WO2012112458A2

WO2012112458A2 - Compositions and methods for increasing reprogramming efficiency

Info

Publication number: WO2012112458A2
Application number: PCT/US2012/024902
Authority: WO
Inventors: Ambrose WILLIAMS; Wenbin Deng
Original assignee: The Regents Of The University Of California
Priority date: 2011-02-14
Filing date: 2012-02-13
Publication date: 2012-08-23
Also published as: WO2012112458A3

Abstract

The present invention relates to methods for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising expressing in the cell an effective amount of pluripotency factors and an effective amount of PARP-1 or an equivalent thereof, thereby enhancing the efficiency of reprogramming the non-pluripotent cell to the pluripotent cell.

Description

COMPOSITIONS AND METHODS FOR INCREASING REPROGRAMMING

EFFICIENCY

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. 1 19(e) of U.S.

Provisional Application No. 61/442,554, filed February 14, 201 1 , the content of which is incorporated by reference in its entirety into the subject application.

STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was supported by Grant Nos. R01 NS059043 and R01 ES015988 awarded by The National Institute of Health. The United States government has rights in this invention.

BACKGROUND

[0003] Pluripotent stem cells, of which embryonic stem cells (ESCs) are the prototypical member (Evans et al., (1981 ) Nature. 292(5819):154-6), are capable of giving rise to any tissue in the adult body and have therefore become a focal point of translational research as a source of cell-replacement therapies for regenerative medicine. While there are still numerous ethical, immunological and legal obstacles for ESCs to becoming practical on a clinical level, the finding that somatic cells can be reprogrammed to a pluripotent state functionally identical to ESCs (Takahashi et al., (2006) Cell 126(4):663-76; Okita et al., (2007) Nature 448(7151 ):313-7) represents a major advance for the field. Briefly, pluripotency can be induced in differentiated cells by ectopic expression of the four

transcription-factor genes Oct3/4, Sox2, Klf4 and c-Myc (collectively known as the Yamanaka factors). These induced pluripotent stem cells (iPSCs) are isogenic to the original somatic cell (and its donor) and thus overcome several of the challenges of ESC research.

SUMMARY

[0004] Described herein are methods for enhancing the reprogramming efficiency of a non-pluripotent cell to a pluripotent cell utilizing Poly-(ADP- ribose)(PAR) polymerase-1 (PARP-1 ). Applicants have discovered that PARP-1 is involved in the initiation and maintenance of the pluripotency of a cell. The method of reprogramming cells and cells and populations containing these cells have pre-clinical and clinical applications in human therapy, drug discovery, drug toxicity screening, and disease modeling.

[0005] Accordingly, in one aspect, the invention provides a method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising, or alternatively consisting essentially of, or yet further consisting of expressing in the cell an effective amount of pluripotency factors and

overexpressing an effective amount of PARP-1 or an equivalent thereof, thereby enhancing the efficiency of reprogramming the non-pluripotent cell to the pluripotent cell.

[0006] Another aspect of the current invention is a method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell,

comprising, or alternatively consisting essentially of, or yet further consisting of overexpressing an effective amount of PARP-1 or an equivalent thereof in a cell induced to reprogramming, thereby enhancing the efficiency of reprogramming the non-pluripotent cell to the pluripotent cell. The PARP-1 or an equivalent thereof can be overexpressed prior to, subsequent to or concommitent with the induction of the cell to reprogramming.

[0007] Also provided is a reprogrammed cell produced by expressing in the cell an effective amount of pluripotency factors and ovexpressing an effective amount of PARP-1 or an equivalent thereof.

[0008] The invention further provides a reprogrammed cell produced by overexpressing an effective amount of PARP-1 or an equivalent thereof in a cell induced to reprogramming. The PARP-1 or an equivalent thereof can be overexpressed prior to, subsequent to or concommitent with the induction of the cell to reprogramming.

[0009] Methods of enhancing the efficiency of reprogramming of non- pluripotent cells, culturing such cells, isolating such cells, and using such reprogrammed cells to treat disease, to screen the efficacy of drugs, to model mammalian disease, to screen for drug toxicity, and to use in the development of transgenic animals also are provided herein. BRIEF DESCRIPTION OF THE FIGURES

[0010] Figure 1 A-C shows that PARP-1 is critical for induced pluripotency. (A) The A19 line of mouse fibroblasts reprogrammed with lentiviruses carrying the Yamanaka repertoire forms alkaline phosphatase-positive (AP+) colonies resembling stem cell colonies, however a PARP-1 -/- fibroblast line of the same genetic background displays a significant deficit when reprogrammed in the same manner. Twenty-fold fewer colonies are observed in the knockout. Two other fibroblast lines, a p53-/- and PARP-1 -/-p53-/- are also reprogrammed, with the p53-/- displaying an expected threefold increase in AP+ colony formation, while the double knockout displays a partial rescue of the reprogramming deficit observed in the PARP-1 -/-. The reduced ability of PARP-1 -/- fibroblasts to reprogram is also observed in primary MEFs prepared from WT and PARP-1 -/- mice of the S129 genetic background, where no colony formation is observed in the reprogrammed knockout cells, a reprogramming deficit of at least thirty fold. (B) PARP-1 -/- colonies typically have poor morphology compared to the WT, specifically they are larger, stained less densely and lack a round shape. (C) Reprogrammed PARP-1 -/- cells fail to reform colonies upon passage when propagated, and do not stain typically for the stem cell markers Oct3/4 or SSEA- 1 , although they do grow at increased density than is typical for fibroblast cultures.

[0011] Figure 2 A-B illustrates that the chemical inhibition of PARP-1 reduces the efficiency of induced pluripotency, and causes ESCs to lose their

pluripotency. (A) Reprogramming wiltdype A19 fibroblasts in the presence of the PARP-1 inhibitor PJ34 reduces early AP+ colony formation in a concentration dependent manner. At 10 μΜ, the concentration at which PARP-1 is completely inhibited, a twenty-fold deficit in colony formation is observed, which mirrors the reprogramming deficit observed in knockout cells in earlier experiments. (B) PJ34 (10 μΜ) treatment causes visible differentiation in mouse ESC cultures at 48 h. Flow cytommetry for the stem cell marker SSEA-1 shows that

approximately one quarter of the PJ34-treated culture lost SSEA-1 expression, indicating the loss of pluripotency.

[0012] Figure 3 A-G shows that PARP-1 dependent reprogramming appears to act through a Sox2 mechanism. (A) PARP-1 ^"'^"fibroblasts express 13 times as much Sox2 and 2.5 times as much p53 as the wildtype or double knockout, while transcription of the other genes analyzed, a battery of pluripotency-related genes as well as PARP-2 and -3 and the unrelated PDRG, are not significantly affected.

