WO2012125828A2 - Methods of treating breast cancer with anthracycline therapy - Google Patents

Methods of treating breast cancer with anthracycline therapy Download PDF

Info

Publication number
WO2012125828A2
WO2012125828A2 PCT/US2012/029226 US2012029226W WO2012125828A2 WO 2012125828 A2 WO2012125828 A2 WO 2012125828A2 US 2012029226 W US2012029226 W US 2012029226W WO 2012125828 A2 WO2012125828 A2 WO 2012125828A2
Authority
WO
WIPO (PCT)
Prior art keywords
biological sample
breast cancer
subtype
anthracycline
her2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/029226
Other languages
English (en)
French (fr)
Other versions
WO2012125828A3 (en
WO2012125828A8 (en
Inventor
Charles M. Perou
Matthew J. ELLIS
Philip S. Bernard
Torsten O. Nielsen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
British Columbia Cancer Agency BCCA
University of Washington
University of North Carolina at Chapel Hill
Washington University in St Louis WUSTL
University of Utah Research Foundation Inc
Original Assignee
British Columbia Cancer Agency BCCA
University of Washington
University of North Carolina at Chapel Hill
Washington University in St Louis WUSTL
University of Utah Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by British Columbia Cancer Agency BCCA, University of Washington, University of North Carolina at Chapel Hill, Washington University in St Louis WUSTL, University of Utah Research Foundation Inc filed Critical British Columbia Cancer Agency BCCA
Priority to JP2013558177A priority Critical patent/JP5971769B2/ja
Priority to EP12757489.5A priority patent/EP2685988A4/en
Priority to AU2012229123A priority patent/AU2012229123B2/en
Priority to CA2830240A priority patent/CA2830240A1/en
Publication of WO2012125828A2 publication Critical patent/WO2012125828A2/en
Publication of WO2012125828A3 publication Critical patent/WO2012125828A3/en
Priority to IL228449A priority patent/IL228449A/en
Anticipated expiration legal-status Critical
Publication of WO2012125828A8 publication Critical patent/WO2012125828A8/en
Priority to AU2017202786A priority patent/AU2017202786A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/82Translation products from oncogenes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • This disclosure relates generally to the field of cancer biology, and specifically, to the fields of detection and identification of specific cancer cell phenotypes and correlation with appropriate therapies.
  • Anthracycline therapy has proven to be effective against many types of tumors.
  • the present invention provides a method of treating breast cancer in a subject in need thereof. This method includes the steps of providing a biological sample from the subject;
  • the subject is administered a breast cancer treatment including anthracycline. If the biological sample is not both a Her2+ subtype and a Her-2-E subtype, the subject is administered a breast cancer treatment without anthracycline.
  • the assaying of the biological sample to determine whether the biological sample is classified as a Her2+ subtype is performed using fluorescence in situ hybridization (FISH) or immunohistochemistry (IHC).
  • FISH fluorescence in situ hybridization
  • IHC immunohistochemistry
  • the assaying the biological sample to determine whether the biological sample is classified as a Her-2-E subtype is performed by detecting at least 10, at least 15, at least 20, at least 25 or all 50 of the intrinsic genes listed in Table 1. Preferably, detection is of all 50 of the intrinsic genes listed in Table 1.
  • the expression of the members of the intrinsic gene list of Table lean be determined using the nanoreporter code system (nCounter® Analysis system).
  • the anthracycline is selected from the group consisting of daunorubicin, doxorubicin, epirubicin, idarubicin, valrubicin and mitoxantrone.
  • the anthracycline is epirubicin.
  • the breast cancer treatment that includes anthracycline can also include
  • cyclophosphamide fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, t
  • cyclophosphamide fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, t
  • the biological sample can be a cell, a tissue or a bodily fluid.
  • the tissue can be sampled from a biopsy or smear.
  • the sample can also be a sampling of bodily fluids. These bodily fluids can include blood, lymph, urine, saliva, nipple aspirates and gynecological fluids.
  • the present invention also provides a method of screening for the likelihood of the effectiveness of a breast cancer treatment including an anthracycline in a subject in need thereof.
  • This method includes the steps of providing a biological sample from the subject; assaying the biological sample to determine whether the biological sample is classified as a Her2+ subtype; and assaying the biological sample to determine whether the biological sample is classified as a Her-2-E subtype. If the biological sample is classified as both a Her2+ subtype and a Her-2-E subtype, the breast cancer treatment including the anthracycline is more likely to be effective in the subject.
  • the assaying of the biological sample to determine whether the biological sample is classified as a Her2+ subtype is performed using fluorescence in situ hybridization (FISH) or immunohistochemistry (IHC).
  • FISH fluorescence in situ hybridization
  • IHC immunohistochemistry
  • the assaying the biological sample to determine whether the biological sample is classified as a Her-2-E subtype is performed by detecting at least 10, at least 15, at least 20, at least 25 or all 50 of the intrinsic genes listed in Table 1. Preferably, detection is of all 50 of the intrinsic genes listed in Table 1.
  • the expression of the members of the intrinsic gene list of Table lean be determined using the nanoreporter code system (nCounter® Analysis system).
  • the anthracycline is selected from the group consisting of daunorubicin, doxorubicin, epirubicin, idarubicin, valrubicin and mitoxantrone.
  • the anthracycline is epirubicin.
  • the breast cancer treatment that includes anthracycline can also include
  • cyclophosphamide fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronate, trastuzumab, t
  • the biological sample can be a cell, a tissue or a bodily fluid.
  • the tissues can be sampled from a tumor biopsy or surgical specimen.
  • the sample can also be a sampling of bodily fluids. These bodily fluids can include blood, lymph, urine, saliva and nipple aspirates.
  • the present invention also provides a kit for screening for the likelihood of the effectiveness of a breast cancer treatment including reagents sufficient for the detection of at least 10, at least 15, at least 20, at least 25 or all 50 of the intrinsic genes and a reagent sufficient for the detection of the amount of expression of Her2.
  • the kit includes reagents sufficient for the detection of all 50 of the intrinsic genes listed in Table 1.
  • the reagent sufficient for the detection of the at least 10, at least 15, at least 20, at least 25 or all 50 of the intrinsic genes listed in Table 1 can include a microarray.
  • the reagent sufficient for the detection of the amount of expression of Her2 can be a Her2 antibody.
  • Figure 1 is a schematic showing a REMARK Diagram of study design.
  • Figure 2A is a line graph showing a Kaplan-Meier (K-M) curve of relapse-free survival of risk classifier risk of relapse score (ROR-S) identified using the PAM50 intrinsic genes in patients that received a cyclophosphamide, methotrexate and 5-fluorouracil (CMF) treatment regimen.
  • Figure 2B is a line graph showing a K-M curve of overall survival of risk classifier ROR-S identified using the PAM50 intrinsic genes in patients that received the CMF treatment regimen.
  • Figure 2C is a line graph showing a K-M curve of relapse-free survival of risk classifier ROR-S identified using the PAM50 intrinsic genes in patients that received a cyclophosphamide, epirubicin and 5-fluorouracil (CEF) treatment regimen.
  • Figure 2D is a line graph showing a K- M curve of overall survival of risk classifier ROR-S identified using the PAM50 intrinsic genes in patients that received the CEF treatment regimen.
  • Figure 3A shows a multivariable Cox regression analysis adjusted relapse free survival (RFS) hazard ratio plots by PAM50 intrinsic subtype, adjusted for clinicopathological variables.
  • Figure 3B shows a multivariable Cox regression analysis adjusted overall survival (OS) hazard ratio plots by PAM50 intrinsic subtype, adjusted for clinicopathological variables.
  • RFS relapse free survival
  • OS multivariable Cox regression analysis adjusted overall survival
  • Figure 4A a line graph showing a K-M curve of relapse-free survival of treatment arms, CEF vs. CMF, in the HER2-E subtype.
  • Figure 4B a line graph showing a K-M curve of relapse- free survival of treatment arms, CEF vs. CMF, in the basal-like subtype.
  • Figure 4C a line graph showing a K-M curve of relapse-free survival of treatment arms, CEF vs. CMF, in the LumB subtype.
  • Figure 4D a line graph showing a K-M curve of relapse-free survival of treatment arms, CEF vs. CMF, in the LumA subtype.
  • Figure 4E a line graph showing a K-M curve of overall survival of treatment arms, CEF vs. CMF, in the HER2-E subtype.
  • Figure 4F a line graph showing a K-M curve of overall survival of treatment arms, CEF vs. CMF, in the basal-like subtype.
  • Figure 4G a line graph showing a K-M curve of overall survival of treatment arms, CEF vs. CMF, in the LumB subtype.
  • Figure 4H a line graph showing a K-M curve of overall survival of treatment arms, CEF vs. CMF, in the LumA subtype.
  • Figure 5A is a line graph showing the predicted rate of relapse-free survival as a continuous function of the correlation to HER2-E subtype centroid stratified by adjuvant CEF and CMF treatment.
  • Figure 5B is a line graph showing the predicted rate of overall survival as a continuous function of the correlation to HER2-E subtype centroid stratified by adjuvant CEF and CMF treatment.
  • the continuous function was generated from a multivariable Cox model including standard clinicopathological variables and HER2-E centroid.
  • X-axis shows the correlation of a tumor to HER2-E centroid; i.e., the higher the positive correlation value, the higher HER2-E subtype component within that sample.
  • the Y-axis shows the predicted relapse- free and overall survival at 5-years for individual patients
