WO2012126369A1

WO2012126369A1 - Dna, recombinant vector containing the same, cell, composition and use thereof

Info

Publication number: WO2012126369A1
Application number: PCT/CN2012/072724
Authority: WO
Inventors: 樊俊蝶; 蒋立新; 周志文
Original assignee: 北京三诺佳邑生物技术有限责任公司
Priority date: 2011-03-22
Filing date: 2012-03-21
Publication date: 2012-09-27
Also published as: CN104017805A; CN102618535A; CN104017805B; CN102618535B

Abstract

Provided is a DNA, wherein the sequence of the DNA is selected from the group consisting of the nucleotide sequences shown as SEQ ID Nos. 1-19 and the DNA with at least 80% homology compared with them respectively. Also provided is a recombinant vector containing the DNA, a cell containing the recombinant vector, a pharmaceutical composition containing them, and the use thereof. Through respectively introducing the DNA having the shown nucleotide sequences selected from the group consisting of SEQ ID Nos.1-19 and the nucleotide sequences with at least 80% homology compared with them into a viral vector, then respectively introducing the viral vector carrying the DNA into the cell in the host body to continuously express a polypeptide, the effect of treating eye diseases is achieved, especially the diseases accompanied with the apoptosis and degeneration of eye tissue cells.

Description

Nucleotide, recombinant vector including the same, cell, composition and application thereof

Technical field

The present invention relates to a nucleotide, a recombinant vector comprising the nucleotide, a cell containing the recombinant vector, a pharmaceutical composition containing one or more selected from the group consisting of, and applications thereof. Specifically, the present invention relates to a nucleotide for treating an ophthalmic disease, a recombinant vector comprising the nucleotide, a cell containing the recombinant vector, and one or more selected from the group consisting of the nucleotide, the recombinant vector and the cell or Several pharmaceutical compositions, and the use of the nucleotides, recombinant vectors and cells in the manufacture of a medicament for the treatment of ophthalmic diseases. Background technique

For diseases in the ophthalmology field, inappropriate treatment can lead to serious blindness. Due to the lack of a fundamental treatment, there are not many ophthalmic diseases that have to rely on symptomatic therapy. Recently, it has been found that the occurrence and deterioration of some severe diseases in the ophthalmology field are related to apoptosis.

Retinitis pigmentosa, a neurodegenerative disease with a distinct family genetic predisposition, is a refractory disease that causes cell death due to extensive damage to the optic nerve cell layer and pigment epithelial layer on the retina. The course of the disease is slow to develop, and the cell degeneration can be as long as several years to several decades. It usually occurs before the age of 30. It is most common in children or adolescents, and the symptoms in adolescence are aggravated. In the middle and old age, the eyesight is almost All lost. Epidemiological surveys show that the incidence of the disease in China is 1/3500, and there are about 5-10 million patients in the country, which has caused a heavy economic negative for the family and society. 4: Social 'negative

Glaucoma refers to at least one characteristic change in the optic nerve head and visual field. In general, a condition characterized by adequate reduction of intraocular pressure can improve optic nerve damage or prevent further deterioration of ocular functional structural abnormalities. Regarding glaucoma, blindness can often be caused if it is not properly treated, and blindness caused by glaucoma is the second leading cause of blindness in China. About 5,8% of people over the age of 40 are reported to have glaucoma. According to 2000 statistics, there are about 65 million people in China over 40 years old, and more than 3.7 million glaucoma patients over 40 years old. This also imposes a heavy burden on the patient's family and society.

Gene therapy refers to the introduction of a foreign normal gene into a target cell to correct or supplement Remedy for genetic defects and abnormal diseases to achieve therapeutic goals. That is, the foreign gene is inserted into the appropriate recipient cell of the patient by gene transfer technology, so that the product produced by the foreign gene can treat a certain disease. Broadly speaking, gene therapy can also include measures taken at the DNA level to treat disease.

The current use of genes for sustained and effective gene therapy for ophthalmic diseases is an urgent problem to be solved. Summary of the invention

The technical problem to be solved by the present invention is which gene is used for sustained and effective gene therapy for ophthalmic diseases.

The present invention provides a nucleotide for treating an ophthalmic disease, the nucleotide sequence of which is selected from the group consisting of the following nucleotide sequences:

(1) the nucleotide sequence shown in SEQ ID Nos. i-19;

(2) having at least 80% homology to the nucleotide sequence shown in SEQ ID Nos. 1-19, respectively.

'The nucleotide sequence of 'i.

The present invention also provides a recombinant vector for treating an ophthalmic disease, the recombinant vector comprising a vector and a foreign gene carried thereby, wherein the foreign gene is a nucleotide of the present invention.

The present invention also provides a cell for treating an ophthalmic disease, wherein the cell comprises the recombinant vector of the present invention.

The present invention also provides a pharmaceutical composition for treating an ophthalmic disease, wherein the pharmaceutical composition contains a pharmaceutically acceptable excipient, and one or more selected from the group consisting of the above-mentioned recombinant carrier and vesicle.

The invention also provides the use of the nucleotide, recombinant vector and cell, respectively, in the manufacture of a medicament for the treatment of an ophthalmic disease. The ophthalmic disease described in the above application is a disease associated with apoptosis of ocular tissue cells, preferably glaucoma, retinitis pigmentosa, retinal detachment, and retinal ischemic disease, and most preferably may be retinitis pigmentosa.

The present invention has at least 80% by comparison with the nucleotide sequences shown in the group consisting of SEQ ID Nos. 1-19 and the nucleotide sequences shown in SEQ ID Nos. 1-19, respectively. The homologous nucleotide sequence is introduced into the above vector, and then the vector loaded with the nucleotide of the present invention is separately introduced into the cells of the host to continuously express the polypeptide, thereby treating the ophthalmic disease, especially the glaucoma. The effect of the eye, retinitis pigmentosa, retinal detachment, and retinal ischemic disorders, most preferably may be retinitis pigmentosa. DRAWINGS

Figure 〗 Histogram of the results of nuclear counts of optic nerve cells treated with recombinant adeno-associated virus obtained by light microscopy;

Figure 2 is a bar graph of the results of nuclear counts of optic nerve cells treated by recombinant lentivirus obtained by light microscopy. Real Jfe million

(1) the nucleotide sequence shown in SEQ ID Nos. i-19;

'The nucleotide sequence of 'i.

Preferably, in (2), a nucleotide sequence having at least 85% homology to the nucleotide sequence shown by SEQ ID Nos. 1-19, more preferably a core having at least 90% homology a nucleotide sequence, more preferably a nucleotide sequence having at least 91% homology, more preferably a nucleotide sequence having at least 92% homology, more preferably a nucleotide sequence having at least 93% homology, A nucleotide sequence having at least 94% homology is preferred, a nucleotide sequence having at least 95% homology is more preferred, a nucleotide sequence having at least 96% homology is more preferred, and more preferably at least 97% A homologous nucleotide sequence, more preferably a nucleotide sequence having at least 98% homology, more preferably a nucleotide sequence having at least 99% homology, more preferably a core having at least 99.5% homology Glycosidic acid sequence.