(B) These results are replicated with PARP-1 knockdown in wildtype fibroblasts using shRNAs. All five PARP-1 shRNAs tested produce a large increase in Sox2 transcription. (C) PARP-1 pharmacological inhibition in fibroblasts with PJ34 causes a similar increase in Sox2 transcription as observed between the knockout and wildtype. (D) In mouse ESCs, PARP-1 inhibition results in a significant increase in Sox2 transcription, at a maximum of seven-fold at 0.1 μΜ, and three-fold at 3 μΜ and 10 μΜ. (E) Treatment of ESCs and iPSCs with PJ34 results in a decrease in Sox2 protein levels (F) in a dose-dependent manner. (G) Sox2 protein levels are also reduced in PARP-1 ^"'^" mouse ESCs.

[0013] Figure 4 A-C shows that PARP-1 overexpression enhances induced pluripotency. (A) Wildtype fibroblasts reprogrammed with a PARP-1 - overexpressing virus accompanying the standard Yamanaka reprogramming set (WT P+) form five times more AP+ colonies than without. Inclusion of PARP-1 in the four-factor Yamanaka reprogramming set as a "fifth factor" also rescues the reprogramming deficit observed in knockout fibroblasts. (B) Wildtype cells reprogrammed with PARP-1 as a fifth factor display gene expression similar to wildtype mESCs, within a twofold range of transcription. PARP-1 knockout cells reprogrammed with the PARP-1 virus also transcribe these genes at normal levels, although PARP-1 expression is minimal after reprogramming is complete.

(C) Teratomas derived from WT and PARP-1 KO cells reprogrammed with the accessory PARP-1 virus are comprised of a typical variety of tissue types including gut epithelium (top), mesodermal smooth muscle (middle) and ectodermal neural epithelium and neuropil (bottom), tissue types which are representative of the three germinal layers.

[0014] Figure 5 A-D shows that Wildtype MEFs are reprogrammed to pluripotency. (A) A line of iPS cells derived from WT MEFs forms colonies and immuno-stains for Oct3/4 and SSEA-1 . (B) When injected into immunodeficient mice, these cells give rise to teratomas containing cartilage, (C) neural tubes and neuropil, (D) and respiratory epithelium, tissue types which are representative of the three germinal layers. [0015] Figure 6 depicts increasing concentrations of PJ34 reduce SSEA-1 expression. Mouse ESCs and iPSC cultures treated with increasing amounts of PJ34 for 48 hours displayed reduced SSEA-1 expression, as measured by flow cytometry.

[0016] Figure 7 shows the gene transcription in PARP-1 knockout ESCs.

Increases in Sox2 and p53 transcription are observed in PARP-1 deficient ESCs, while transcription of Oct3/4 is not significantly different between the wildtype and knockout.

[0017] Figure 8 depicts that PARP-1 transcription in cultures treated with the PARP-1 polynucleotide containing virus was increased 38% ± 8% when compared to cultures treated with an empty virus. However no significant changes in Sox2 or p53 trancription were noticed after 24 h of PARP-1

overexpression.

[0018] Figure 9 shows the expression of PARP-1 in wild type (wt) and iPSCs.

DETAILED DESCRIPTION

[0019] Pluripotent stem cells, of which embryonic stem cells (ESCs) are the prototypical member, are capable of giving rise to any tissue in the adult body and have therefore become a focal point of translational research as a source of cell-replacement therapies for regenerative medicine. While there are still numerous ethical, immunological and legal obstacles for ESCs to becoming practical on a clinical level, the finding that somatic cells can be reprogrammed to a pluripotent state functionally identical to ESCs (Takahashi, K. et al. (2006) Cell 126(4): 663-76; Okita, K. et al. (2007) Nature 448(7151 ): 313-7) represents a major advance for the field. Briefly, pluripotency can be induced in differentiated cells by ectopic expression of the four transcription-factor genes Oct3/4, Sox2, Klf4 and c-Myc (collectively known as the Yamanaka factors). These induced pluripotent stem cells (iPSCs) are genetically autologous to the original somatic cell (and its donor) and thus overcome several of the challenges of ESC research. Although the classical method of inducing pluripotency, by inserting and over-expressing genes encoding the Yamanaka factors, introduces a significant oncogenic hazard (Takahashi, K. et al. (2006) Cell 126(4): 663-76; Okita, K. et al. (2007) Nature 448(7151 ): 313-7), more advanced techniques have reduced these safety concerns (Kim, D. et al. (2009) Cell Stem Cell 4(6): 472-6; Warren, L. et al. (2010) Cell Stem Cell 7(5): 618-30). Despite the success and reproducibility of induced pluripotency, our understanding of the reprogramming process remains limited. To facilitate clinical use, further elucidation of the mechanisms of cell reprogramming, with which one can make reprogramming faster, safer and easier.

[0020] Poly-(ADP-ribose)(PAR) polymerase-1 (PARP-1 ) is the primary member of the family of PARP enzymes that use NAD+ as the substrate to form PAR (Chambon, P. et al. (1963) Biochem Biophys Res Commun 1 1 : 39-43; Jacobson, M. et al. (1999) Trends in Biochemical Science 24(1 1 ): 415-7), a branched nucleic acid of varying length up to 200 residues (Miwa, M. et al. (1984) Methods in Ezymology). PAR can occur in the cell either as a free-floating polymer into the cytoplasm or nucleoplasm, or covalently attached to proteins as a form of post- translational modification known as PARylation (Chambon, P. et al. (1963) Biochem Biophys Res Commun 1 1 : 39-43; Kim, M.Y. et al. (2005) Genes Dev 19(17): 1951 -67). Free-floating PAR is bound-to by a variety of macrodomain- containing proteins (Karras, G. et al. (2005) The EMBO Journal 24: 191 1 -20) and is an inhibitor of DNA methyltransferase activity (Reale, A. et al. (2005)

Oncogene 24(1 ): 13-9). When PARP-1 is pathologically over-activated in response to excessive DNA damage, PAR can also accumulate at the

mitochondrial membrane and cause a form of caspase-independent cell death called parthanatos (Yu, S. et al. (2006) PNAS 103: 18314-9; Scott, G. et al.