  • the present invention provides a method of determining whether a breast cancer treatment comprising an anthracycline is optimal for administration to a patient suffering from breast cancer. Determining whether a breast cancer patient should receive a treatment including anthracycline includes determining the subtype of the breast cancer using an intrinsic gene expression set and determining the Her2 status of the breast cancer by using fluorescence in situ hybridization analysis (FISH) or immunohistochemistry (IHC). The disclosure also provides a method of treating breast cancer by determining whether a breast cancer patient should receive a treatment including anthracycline and then administering the optimal breast cancer treatment to the patient based on that determination.
  • FISH fluorescence in situ hybridization analysis
  • IHC immunohistochemistry
  • Intrinsic genes are statistically selected to have low variation in expression between biological sample replicates from the same individual and high variation in expression across samples from different individuals. Thus, intrinsic genes are used as classifier genes for breast cancer classification. Although clinical information was not used to derive the breast cancer intrinsic subtypes, this classification has proved to have prognostic significance. Intrinsic gene screening can be used to classify breast cancers into various subtypes. The major intrinsic subtypes of breast cancer are referred to as Luminal A (LumA), Luminal B (LumB), HER2-enriched (Her-2-E), Basal-like, and Normal-like (Perou et al. Nature, 406(6797):747-52 (2000); Sorlie et al. PNAS, 98(19):10869-74 (2001)).
  • the PAM50 gene expression assay (Parker et al. J Clin Oncol., 27(8): 1160-7 (2009) and U.S. Patent Application Publication No. 2011/0145176, both incorporated herein, by reference, in their entireties) is able to identify intrinsic subtype from standard formalin fixed paraffin embedded tumor tissue.
  • the methods utilize a supervised algorithm to classify subject samples according to breast cancer intrinsic subtype.
  • This algorithm referred to herein as the PAM50 classification model, is based on the gene expression profile of a defined subset of intrinsic genes that has been identified herein as superior for classifying breast cancer intrinsic subtypes.
  • the subset of genes, along with primers specific for their detection, is provided in Table 1.
  • CDH3 BC041846 G AC AA G GAGA ATC 12 ACTGTCTGGGTCCAT 62
  • RRM2 A 123010 AATGCCACCGAAG 45 GCCTCAGATTTCAAC 95
  • Table 2 provides select sequences for the PAM50 genes of Table 1
  • NM_00101227 CCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATT 106 1 AACCGCCAGATTTGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGC
  • NM_031423 GCGGAATGGGGCGGGACTTCCAGTAGGAGGCGGCAAGTTTGAAAAGTGATGACGGTTGACGTTTGCTGAT 113
  • NM_005310 ACCCGCCCCCATCTGCCCAAGATAATTTTAGTTTCCTTGGGCCTGGAATCTGGACACACAGGGCTCCCCC 126
  • NM_014176 AGTCAGAGGTCGCGCAGGCGCTGGTACCCCGTTGGTCCGCGCGTTGCTGCGTTGTGAGGGGTGTCAGCTC 127
  • BC042437 CTCCCTCCTCTGCACCATGAC TACCTGCAGCCGCCAGTTCACCTCCTCCAGCTCCATGAAGGGCTCCTGC 130
  • FISH analysis or IHC was also performed on samples from patients to classify breast cancers. Samples that showed an amplification ratio of greater than 2.0 for Her2 were classified at Her2+. Because of the multitude of sources of specimens with a wide range of fixatives and processing techniques, a "subtraction scoring" was used. (See Yaziji et al. JAMA 291(16): 1972- 1977 (Apr. 2004)). Using this method any visible signal of the non-neoplastic breast epithelium is counted as negative and subtracts the score of the tumor cells from that of the benign cells. When the subtraction score is 2+, the cells were classified as Her2+.
  • Subjects that were shown to be Her2+ using FISH analysis or IHC also surprisingly had a better prognosis on average when treated with a breast cancer treatment that includes an anthracylcine.
  • breast cancer includes, for example, those conditions classified by biopsy or histology as malignant pathology.
  • the clinical delineation of breast cancer diagnoses is well known in the medical arts.
  • breast cancer refers to any malignancy of the breast tissue, including, for example, carcinomas and sarcomas.
  • Particular embodiments of breast cancer include ductal carcinoma in situ (DCIS), lobular carcinoma in situ (LCIS), or mucinous carcinoma.
  • Breast cancer also refers to infiltrating ductal (IDC), lobular neoplasia or infiltrating lobular carcinoma (ILC).
  • the subject of interest is a human patient suspected of or actually diagnosed with breast cancer.
  • Breast cancer includes all forms of cancer of the breast.
  • Breast cancer can include primary epithelial breast cancers.
  • Breast cancer can include cancers in which the breast is involved by other tumors such as lymphoma, sarcoma or melanoma.
  • Breast cancer can include carcinoma of the breast, ductal carcinoma of the breast, lobular carcinoma of the breast, undifferentiated carcinoma of the breast, cystosarcoma phyllodes of the breast, angiosarcoma of the breast, and primary lymphoma of the breast.
  • Breast cancer can include Stage I, II, IIIA, IIIB, IIIC and IV breast cancer.
  • Ductal carcinoma of the breast can include invasive carcinoma, invasive carcinoma in situ with predominant intraductal component, inflammatory breast cancer, and a ductal carcinoma of the breast with a histologic type selected from the group consisting of comedo, mucinous (colloid), medullary, medullary with lymphcytic infiltrate, papillary, scirrhous, and tubular.
  • Lobular carcinoma of the breast can include invasive lobular carcinoma with predominant in situ component, invasive lobular carcinoma, and infiltrating lobular carcinoma.
  • Breast cancer can include Paget' s disease, Paget' s disease with intraductal carcinoma, and Paget' s disease with invasive ductal carcinoma.
  • Breast cancer can include breast neoplasms having histologic and ultrastructual heterogeneity ⁇ e.g., mixed cell types).
  • a breast cancer that is to be treated can include familial breast cancer.
  • a breast cancer that is to be treated can include sporadic breast cancer.
  • a breast cancer that is to be treated can arise in a male subject.
  • a breast cancer that is to be treated can arise in a female subject.
  • a breast cancer that is to be treated can arise in a premenopausal female subject or a
  • a breast cancer that is to be treated can include a localized tumor of the breast.
  • a breast cancer that is to be treated can include a tumor of the breast that is associated with a negative sentinel lymph node (SLN) biopsy.
  • a breast cancer that is to be treated can include a tumor of the breast that is associated with a positive sentinel lymph node (SLN) biopsy.
  • a breast cancer that is to be treated can include a tumor of the breast that is associated with one or more positive axillary lymph nodes, where the axillary lymph nodes have been staged by any applicable method.
  • a breast cancer that is to be treated can include a tumor of the breast that has been typed as having nodal negative status ⁇ e.g., node-negative) or nodal positive status ⁇ e.g., node- positive).
  • a breast cancer that is to be treated can include a tumor of the breast that has metastasized to other locations in the body.
  • a breast cancer that is to be treated can be classified as having metastasized to a location selected from the group consisting of bone, lung, liver, or brain.
  • a breast cancer that is to be treated can be classified according to a characteristic selected from the group consisting of metastatic, localized, regional, local-regional, locally advanced, distant, multicentric, bilateral, ipsilateral, contralateral, newly diagnosed, recurrent, and inoperable.
  • anthracyclines are a class of drugs used in cancer chemotherapy derived from Streptomyces bacteria. These drugs are used to treat a wide variety of cancers including breast cancer. However, this class of drugs is extremely toxic and produces significant deleterious side effects including heart damage and vomiting.
  • Anthracyclines include daunorubicin, doxorubicin, epirubicin, idarubicin, valrubicin and mitoxantrone.
  • a breast cancer treatment comprising anthracycline is a breast cancer treatment that includes an anthracyclines. These treatments can also include other anti-cancer or chemotherapeutic agents.
  • a breast cancer treatment not comprising anthracycline is a breast cancer treatment that does not include any anthracycline. These treatments contain other anti-cancer or chemotherapeutic agents.
  • Classes of anti-cancer or chemotherapeutic agents can include alkylating agents, platinum agents, taxanes, vinca agents, anti-estrogen drugs, aromatase inhibitors, ovarian suppression agents, endocrine/hormonal agents, bisphophonate therapy agents and targeted biological therapy agents.
  • Specific anti-cancer or chemotherapeutic agents can include cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, thiotepa, carboplatin, cisplatin, taxanes, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixabepilone, temozolmide, topotecan, vincristine, vinblastine, eribulin, mutamycin, capecitabine, capecitabine, anastrozole, exemestane, letrozole, leuprolide, abarelix, buserlin, goserelin, megestrol acetate, risedronate, pamidronate,
  • ibandronate alendronate, denosumab, zoledronate, trastuzumab, tykerb or bevacizumab, or combinations thereof.
  • Combinational anti-cancer or chemotherapeutic therapies can include AT: Adriamycin ® (Doxorubicin) and Taxotere ® (Docetaxel); AC: Adriamycin ® , Cytoxan ® (Cyclophosphamide); AC + Taxol ® ; AC + Taxotere ® ; CMF: Cytoxan ® , Methotrexate, 5-fluorouracil; CEF: Cytoxan ® , Ellence ® (Epirubicin), and fluorouracil; EC: Ellence ® , Cytoxan ® ; FAC: 5-fluorouracil,
  • Adriamycin ® and Cytoxan ® ;
  • TC gemzar ® (Gemcitabine), Ellence ® , and Taxol ® ;
  • Taxotere ® Cytoxan ® ; TC: Taxotere ® , Paraplatin ® (Carboplatin); TAC: Taxotere ® , Adriamycin ® , Cytoxan ® or TCH: Taxotere ® , Herceptin ® (Trastuzumab), and Paraplatin ® .
  • Additional combination chemotherapeutic therapies for metastatic breast cancer can include: Taxol and Xeloda ® (Capecitabine); Taxotere ® and Xeloda ® ; Taxotere ® and Paraplatin ® ; Taxol ® and
  • Paraplatin ® ; Taxol ® and Gemzar ® ; Abraxane ® (Protein-bound Paclitaxel) and Xeloda ® ;
  • the anti-cancer or chemotherapeutic agents include cyclophosphamide and 5- fluorouracil or include methotrexate, cyclophosphamide and 5-fluorouracil.
  • anthracyclines can be administered in the breast cancer treatments described herein.
  • anthracyclines are administered intravenously, but can be administered by any method known in the art.
  • Anthracyclines can be administered at dosages from 10 mg/m to 300 mg/m 2 per week.