The sequence of the nucleotide is preferably selected from the group consisting of the following nucleotide sequences:

(1) a nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 5;

(2) a nucleotide sequence having at least 90% homology to the nucleotide sequences shown by SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 5, respectively, particularly preferably SEQ ID NO : Preferably, in (2), a nucleotide sequence having at least 91% homology to the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5, respectively, Preferred are nucleotide sequences having at least 92% homology, more preferably nucleotide sequences having at least 93% homology, more preferably nucleotide sequences having at least 94% homology, more preferably at least 95% A homologous nucleotide sequence, more preferably a nucleotide sequence having at least 96% homology, more preferably a nucleotide sequence having at least 97% homology, more preferably a core having at least 98% homology The nucleotide sequence, more preferably a nucleotide sequence having at least 99% homology, more preferably a nucleotide sequence having at least 99.5% homology.

The sequence of the nucleotide is preferably selected from the nucleotide sequences set forth in SEQ ID NO: 8 19 and has at least 90% homology to the nucleotide sequence shown in SEQ ID Nos. 8-9, respectively. Among the groups consisting of nucleotide sequences, wherein the group consisting of the following nucleotide sequences is further preferred:

(1) a nucleotide sequence represented by SEQ ID No I 8 and S-EQ ID NO: 2;

(2) A nucleotide sequence having at least 90% homology to the nucleotide sequences shown in SEQ ID No: 8 and SEQ ID NO: 12, respectively. Preferably, in (2), a nucleotide sequence having at least 91% homology to the nucleotide sequence represented by SEQ ID No: 8 and SEQ ID NO: 12, respectively, more preferably at least 92% identical a nucleotide sequence derived from a nucleotide sequence, more preferably a nucleotide sequence having at least 93% homology, more preferably a nucleotide sequence having at least 94% homology, more preferably a nucleoside having at least 95% homology. The acid sequence, more preferably a nucleotide sequence having at least 96% homology, more preferably a nucleotide sequence having at least 97% homology, more preferably a nucleotide sequence having at least 98% homology, more preferably A nucleotide sequence having at least 99% homology, more preferably a nucleotide sequence having at least 99.5% homology. Most preferred is SEQ ID NO: 8. Also preferred is SEQ ID NO: 17.

The present invention also provides a recombinant vector for treating an ophthalmic disease, the recombinant vector comprising a vector and a foreign gene carried thereby, wherein the foreign gene is a nucleotide of the present invention. The vector is selected from the group consisting of a DNA vector and a viral vector. The DNA vector is selected from the group consisting of DNA; the viral vector is selected from the group consisting of an adeno-associated virus vector, a lentiviral vector and an adenoviral vector. Wherein, the foreign gene may further comprise a regulatory sequence, such as a promoter, a terminator and an enhancer of the one or more exogenous gene expression. The foreign gene may also include a marker gene (eg, a gene encoding β-galactosidase, green fluorescent protein, or other fluorescent protein) or a gene thereof that regulates expression of other genes. The foreign gene may be, in addition to DNA, The mRNA, tRNA or rRNA may also include transcriptional regulatory sequences normally associated with the transcribed sequence, such as transcription termination signals, polyadenylation sites, and downstream enhancer elements. Improved vectors are available for carrying foreign genes. The vector is, for example, a plasmid (DNA), a liposome, a molecular coupler, a polymer, and a viral vector.

The plasmid (DNA) vector can carry a gene of interest, and the plasmid vector carrying the gene of interest can be directly injected or introduced into tissue cells by gene gun, electroporation, and electrofusion. In addition, ultrasound helps to increase the efficiency of plasmid transfer. Ultrasound combined with microbubble echo ratio can improve the permeability of cell membrane, and significantly increase the transfer and expression efficiency of DNA from 3⁄4. This membrane permeation technique creates pores instantaneously on the surface of the cell membrane, and the DNA enters the cell.

The liposome is a particle composed of a lipid molecular layer that mediates a gene of interest or a plasmid vector carrying a gene of interest to cross the cell membrane. The lipid may be a natural phospholipid mainly derived from phospholipid (phospholipid choline, PC) derived from egg yolk and soybean; or may be dipalmitoyl cholestyramine (DPPC) or dipalmitoylphosphatidylethanolamine ( Synthetic phospholipids such as DPPE), distearoylphosphatidylcholine (DSPC); and cholesterol. Preferred liposomes are cationic liposomes which are mainly composed of a mixture of positively charged lipids and neutral auxiliary lipids in equimolar amounts. The positively charged liposome forms a complex with the negatively charged DNA and is transferred into the cell by endocytosis.

The molecular coupler is a ligand which covalently binds a plasmid vector carrying a gene of interest to a cell surface specific receptor or a monoclonal antibody or a viral membrane protein, and utilizes specific binding characteristics to mediate the introduction of the exogenous gene into In a particular type of cell.

The polymer, i.e., using a cationic multimer, such as a positive charge on poly-L-lysine, combines with a negative charge on a plasmid carrier to electrically neutralize hydrazine to form a stable multimeric ZDNA complex. The complex of the obtained cationic multimer and DNA 5 is positively charged and can be infiltrated into the cells by binding to a negatively charged receptor on the cell surface.

Viruses can usually enter specific cells efficiently, express their own proteins, and produce new virions. Therefore, the virus that has been changed becomes the carrier of gene therapy first. For example, retroviral vectors (including lentiviral vectors), glands Viral vector, adeno-associated virus vector and herpes simplex virus vector temple.

The vector is preferably selected from the group consisting of an adeno-associated virus vector and a lentiviral vector. Wherein, the adeno-associated virus belongs to a member of the non-pathogenic parvoviridae family and may only proliferate depending on the helper virus. The adeno-associated virus genome is small, such as type 2 adeno-associated virus, which is a single-stranded DNA consisting of 468 nucleotides, containing two genes, the rep gene (encoding responsible for regulating viral replication, structural gene expression, and integration into the host genome). The protein) and the cap gene (encoding the capsid structural protein) have a terminal repeat region of 1451 φ at one end of the genome. Adeno-associated virus can infect mitotic and quiescent cells, can be inserted into the host cell chromosome, or can be stably expressed in the form of extrachromosomal concatemer DNA, which can effectively transduce cells of the brain, skeletal muscle and liver. It is characterized by antigenicity, low toxicity and no disease.

A preferred vector of the invention is an adeno-associated viral vector. It is characterized by its high safety, wide range of host cells (dividing and non-dividing cells), low immunogenicity, and long time to express foreign genes in vivo. It is regarded as one of the most promising gene transfer vectors in the world. It is widely used in gene therapy and vaccine research.

A preferred vector may be a lentiviral vector. Lentiviruses include a range of viruses that infect primates such as the human immunodeficiency virus HIV and HIV-2, the simian immunodeficiency virus SIV, and non-primate viruses such as the Mediv/Visna virus (MVV). , Feline Immunodeficiency Virus (FIV), Equine Infectious Anemia Virus (EIAV), Goat Arthritis Encephalitis Virus (CAEV), and Bovine Immunodeficiency Virus (BIV). HIV-1 and HIV-2, SIV, FIV, EIAV and CAE V in the lentivirus family have been studied as vectors for gene therapy. However, many potential target cells for gene therapy are non-dividing cells, mainly hepatocytes, neuronal cells, hematopoietic cells, myocyte macrophages, etc. Lentiviruses can mediate efficient transduction of non-dividing cells by the target gene, thus in human genes. Treatment has gradually gained attention. Recombinant vector. The "cell for treating an ophthalmic disease" as used herein includes not only a cell containing the recombinant vector of the present invention which is directly administered to a subject, but also a cell which is used in the course of realizing a therapeutic process, for example, for amplifying and cultivating the recombinant of the present invention. The carrier's cells, but the cells are not directly used for administration to the subject. The cells may be endogenous (from the subject's own cells) or exogenous (e.g., from allogeneic cells or even xenogeneic cells, including commercially available cell lines). The cell is selected from one or more of 293T cells, pluripotent cells, retinal pigment epithelial cells, iris pigment epithelial cells, conjunctival epithelial cells, and retinal photoreceptor cells. The pluripotent thousand cells are preferably selected from the group consisting of embryonic stem cells, neural cells, bone marrow mesenchymal cells, hematopoietic stem cells, and limbal stem cells. One or several of them.