(1999) Annals of Neurology 45: 120-4), characterized by the translocation of apoptosis-inducing factor (AIF) from the mitochondrion to the nucleus. PARylation of transcription factors reduces their DNA-binding activity due to stearic size and large negative charge of the PAR moiety (Chang, W.J. et al. (2001 ) J Biol Chem 276(50): 47664-70). However, PARP-1 also has a vast number of physiological roles and regulatory targets. PARP-1 is well-characterized for its roles in DNA damage repair (Durkacz, B. et al. (1980) Nature 283: 593-6; Shall, S. et al. (1984) Advances in Radiation Biology 1 1 : 1 -69) and cell cycle control (Trucco, C. et al. (1998) Nucleic Acids Research 26(1 1 ): 2644-9), in which PARP-1 functionally overlaps the tumor suppressor p53. Several PARP-1 pharmacological inhibitors are in clinical trials as chemotherapeutics (Papeo, G. et al. (2009) Expert opinion on therapeutic patients 19(10): 1377-400). Additionally, p53 has been identified as a roadblock to induced pluripotency (Hong, H. et al. (2009) Nature 460(7259): 1 132-5; Kawamura, T. et al. (2009) Nature 460(7259): 1 140-4; Li, H. et al. (2009) Nature 460(7259): 1 136-9; Marion, R.M. et al. (2009) Nature 460(7259): 1 149-53; Utikal, J. et al. (2009) Nature 460(7259): 1 145-8), and the process of cell reprogramming is enhanced by 100-fold in p53-deficient cells. PARP-1 not only functionally interacts with p53, but also physically PARylates p53 and thus influences p53's activity (Valenzuela, M.T. et al. (2002) Oncogene 21 (7): 1 108- 16), either enhancing the p53 response to ionizing radiation-induced DNA damage, or suppressing it during genomic damage from DNA-alkylating agents. Thus, Applicants hypothesize that PARP-1 , like p53, can play a role in induced pluripotency.

[0021] Several important genes related to pluripotency are regulated by PARP- 1 . The transcription factor Sox2 is a known target of PARylation (Gao, F. et al. (2009) J Biol Chem 284(33): 22263-73), as is the chromatin remodeling protein Aid (Ahel, D. et al. (2009) Science 325(5945): 1240-3). Activation of PARP-1 is known to cause chromatin remodeling through the action of macrodomain- containing histone variant macroH2A1 .1 (Timinszky, G. et al. (2009) Nat Struct Mol Biol 16(9): 923-9). PARP-1 is also known to play a dual role in regulating DNA methyltransferase (DNMT) because of PARP-1 's occupying and protecting the DNMT1 promoter from methylation, and PAR'S inhibiting DNMT enzymatic activity (Reale, A. et al. (2005) Oncogene 24(1 ): 13-9). Although mice

administered PARP-1 inhibitors are more resistant to experimental models of stroke (Abdelkarim, G.E. et al. (2001 ) Int J Mol Med 7(3): 255-60) and multiple sclerosis (Scott, G. et al. (2004) The Journal of Pharmacology 310(3): 1053-61 ), Applicants have previously found that PARP-1 knockout mice have altered immune system composition (Selvaraj, V. et al. (2009) J Biol Chem 284(38): 26070-84), resulting in exacerbated clinical outcomes in mice in an experimental model of multiple sclerosis. This finding is consistent with the demonstration that PARylation is required for the maturation of dendritic cells (Aldinucci, A. et al. (2007) The Journal of Immunology 179: 305-312). Chemical inhibition of PARP activity in pluripotent embryonal carcinoma (EC) stem cells causes them to lose pluripotency (Ohashi, Y. et al. (1984) Proceedings of the National Academy of Sciences 81 : 7132-6), and PARP-1 knockout in ESCs drives them to differentiate into trophoblast-like cells (Hemberger, M. et al. (2003) Dev Biol 257(2): 371 -81 ), suggesting a role for PARP-1 as a regulator of progenitor stem cell differentiation. Here, Applicants seek to determine a possible role of PARP-1 in induced pluripotency and its maintenance.

Definitions

[0022] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook et al., (1989) Molecular Cloning: A

Laboratory Manual, 2nd edition; Ausubel et al., eds. (1987) Current Protocols In Molecular Biology; MacPherson, B.D. Hames and G.R. Taylor eds., (1995) PCR 2: A Practical Approach; Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual; Harlow and Lane, eds. (1999) Using Antibodies, a Laboratory Manual; and R.I. Freshney, ed. (1987) Animal Cell Culture.

[0023] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied ( + ) or ( - ) by increments of 1 .0 or 0.1 , as appropriate. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term "about". It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.

[0024] As used in the specification and claims, the singular form "a," "an" and "the" include plural references unless the context clearly dictates otherwise.

[0025] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements, but do not exclude others. "Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination when used for the intended purpose. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace

contaminants or inert carriers. "Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this invention.

[0026] A "composition" is also intended to encompass a combination of active agent and another carrier, e.g., compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in

combination 1 -99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid/antibody components, which can also function in a buffering capacity, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this invention, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.

[0027] The term "pharmaceutically acceptable carrier" (or medium), which may be used interchangeably with the term biologically compatible carrier or medium, refers to reagents, cells, compounds, materials, compositions, and/or dosage forms that are not only compatible with the cells and other agents to be administered therapeutically, but also are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other complication commensurate with a reasonable benefit/risk ratio.

Pharmaceutically acceptable carriers suitable for use in the present invention include liquids, semi-solid (e.g., gels) and solid materials (e.g., cell scaffolds and matrices, tubes sheets and other such materials as known in the art and described in greater detail herein). These semi-solid and solid materials may be designed to resist degradation within the body (non-biodegradable) or they may be designed to degrade within the body (biodegradable, bioerodable). A biodegradable material may further be bioresorbable or bioabsorbable, i.e., it may be dissolved and absorbed into bodily fluids (water-soluble implants are one example), or degraded and ultimately eliminated from the body, either by conversion into other materials or breakdown and elimination through natural pathways.

[0028] As used herein, the term "patient" or "subject" intends an animal, a mammal or yet further a human patient. For the purpose of illustration only, a mammal includes but is not limited to a human, a feline, a canine, a simian, a murine, a bovine, an equine, a porcine or an ovine.

[0029] As used herein, the term "oligonucleotide" or "polynucleotide" refers to a short polymer composed of deoxyribonucleotides, ribonucleotides or any combination thereof. Oligonucleotides are generally at least about 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleotides in length. An oligonucleotide may be used as a primer or as a probe.

[0030] The term "isolated" as used herein refers to molecules or biological or cellular materials being substantially free from other materials, e.g., greater than 70%, or 80%, or 85%, or 90%, or 95%, or 98% with which they are associated in culture in in vivo. In one aspect, the term "isolated" refers to nucleic acid, such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source and which allow the manipulation of the material to achieve results not achievable where present in its native or natural state, e.g., recombinant replication or manipulation by mutation. The term "isolated" also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an "isolated nucleic acid" is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides, e.g., with a purity greater than 70%, or 80%, or 85%, or 90%, or 95%, or 98%. The term "isolated" is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.