  • Anthracyclines can be administered at 20-200 mg/m 2 , 30-100 mg/m 2 , or 35-75 mg/m per week.
  • the anthracycline is administered at about 60 mg/m2 per week.
  • methotrexate is administered intravenously, but can be administered by any method known in the art. Methotrexate can be administered between 1 mg/m2 and 500 mg/m2.
  • Methotrexate can be administered at 10-200 mg/m 2 , 20-100 mg/m 2 or 30-60 mg/m 2 per week. Preferably, methotrexate is administered at about 40 mg/m per week.
  • 5-flurouracil is administered intravenously, but can be administered by any method known in the art.
  • 5-flurouracil can be administered at dosages from 25 mg/m to 1000 mg/m 2 per week.
  • 5-flurouracil can be administered at 50-900 mg/m 2", 100-800 mg/m 2", 300-700 mg/m 2 or 450-650 mg/m 2 per week.
  • 5-flurouracil is administered at about 500 mg/m 2 per week.
  • cyclophosphamide is administered orally, but can be administered by any method known in the art.
  • Cyclophosphamide can be administered at dosages from 10 mg/m to
  • Cyclophosphamide can be administered at 20-200 mg/m 2 , 30-100 mg/m 2 , or
  • cyclophosphamide is administered at about 75 mg/m 2 per day.
  • the PAM50 classification model described herein may be further combined with information on clinical variables to generate a continuous risk of relapse (ROR) predictor.
  • ROR risk of relapse
  • a number of clinical and prognostic breast cancer factors are known in the art and are used to predict treatment outcome and the likelihood of disease recurrence. Such factors include, for example, lymph node involvement, tumor size, histologic grade, estrogen and progesterone hormone receptor status, HER-2 levels, and tumor ploidy.
  • risk of relapse (ROR) score is provided for a subject diagnosed with or suspected of having breast cancer. This score uses the PAM50 classification model in combination with clinical factors of lymph node status (N) and tumor size (T).
  • Lymph node status is classified as N0-N3 (NO: regional lymph nodes are free of metastasis; Nl : metastasis to movable, same-side axillary lymph node(s); N2: metastasis to same-side lymph node(s) fixed to one another or to other structures; N3: metastasis to same- side lymph nodes beneath the breastbone).
  • Methods of identifying breast cancer patients and staging the disease are well known and may include manual examination, biopsy, review of patient's and/or family history, and imaging techniques, such as mammography, magnetic resonance imaging (MRI), and positron emission tomography (PET).
  • MRI magnetic resonance imaging
  • PET positron emission tomography
  • breast cancer subtype is assessed through the evaluation of expression patterns, or profiles, of the intrinsic genes listed in Table 1 in one or more subject samples and/or FISH analysis or IHC performed to ascertain the Her-2 status of the cancer.
  • subject, or subject sample refers to an individual regardless of health and/or disease status.
  • a subject can be a subject, a study participant, a control subject, a screening subject, or any other class of individual from whom a sample is obtained and assessed in the context of the disclosure.
  • a subject can be diagnosed with breast cancer, can present with one or more symptoms of breast cancer, or a predisposing factor, such as a family (genetic) or medical history (medical) factor, for breast cancer, can be undergoing treatment or therapy for breast cancer, or the like.
  • a predisposing factor such as a family (genetic) or medical history (medical) factor
  • the subject is a subject in need of treatment for breast cancer or detection of breast cancer.
  • a subject can be healthy with respect to any of the aforementioned factors or criteria.
  • the term “healthy” as used herein, is relative to breast cancer status, as the term “healthy” cannot be defined to correspond to any absolute evaluation or status.
  • an individual defined as healthy with reference to any specified disease or disease criterion can in fact be diagnosed with any other one or more diseases, or exhibit any other one or more disease criterion, including one or more cancers other than breast cancer.
  • the healthy controls are preferably free of any cancer.
  • a "subject in need thereof is a subject having breast cancer or presenting with one or more symptoms of breast cancer, or a subject having an increased risk of developing breast cancer relative to the population at large.
  • a subject in need thereof has breast cancer.
  • a "subject” includes a mammal.
  • the mammal can be e.g., any mammal, e.g., a human, primate, bird, mouse, rat, fowl, dog, cat, cow, horse, goat, camel, sheep or a pig.
  • the mammal is a human.
  • the methods for predicting breast cancer intrinsic subtypes or Her-2 status include collecting a biological sample comprising a cancer cell or tissue, such as a breast tissue sample or a primary breast tumor tissue sample.
  • biological sample is intended any sampling of cells, tissues, or bodily fluids in which expression of an intrinsic gene can be detected. Examples of such biological samples include, but are not limited to, biopsies and smears.
  • Bodily fluids useful in the present disclosure include blood, lymph, urine, saliva, nipple aspirates, gynecological fluids, or any other bodily secretion or derivative thereof. Blood can include whole blood, plasma, serum, or any derivative of blood.
  • the biological sample includes breast cells, particularly breast tissue from a biopsy, such as a breast tumor tissue sample.
  • Biological samples may be obtained from a subject by a variety of techniques including, for example, by scraping or swabbing an area, by using a needle to aspirate cells or bodily fluids, or by removing a tissue sample (i.e., biopsy). Methods for collecting various biological samples are well known in the art.
  • a breast tissue sample is obtained by, for example, fine needle aspiration biopsy, core needle biopsy, or excisional biopsy. Fixative and staining solutions may be applied to the cells or tissues for preserving the specimen and for facilitating examination.
  • Biological samples, particularly breast tissue samples may be transferred to a glass slide for viewing under magnification.
  • the biological sample is a formalin-fixed, paraffin-embedded breast tissue sample, particularly a primary breast tumor sample.
  • the tissue sample is obtained from a pathologist-guided tissue core sample.
  • the present disclosure provides methods for classifying, prognosticating, or monitoring breast cancer in subjects.
  • data obtained from analysis of intrinsic gene expression is evaluated using one or more pattern recognition algorithms.
  • Such analysis methods may be used to form a predictive model, which can be used to classify test data.
  • one convenient and particularly effective method of classification employs multivariate statistical analysis modeling, first to form a model (a "predictive mathematical model") using data (“modeling data”) from samples of known subtype ⁇ e.g., from subjects known to have a particular breast cancer intrinsic subtype: LumA, LumB, Basal-like, HER2-enriched, or normal-like), and second to classify an unknown sample ⁇ e.g., "test sample”) according to subtype.
  • Pattern recognition methods have been used widely to characterize many different types of problems ranging, for example, over linguistics, fingerprinting, chemistry and psychology.
  • pattern recognition is the use of multivariate statistics, both parametric and non-parametric, to analyze data, and hence to classify samples and to predict the value of some dependent variable based on a range of observed measurements.
  • One set of methods is termed "unsupervised” and these simply reduce data complexity in a rational way and also produce display plots which can be interpreted by the human eye.
  • this type of approach may not be suitable for developing a clinical assay that can be used to classify samples derived from subjects independent of the initial sample population used to train the prediction algorithm.
  • the other approach is termed "supervised” whereby a training set of samples with known class or outcome is used to produce a mathematical model which is then evaluated with independent validation data sets.
  • a "training set” of intrinsic gene expression data is used to construct a statistical model that predicts correctly the "subtype” of each sample.
  • This training set is then tested with independent data (referred to as a test or validation set) to determine the robustness of the computer-based model.
  • These models are sometimes termed “expert systems,” but may be based on a range of different mathematical procedures.
  • Supervised methods can use a data set with reduced dimensionality (for example, the first few principal components), but typically use unreduced data, with all dimensionality.
  • the methods allow the quantitative description of the multivariate boundaries that characterize and separate each subtype in terms of its intrinsic gene expression profile. It is also possible to obtain confidence limits on any predictions, for example, a level of probability to be placed on the goodness of fit. The robustness of the predictive models can also be checked using cross-validation, by leaving out selected samples from the analysis.
  • the PAM50 classification model described herein is based on the gene expression profile for a plurality of subject samples using the intrinsic genes listed in Table 1.
  • the plurality of samples includes a sufficient number of samples derived from subjects belonging to each subtype class.
  • sufficient samples or “representative number” in this context is intended a quantity of samples derived from each subtype that is sufficient for building a classification model that can reliably distinguish each subtype from all others in the group.
  • a supervised prediction algorithm is developed based on the profiles of objectively- selected prototype samples for "training" the algorithm. The samples are selected and subtyped using an expanded intrinsic gene set according to the methods disclosed in U.S. Patent Publication No. 2009/0299640, which is herein incorporated by reference in its entirety.
  • the samples can be subtyped according to any known assay for classifying breast cancer subtypes. After stratifying the training samples according to subtype, a centroid-based prediction algorithm is used to construct centroids based on the expression profile of the intrinsic gene set described in Table 1.