The cells containing the recombinant vector of the present invention administered directly to the subject are commonly used in the treatment of ophthalmic diseases, for example: 1 autologous transplantation: taking the patient's own body, the advantage is that there is no immune rejection. The disadvantage is that the supply is limited, and it is necessary to separate and culture 4 pieces. 2 Allogeneic transplantation: taken from other people's tissues, for example, from fresh corpses (comparable to the requirements for corneal transplantation), from relatives of the patient (live), or from commercially available cell lines. The advantage is that the feeding is easier; the disadvantage is that immune rejection can occur. 3 xenograft: taken from other animals, usually with more obvious rejection reactions, which need to be overcome by tissue engineering methods. Among them, the cells are preferably retinal pigment epithelial cells. For example, retinal pigment epithelial cells ARPE-19 can be used as host cells for the eukaryotic expression vector of the present invention. The retinal pigment epithelial cells may be commercially available cell lines or may be derived from a subject such as a patient with retinitis pigmentosa. In the course of gene therapy, it is preferred that the retinal pigment epithelial cell ARPE from the subject is introduced into a recombinant vector containing the nucleotide of the present invention, and then re-transplanted to the subject to be less susceptible to immunological rejection.

The present invention also provides a pharmaceutical composition for treating an ophthalmic disease, wherein the pharmaceutical composition contains a pharmaceutically acceptable excipient, and one or more selected from the group consisting of the above-mentioned recombinant carrier and vesicle. Preferably, the pharmaceutical composition is an injection comprising a pharmaceutically acceptable excipient and one or more selected from the group consisting of the recombinant vector of the present invention and the cells of the present invention.

Preferably, the pharmaceutically acceptable excipient is 10 mM Tris, which preferably maintains pH 7.2-7.6 of the pharmaceutical composition, preferably pH 7.4; 10 per ml of injection ⁶ - 10 ¹² vg of the recombinant vector, preferably 10 ^{1 (} vg of the recombinant vector per ml of injection).

Preferably, the pharmaceutically acceptable excipient is a phosphate buffer having a pH of 5,0-9,0; the recombinant carrier is contained in an amount of 10 ⁶ - 10 ^{i 2} vg per ml of the injection, preferably 10" Vg of the recombinant vector was contained per ml of the injection.

The injection solution further contains a protective agent and/or an osmotic pressure adjusting agent; the protective agent is contained in an amount of 0.0130% by weight based on the injection solution, and the protective agent is selected from the group consisting of alcohol, sorbitol and sucrose. One or more; the osmotic pressure adjusting agent is present in an amount such that the osmotic pressure of the injection liquid is 200-700 milliosmoles per kilogram, and the osmotic pressure adjusting agent is platinum chloride and/or potassium chloride and/or Or magnesium chloride „

When the injection solution is used, 10 ⁶ - 10 ¹² vg of the recombinant vector is administered to the treated individual each time, 10 ⁸ 10 ¹¹ vg, more preferably 10 1 ^ΰ -10 ^η vg, particularly preferably ί θ ⁸ ; further preferably the recombinant vector is a recombinant adeno-associated virus vector, each gland associated with ϋ θ ⁶ liO ⁱ² vg administered to the subject The viral vector, preferably 10 ^s - 10" vg, more preferably 10 1 ^G vg. When the pharmaceutical composition of the present invention is injected, the dosage can be used in the art, up to 300 microliters, generally -200 microliters Preferably, 50 150 microliters; if the subretinal injection mode is selected, the human injection dose per eye is 50 150 microliters, preferably 100 microliters. The number of administrations of the injection according to the present invention can be based on various parameters, in particular It is determined according to the annual weight and condition of the patient to be treated, the severity of the disease or condition, and the route of administration. The number of administrations of the injection according to the present invention is plural, preferably 〜5 times, most preferably 1 time. One skilled in the art can readily determine the optimal route of administration and dosage, so the route of administration and dosage are for reference only. The dosage can be based on various parameters, particularly depending on the year of the patient to be treated The weight of the body and the condition, the severity of the disease or condition, and the route of administration are determined. The pharmaceutical composition injection of the present invention may also be administered systemically, or the injection of the pharmaceutical composition of the present invention may be injected into a localized part (for example) In the case of subretinal administration, the administration once means that the number of affected eyes is i times per administration, and the number of administrations is preferably one.

The invention also provides the use of the nucleotide, recombinant vector and cell, respectively, in the manufacture of a medicament for the treatment of an ophthalmic disease. The ophthalmic disease described in the foregoing application is accompanied by apoptosis of ocular tissue apoptosis, and particularly preferred are glaucoma retinitis pigmentosa, retinal detachment, and retinal ischemic disease. Most preferably, the ophthalmic disease described in the aforementioned application may be retinitis pigmentosa.

The following examples are intended to further illustrate the invention, but are not to be construed as limiting the invention. Modifications or substitutions of the methods, procedures, or conditions of the invention are intended to be included within the scope of the invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise specified. Unless otherwise specified, the reagents and culture media used in the present invention are commercially available.

The methods used in the examples are all routine in the art, as described in the third edition of the Guide to Molecular Cloning.

Really pour 1 chemical synthesis of the nucleotide of the present invention

SEQ ID Nos. 1-19 was synthesized by Dalian Bao Biotech Co., Ltd., and the appropriate restriction endonuclease sites Cia I ( ATCGAT ) and Bgill ( AGATCT ) were added to both ends of the vector, and linked to the pMD-1ST vector. Above, denoted as pMD-18T-Sl, pMD-18T-S2, pMD- 18T S3, pMD-1ST-S4, pM- D- 18T S5, pMI 18T-S6 . pMD-18T-S7, pMi 18T S8, pMD 18T-S9, pMD 18T-S 10, pMD 18T-S 11, pMD-18T-S 12, pMD- 18T- S 13, pMD-18T-S 14, pMD-18T S 15, pMD-18T-S 16, pMD-18T-SI 7, pMD-18T S 18 and pMD 18T-S 19. After sequencing, the synthetic sequence SEQ ID Nos, 1 19 was correct.

