanas’ ev et al. Comparative multilocus VNTR and SNP analysis of Bacillus anthracis vaccine strains

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12764350

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12764350

Country of ref document: EP

Kind code of ref document: A2