  • the prediction algorithm is the nearest centroid methodology related to that described in Narashiman and Chu (2002) PNAS 99:6567-6572, which is herein incorporated by reference in its entirety.
  • the method computes a standardized centroid for each subtype. This centroid is the average gene expression for each gene in each subtype (or "class") divided by the within-class standard deviation for that gene.
  • Nearest centroid classification takes the gene expression profile of a new sample, and compares it to each of these class centroids.
  • Subtype prediction is done by calculating the Spearman's rank correlation of each test case to the five centroids, and assigning a sample to a subtype based on the nearest centroid.
  • detecting expression is intended determining the quantity or presence of an RNA transcript or its expression product of an intrinsic gene.
  • Methods for detecting expression of the intrinsic genes of the disclosure include methods based on hybridization analysis of polynucleotides, methods based on sequencing of polynucleotides, immunohistochemistry methods, and proteomics-based methods. The methods generally detect expression products (e.g., mRNA) of the intrinsic genes listed in Table 1.
  • PCR-based methods such as reverse transcription PCR (RT- PCR) (Weis et al, TIG 8:263- 64, 1992), and array-based methods such as microarray (Schena et al., Science 270:467- 70, 1995) are used.
  • microarray is intended an ordered arrangement of hybridizable array elements, such as, for example, polynucleotide probes, on a substrate.
  • probe refers to any molecule that is capable of selectively binding to a specifically intended target biomolecule, for example, a nucleotide transcript or a protein encoded by or corresponding to an intrinsic gene.
  • Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
  • RNA isolated from a biological sample such as a tumor or tumor cell line
  • RNA ⁇ e.g., mRNA
  • tissue samples e.g., pathologist-guided tissue core samples.
  • RNA isolation can be performed using a purification kit, a buffer set and protease from commercial manufacturers, such as Qiagen (Valencia, CA), according to the manufacturer's instructions.
  • RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns.
  • Other commercially available RNA isolation kits include MASTERPURETM Complete DNA and RNA Purification Kit (Epicentre, Madison, Wis.) and Paraffin Block RNA Isolation Kit
  • RNA from tissue samples can be isolated, for example, using RNA Stat-60 (Tel-Test, Friendswood, TX).
  • RNA prepared from a tumor can be isolated, for example, by cesium chloride density gradient centrifugation. Additionally, large numbers of tissue samples can readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski (U.S. Pat. No.
  • Isolated RNA can be used in hybridization or amplification assays that include, but are not limited to, PCR analyses and probe arrays.
  • One method for the detection of RNA levels involves contacting the isolated RNA with a nucleic acid molecule (probe) that can hybridize to the mRNA encoded by the gene being detected.
  • the nucleic acid probe can be, for example, a full-length cDNA, or a portion thereof, such as an oligonucleotide of at least 7, 15, 30, 60, 100, 250, or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to an intrinsic gene of the present disclosure, or any derivative DNA or RNA.
  • Hybridization of an mRNA with the probe indicates that the intrinsic gene in question is being expressed.
  • the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
  • the probes are immobilized on a solid surface and the mRNA is contacted with the probes, for example, in an Agilent gene chip array.
  • Agilent gene chip array A skilled artisan can readily adapt known mRNA detection methods for use in detecting the level of expression of the intrinsic genes of the present disclosure.
  • An alternative method for determining the level of intrinsic gene expression product in a sample involves the process of nucleic acid amplification, for example, by RT-PCR (U.S. Pat. No. 4,683,202), ligase chain reaction (Barany, PNAS USA 88: 189-93, (1991)), self sustained sequence replication (Guatelli et al, Proc. Natl. Acad. Sci USA 87: 1874-78, (1990)), transcriptional amplification system (Kwoh et ah, Proc. Natl. Acad.
  • PCR a target polynucleotide sequence is amplified by reaction with at least one oligonucleotide primer or pair of oligonucleotide primers.
  • the primer(s) hybridize to a complementary region of the target nucleic acid and a DNA polymerase extends the primer(s) to amplify the target sequence.
  • a nucleic acid fragment of one size dominates the reaction products (the target polynucleotide sequence which is the amplification product).
  • the amplification cycle is repeated to increase the concentration of the single target polynucleotide sequence.
  • the reaction can be performed in any thermocycler commonly used for PCR. However, preferred are cyclers with real time fluorescence measurement capabilities, for example, SMARTCYCLER® (Cepheid, Sunnyvale, CA), ABI PRISM 7700® (Applied Biosystems, Foster City, Calif.), ROTOR- GENETM (Corbett Research, Sydney, Australia), LIGHTCYCLER® (Roche
  • microarrays are used for expression profiling. Microarrays are particularly well suited for this purpose because of the reproducibility between different experiments. DNA microarrays provide one method for the simultaneous measurement of the expression levels of large numbers of genes. Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA or DNA is hybridized to
  • Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, for example, U.S. Pat. Nos. 6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316. High-density oligonucleotide arrays are particularly useful for determining the gene expression profile for a large number of RNAs in a sample.
  • the nCounter® Analysis system is used to detect intrinsic gene expression.
  • the basis of the nCounter® Analysis system is the unique code assigned to each nucleic acid target to be assayed (U.S. Patent Application Publication No. 2010/0112710 and Geiss et al. Nature Biotechnology. 2008. 26(3): 317-325; the contents of which are each incorporated herein by reference in their entireties).
  • the code is composed of an ordered series of colored fluorescent spots which create a unique barcode for each target to be assayed.
  • a pair of probes is designed for each DNA or RNA target, a biotinylated capture probe and a reporter probe carrying the fluorescent barcode. This system is also referred to, herein, as the
  • reporter and capture probes are synthesized for each target. Briefly, sequence- specific DNA oligonucleotide probes are attached to code-specific reporter molecules. Capture probes are made by ligating a second sequence- specific DNA oligonucleotide for each target to a universal oligonucleotide containing biotin. Reporter and capture probes are all pooled into a single hybridization mixture, the "probe library”.
  • the relative abundance of each target is measured in a single multiplexed hybridization reaction.
  • the sample is combined with the probe library, and hybridization occurs in solution.
  • the tripartite hybridized complexes are purified in a two-step procedure using magnetic beads linked to oligonucleotides complementary to universal sequences present on the capture and reporter probes. This dual purification process allows the hybridization reaction to be driven to completion with a large excess of target- specific probes, as they are ultimately removed, and, thus, do not interfere with binding and imaging of the sample. All post hybridization steps are handled robotically on a custom liquid-handling robot (Prep Station, NanoString Technologies).
  • NanoString Technlogies The expression level of a target is measured by imaging each sample and counting the number of times the code for that target is detected. For each sample, typically 600 fields-of-view (FOV) are imaged (1376 X 1024 pixels) representing approximately 10 mm of the binding surface. Typical imaging density is 100-1200 counted reporters per field of view depending on the degree of multiplexing, the amount of sample input, and overall target abundance. Data is output in simple spreadsheet format listing the number of counts per target, per sample. [69] This system can be used along with nanoreporters. Additional disclosure regarding nanoreporters can be found in U.S. Patent Application Publication Nos. 2010/0015607 and 2010/0261026, the contents of which are incorporated herein in their entireties. Further, the term nucleic acid probes and nanoreporters can include the rationally designed (e.g. synthetic sequences) described in U.S. Patent Application Publication No. 2010/0047924, incorporated herein by reference in its entirety.
  • Multivariate projection methods such as principal component analysis (PCA) and partial least squares analysis (PLS), are so-called scaling sensitive methods.
  • PCA principal component analysis
  • PLS partial least squares analysis
  • Scaling and weighting may be used to place the data in the correct metric, based on knowledge and experience of the studied system, and therefore reveal patterns already inherently present in the data.
  • missing data may replaced or "filled” with, for example, the mean value of a column ("mean fill”); a random value (“random fill”); or a value based on a principal component analysis (“principal component fill”).
  • Translation of the descriptor coordinate axes can be useful. Examples of such translation include normalization and mean centering. “Normalization” may be used to remove sample-to-sample variation. For microarray data, the process of normalization aims to remove systematic errors by balancing the fluorescence intensities of the two labeling dyes. The dye bias can come from various sources including differences in dye labeling efficiencies, heat and light sensitivities, as well as scanner settings for scanning two channels. Some commonly used methods for calculating normalization factor include: (i) global normalization that uses all genes on the array; (ii) housekeeping genes normalization that uses constantly expressed
  • the intrinsic genes disclosed herein can be normalized to control housekeeping genes.
  • the housekeeping genes described in U.S. Patent Publication 2008/0032293, which is herein incorporated by reference in its entirety, can be used for normalization.
  • Exemplary housekeeping genes include MRPL19, PSMC4, SF3A1, PUM1, ACTB, GAPD, GUSB, RPLPO, and TFRC. It will be understood by one of skill in the art that the methods disclosed herein are not bound by normalization to any particular housekeeping genes, and that any suitable housekeeping gene(s) known in the art can be used.