Example 2 Construction of Recombinant Adeno-associated Gene Transfer Vector (hereinafter referred to as AAV)

1) MD-18T-S1 was transformed into competent Escherichia coli DH5a, and cultured overnight on an LB medium plate containing 100 μg/ml ampicillin, and the grown positive clones were cultured overnight in ampicillin-containing IJB liquid medium. The cells were collected by centrifugation, and the pMD-]8>S1 extracted product was extracted by the plasmid extraction kit and sent to the sequencing company for sequencing. The sequence of the ligated sequence was confirmed to be correct, and the sequencing result was correctly set to -80 X:

2) The fragment of SEQ ID No: 1 was excised from the pMD-18T-S1 vector by restriction endonucleases Cla I (ATCGAT) and Bgill (AGATCT), and the target product SEQ ID No: 1 fragment was recovered by gel electrophoresis. ;

3) digesting pAAV-hrGFP (Stratagene) with restriction endonuclease Cla I (ATCGAT) and Bgill (AGATCT), and recovering 50 ul of each vector fragment by gel electrophoresis;

4) The fragment of SEQ ID No: 1 recovered in step 2) was ligated with the vector fragment recovered in step 3) under the action of T4 ligase, and subjected to transformation and sequencing according to the method in the above 1), confirming that the sequence of the ligating was correct.

The correct identification of the adeno-associated virus exogenous gene transfer vector pAAV~Sl, -80 X: is reserved for use.

The adeno-associated virus exogenous gene transfer vectors pAAV-S2, pAAV-S3, pAAV-S4 pAAV~S5, pAAV-S6, pAAV~S7, pAAV-S8, pAAV S9, pAAV obtained the remaining eighteen sequences were prepared as described above. -. S10, pAAV S1 L pAAV- S12, pAAV- S13, pAAV- Si4, pAAV- S15, pAAV- Si6, pAAV- Si7, pAAV- S18, pAAV-S19 t,

Loaded with SEQ ID No. i, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No, 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13 > SEQ ID No. 14, SEQ ID No. 15. SEQ ID No. 16, SEQ ID No. 17. SEQ ID No. 18 and SEQ ID No. 19 adeno-associated virus vector (pAAV) and adeno-associated virus exogenous gene transfer vector pAAV-S i, pAAV-S2 pAAV S3, pAAV S4, pAAV S5, pAAV S6, pAAV-S7, pAAV S8, pAAV-S9, pAAV-S 10, pAAV-SI K pAAV S12, pAAV»SI3, pAAV-S 14 , pAAV S15 , pAAV S 16 , pAAV-SI7, pAAV-S18 and pAAV-S are corresponding to 9.

Example 3 Preparation and Concentration of rAAV Vector Carrying Therapeutic Gene

3 1. Preparation of rAAV-S carrying the fragment of SEQ ID No: 1]

The AAV vector was constructed based on the modified gene transfer vector pAAV-Sl, Cap/Rep helper plasmid R ₂ C ₂ and Ad helper (Ad helper) three plasmid systems (straiagene, AAV Helper-Free System). preparation. The vector carrying the therapeutic gene is produced in units of 20 15 cm culture sub-units. About 127T cells of approximately W ⁷ were inoculated according to each 15 cm plastic culture. After 24 hours of culture, the culture medium was replaced with ΟΡΤΊ MEM medium, and incubated at 37 ° C in a 5% carbon dioxide incubator to prepare for transfection. . The transfection complex was prepared and transfected with calcium phosphate transfection reagent. The next day after transfection, exchange culture was carried out with fresh 30 ml of DMEM medium containing 10% fetal bovine serum. Two days after transfection, the supernatant and cells were recovered. According to Wu Xiaobing et al. (Wu Xiaobing et al., a method for rapid and efficient isolation and purification of recombinant adenovirus-associated viral vectors, Science Communication, 2000, 45 (19), 2071-2075), high-speed separation and purification of rAAV-Sl vector, A concentrated and purified viral solution is obtained. The virus solution was filtered through a filter having a pore size of 0,45 μm, and the filtrate was purified by a cation column (SP sepharose 4FF) (loading rate of 5 ml./min), D PBS was washed to equilibrium-, and NaCl containing lmoi/i was used. The solution was eluted with D-PBS solution, ultrafiltered with an ultrafiltration tube (I 00 KD, milipore) at 2000 rpm/min for 3 min, and then filtered through a filter having a pore size of 0.22 μm. The filtrate was collected and the AAV viral vector in the filtrate was stored in D-PBS. After dispensing, store at -80 °C and take one of them for titer detection.

The rAAV-S2--19 vector carrying the SEQ ID Nos. 2-19 fragment and the empty vector pAAV^hrGFP carrying the target gene were prepared in a large amount according to the above method.

3-2, titer determination

The determination of the AAV vector titer using the dot hybridization method means that the genome copy number (vector genomes/ml, abbreviated as vg/mi) of the virus particles per mi virus solution. The viral vector pAAV-hrGFP (Stratagene) carrying humanized green fluorescent protein was used as a standard for AAV vector titer determination, and the promoter/target gene sequence labeling probe was used to hybridize with the standard and the test sample on the membrane. Judging the strength of the hybridization signal of the sample to be tested on the hybrid membrane and the standard series The copy number of the promoter/target gene contained in the AAV vector sample point, thereby deducing the AAV vector titer (vg/ml).

Carrier titer determination of the required solution:

5 X SSC, 1% (W/V) blocking reagent (Roleie, Cat# 11096176001), 0.1% (w/v) sodium N-dodecanoyl sarcosinate and 0.02% (w/v) SDS.

5 X SSC, 1 % (w/v) blocking reagent, 0.1% (w/v) N-dodecanoyl sarcosinate, 0.02% (w/v) SDS and newly denatured probe DNA (20u! ) (The probe is currently used).

3) 2 X SSC/0.1% ( W/V ) SDS

Dilute to 2 X SSC/0,1% (W/V) SDS by 5 χ SSC and 10% SDS.

4) O.l SSC/0.1% SDS

Dilute to O.i x SSC/0.1% (W/V) SDS with 5 x SSC and i0% SDS.

5) Buffer i

Maleic acid (i00 mmol/L); NaCl (I50 mmol/L); pH 7.5 (20 ° C).

6) Buffer 2

1% (W/V) blocking reagent, formulated in buffer 1.

7) Buffer 3

Tris-HCl (100 mmol/L); NaCl (100 mmol/L); pH 9.5 (20 ° C).

8) Buffer 4

Tris-HCl (10 mmol/l); EDTA (1 mmol/L); pH 8,0 (20 ° C).

9) chromogenic solution

Freshly prepared, in IOml Buffer 3, add 45 μl of NBT solution (Roche, Cat#li 383213001) and 35 μl of BCIP (Roche, Cat#ll 383221001).

10) 5mol/L LiCL,

3-2-1 probe labeling and purification

1) PCR method probe labeling

The reaction system is as follows: 10 x buffer

lOxdNTP 1 μΐ

Upstream primer (25μΜ) 1 μΐ

Downstream primer (25μΜ) 1μ!

Taq drunk (5α/μ1)

Standard ίρ rig

Fill dd 0 to a total volume of 50μ1.

Among them, the upstream primer: 5,- GTACGGTGGGAGGTCTATATAAGCA -3 '

Downstream primer: 5, GGTCCCGGTGTCTTCTATGGA -3 '.

94 X:, 300s: 94 "C, 30s; 55 °C, 30s; 72C, i minutes; - 30 cycles of 72 X:, 300s.

Among them, the PCR instrument used is the instrument number of PCR- 02~04 of TECHNE Techgene.