[0031] As used herein, the term "promoter" refers to a nucleic acid sequence sufficient to direct transcription of a gene. Also included in the invention are those promoter elements which are sufficient to render promoter dependent gene expression controllable for cell type specific, tissue specific or inducible by external signals or agents.

[0032] In some embodiments, a promoter is an inducible promoter or a discrete promoter. Inducible promoters can be turned on by a chemical or a physical condition such as temperature or light. Examples of chemical promoters include, without limitation, alcohol-regulated, tetracycline-regulated, steroid-regulated, metal-regulated and pathogenesis-related promoters. Examples of discrete promoters can be found in, for examples, Wolfe et al., (2002) Mol. Endocrinol. 16:435-449.

[0033] As used herein, the term "regulatory element" refers to a nucleic acid sequence capable of modulating the transcription of a gene. Non-limiting examples of regulatory element include promoter, enhancer, silencer, poly- adenylation signal, transcription termination sequence. Regulatory element may be present 5' or 3' regions of the native gene, or within an intron.

[0034] Various proteins are also disclosed herein with their GenBank Accession Numbers for their human proteins and coding sequences. However, the proteins are not limited to human-derived proteins having the amino acid sequences represented by the disclosed GenBank Accession numbers, but may have an amino acid sequence derived from other animals, particularly, a warm-blooded animal (e.g., rat, guinea pig, mouse, chicken, rabbit, pig, sheep, cow, monkey, etc.). [0035] As used herein, the term "treating" is meant administering a

pharmaceutical composition for the purpose of improving the condition of a patient by reducing, alleviating, reversing, or preventing at least one adverse effect or symptom.

[0036] As used herein, the term "preventing" is meant identifying a subject (i.e., a patient) having an increased susceptibility to a disease but not yet exhibiting symptoms of the disease, and administering a therapy according to the principles of this disclosure. The preventive therapy is designed to reduce the likelihood that the susceptible subject will later become symptomatic or that the disease will be delay in onset or progress more slowly than it would in the absence of the preventive therapy. A subject may be identified as having an increased likelihood of developing the disease by any appropriate method including, for example, by identifying a family history of the disease or other degenerative brain disorder, or having one or more diagnostic markers indicative of disease or susceptibility to disease.

[0037] Any compositions, cells or populations of cells, described herein for a therapeutic use may be administered with an acceptable pharmaceutical carrier. Acceptable "pharmaceutical carriers" are well known to those of skill in the art and can include, but not be limited to any of the standard pharmaceutical carriers, such as phosphate buffered saline, water and emulsions, such as oil/water emulsions and various types of wetting agents.

[0038] As used herein, the term "sample" or "test sample" can refer to a liquid or solid material containing nucleic acids. In some aspects, a test sample is obtained from a biological source (i.e., a "biological sample"), such as cells in culture or a tissue sample from an animal, e.g., a human.

[0039] As used herein, the term "effective amount" refers to a quantity of an agent such as a polynucleotide, agent, protein, small molecule or other

composition, that is effective for the desired function or benefit. For the purpose of illustration only, an effective amount of a PARP-1 polynucleotide is one that increases the reprogramming efficiency of the Yamanaka factors when expressed in a suitable host cell. [0040] A population of cells intends a collection of more than one cell that is identical (clonal) or non-identical in phenotype and/or genotype.

[0041] "Substantially homogeneous" describes a population of cells in which more than about 50%, or alternatively more than about 60 %, or alternatively more than 70 %, or alternatively more than 75 %, or alternatively more than 80%, or alternatively more than 85 %, or alternatively more than 90%, or alternatively, more than 95 %, of the cells are of the same or similar phenotype. Phenotype can be determined by a pre-selected cell surface marker or other marker, such as the pluripotency markers.

[0042] As used herein, an "antibody" includes whole antibodies and any antigen binding fragment or a single chain thereof. Thus the term "antibody" includes any protein or peptide containing molecule that comprises at least a portion of an immunoglobulin molecule. Examples of such include, but are not limited to a complementarity determining region (CDR) of a heavy or light chain or a ligand binding portion thereof, a heavy chain or light chain variable region, a heavy chain or light chain constant region, a framework (FR) region, or any portion thereof, or at least one portion of a binding protein.

[0043] As used herein, "stem cell" defines a cell with the ability to divide for indefinite periods in culture and give rise to specialized cells. Stem cells include, for example, somatic (adult) and embryonic stem cells. A somatic stem cell is an undifferentiated cell found in a differentiated tissue that can renew itself (clonal) and (with certain limitations) differentiate to yield all the specialized cell types of the tissue from which it originated. An embryonic stem cell is a primitive

(undifferentiated) cell derived from the embryo that has the potential to become a wide variety of specialized cell types. An embryonic stem cell is one that has been cultured under in vitro conditions that allow proliferation without

differentiation. Non-limiting examples of embryonic stem cells are the HES2 (also known as ES02) cell line available from ESI, Singapore and the H1 (also know as WA01 ) cell line available from WiCells, Madison, Wl. In addition, for example, there are 40 embryonic stem cell lines that are recently approved for use in N unfunded research including CHB-1 , CHB-2, CHB-3, CHB-4, CHB-5, CHB-6, CHB- 8, CHB-9, CHB-10, CHB-1 1 , CHB-12, RUES1 , HUES1 , HUES2, HUES3, HUES4, HUES5, HUES6, HUES7, HUES8, HUES9, HUES10, HUES1 1 , HUES12, HUES13, HUES14, HUES15, HUES16, HUES17, HUES18, HUES19, HUES20, HUES21 , HUES22, HUES23, HUES24, HUES26, HUES27, and HUES28.

Pluripotent embryonic stem cells can be distinguished from other types of cells by the use of markers including, but not limited to, Oct-4, alkaline phosphatase, CD30, TDGF-1 , GCTM-2, Genesis, Germ cell nuclear factor, SSEA1 , SSEA3, and SSEA4.

[0044] As used herein, a "pluripotent cell" broadly refers to stem cells with similar functional and phenotypic properties to embryonic stem cells with respect to the ability for self-renewal and pluripotency (i.e., the ability to differentiate into cells of multiple lineages). Pluripotent cells refer to cells both of embryonic and non-embryonic origin. For example, pluripotent cells includes Induced Pluripotent Stem Cells (iPSCs).

[0045] A "non-pluripotent cell: is any cell that is not pluripotent.