  • microarray data is normalized using the LOWESS method, which is a global locally weighted scatterplot smoothing normalization function.
  • qPCR data is normalized to the geometric mean of set of multiple housekeeping genes.
  • “Mean centering” may also be used to simplify interpretation. Usually, for each descriptor, the average value of that descriptor for all samples is subtracted. In this way, the mean of a descriptor coincides with the origin, and all descriptors are "centered” at zero. In “unit variance scaling,” data can be scaled to equal variance. Usually, the value of each descriptor is scaled by 1/StDev, where StDev is the standard deviation for that descriptor for all samples. "Pareto scaling” is, in some sense, intermediate between mean centering and unit variance scaling.
  • each descriptor In pareto scaling, the value of each descriptor is scaled by l/sqrt(StDev), where StDev is the standard deviation for that descriptor for all samples. In this way, each descriptor has a variance numerically equal to its initial standard deviation.
  • the pareto scaling may be performed, for example, on raw data or mean centered data.
  • logarithmic scaling may be used to assist interpretation when data have a positive skew and/or when data spans a large range, e.g., several orders of magnitude. Usually, for each descriptor, the value is replaced by the logarithm of that value. In “equal range scaling,” each descriptor is divided by the range of that descriptor for all samples. In this way, all descriptors have the same range, that is, 1. However, this method is sensitive to presence of outlier points. In “autoscaling,” each data vector is mean centered and unit variance scaled. This technique is a very useful because each descriptor is then weighted equally, and large and small values are treated with equal emphasis.
  • data is collected for one or more test samples and classified using the PAM50 classification model described herein.
  • DWD Distance Weighted Discrimination
  • DWD is a multivariate analysis tool that is able to identify systematic biases present in separate data sets and then make a global adjustment to compensate for these biases; in essence, each separate data set is a multi-dimensional cloud of data points, and DWD takes two points clouds and shifts one such that it more optimally overlaps the other.
  • the methods described herein may be implemented and/or the results recorded using any device capable of implementing the methods and/or recording the results.
  • devices that may be used include but are not limited to electronic computational devices, including computers of all types.
  • the computer program that may be used to configure the computer to carry out the steps of the methods may be contained in any computer readable medium capable of containing the computer program. Examples of computer readable medium that may be used include but are not limited to diskettes, CD- ROMs, DVDs, ROM, RAM, and other memory and computer storage devices.
  • the computer program that may be used to configure the computer to carry out the steps of the methods and/or record the results may also be provided over an electronic network, for example, over the internet, an intranet, or other network.
  • Outcome may refer to overall or disease-specific survival, event-free survival, or outcome in response to a particular treatment or therapy.
  • the methods may be used to predict the likelihood of long-term, disease- free survival.
  • Predicting the likelihood of survival of a breast cancer patient is intended to assess the risk that a patient will die as a result of the underlying breast cancer.
  • Long-term, disease-free survival is intended to mean that the patient does not die from or suffer a recurrence of the underlying breast cancer within a period of at least five years, or at least ten or more years, following initial diagnosis or treatment.
  • outcome is predicted based on classification of a subject according to subtype. This classification is based on expression profiling using the list of intrinsic genes listed in Table 1.
  • the PAM50 bioinformatics model provides a measurement of the similarity of a test sample to all four subtypes which is translated into a Risk of Relapse (ROR) score that can be used in any patient population regardless of disease status and treatment options.
  • ROR Risk of Relapse
  • the intrinsic subtypes and ROR also have value in the prediction of pathological complete response in women treated with, for example, neoadjuvant taxane and anthracycline chemotherapy (Rouzier et ah, J Clin Oncol 23:8331-9 (2005), incorporated herein by reference in its entirety).
  • a risk of relapse (ROR) model is used to predict outcome.
  • ROR risk of relapse
  • subjects can be stratified into low, medium, and high risk of relapse groups.
  • Calculation of ROR can provide prognostic information to guide treatment decisions and/or monitor response to therapy.
  • the prognostic performance of the PAM50- defined intrinsic subtypes and/or other clinical parameters is assessed utilizing a Cox
  • Proportional Hazards Model Analysis which is a regression method for survival data that provides an estimate of the hazard ratio and its confidence interval.
  • the Cox model is a well- recognized statistical technique for exploring the relationship between the survival of a patient and particular variables. This statistical method permits estimation of the hazard ⁇ i.e., risk) of individuals given their prognostic variables ⁇ e.g., intrinsic gene expression profile with or without additional clinical factors, as described herein).
  • the "hazard ratio" is the risk of death at any given time point for patients displaying particular prognostic variables. See generally Spruance et al, Antimicrob. Agents & Chemo. 48:2787-92 (2004).
  • the PAM50 classification model described herein can be trained for risk of relapse using subtype distances (or correlations) alone, or using subtype distances with clinical variables as discussed supra.
  • the risk score for a test sample is calculated using intrinsic subtype distances alone using the following equation:
  • ROR 0.05*Basal + 0.1 l*Her2 + -0.25*LumA + 0.07*LumB + -0.1 l*Normal, where the variables "Basal,” “Her2,” “LumA,” “LumB,” and “Normal” are the distances to the centroid for each respective classifier when the expression profile from a test sample is compared to centroids constructed using the gene expression data deposited with the Gene Expression Omnibus (GEO) as accession number GSE2845.
  • GEO Gene Expression Omnibus
  • risk score for a test sample is calculated using intrinsic subtype distances alone using the following equation:
  • ROR-S 0.05*Basal + 0.12*Her2 + -0.34*LumA + 0.0.23*LumB, where the variables "Basal,” “Her2,” “LumA,” and “LumB” are as described supra and the test expression profiles are compared to centroids constructed using the gene expression data deposited with GEO as accession number GSE2845.
  • a Ki67 antibody (clone SP6; ThermoScientific, Fremont, CA) can be applied at a 1:200 dilution for 32 minutes, by following the Ventana Benchmark automated immunostainer (Ventana, Arlington AZ) standard Cell Conditioner 1 (CC1, a proprietary buffer) protocol at 98°C for 30 minutes.
  • An ER antibody (clone SPl; ThermoFisher Scientific, Fremont CA) can be used at 1:250 dilution with 10-minute incubation, after an 8-minute microwave antigen retrieval in 10 mM sodium citrate (pH 6.0).
  • Ready-to-use PR antibody (clone 1E2; Ventana) can be used by following the CC1 protocol as above.
  • HER2 staining can be done with a SP3 antibody (ThermoFisher Scientific) at a 1:100 dilution after antigen retrieval in 0.05 M Tris buffer (pH 10.0) with heating to 95°C in a steamer for 30 minutes.
  • FISH fluorescent in situ hybridization
  • slides can be hybridized with probes to LSI (locus- specific identifier) HER2/neu and to centromere 17 by use of the PathVysion HER-2 DNA Probe kit (Abbott Molecular, Abbott Park, IL) according to manufacturer's instructions, with modifications to pretreatment and hybridization as previously described (Brown LA, Irving J, Parker R, et al.
  • Tumors were considered positive for ER or PR if immuno staining was observed in more than 1% of tumor nuclei, as described previously. Tumors were considered positive for HER2 if immuno staining was scored as 3+ according to HercepTest criteria, with an amplification ratio for fluorescent in situ hybridization of 2.0 or more being the cut point that was used to segregate immunohistochemistry equivocal tumors (scored as 2+) (Yaziji, et ah, JAMA, 291(16): 1972- 1977 (2004)). Ki67 was visually scored for percentage of tumor cell nuclei with positive immuno staining above the background level by two pathologists.
  • kits useful for classifying breast cancer intrinsic subtypes and/or providing prognostic information to identify breast cancers that are more responsive to anthracyclines comprise a set of capture probes and/or primers specific for the intrinsic genes listed in Table 1, as well as reagents sufficient to facilitate detection and/or quantitation of Her2, in order to classify cells as Her2+.
  • the kit comprises a set of capture probes and/or primers specific for at least 10, at least 15, at least 20, at least 25 of the intrinsic genes or all 50 intrinsic genes listed in Table 1.
  • the kit may further comprise a computer readable medium.
  • the capture probes are immobilized on an array.
  • array is intended a solid support or a substrate with peptide or nucleic acid probes attached to the support or substrate.
  • Arrays typically comprise a plurality of different capture probes that are coupled to a surface of a substrate in different, known locations.
  • the arrays of the disclosure comprise a substrate having a plurality of capture probes that can specifically bind an intrinsic gene expression product. The number of capture probes on the substrate varies with the purpose for which the array is intended.
  • the arrays may be low-density arrays or high- density arrays and may contain 4 or more, 8 or more, 12 or more, 16 or more, 32 or more addresses, but will minimally comprise capture probes for at least 10, at least 15, at least 20, at least 25 of the intrinsic genes or all 50 intrinsic genes listed in Table 1.
  • arrays may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces.