2) Purification of the probe

a) Add 4 μl of SnioFL LiCl and ί5() μ 1 pre-cooled (20 minutes at 0 ° C) absolute ethanol to 50 μl of the PCR reaction solution, and place at -70 ° C for 30 minutes or - 20 ° C 2h.

b) 4. C Centrifuge at i2000 rpm for 10 minutes, add 200 μl of 70% ethanol solution to the supernatant and gently invert twice. 41: Centrifuge at 12,000 rpm for 5 minutes, aspirate the supernatant, and repeat centrifugation once.

c) After drying for 10 minutes at room temperature, the precipitate was dissolved in 20 μl of pH 8.0 TE buffer. Set - 20. C Save the spare.

3-2-2 Pretreatment of samples and standards

a) Take 10 μl of the vector to be tested prepared in 3-1, add 9 μ 1 dd3⁄40, 1 μ 1 DNaseli SIGMA) to a total volume of 20 μl. 37. C was incubated for lh.

b) The standard was quantified by UV spectrophotometer (SOP-.ZJ01 YQ005) and diluted with TE (pH 8.0), 4 吏-concentration - 10,4 ngZ i, 7.8 ng/μ 1, 5.2 ng/ μ 1, 2.6 ng /, ul, L3 ng / μ 1, 0.65 ng / μ i.

c) The sample and the serially diluted standard of step b) were boiled for 10 minutes at i00 and then immediately placed in water. d) Take 1 μΐ of the denatured sample and the serially diluted standard on a nylon membrane (positive charge label, Rodte, Cai# 1 209299), after the liquid on the membrane is completely thousand, The film was sandwiched between two filter papers, placed in a glass dish, and placed in a 120 baking film for 20 minutes.

3-2-3 pre-hybridization

The film was placed in a plastic bag with a small tweezers, 2 ml of the pre-hybrid solution was added, the gas was removed, and the mixture was sealed, and pre-hybridized in a water bath at 68 ° C for 3 hours.

324 hybrid

Cut the pre-hybrid bag into a small mouth, pour out about 8 ml of pre-hybrid solution, add 2 mj of hybridization solution, and mix overnight in a water bath at 68 ° C (18 hours λ

3 -2 - 5

a) Remove the membrane into a thousand disposable ones, add 20ml 2 x SSC/0.1% (W/V) SDS solution at room temperature, and put it on the shaker at 80rpm for 5 minutes, 2 times. .

b) The membrane was removed and placed in a 50 ml flask, and 30 ml of 0.1 χ SSC/0.1% SDS was added to rinse the solution under conditions of 68 for 15 minutes, twice.

3-2-6 immunoassay

c) Place the membrane in a disposable flat, add buffer to i 20 ml, and wash for 5 minutes at room temperature.

d) The membrane was placed in 20 ml of buffer 2 and allowed to stand at room temperature for 15 minutes with occasional shaking. e) Wash again with 20ml buffer 1 for 30 seconds.

f) Dilute the anti-digoxigenin antigen-binding fragment (Anti DIG-Fab) with 10 ml of buffer 2 to obtain an I50 U/L (1:5000) antibody conjugate solution, which is placed at room temperature in the aforementioned antibody conjugate solution. minute.

g) Shake with 20 ml of buffer 1 to remove unbound antibody conjugate for 15 minutes, co-wash

2 times.

h) The membrane was equilibrated in iOmi buffer 3 for 5 minutes.

1) The film was placed in 10 ml of a color developing solution, and reacted for 3 hours in the dark.

j) When there is a clear gradient in the color development of the standard, that is, the color development is completed, the film is washed with 10mi buffer 4 for 10 minutes to terminate the reaction.

k) Scan the color rendering results and process the data using the Bandscaii 4,3 software (SOP ZJ01-01027). Based on the hybridization signal, the titer of the sample to be tested is determined.

Titer ( vg ml ) - corresponding copy number X 2 X dilution factor

The above method for measuring the titer is carried out in accordance with the procedure described in the instructions of the Digoxin DNA Labeling and Detection Kit (Roche).

The virus titer of the rAAV-Sl-S19 vector carrying the SEQ ID Nos. 1-19 fragment and the empty vector pAAV-hrGFP prepared according to the method of the above-mentioned method was 1 χ 10 ³² vg/mU. Example 4 Construction and bulk preparation of recombinant 'ft viral vector (hereinafter referred to as Leu)

Construction of a recombinant lentiviral gene transfer vector Len S1

The pMD-18' S1 plasmid was used as a template, and the following primers were used for PCR amplification:

Forward primer SI -Forward: atgcaggccctggtgctactcc

Reverse-directed primer SI -Reverse: tcatcicacagccttcctgctg

PCR reaction cycle conditions: denaturation at 95 ° C for 5 minutes, then at 95 ° C, 30 seconds;, 6 CTC, 1 minute, 72 ° C, 45 seconds 40 cycles, and finally 72 ° C extension for 10 min.

After the gel was recovered, the obtained sequence (length 1737 bp) was ligated into the pLenti6.3/V5-TOPO® vector (Invitrogeii K5315-20) by TA cloning according to the instructions, and sequencing confirmed that the sequence of the ligated fragment was correct, That is Len-S 1.

According to the above method, the sequence obtained by PCR amplification of the template and primers in Table 1 was prepared according to the above method and the recombinant carrying the remaining 18 sequences (SEQ ID Nos. 2-19) was determined. Lentiviral gene transfer vector Len-S2~Len-S19 ₀