[0046] An "induced pluripotent stem cell" or "iPSC" or "iPS cell" refers to an artificially derived stem cell from a non-pluripotent cell, typically an adult somatic cell, produced by inducing expression of one or more reprogramming genes or corresponding proteins or RNAs. Such stem cell specific genes include, but are not limited to, the family of octamer transcription factors, i.e. Oct-3/4; the family of Sox genes, i.e. Sox1 , Sox2, Sox3, Sox 15 and Sox 18; the family of Klf genes, i.e. Klf1 , Klf2, Klf4 and Klf5; the family of Myc genes, i.e. c-myc and L-myc; the family of Nanog genes, i.e. OCT4, NANOG and REX1 ; or LIN28. Examples of iPSCs and methods of preparing them are described in Takahashi et al., (2007) Cell. 131 (5):861 -72; Takahashi & Yamanaka (2006) Cell 126:663-76; Okita et al., (2007) Nature 448:260-262; Yu et al., (2007) Science 318(5858):1917-20; and Nakagawa et al., (2008) Nat. Biotechnol. 26(1 ):101 -6.

[0047] A "precursor" or "progenitor cell" intends to mean cells that have a capacity to differentiate into a specific type of cell such as a hepatocyte. A progenitor cell may be a stem cell. A progenitor cell may also be more specific than a stem cell. A progenitor cell may be unipotent or multipotent. Compared to adult stem cells, a progenitor cell may be in a later stage of cell differentiation and therefore, "non-pluripotent". [0048] A "chimeric polypeptide", "chimeric protein" or "fusion protein" refers to a protein, peptide or polypeptide created through the joining of two or more amino acid sequences or alternatively created by expression of a joint nucleotide sequence comprising two or more nucleotide sequences which originally code for separate proteins, peptides, polypeptides. Translation of joined nucleotide sequence, also known as a fusion gene, results in a single polypeptide, the "chimeric polypeptide", with functional properties derived from each of the original proteins.

[0049] As used herein, the term "recombinant" as it pertains to polypeptides or polynucleotides intends a form of the polypeptide or polynucleotide that does not exist naturally, a non-limiting example of which can be created by combining polynucleotides or polypeptides that would not normally occur together. In one embodiment, a recombinant polynucleotide is created through the introduction of relevant DNA into an existing organismal DNA, such as the plasmids of bacteria, to code for or alter different traits for a specific purpose, such as antibiotic resistance. A "recombinant" polypeptide is a polypeptide that is derived from a recombinant nucleic acid.

[0050] As used herein, the term "an equivalent thereof" is used synonymously with "equivalent" unless otherwise specifically intended. When referring to a reference protein, polypeptide or nucleic acid, the term intends those having minimal homology while still maintaining desired structure or functionality. Unless specifically recited herein, it is contemplated that any polynucleotide, polypeptide or protein mentioned herein also includes "an equivalent" thereof. For example, an equivalent intends at least about 60%, or 65%, or 70%, or 75%, or 80 % homology or identity and alternatively, at least about 85 %, or alternatively at least about 90 %, or alternatively at least about 95 %, or alternatively 98 % percent homology or identity, or alternatively a polynucleotide that hybridizes under stringent conditions to the reference polynucleotide or its complement, and exhibits substantially equivalent biological activity to the reference protein, polypeptide or nucleic acid.

[0051] A polynucleotide or polynucleotide region (or a polypeptide or

polypeptide region) having a certain percentage (for example, about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 97%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. The alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology (Ausubel et al., eds. 1987) Supplement 30, section 7.7.18, Table 7.7.1 . Preferably, default parameters are used for alignment. A preferred alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix =

BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following Internet address: ncbi.nlm.nih.gov/cgi-bin/BLAST.

[0052] "Hybridization" refers to hybridization reactions can be performed under conditions of different "stringency". Conditions that increase the stringency of a hybridization reaction are widely known and published in the art: see, for example, Sambrook, et al., infra. Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25° C, 37°C, 50°C, and 68 °C; buffer concentrations of 10 X SSC, 6 X SSC, 1 X SSC, 0.1 X SSC (where SSC is 0.15 M NaCI and 15 mM citrate buffer) and their equivalent using other buffer systems; formamide concentrations of 0%, 25%, 50%, and 75%; incubation times from 5 minutes to 24 hours and washes of increasing duration, increasing frequency, or decreasing buffer concentrations.

[0053] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention. [0054] As used herein, "expression" refers to the process by which

polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in an eukaryotic cell.

[0055] The term "overexpress" intends the increase in transcription of a polynucleotide into mRNA and/or the process by which the transcribed mRNA is translated into peptides, polypeptides or proteins that is greater than a base line expression in a cell of an endogenous polynucleotide or gene or one that is exogenous and expressed at base line levels. In one aspect, the overexpression is at least 10% more RNA transcript over endogenous levels of RNA transcript, or alternatively at least 15%, or alternatively at least 20%, or alternatively at least 25%, or alternatively at least 30%, or alternatively at least 35%, or alternatively at least 38%, or alternatively at least 40%, or alternatively at least 45%, or alternatively at least 50%, or alternatively at least 55%, or alternatively at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, of the level or RNA transcript as compared to base line levels of RNA transcript. In a further aspect, overexpression is at least about 1 .1 times the level as compared to base line levels, or alternatively at least 1 .2 times, or alternatively at least 1 .25 times, or alternatively at least 1 .3 times, or alternatively at least 1 .35 times, or alternatively at least 1 .4 times, or alternatively at least 1 .45 times, or alternatively at least 1 .5 times, or alternatively at least 1 .55 times, or alternatively at least 1 .6 times, or alternatively at least 1 .65 times, or alternatively at least 1 .7 times, or alternatively at least 1 .75 times, or alternatively at least 1 .8 times, or alternatively at least 1 .85 times, or alternatively at least 1 .9 times, or alternatively at least 2 times, or alternatively at least 2.25 times, or alternatively at least 2.5 times, or alternatively at least 2.75 times, or alternatively at least 3 times, or alternatively at least 3.25 times, or alternatively at least 3.5 times, or alternatively at least 3.75 times, or alternatively at least 4 times, or alternatively at least 4.5 times, or alternatively at least 5 times, or alternatively at least 5.5 times, or alternatively at least 6 times of the level or RNA transcript as compared to base line levels of RNA transcript. Such levels can be determined using quantitative methods known in the art such as those described herein.

[0056] The term "encode" as it is applied to polynucleotides refers to a polynucleotide which is said to "encode" a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

[0057] "Regulatory polynucleotide sequences" intends any one or more of promoters, operons, enhancers, as know to those skilled in the art to facilitate and enhance expression of polynucleotides.