  • Arrays may be probes (e.g., nucleic-acid binding probes) on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, each of which is hereby incorporated in its entirety for all purposes.
  • Arrays may be packaged in such a manner as to allow for diagnostics or other manipulation on the device. See, for example, U.S. Pat. Nos.
  • the kit comprises a set of oligonucleotide primers sufficient for the detection and/or quantitation of each of the intrinsic genes listed in Table 1.
  • the kit comprises a set of oligonucleotide primers sufficient for the detection and/or quantitation of at least 10, at least 15, at least 20, at least 25 of the intrinsic genes or all 50 intrinsic genes listed in Table 1.
  • the oligonucleotide primers may be provided in a lyophilized or reconstituted form, or may be provided as a set of nucleotide sequences.
  • the primers are provided in a microplate format, where each primer set occupies a well (or multiple wells, as in the case of replicates) in the microplate.
  • the microplate may further comprise primers sufficient for the detection of one or more housekeeping genes as discussed infra.
  • the kit may further comprise reagents and instructions sufficient for the amplification of expression products from the genes listed in Table 1.
  • the molecular signatures/expression profiles are typically recorded in a database.
  • the database is a relational database accessible by a computational device, although other formats, e.g., manually accessible indexed files of expression profiles as photographs, analogue or digital imaging readouts, spreadsheets, etc. can be used. Regardless of whether the expression patterns initially recorded are analog or digital in nature, the expression patterns, expression profiles (collective expression patterns), and molecular signatures
  • correlated expression patterns are stored digitally and accessed via a database.
  • the database is compiled and maintained at a central facility, with access being available locally and/or remotely.
  • the kit also includes a substance that is used to find the expression level of Her-2.
  • This substance can be an antibody or a nucleic acid probe. These substances can be used to detect Her-2 using FISH, IHC, ELISA, Western blots, Northern blots, or FACS analysis.
  • the kit also includes reagents that allows for the detection of the detecting substance and the quantitation of Her-2 expression in a sample.
  • Example 1 Classification of tumors using PAM50 and immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH)
  • CEF regimen included six cycles of epirubicin 60mg/m 2 and 5-fluorouracil (5-FU) 500 mg/m 2 , both delivered intravenously on days 1 and 8, and oral cyclophosphamide 75 mg/m daily on days 1 through 14.
  • the adjuvant CMF regimen included six cycles of methotrexate 40 mg/m and 5-FU 600 mg/m , both delivered intravenously on days 1 and 8, and oral cyclophosphamide
  • FISH fluorescence in-situ hybridization
  • RNA preparation from paraffin cores, the qRT-PCR assay for the PAM50 panel and reference genes, and tumor samples were classified into luminal A, luminal B, HER2- enriched, basal-like and normal-like subtypes as described previously (Nielsen et ah, Clin Cancer Res., 16(21):5222-32 (2010); Parker et al, J. Clin Oncol., 27(8): 1160-7 (2009)).
  • the intrinsic subtypes, risk classifier and biomarkers data were sent to the NCIC Clinical Trials Group statistical centre for independent analyses of pre-specified hypotheses.
  • Primary outcomes for MA.5 were relapse-free survival (RFS) and overall survival (OS).
  • RFS was defined as time from random assignment to any recurrences including local breast chest wall, regional or distant relapses.
  • OS was defined as any death from any cause.
  • the survival estimates for intrinsic subtypes and risk classifiers were plotted using Kaplan-Meier curves and compared by both log-rank and Wilcoxon tests. Univariable Cox proportional hazard regression models were used to obtain the hazard ratios (HRs) and associated 95% confidence intervals (CIs) of single covariates.
  • HRs hazard ratios
  • CIs 95% confidence intervals
  • Multivariate Cox regression analyses were used with treatments, intrinsic subtypes, and their interaction as covariates, to determine the significance of the interaction between treatment and intrinsic subtypes. These multivariable Cox models were adjusted for age (> 50 years vs. ⁇ 50 years), number of positive lymph nodes ( ⁇ 4 vs. > 4), estrogen-receptor level (> 10 vs. ⁇ 10 fmol/mg), type of surgery (total vs. partial mastectomy) and tumor size (Tl, T2, or T3). The association of clinical variables with subtypes was tested using Chi-square test or Fisher's Exact test.
  • the C-index (concordance index) (Harrell et al, Stat Med., 15(4):361-87 (1996)) is defined as the probability that risk assignments to members of a random pair are accurately ranked according to their prognosis. The number of concordant pairs (order of failure and risk assignment agree), discordant pairs (order of failure and risk assignment disagree), and uninformative pairs are tabulated to calculate the measure. C-indexes for intrinsic subtypes, ROR-S, Her2 status and TOP2A were compared for their predictions in patient outcomes stratified by each treatment arm. The associations of intrinsic subtypes with standard
  • the ROR-S risk classifier was significantly associated with distinct survival differences (Log- rank p ⁇ 0.0001): the low-risk group (75% RFS and 94% OS at 5-yr) had the most favorable clinical outcome, when compared to the moderate-risk group (59% RFS and 80% OS at 5-yr) and high-risk group (51% RFS and 53% OS at 5-yr) respectively (Table 4).
  • LumB tumors had a worse prognosis than LumA, having hazard ratios of 2.0 to develop any relapses and 2.44 to any death (Table 6).
  • the three survival risk groups defined by the pre-specified ROR-S risk classifier were significantly associated with distinct RFS and OS estimates ( Figure 2a-2b).
  • the HER2-E subtype by PAM50 was significantly associated with clinical Her2 positivity (p ⁇ 0.001). Sixty-eight percent (71/105) of the HER2-E subtype tumors were clinically Her2 positive by IHC/FISH analyses. For the other subtypes, 6% (9/145) of LumA, 7% (8/110) of LumB, and 2% (2/94) of Basal-like were Her2 positive by IHC/FISH.
  • Table 7 Predictive analysis of clinical Her2 status with RFS and OS endpoint among patients subjected to PAM50 assay.
  • Table 8 Multivariable Cox Regression analysis analyses of clinical Her2 status and Her2-E subtypes to predict anthracyc lines sensitivity based on RFS and OS endpoints. All MVA models included the standard clinicopathological variables.
  • FIG. 5A and 5B illustrate the relationship between benefit of CEF over CMF with the tumor's relation to the prototypical HER2-E centroid as a continuous predictor. 5-year predicted relapse free survival and overall survival were estimated from a Cox model including the HER2-E component of a tumor (i.e. the higher the HER2-E content present in a tumor, the higher the HER2-E centroid value).
  • Anthracycline-based chemotherapy is probably the most common conventional adjuvant regimen for early stage breast cancers despite of their significant association with long-term cardiotoxicities (Doyle et ah, J Clin Oncol., 23(34):8597-605 (2005)). This favored choice of treatment in clinical practice is mostly sustained by a meta-analysis of data from randomized trials showing a marginal gain of 4% in overall and disease-free survival rates of anthracycline- based chemotherapy over non-anthracycline-based chemotherapy (EBCTCG, Lancet,
  • Basal-like breast cancers represent a particular clinical challenge as they are both hormone receptor and Her2 negative and therefore not sensitive to existing targeted therapies.
  • Studies of neoadjuvant chemotherapy in breast cancer demonstrate that clinical and pathological response rates tend to be high in Basal-like cancers ( Rouzier et al., Clin Cancer Res.
  • Luminal B breast cancers are highly proliferative ER positive tumors which carry a significantly worse prognosis than their counterpart ER positive/Luminal A tumors (Cheang et al., Journal of the National Cancer Institute. 2009;101:736-50). These Luminal B tumors are chemosensitive and generally respond to cytotoxic drugs. Paik et al. reported that the Oncotype Dx® high risk group had a large benefit from additional adjuvant CMF with an absolute decrease of 28% in distant relapse risk when compared to the tamoxifen only arm in the NSABP-B20 trial ( Paik et al., Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006;24:3726-34). The date provided herein shows that there was no major survival difference between adjuvant anthracycline-containing vs. non-anthracycline adjuvant
  • Luminal A tumors representing 31% of patients in this study, do appear to represent another large subset of patients in whom anthracycline based treatment may be dispensed with.
  • the present invention also provides for the assessment of prognostic value of ROR-S risk classifier for adjuvant CMF and CEF regimens respectively.
  • the ROR-S classifiers were previously developed and defined based on the biology of intrinsic subtypes using an
  • the invention demonstrates that intrinsic subtypes provide independent predictive value to anthracycline vs. non-anthracycline chemotherapy beyond clinical Her2 status.
  • the data show that the benefit of CEF over CMF is directed to patients with the HER2-E gene expression pattern and Her2+ IHC/FISH status.
  • Chemotherapy- sensitive Basal-like tumors showed no added benefit of CEF vs. CMF, indicating that non-anthracycline regimens are adequate in this subtype.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Gynecology & Obstetrics (AREA)
PCT/US2012/029226 2011-03-15 2012-03-15 Methods of treating breast cancer with anthracycline therapy Ceased WO2012125828A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2013558177A JP5971769B2 (ja) 2011-03-15 2012-03-15 アントラサイクリン療法を用いて乳癌を処置する方法
EP12757489.5A EP2685988A4 (en) 2011-03-15 2012-03-15 Methods of treating breast cancer with anthracycline therapy
AU2012229123A AU2012229123B2 (en) 2011-03-15 2012-03-15 Methods of treating breast cancer with anthracycline therapy
CA2830240A CA2830240A1 (en) 2011-03-15 2012-03-15 Methods of treating breast cancer with anthracycline therapy
IL228449A IL228449A (en) 2011-03-15 2013-09-15 Signs of Efficacy of Breast Cancer Methods with Anthracycline Therapy
AU2017202786A AU2017202786A1 (en) 2011-03-15 2017-04-27 Methods of Treating Breast Cancer with Anthracycline Therapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161453035P 2011-03-15 2011-03-15
US61/453,035 2011-03-15