Recombinant chronic disease

Creek plate primer gel recovery fragment length toxic vector

S2- Foword: atgtccatgtigttctacactc

L,en-S2 pMD- 18T- S2 1737 bp

S 2 -Reverse: tcaggggcccclggggtc cag

S3- Foword: atgcaggccctggtgctactcc

Len- S3 pMD- 18T- S3 1767bp

S3- Reverse: tcagctcttagcagacaltgg

S4- Foword: atgcccgccttgcccgaggatg

L,en-S4 pMD- 18T- S4 1770 bp

S4- Reverse: tcaggggcccctggggtccag

S5-Foword: atgtccatgttgttctacactc

Len- S5 pMD- 18T- S5 921 bp

S5- Reverse: tcagctcttagcagacaitgg

S6- Foword: atgcccgccttgcccgaggatg

L,en-S6 pMD- 18T- S6 924 bp

S6- Reverse: tcatctcacagccticctgctg

S7-Fowordi atgcaggccctggtgctactcc

Len- S7 pMD- 18T- S7 2247 bp

S7- Reverse: tcatctcacagccttcctgctg

S8- Foword: atgcaggccctggtgctactcc

L,en-S8 pMD- 18T- S8 2046bp

S 8- Reverse: tcaictcacagccitccigctg

S9- Foword: atgtccatgttgttctacactc

Len- S9 pMD-18T-S9 2046bp

S9-Reverse: ttaggggcccctggggtccaga

S 10- Foword: atgcaggccctggtgctactcc

Len-SlO pMD-18T-S10 1794bp

S 10- Reverse: tcagctcttagcagacattgga

Si 1- Foword: aiggcagccgggagcatcacca

Len- SI 1 pMD 18T- Sll 1794bp

SI 1 -Reverse: ttaggggcccctggggtccaga

S 12- Foword: atgtccatgttgttciacactc

Len- S 12 pMD- 18T S12 1257bp

S 12- Reverse: tcagctcttagcagacattgga

S 13- Foword: aiggcagccgggagcatcacca

Len-S13 pMD- 18T-S13 1257bp

S 13 -Reverse: tcatctcacagccttcctgctg

S 14- Foword: atgcaggccctggtgctactcc

Len- S 14 pMD- 18T S14 2583bp

S 14- Reverse: tcagctcttagcagacattgga

S 15 -Foword: atgcaggccctggtgctactcc

Len-S15 pMD-18T-S15 2046bp

S 15 -Reverse: tcatctcacagccttcctgctg

S 16- Foword: atgtccatgttgttciacactc

Len-S16 pMD- 18T S16 2046bp

S] 6- Reverse: ttaggggcccctggggtccaga

S 17- Foword: atgtccatgttgttctacactc

Len- SI 7 pMD- 18T- S— 17 1257bp

S 17- Reverse: tcagclcttagcagacattgga

818-Foword: aiggcagccgggagcatcacca

Len-S18 pMD-18T-S18 1257bp

S] 8- Reverse: tcatctcacagccttcctgctg

S 19- Foword: atgcaggccctggtgctactcc

Len- SI 9 pMD-18T-SI9 2583bp

S 19- Reverse: tcagclcttagcagacattgga 4-2. Preparation of recombinant lentiviral vector Len-S carrying the fragment of SEQ ID No. 1 293T cells (purchased from American type culture collection, ATCC for short), each 15 cm plastic The culture dish was inoculated with approximately M0 ⁷ cells (80% density per day), and cultured in 20 ml of D-MEM medium (: Gibco BL) containing 10% fetal calf serum for 24 hours. After 24 hours of culture, the medium was replaced with 10 ml of ΟΡΤΪ-MEM medium ( Gibco BRL ), and used as a transfected cell.

The gene transfer vector Len-S obtained according to step 4 of each culture Jffi was 10 μ _§ , and the package contained '5 μg of the body, rev-expressing the body' 2 μg ^ VSV-G. The expression contained 'body 2 μ g (Invitrogen) After dissolving in 1,5 ml of OPTI-MEM medium, 40 μl of PLUS Reagent reagent (Invitrogen) was added and stirred, and allowed to stand at room temperature for 15 minutes. 60 μl of LIPOFECT AMINE Reagent reagent diluted with 5 mj of OPTI-MEM medium was added thereto and stirred, and allowed to stand at room temperature for 15 minutes. The resulting DNA complex was added dropwise to the above 5 cm cultured sub-293T cells, carefully shaken and mixed, and incubated at 37 ° C in a 5% CO ₂ incubator for 3 hours. Then, 13 ml of D-MEM medium containing 20% fetal calf serum was added to the above cultured J2L for 'cultivation.

The transfected sputum was exchange cultured in fresh 30 ml DMEM medium containing 10% fetal bovine serum. Two days after transfection, the supernatant was recovered and 20 ml of fresh medium was added. The recovered supernatant was filtered through a 0.45 μm filter and stored at 4 Torr. Three days after the transfection, the supernatant was recovered, filtered through a 0,45 μηη filter, mixed with the carrier recovered the previous day, and concentrated using a high-speed centrifuge. Specifically, the recovered carrier suspension is added to a sterilized test tube for dispensing at 42500 G, 4. Centrifuge for 1 hour under C. The centrifugation was repeated twice and the carrier suspension was concentrated to 1000 times. The carrier was precipitated as a precipitate, and the precipitate was dissolved in D-PBS. The concentrated carrier was collected by column chromatography (GE Healthcare, XK16/100, 4FF (Sepharose 4 Fast Flow), upper flow rate L5ml/min, bed height 90 em), and the first peak was collected and collected. The sample was filtered and dispensed through a 0.22 μηι filter, one of which was used for titer determination, and the rest was kept at 80 ° C - standby.

The Len-S2-19 vector carrying the SEQ ID Nos. 2-19 fragment and the empty vector lentivirus (Lenti6.3/V5-TOPO) carrying the target gene were prepared in large quantities according to the above method.

4 3 titer determination (1) extracting the genomic RNA in the above-mentioned system according to the instructions of the Trizol LS (Invitrogen) kit;

(2) Real-time quantitative PCR to quantify genome R A copy number:

A. Prepare the standard Len-RNA:

1) In vitro transcription preparation RNA, in vitro transcription reaction was carried out according to the HiScribeTM T7 In Vitro Transcription Kit (NEB, Cat: 2030S) kit instructions.

Purified PCR product (50-100 ng/μΐ) 25μ!

20 NTPs ΙΟμΙ

20 HMW Mix 10μ!

】0 x Transcription Buffer (Trans Buffer) 20μ1

RRI 1 O .1

T7 RNA polymerase (500U4d) 5μ1

RNase-free li ₂ 0 120μ1

Total (total) 200μ1, 37 °C, 2hr

2) Removal of DNA templates from RNA standards

The above reaction system was 75 Ό, T7 RNA polymerase was denatured in 10 minutes, and then cooled to room temperature, and then added [[Hil DNase I, 37 Ό, the reaction was continued for 1 hour.

3) Purification and quantification of RNA standards

200 μl face chloroform, vortex (rtex), centrifuge at 4 ° C, 12000 φΐη, 10 minutes, transfer the supernatant (about 180μ1) to a new centrifuge tube, add 500μ1 absolute ethanol, then add 20 μΐ 3 M NaAc ( ρί·Ι5,2 ). Centrifuge at 4 ° C, 12.000 rpm, 20 minutes, discard the supernatant, and wash the pellet with 500 μΐ 70% ethanol, 4. C centrifuge and remove the supernatant. After the precipitate was dried, it was dissolved in 200 μM without RNase water. The purified RNA standards were diluted 100-fold and 200-fold, OD260/280 was determined, the concentration was calculated, and the copy number was calculated based on the RNA concentration.

Copy number per microgram = l() - ³ g X 6 2 X 10 ²³ /RNA molecular weight.

4) Packing of RNA standards

The standard RNA of the Len genome needs to be diluted with a yeast iRNA (20ng/ui) solution to obtain a standard solution (0 copies/μ1, 20 copies/μί, 2χ10 ² copies Ζμΐ, 2χ 10 ³ Copy / μΐ, 2χ 10 ⁴ copies / μϋ, 2χ 10 ⁵ copies / μΐ and 2χ 10 ⁶ copies / μΐ), divided into 20 μ_1 / tube, -80 ° refrigerator to save.

Β.Taqman RNA-io-CT 1-step Kit (Applied)

Biosystems, cai #4392938) Prepare a reaction mixture in a PCR tube.

The counter system should be as follows:

2 X RT-PCR mix ΙΟμΙ

Len F-primer (forward primer) 0.2μ1 ( 10 pmol/μΐ )

Len R- primer (reverse primer) 0.2 1 (10 pmol/μΐ)

Len probe (probe) 0.2μ1 (] 0 pmol/μΐ )

( 40 ^x ) —Enzyme mix 0.5ul

Nuclease- free water 4.9ul

Total 20u

among them,

Forward primer Len F primer: 5 ' - CATC AATGGGCGTGGATAGC 3 ' .ΊΓ 11 Len R-primer: 5 ' -CGCCTACCGCCCATTTG-3 '

Len probe probe:

FAM- CTTTCCAAAATGTCGTAACAACTCCGCCC- TAMRA

C. Add sample R A or standard leg A ( 5 ul ) to the PCR tube and perform real-time quantitative PCR according to the following conditions. (Total amount: 25ul)

Stage temperature time

Hold (Hold) 48 °C for 15 minutes

Hold (Hold) 95 'C 10 minutes

Cycle (40cyeies) 95 °C 15 sec

60. C 1 minute

D. Quantify the copy number of lentivirus: genomic RNA in the sample according to the standard curve, and quantify the copy number of the genomic RNA X 1000 X dilution factor according to the standard curve, which is the lentiviral vector titer carrying the therapeutic gene to be detected. (vg/mi).