[0058] An "expression vehicle" is a vehicle or a vector, non-limiting examples of which include viral vectors or plasmids, that assist with or facilitate expression of a gene or polynucleotide that has been inserted into the vehicle or vector.

[0059] A "delivery vehicle" is a vehicle or a vector that assists with the delivery of an exogenous polynucleotide into a target cell. The delivery vehicle may assist with expression or it may not, such as traditional calcium phosphate transfection compositions.

[0060] "An effective amount" when referring to a therapeutically effective amount refers to the amount of an active agent or a pharmaceutical composition sufficient to induce a desired biological and/or therapeutic result. That result can be alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. The effective amount will vary depending upon the health condition or disease stage of the subject being treated, timing of administration, the manner of administration and the like, all of which can be determined readily by one of ordinary skill in the art.

[0061] As used herein, the terms "treating," "treatment" and the like are used herein to mean obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disorder or sign or symptom thereof, and/or may be therapeutic in terms of a partial or complete cure for a disorder and/or adverse effect attributable to the disorder. [0062] As used herein, to "treat" further includes systemic amelioration of the symptoms associated with the pathology and/or a delay in onset of symptoms. Clinical and sub-clinical evidence of "treatment" will vary with the pathology, the subject and the treatment.

[0063] "Administration" can be effected in one dose, continuously or

intermittently throughout the course of treatment. Methods of determining the most effective means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. Suitable dosage formulations and methods of administering the agents are known in the art. Route of administration can also be determined and method of determining the most effective route of

administration are known to those of skill in the art and will vary with the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue. Non- limiting examples of route of administration include oral administration, nasal administration, injection, topical application, intrapentoneal, intravenous and by inhalation. An agent of the present invention can be administered for therapy by any suitable route of administration. It will also be appreciated that the preferred route will vary with the condition and age of the recipient, and the disease being treated.

[0064] The agents and compositions of the present invention can be used in the manufacture of medicaments and for the treatment of humans and other animals by administration in accordance with conventional procedures, such as an active ingredient in pharmaceutical compositions.

[0065] As used herein, the term "detectable label" intends a directly or indirectly detectable compound or composition that is conjugated directly or indirectly to the composition to be detected, e.g., N-terminal histadine tags (N-His), magnetically active isotopes, e.g., ¹¹⁵Sn, ¹¹⁷Sn and ¹¹⁹Sn, a non-radioactive isotopes such as ¹³C and ¹⁵N, polynucleotide or protein such as an antibody so as to generate a "labeled" composition. The term also includes sequences conjugated to the polynucleotide that will provide a signal upon expression of the inserted sequences, such as green fluorescent protein (GFP) and the like. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable. The labels can be suitable for small scale detection or more suitable for high-throughput screening. As such, suitable labels include, but are not limited to magnetically active isotopes, nonradioactive isotopes, radioisotopes, fluorochromes, luminescent compounds, dyes, and proteins, including enzymes. The label may be simply detected or it may be quantified. A response that is simply detected generally comprises a response whose existence merely is confirmed, whereas a response that is quantified generally comprises a response having a quantifiable (e.g., numerically reportable) value such as an intensity, polarization, and/or other property. In luminescence or fluorescence assays, the detectable response may be

generated directly using a luminophore or fluorophore associated with an assay component actually involved in binding, or indirectly using a luminophore or fluorophore associated with another (e.g., reporter or indicator) component.

[0066] Examples of luminescent labels that produce signals include, but are not limited to bioluminescence and chemiluminescence. Detectable luminescence response generally comprises a change in, or an occurrence of, a luminescence signal. Suitable methods and luminophores for luminescently labeling assay components are known in the art and described for example in Haugland, Richard P., (1996) Handbook of Fluorescent Probes and Research Chemicals (6^th ed.). Examples of luminescent probes include, but are not limited to, aequorin and luciferases.

[0067] Examples of suitable fluorescent labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue™, and Texas Red. Other suitable optical dyes are described in the

Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6^th ed.).

[0068] In another aspect, the fluorescent label is functionalized to facilitate covalent attachment to a cellular component present in or on the surface of the cell or tissue such as a cell surface marker. Suitable functional groups, including, but not are limited to, isothiocyanate groups, amino groups, haloacetyl groups, maleimides, succinimidyl esters, and sulfonyl halides, all of which may be used to attach the fluorescent label to a second molecule. The choice of the functional group of the fluorescent label will depend on the site of attachment to either a linker, the agent, the marker, or the second labeling agent.

[0069] "Liposomes" are microscopic vesicles consisting of concentric lipid bilayers that are suitable expression or delivery vehicles. Structurally, liposomes range in size and shape from long tubes to spheres, with dimensions from a few hundred Angstroms to fractions of a millimeter. Vesicle-forming lipids are selected to achieve a specified degree of fluidity or rigidity of the final complex providing the lipid composition of the outer layer. These are neutral (cholesterol) or bipolar and include phospholipids, such as phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), and sphingomyelin (SM) and other types of bipolar lipids including but not limited to

dioleoylphosphatidylethanolamine (DOPE), with a hydrocarbon chain length in the range of 14-22, and saturated or with one or more double C=C bonds.

Examples of lipids capable of producing a stable liposome, alone, or in combination with other lipid components are phospholipids, such as

hydrogenated soy phosphatidylcholine (HSPC), lecithin,

phosphatidylethanolamine, lysolecithin, lysophosphatidylethanol- amine, phosphatidylserine, phosphatidylinositol, sphingomyelin, cephalin, cardiolipin, phosphatidic acid, cerebrosides, distearoylphosphatidylethan- olamine (DSPE), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), palmitoyloleoylphosphatidylcholine (POPC),

palmitoyloleoylphosphatidylethanolamine (POPE) and

dioleoylphosphatidylethanolamine 4-(N-maleimido-methyl)cyclohexane-1 -carb- oxylate (DOPE-mal). Additional non-phosphorous containing lipids that can become incorporated into liposomes include stearylamine, dodecylamine, hexadecylamine, isopropyl myristate, triethanolamine-lauryl sulfate, alkyl-aryl sulfate, acetyl palmitate, glycerol ricinoleate, hexadecyl stereate, amphoteric acrylic polymers, polyethyloxylated fatty acid amides, and the cationic lipids mentioned above (DDAB, DODAC, DMRIE, DMTAP, DOGS, DOTAP (DOTMA), DOSPA, DPTAP, DSTAP, DC-Choi). Negatively charged lipids include phosphatidic acid (PA), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylglycerol and (DOPG), dicetylphosphate that are able to form vesicles. Typically, liposomes can be divided into three categories based on their overall size and the nature of the lamellar structure. The three classifications, as developed by the New York Academy Sciences Meeting, "Liposomes and Their Use in Biology and Medicine," December 1977, are multi-lamellar vesicles

(MLVs), small uni-lamellar vesicles (SUVs) and large uni-lamellar vesicles

(LUVs).