Publications (3)

Publication Number Publication Date
WO2012125828A2 true WO2012125828A2 (en) 2012-09-20
WO2012125828A3 WO2012125828A3 (en) 2012-11-08
WO2012125828A8 WO2012125828A8 (en) 2013-11-28

Family

ID=46831350

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/029226 Ceased WO2012125828A2 (en) 2011-03-15 2012-03-15 Methods of treating breast cancer with anthracycline therapy

Country Status (7)

Country Link
US (2) US9066963B2 (https=)
EP (1) EP2685988A4 (https=)
JP (2) JP5971769B2 (https=)
AU (2) AU2012229123B2 (https=)
CA (1) CA2830240A1 (https=)
IL (1) IL228449A (https=)
WO (1) WO2012125828A2 (https=)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2016539625A (ja) * 2013-10-09 2016-12-22 フンダシオ、インスティトゥト、デ、レセルカ、ビオメディカ(イエレベ、バルセロナ)Fundacio Institut De Recerca Biomedica (Irb Barcelona) 乳がんに由来する骨の転移がんの予後診断および処置のための方法
US9631239B2 (en) 2008-05-30 2017-04-25 University Of Utah Research Foundation Method of classifying a breast cancer instrinsic subtype
US10111861B2 (en) 2011-07-29 2018-10-30 Medivation Prostate Therapeutics, Inc. Treatment of breast cancer
US10322192B2 (en) 2016-03-02 2019-06-18 Eisai R&D Management Co., Ltd. Eribulin-based antibody-drug conjugates and methods of use
EP3230471B1 (en) * 2014-12-12 2019-08-28 Medivation Prostate Therapeutics LLC Method for predicting response to breast cancer therapeutic agents and method of treatment of breast cancer
CN111455055A (zh) * 2020-04-28 2020-07-28 重庆浦洛通基因医学研究院有限公司 一种人类tyms基因表达量检测标准对照品
US10866241B2 (en) 2012-04-09 2020-12-15 Institucio Catalana De Recerca I Estudis Avancats Method for the prognosis and treatment of cancer metastasis
US11072831B2 (en) 2010-10-06 2021-07-27 Fundació Institut De Recerca Biomèdica (Irb Barcelona) Method for the diagnosis, prognosis and treatment of breast cancer metastasis
US11596642B2 (en) 2016-05-25 2023-03-07 Inbiomotion S.L. Therapeutic treatment of breast cancer based on c-MAF status
US11654153B2 (en) 2017-11-22 2023-05-23 Inbiomotion S.L. Therapeutic treatment of breast cancer based on c-MAF status

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12324657B2 (en) 2007-11-28 2025-06-10 Intervet Inc. System and method for diagnosis of bovine diseases using auscultation analysis
AU2012345789B2 (en) 2011-11-30 2018-02-15 British Columbia Cancer Agency Branch Methods of treating breast cancer with taxane therapy
AU2014215675B2 (en) * 2013-02-06 2018-08-30 Intervet International B.V. System and method for determining antibiotic effectiveness in respiratory diseased using auscultation analysis
CA2968376C (en) 2014-11-21 2020-06-23 Nanostring Technologies, Inc. Enzyme- and amplification-free sequencing
JP7144142B2 (ja) 2014-11-24 2022-09-29 ナノストリング テクノロジーズ,インコーポレイティド 遺伝子精製および画像化のための方法および装置
EP4674976A3 (en) 2016-05-16 2026-03-25 Bruker Spatial Biology, Inc. Methods for detecting target nucleic acids in a sample
KR102313431B1 (ko) 2016-11-21 2021-10-18 나노스트링 테크놀로지스, 인크. 화학적 조성물 및 이것을 사용하는 방법
CA3064564C (en) 2017-06-22 2021-11-30 SNBioScience Inc. Particle and pharmaceutical composition comprising an insoluble camptothecin compound with double core-shell structure and method for manufacturing the same
AU2019271028B2 (en) 2018-05-14 2025-09-18 Bruker Spatial Biology, Inc. Chemical compositions and methods of using same

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4843155A (en) 1987-11-19 1989-06-27 Piotr Chomczynski Product and process for isolating RNA
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
US5708153A (en) 1991-09-18 1998-01-13 Affymax Technologies N.V. Method of synthesizing diverse collections of tagged compounds
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6020135A (en) 1998-03-27 2000-02-01 Affymetrix, Inc. P53-regulated genes
US6033860A (en) 1997-10-31 2000-03-07 Affymetrix, Inc. Expression profiles in adult and fetal organs
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6040193A (en) 1991-11-22 2000-03-21 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US6344316B1 (en) 1996-01-23 2002-02-05 Affymetrix, Inc. Nucleic acid analysis techniques
US20080032293A1 (en) 2004-07-15 2008-02-07 The University Of North Carolina At Chapel Hill Housekeeping Genes And Methods For Identifying Same
US20090299640A1 (en) 2005-11-23 2009-12-03 University Of Utah Research Foundation Methods and Compositions Involving Intrinsic Genes
US20100015607A1 (en) 2005-12-23 2010-01-21 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
US20100047924A1 (en) 2008-08-14 2010-02-25 Nanostring Technologies, Inc. Stable nanoreporters
US20100112710A1 (en) 2007-04-10 2010-05-06 Nanostring Technologies, Inc. Methods and computer systems for identifying target-specific sequences for use in nanoreporters
US20100261026A1 (en) 2005-12-23 2010-10-14 Nanostring Technologies, Inc. Compositions comprising oriented, immobilized macromolecules and methods for their preparation
US20110145176A1 (en) 2008-05-30 2011-06-16 Perou Charles M Gene expression profiles to predict breast cancer outcomes

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2012345789B2 (en) 2011-11-30 2018-02-15 British Columbia Cancer Agency Branch Methods of treating breast cancer with taxane therapy
AU2013266419B2 (en) 2012-05-22 2018-09-27 British Columbia Cancer Agency Branch NANO46 genes and methods to predict breast cancer outcome
WO2014005010A2 (en) 2012-06-29 2014-01-03 Nanostring Technologies, Inc. Methods of treating breast cancer with gemcitabine therapy