E. Corrected according to the recovery obtained.

The fragment carrying SEQ ID Nos. 1 -19 obtained in Example 4-2 as determined by the above method The Len-Sl-S19 vector and the empty vector lentivirus have a virus titer of 5 x 10 ^1Q vg/mi.

4-4 it disease - venom concentration

The lentiviral solution carrying the Len SI vector carrying the fragment of SEQ ID No: 1 was placed in a labeled ultrafiltration tube (Milipore, lOOKD/ISml), and D-PBS was added to 5 ml. Centrifuge at 4 ° C, 3000 rpm for 2-3 minutes, discard the supernatant and control the final lentiviral solution to 0.1 ml.

After filtering 0.22 and ηι filter, after aseptic dispensing, the sample was immediately tested (within 20 minutes) using the same method as above, and the virus titer was 5 X 〗 0"vg/m].

The Len S2 S19 vector carrying the SEQ ID Nos. 2-19 fragment and the lentiviral solution of the empty vector lentivirus were concentrated in the same manner as above, and the virus titers were determined to be 5 x 10 ⁿ vg/ml.

Example S Therapeutic effect of recombinant adeno-associated virus vector on retinitis pigmentosa model animals

1. Modeling of retinitis pigmentosa model animals

Rat model of retinitis pigmentosa was purchased from the Southwestern Eye Hospital Animal Center. In this example, 45 3 week old RCS rats were randomly divided into 9 groups, 5 in each group, and 7 groups in the experimental group. The drug group, the other two groups were empty vector control and BBS control, free water for one week.

2. Administration of recombinant adeno-associated virus of Example 3

The test group drug formulation: the AAV virus solution containing the fragment of SEQ ID Nos. 1-19 obtained in Example 3-1 was diluted with an equal amount of D-PBS solution to a virus titer of 5 X 10 ⁿ vg / ml;

Control drug formulation: control with an equal amount of empty vector virus D-PBS solution and an equal volume of D-PBS;

Mode of administration: By subretinal administration, a single dose of each eye was administered at 2 ui, and the total dose was administered at I0 ⁹ vg per eye.

3, effect observation

Four weeks after the recombinant vector was transduced, the eyeballs were removed, and the retinal site containing the optic nerve sections was counted for the optic nerve nuppleules per unit area (square millimeters) using an optical microscope. The results of the optical microscope (results of the pharmaceutical composition with a virus titer of 10 ⁹ ) are shown in Fig. 1, wherein the ordinate is the number of optic nerve nuclei (unit: unit/mm 2 ). The results in Figure 1 show that the number of optic nerve nuclei in the retina site of the nineteen recombinant AAV viral vectors was significantly increased, indicating that the nucleotides of the present invention have significant therapeutic effects.

The data of treatment results of retinal nuclei are shown in Table 2 (units/mm ² ): D-PBS iv rAAV-Sl rAAV"S2 IAAV- S3 rAAV-S4 rAAV- S5 iAAV- S6 rAAV- S7

SI 500 500 2480 2650 3050 3180 3400 3400 4100

S2 530 550 2490 2750 3189 3200 3400 3350 4250

S3 440 450 2488 2500 2800 3200 3350 3600 3950

S4 450 400 2500 2400 3490 3400 3500 3650 4000

S5 450 400 2500 2650 3250 32.00 3500 3500 4100 Average 474 550 2490 2590 3340 3236 3430 3500 4080

Example 6 Therapeutic effect of recombinant 3⁄4_viral vector on retinitis pigmentosa model animals

Test group drug formula: The drug formulation is the 'ientiviras' solution containing the fragments of SEQ ID Nos. 1-19 obtained in Example 4-4;

Control drug formulation: an equal amount of empty vector virus D-PBS solution and an equal volume of D PBS as a control;

Mode of administration: Administration by subretinal administration, single administration of each eye was controlled at 2 μ], and the total dose was 10 ⁹ vg per eye.

3, effect observation

The effect was observed according to the same method as in Example 5. The data of the treatment results of the number of retinal nuclei are shown in Table 3 and Figure 2 (units/mm ² ): D-PBS slow. Virus Len-Sl Less- S2 Len~S3 Lea-S4 Leii-SS Lesi-S6 Len-S7 lesiiivirus

SI 580 600 2500 2600 3000 3200 3500 3400 4000

S2 600 650 2490 2800 3200 3300 3450 3330 4200

S3 600 550 2480 2400 2800 3100 3300 3650 3800

S4 550 500 2510 2500 3500 3500 3600 3750 4000

S5 480 490 2520 2700 3100 3000 3560 3500 4200 Average 562 558 2.500 2600 3120 32.20 3482. 352.6 4040 Continued Table 3

As can be seen from Table 3, the recombinant lentivirus of the present invention has a retinitis pigmentosa model animal.

Example 7 Recombinant virus in glaucoma treatment of ischemia-reperfusion model animals Glaucoma model animals were established by ischemia-reperfusion to demonstrate the therapeutic effect of recombinant adeno-associated virus preparations on glaucoma. The obtained rAAV-Sl.-, ·ΓΑΑΥ"8]9 suspension was administered to the subretinal space of 4-week-old Wistar rats, and the single administration was controlled at 2 μl per eye, and the total dose was 10 ⁹ vg. After 14 days of vector transduction, the intraocular pressure of the above rats was placed under a pressure of 10 mmHg for 60 minutes for ischemic treatment, and the retinal ganglion cells were damaged. After 4 days of damage, the brain stereotaxic apparatus was used. The fluorescent pigment DAPI (4,6-diamidino-2 phenylindole) was injected into the upper eye of both eyes to mark the ganglion cells. After 7 days of retinal ganglion cell damage (after 21 days of vector introduction), the eyeballs were removed and plated with a fluorescence microscope. Observations were made to count the number of labeled ganglion cells per imm ² from the optic nerve at 1 mm.

As a control, D-PBS solution was administered to the subretinal space instead of the vehicle suspension, and the "carrierless/ischemia-reperfusion injury group" was treated with ischemia-reperfusion injury, according to the same method in fluorescence microscopy. The observations were made and the number of labeled ganglion cells was counted.

The number of labeled ganglion cells obtained under the microscope (number / mm ² )

These results indicate that the nucleotide sequence carried by the recombinant adeno-associated virus has protective effects on ganglion cells in glaucoma caused by ischemia-reperfusion. Implementation of inverted 8 recombinant lentivirus Len-Sl-Leii-SI 9 in the treatment of ischemia-reperfusion model animal light-eye treatment effect by glaucoma model animals by ischemia-reperfusion to demonstrate recombinant adeno-associated virus preparations Inventive Example 4-2 obtained carrier Len S1~! Len-SI9, or a lentiviral vector lentivirus suspension without exogenous gene, was administered to the subretinal space of 4-week-old Wistar rats. The single dose was controlled at 2 ul per eye, and the total dose was 10 ⁹ vg / per eye. After 14 days of vector transduction, the intraocular pressure of the above rats was placed under the pressure of 110°Hg for 60 minutes of ischemic treatment. Retinal ganglion cells undergo damage. Four days after the damage, the fluorochrome DAPI (4',6-diamidino-2-pheny!indo1e) was injected into the two eyes using the brain stereotaxic apparatus to mark the ganglion cells. After 7 days of retinal ganglion cell damage (after 21 days of vector introduction), the eyeballs were removed, and the flattening was observed with a fluorescence microscope, and the number of labeled ganglion cells per 1 mm ² from the optic nerve Imni was counted.