[0070] A "micelle" is an aggregate of surfactant molecules dispersed in a liquid colloid. A micelle is an example of a delivery or expression vehicle. A typical micelle in aqueous solution forms an aggregate with the hydrophilic "head" regions in contact with surrounding solvent, sequestering the hydrophobic tail regions in the micelle center. This type of micelle is known as a normal phase micelle (oil-in-water micelle). Inverse micelles have the head groups at the center with the tails extending out (water-in-oil micelle). Micelles can be used to attach a polynucleotide, polypeptide, antibody or composition described herein to facilitate efficient delivery to the target cell or tissue.

[0071] A "gene delivery vehicle" is defined as any molecule that can carry inserted polynucleotides into a host cell. Examples of gene delivery vehicles are liposomes, micelles pharmaceutically acceptable polymers, including natural polymers and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metal particles; and bacteria, or viruses, such as baculovirus, adenovirus and retrovirus, bacteriophage, cosmid, plasmid, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.

[0072] A polynucleotide of this invention can be delivered to a cell or tissue using a gene delivery vehicle. "Gene delivery," "gene transfer," "transducing," and the like as used herein, are terms referring to the introduction of an

exogenous polynucleotide (sometimes referred to as a "transgene") into a host cell, irrespective of the method used for the introduction. Such methods include a variety of well-known techniques such as vector-mediated gene transfer (by, e.g., viral infection/transfection, or various other protein-based or lipid-based gene delivery complexes) as well as techniques facilitating the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery and various other techniques used for the introduction of polynucleotides). The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contains an origin of replication compatible with the host cell or integrates into a replicon of the host cell such as an extrachromosomal replicon (e.g., a plasmid) or a nuclear or mitochondrial chromosome. A number of vectors are known to be capable of mediating transfer of genes to mammalian cells, as is known in the art and described herein.

[0073] A "plasmid" is an extra-chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently of the

chromosomal DNA. In many cases, it is circular and double-stranded. Plasmids provide a mechanism for horizontal gene transfer within a population of microbes and typically provide a selective advantage under a given environmental state. Plasmids may carry genes that provide resistance to naturally occurring antibiotics in a competitive environmental niche, or alternatively the proteins produced may act as toxins under similar circumstances.

[0074] "Plasmids" used in genetic engineering are called "plasmic vectors". Many plasmids are commercially available for such uses. The gene to be replicated is inserted into copies of a plasmid containing genes that make cells resistant to particular antibiotics and a multiple cloning site (MCS, or polylinker), which is a short region containing several commonly used restriction sites allowing the easy insertion of DNA fragments at this location. Another major use of plasmids is to make large amounts of proteins. In this case, researchers grow bacteria containing a plasmid harboring the gene of interest. Just as the bacteria produces proteins to confer its antibiotic resistance, it can also be induced to produce large amounts of proteins from the inserted gene. This is a cheap and easy way of mass-producing a gene or the protein it then codes for.

[0075] A "viral vector" is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro. Examples of viral vectors include retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors and the like. Infectious tobacco mosaic virus (TMV)-based vectors can be used to manufacturer proteins and have been reported to express Griffithsin in tobacco leaves (O'Keefe et al., (2009) Proc. Nat. Acad. Sci. 106(15):6099-6104).

Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus- based vectors, have also been developed for use in gene therapy and

immunotherapy. See, Schlesinger & Dubensky, (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al., (1999) Nat. Med. 5(7):823-827. In aspects where gene transfer is mediated by a retroviral vector, a vector construct refers to the polynucleotide comprising the retroviral genome or part thereof, and a therapeutic gene.

[0076] As used herein, "retroviral mediated gene transfer" or "retroviral transduction" carries the same meaning and refers to the process by which a gene or nucleic acid sequences are stably transferred into the host cell by virtue of the virus entering the cell and integrating its genome into the host cell genome. The virus can enter the host cell via its normal mechanism of infection or be modified such that it binds to a different host cell surface receptor or ligand to enter the cell. As used herein, retroviral vector refers to a viral particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.

[0077] Retroviruses carry their genetic information in the form of RNA;

however, once the virus infects a cell, the RNA is reverse-transcribed into the DNA form which integrates into the genomic DNA of the infected cell. The integrated DNA form is called a provirus.

[0078] "Eukaryotic cells" comprise all of the life kingdoms except monera. They can be easily distinguished through a membrane-bound nucleus. Animals, plants, fungi, and protists are eukaryotes or organisms whose cells are organized into complex structures by internal membranes and a cytoskeleton. The most characteristic membrane-bound structure is the nucleus. A eukaryotic host, including, for example, yeast, higher plant, insect and mammalian cells. Non- limiting examples include simian, bovine, ovine, porcine, murine, rats, canine, equine, feline, avian, reptilian and human. [0079] The term "LD50" refers to the median lethal dose of a toxic substance required to kill half the members of a tested population after a specified test duration.

[0080] Poly [ADP-ribose] polymerase 1 (PARP-1 ) also known as NAD+ ADP- ribosyltransferase 1 or poly[ADP-ribose] synthase 1 is an enzyme that in humans is encoded by the PARP1 gene. Methods of this invention include

overexpressing PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement for enhancing the efficiency of reprogramming of a non-pluripotent cell to a pluripotent cell. Without being bound by theory, Applicants contemplate that that overexpression of PARP-1 decreases the expression of p53 in the cell. Also without being bound by theory, it is further contemplated that overexpression of PARP-1 alters the cellular localization of Sox2. GENBANK ACCESSION Nos.: NM_001618, NP_001609 (Human); NM_007415, NP_031441 (Mouse) for sequences of PARP-1 . As used herein or unless specifically stated, "PARP-1 polynucleotide or gene" intends the represented polynucleotide or gene or an equivalent thereof as defined herein or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement.

[0081] Oct3/4 (octamer-binding transcription factor 3/4) also known as POU5F1 (POU domain, class 5, transcription factor 1 ) is a protein that in humans is encoded by the POU5F1 gene. Oct3/4 is a homeodomain transcription factor of the POU family. This protein is critically involved in the self-renewal of

undifferentiated embryonic stem cells. As such, it is frequently used as a marker for undifferentiated cells. See, e.g., GENBANK ACCESSION Nos.: NM_002701 , NP_002692 (Human); NM_013633, NP_038661 (Mouse).