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (https=) 1985-03-28 1990-11-27 Cetus Corp
US4843155A (en) 1987-11-19 1989-06-27 Piotr Chomczynski Product and process for isolating RNA
US5800992A (en) 1989-06-07 1998-09-01 Fodor; Stephen P.A. Method of detecting nucleic acids
US5708153A (en) 1991-09-18 1998-01-13 Affymax Technologies N.V. Method of synthesizing diverse collections of tagged compounds
US5770358A (en) 1991-09-18 1998-06-23 Affymax Technologies N.V. Tagged synthetic oligomer libraries
US5789162A (en) 1991-09-18 1998-08-04 Affymax Technologies N.V. Methods of synthesizing diverse collections of oligomers
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
US6040193A (en) 1991-11-22 2000-03-21 Affymetrix, Inc. Combinatorial strategies for polymer synthesis
US5922591A (en) 1995-06-29 1999-07-13 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US5856174A (en) 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US6344316B1 (en) 1996-01-23 2002-02-05 Affymetrix, Inc. Nucleic acid analysis techniques
US6033860A (en) 1997-10-31 2000-03-07 Affymetrix, Inc. Expression profiles in adult and fetal organs
US6020135A (en) 1998-03-27 2000-02-01 Affymetrix, Inc. P53-regulated genes
US20080032293A1 (en) 2004-07-15 2008-02-07 The University Of North Carolina At Chapel Hill Housekeeping Genes And Methods For Identifying Same
US20090299640A1 (en) 2005-11-23 2009-12-03 University Of Utah Research Foundation Methods and Compositions Involving Intrinsic Genes
US20100015607A1 (en) 2005-12-23 2010-01-21 Nanostring Technologies, Inc. Nanoreporters and methods of manufacturing and use thereof
US20100261026A1 (en) 2005-12-23 2010-10-14 Nanostring Technologies, Inc. Compositions comprising oriented, immobilized macromolecules and methods for their preparation
US20100112710A1 (en) 2007-04-10 2010-05-06 Nanostring Technologies, Inc. Methods and computer systems for identifying target-specific sequences for use in nanoreporters
US20110145176A1 (en) 2008-05-30 2011-06-16 Perou Charles M Gene expression profiles to predict breast cancer outcomes
US20100047924A1 (en) 2008-08-14 2010-02-25 Nanostring Technologies, Inc. Stable nanoreporters

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1987, JOHN WIIEY & SONS
8PRUANCE ET AL., ANTIMICROB. AGENTS & CHEMO., vol. 48, 2004, pages 2787 - 92
BARANY, PNAS USA, vol. 88, 1991, pages 189 - 93
BENITO ET AL., BIOINFORMATICS, vol. 20, no. 1, 2004, pages 105 - 114
BROWN HA; IRVING J; PARKER R ET AL.: "Amplification of EMSY, a novel oncogene on 1 lql3, in high grade ovarian surface epithelial carcinomas", GYNECOL ONCOL., vol. 100, no. 2, 2006, pages 264 - 270
CHEANG ET AL., CLIN CANCER RES., vol. 14, no. 5, 2008, pages 1368 - 1376
DE ANDRES ET AL., BIOTECHNIQUES, vol. 18, 1995, pages 42 - 44
GEISS ET AL., NATURE BIOTECHNOLOGY, vol. 26, no. 3, 2008, pages 317 - 325
GENNARI, BREAST CANCER RES. TREAT, vol. 100, no. 1, 2006, pages 19
GUATELLI ET AL., PROC. NATL. ACAD. SCI USA, vol. 87, 1990, pages 1874 - 78
KWOH ET AL., PROC. NATL. ACAD. SCL USA, vol. 86, 1989, pages 1173 - 77
LIZARDI, BIO/TECHNOLOGY, vol. 6, 1988, pages 1197
NARASHIMAN; CHU, PNAS, vol. 99, 2002, pages 6567 - 6572
PARKER ET AL., J CLIN ONCOL., vol. 27, no. 8, 2009, pages 1160 - 7
PEROU ET AL., NATURE, vol. 406, 2000, pages 747 - 752
PEROU ET AL., NATURE, vol. 406, no. 6797, 2000, pages 747 - 52
PRITCHARD ET AL., N.ENGL.J.MED, 2006, pages 2103
QUACKENBUSH NAT. GENET., vol. 32, 2002, pages 496 - 501
ROUZIER, J CLIN ONCOL, vol. 23, 2005, pages 8331 - 9
RUPP; LOCKER, LAB INVEST., vol. 56, 1987, pages A67
SCHENA ET AL., SCIENCE, vol. 270, 1995, pages 467 - 70
See also references of EP2685988A4
SORLIE ET AL., PNAS, vol. 98, no. 19, 2001, pages 10869 - 74
WEIS ET AL., TIG, vol. 8, 1992, pages 263 - 64
YAZIJI ET AL., JAMA, vol. 291, no. 16, pages 1972 - 1977

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9631239B2 (en) 2008-05-30 2017-04-25 University Of Utah Research Foundation Method of classifying a breast cancer instrinsic subtype
US12595518B1 (en) 2008-05-30 2026-04-07 British Columbia Cancer Agency Branch Methods for assaying enriched nucleic acids
US11072831B2 (en) 2010-10-06 2021-07-27 Fundació Institut De Recerca Biomèdica (Irb Barcelona) Method for the diagnosis, prognosis and treatment of breast cancer metastasis
US12312642B2 (en) 2010-10-06 2025-05-27 Fundacio Institut De Recerca Biomedica (Irb Barcelona) Method for the diagnosis, prognosis and treatment of breast cancer metastasis
US10111861B2 (en) 2011-07-29 2018-10-30 Medivation Prostate Therapeutics, Inc. Treatment of breast cancer
US12196758B2 (en) 2012-04-09 2025-01-14 FUNDACIO INSTITUT DE RECERCA BIOMEDICA (IRB BARCELONA) and INSTITUCIO CATALANA DE RECERCA I ESTUDIS AVANCATS Method for the prognosis and treatment of cancer metastasis
US10866241B2 (en) 2012-04-09 2020-12-15 Institucio Catalana De Recerca I Estudis Avancats Method for the prognosis and treatment of cancer metastasis
JP2016539625A (ja) * 2013-10-09 2016-12-22 フンダシオ、インスティトゥト、デ、レセルカ、ビオメディカ(イエレベ、バルセロナ)Fundacio Institut De Recerca Biomedica (Irb Barcelona) 乳がんに由来する骨の転移がんの予後診断および処置のための方法
EP3230471B1 (en) * 2014-12-12 2019-08-28 Medivation Prostate Therapeutics LLC Method for predicting response to breast cancer therapeutic agents and method of treatment of breast cancer
US11186876B2 (en) 2014-12-12 2021-11-30 Medivation Prostate Therapeutics Llc Method for predicting response to breast cancer therapeutic agents and method of treatment of breast cancer
US11952634B2 (en) 2014-12-12 2024-04-09 Medivation Prostate Therapeutics Llc Method for predicting response to breast cancer therapeutic agents and method of treatment of breast cancer
US10548986B2 (en) 2016-03-02 2020-02-04 Eisai R&D Management Co., Ltd. Eribulin-based antibody-drug conjugates and methods of use
US10322192B2 (en) 2016-03-02 2019-06-18 Eisai R&D Management Co., Ltd. Eribulin-based antibody-drug conjugates and methods of use
US11596642B2 (en) 2016-05-25 2023-03-07 Inbiomotion S.L. Therapeutic treatment of breast cancer based on c-MAF status
US11654153B2 (en) 2017-11-22 2023-05-23 Inbiomotion S.L. Therapeutic treatment of breast cancer based on c-MAF status
US12233077B2 (en) 2017-11-22 2025-02-25 Inbiomotion S.L. Therapeutic treatment of breast cancer based on c-MAF status
CN111455055B (zh) * 2020-04-28 2021-11-16 重庆浦洛通基因医学研究院有限公司 一种人类tyms基因表达量检测标准对照品
CN111455055A (zh) * 2020-04-28 2020-07-28 重庆浦洛通基因医学研究院有限公司 一种人类tyms基因表达量检测标准对照品

Also Published As

Publication number Publication date
US20150252440A1 (en) 2015-09-10
EP2685988A2 (en) 2014-01-22
AU2012229123A1 (en) 2013-10-03
AU2017202786A1 (en) 2017-05-18
JP2016130256A (ja) 2016-07-21
CA2830240A1 (en) 2012-09-20
AU2012229123A8 (en) 2013-11-07
EP2685988A4 (en) 2014-08-20
WO2012125828A3 (en) 2012-11-08
IL228449A (en) 2017-10-31
US9066963B2 (en) 2015-06-30
JP2014514278A (ja) 2014-06-19
US20130004482A1 (en) 2013-01-03
JP5971769B2 (ja) 2016-08-17
WO2012125828A8 (en) 2013-11-28
AU2012229123B2 (en) 2017-02-02
IL228449A0 (en) 2013-12-31

Similar Documents

Publication Publication Date Title
US9066963B2 (en) Methods of treating breast cancer with anthracycline therapy
US20230272476A1 (en) Nano46 genes and methods to predict breast cancer outcome
US20140037620A1 (en) Methods of Treating Breast Cancer with Gemcitabine Therapy
US9181588B2 (en) Methods of treating breast cancer with taxane therapy
CA2725760C (en) Gene expression profiles to predict breast cancer outcomes
US20150072021A1 (en) Methods and Kits for Predicting Outcome and Methods and Kits for Treating Breast Cancer with Radiation Therapy
WO2014075067A1 (en) Methods to predict breast cancer outcome
US20160115551A1 (en) Methods to predict risk of recurrence in node-positive early breast cancer
US20160160293A1 (en) Breast cancer treatment with taxane therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12757489

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2830240

Country of ref document: CA

Ref document number: 2013558177

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2012229123

Country of ref document: AU

Date of ref document: 20120315

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012757489

Country of ref document: EP