As a control, D PBS solution was administered to the subretinal space instead of the vehicle suspension, and the "carrierless/ischemic reperfusion injury group" for ischemia-reperfusion injury treatment was observed under the fluorescence microscope in the same manner. The number of labeled ganglion cells was counted.

The above table illustrates that a recombinant lentiviral vector carrying the nucleotide sequence of the present invention has a protective effect on ganglion cells in glaucoma caused by ischemia reperfusion.

Example 9 Preparation of recombinant adeno-associated virus vector and lentiviral vector preparation 1. Preparation of preservation solution: According to the formula in Table 6, the other components outside the viral carrier are mixed to prepare a preservation solution and adjust the osmotic pressure to the corresponding value in the formula;

2. Solution replacement:

The AAV virus (1 10 ^l2 vg mJ ) obtained in the experiment 3-1, lml was placed in a labeled ultrafiltration tube, or diluted to the desired concentration with D-PBS solution or concentrated by the method of Example 4-4. Add the preservation solution prepared above to 15m at the required concentration! . Centrifuge at 4 ° C, 3000 rpm for 2 - 3 minutes, discard the supernatant, and keep 3 ml of liquid. The above-prepared preservation solution of the preparation was further added to 15 rpm, centrifuged once more at 3000 rpm, and finally the volume of the recombinant viral vector preparation was controlled to be 1 ml.

After filtration through a 0,22 μίϊΐ filter, the sample was assayed for titer immediately (within 20 minutes) after aseptic dispensing. The above experimental procedures should all be performed on ice at 0 °C. After the other remaining samples were frozen in liquid nitrogen, they were directly stored at -80 °C.

A recombinant lentiviral vector preparation was prepared in the same manner.

The therapeutic effect of recombinant adeno-associated virus vector and lentiviral vector preparation on retinitis pigmentosa model animals

Test group drug formula: Recombinant related viral vector prepared in Example 9 and lentiviral vector preparation control group Pharmaceutical formula: Empty vector virus containing the same formulation ingredients as Table 6 and containing the same as Table 6 The effect observation was carried out in the same manner as in Example 5, and the results showed that the subretinal cavity was injected with the recombinant AAV/Leu viral vector preparation carrying the nucleotide sequence shown in SEQ ID Nos. 19 of the present invention. The number of the cells is significantly increased. Specifically, the preparation of the 266 recombinant vaccine vectors of the present invention is the number of nerve cells in the control group (the vector containing the empty vector virus or the virus-free solution). 0 times, indicating that the nucleotide sequence of the present invention has a remarkable therapeutic effect.

Claims

right

A nucleotide for treating an ophthalmic disease, characterized in that the nucleotide sequence is selected from the group consisting of the following nucleotide sequences:

(1) a nucleotide sequence represented by SEQ ID Nos. 1 - 19;

(2) A nucleotide sequence having at least 80% homology to the nucleotide sequence shown by SEQ ID NosJ - 9 , respectively.

2. Nucleotide according to claim 1, characterized in that the sequence of the nucleotide is selected from the group consisting of the following nucleotide sequences:

(1) a nucleotide sequence represented by SEQ ID NO: SEQ ID NO: 3 and SEQ ID NO: 5;

(2) A nucleotide sequence having at least 90% homology to the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 5, respectively.

The nucleotide according to claim 1, wherein the nucleotide sequence is selected from the group consisting of the following nucleotide sequences:

(1) the nucleotide sequences shown in SEQ ID No: 8 and SEQ ID NO: 12;

(2) A nucleotide sequence i having at least 90% homology to the nucleotide sequences shown in SEQ ID No: 8 and SEQ ID NO: 12, respectively.

A recombinant vector for treating an ophthalmic disease, the recombinant vector comprising a vector and a foreign gene thereof, wherein the foreign gene is the nucleotide according to any one of claims 1 to 3. .

The recombinant vector according to claim 4, wherein the vector is selected from the group consisting of a DNA vector and a viral vector.

The recombinant vector according to claim 5, wherein the DNA vector is selected from the group consisting of a DNA plasmid vector, a liposome bound thereto, a molecular coupling body combined therewith, and a polymer combined therewith. In the group; the viral vector is selected from the group consisting of an adeno-associated virus vector, a lentiviral vector, and an adenoviral vector.

A cell for treating an ophthalmic disease, characterized in that the cell comprises the recombinant vector of claim 46.

The cell according to claim 7, wherein the cell is selected from the group consisting of 293T cells, pluripotent cells, retinal pigment epithelial cells, iris pigment epithelial cells, conjunctival epithelial cells, and retinal photoreceptor cells or Children.

The cell according to claim 8, wherein the pluripotent cell is selected from the group consisting of an embryonic thousand cell, a neural stem cell, a bone marrow mesenchymal cell, a hematopoietic cell, and a limbal stem cell. Kind.

A pharmaceutical composition for treating an ophthalmic disease, characterized in that the pharmaceutical composition contains a pharmaceutically acceptable excipient, and a recombinant carrier according to claim 46 and claims 7-9 One or more of the cells described.

The pharmaceutical composition according to claim 10, wherein the pharmaceutical composition is an injection, the injection comprises a pharmaceutically acceptable excipient, and any of the claims of claim 46 Recombinant vector described.

The pharmaceutical composition according to claim 11, wherein the pharmaceutically acceptable excipient is an iOmM trishydroxymethyl group which maintains the pH of the pharmaceutical composition of 7, 2 to 7, 6 A

The pharmaceutical composition according to claim 11, wherein the pharmaceutically acceptable excipient is a phosphate buffer solution for maintaining a pH of the pharmaceutical composition of 5,0-9,0; The ml injection contained 10 ⁶ - 10 ¹² vg of the recombinant vector.

The pharmaceutical composition according to claim 12 or 13, wherein the injection solution further contains a protective agent and/or an osmotic pressure adjusting agent; and the content of the protective agent is based on the injection solution. 0.01 to 30% by weight, the agent is selected from one or more of inositol, sorbitol and sucrose; the osmotic pressure adjusting agent is present in an amount such that the osmotic pressure of the injection is 200-700 milliosmoles /kg, the osmotic pressure adjusting agent is one or more selected from the group consisting of sodium chloride, potassium chloride and magnesium chloride.

15. A nucleotide selected from the group consisting of the nucleotides of claims 1-3, the recombinant vector of claims 4-6, and the cells of claims 7-9 and the composition of claims 10-14, in the preparation of a treatment Application in medicine for ophthalmic diseases „

The use according to claim 15, wherein the ophthalmic disease is an ophthalmic disease accompanying apoptosis of the ocular tissue.

17. The use according to claim 16, wherein the ophthalmic disease is selected from the group consisting of glaucoma Eyes. One or more of retinitis pigmentosa, retinal detachment, and retinal ischemic disease,