[0082] SRY (sex determining region Y)-box 2, also known as SOX2, is a transcription factor that is essential to maintain self-renewal of undifferentiated embryonic stem cells. This intronless gene encodes a member of the SRY- related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. Mutations in this gene have been associated with bilateral anophthalmia, a severe form of structural eye malformation. See, e.g., GENBANK ACCESSION Nos.: NM_003106, NP_003097 (Human); XM_985079, XM_990173 (Mouse).

[0083] The Kmppel-like family of transcription factors (Klfs), so named for their homology to the Drosophila melanogaster Kruppel protein, have been extensively studied for their roles in cell proliferation, differentiation and survival, especially in the context of cancer . All KLF family members are characterised by their three Cys2 His2 zinc fingers located at the C-terminus, separated by a highly conserved H/C link. DNA binding studies demonstrated that the KLFs have similar affinities for different GC-rich sites, or sites with CACCC homology, and can compete with each other for the occupation of such sites. KLFs also share a high degree of homology between the specificity protein (Sp) family of zinc-finger transcription factors and bind similar, if not the same sites, in a large number of genes. Klf4, known also as gut-enriched Kmppel-like factor (GKLF) acts as a transcriptional activator or repressor depending on the promoter context and/or cooperation with other transcription factors. See, e.g., GENBANK ACCESSION Nos.: NM_004235, NP_004226 (Human); NM_010637, NP_034767 (Mouse).

[0084] Myc (c-Myc) codes for a protein that binds to the DNA of other genes and is therefore a transcription factor. When a gene like Myc is altered to cause cancer, the cancerous version of the gene is called an oncogene. The healthy version of the gene that it is derived from is called a proto-oncogene. See, e.g., GENBANK ACCESSION Nos.: NM_002467, NP_002458 (Human); NM_010849, NP_034979 (Mouse).

[0085] NANOG is a transcription factor critically involved with self-renewal of undifferentiated embryonic stem cells. In humans, this protein is encoded by the NANOG gene. NANOG is a gene expressed in embryonic stem cells (ESCs) and is thought to be a key factor in maintaining pluripotency. NANOG is thought to function in concert with other factors to establish ESC identity. See, e.g., GENBANK ACCESSION Nos.: NM_0024865, NP_079141 (Human);

XM_132755, XP_132755 (Mouse).

[0086] Lin-28 homolog A is a protein that in humans is encoded by the LIN28 gene. It is a marker of undifferentiated human embryonic stem cells and has been used to enhance the efficiency of the formation of induced pluripotent stem (iPS) cells from human fibroblasts. See, e.g., GENBANK ACCESSION Nos.: NM_024674, NP_078950 (Human); NM_145833, NP_665832 (Mouse).

[0087] The term "pluripotency factors" intends polynucleotides, small molecules (compounds) or other agents that will de-differentiate a non-pluripotent cell to a pluripotent cell. Non-limiting examples include without limitation the Yamanaka factors, the Thompson factors or the cocktails described herein.

[0088] The term "Yamanaka factors" refers to factors that, when expressed in a non-pluripotent cell, induce pluripotency. These factors include Sox2, Klf4, c- Myc, and Oct3/4.

[0089] The term "Thompson factors" refers to factors that, when expressed in a non-pluripotent cell, induce pluripotency. These factors include Lin28, Sox2, Nanog, and Oct3/4.

Methods for Enhancing Efficiency of Reprogramming

[0090] In one aspect, this invention provides a method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising expressing in the cell an effective amount of pluripotency factors and an effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement, thereby enhancing the efficiency of reprogramming the non- pluripotent cell to the pluripotent cell. In one embodiment of the present invention, the pluripotency factors are the Yamanaka factors. As used herein, the term "enhancing the efficiency" intends an increase in the number of, or conversion ratio of non-pluripotent to pluripotent cells. This can be determined by methods known in the art, e.g., counting the number of alkaline phosphatase positive stem cell-like colonies that form in a reprogrammed non-pluripotent culture, or by counting the absolute number of stem cell-like (eg: staining positively for SSEA-1 ) cells via flow cytometry.

[0091] In another aspect of the present invention, described herein is a method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising or alternatively consisting essentially of, or yet further consisting of overexpressing an effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement in a cell induced to reprogramming, thereby enhancing the efficiency of reprogramming the non-pluripotent cell to the pluripotent cell. In a related embodiment, the cell is induced to reprogramming prior to, subsequent to, or concurrently with overexpressing the effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement. In a further embodiment, the cell is induced to reprogramming by expressing in the cell an effective amount of the Yamanaka factors. Pluripotency can be induced in differentiated cells by ectopic expression of the four transcription-factor genes Oct3/4, Sox2, Klf4 and c-Myc (collectively known as the Yamanaka factors).

These induced pluripotent stem cells (iPSCs) are isogenic to the original somatic cell (and its donor) and thus overcome several of the challenges of ESC research.

[0092] Another method relates to enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising or alternatively consisting essentially of, or yet further consisting of overexpressing an effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement in a non- pluripotent cell having pluripotency-inducing transgenes. Methods of this invention include the introduction of transgenes that are inducible by, for example, chemical agents or physical agents. In this instance, PARP-1 can be made to be overexpressed in the cell, and subsequent induction of pluripotency transgenes will enhance the efficiency of the reprogramming of the non- pluripotent cell to the pluripotent cell. In other instances, the PARP-1 transgene is inducible by the same agent as the pluripotency factors. In this instance, the induction of the pluripotency factors and PARP-1 can occur simultaneously. In other instances, the PARP-1 transgene is inducible by a different agent than the pluripotency factors. In this instance, the order of induction of PARP-1 and the pluripotency factors is not important.

[0093] Applicants unexpectedly found that PARP-1 was required for

reprogramming a cell. Cells deficient for the PARP-1 gene were greatly reduced in their ability to reprogram a cell compared to cells that exhibited endogenous levels of expression of the PARP-1 protein. It is contemplated that overexpression of PARP-1 can enhance the reprogramming of a non-pluripotent cell to a pluripotent cell wherein the cell also expresses or is made to express pluripotency factors such as the Thompson factors. The Thompson factors include Oct3/4, Sox2, Nanog, and Lin28.

[0094] It is further contemplated that overexpression of PARP-1 will increase the efficiency of reprogramming when the pluripotency factors expressed in the cell include only include three of the four Yamanaka factors. For example, it is contemplated that overexpression of PARP-1 will enhance the reprogramming efficiency of cells expressing or made to express a cocktail of the Yamanaka factors that includes Oct3/4, Sox2, and Klf4 or cells expressing or made to express any three of the four Thompson factors or 2 of the four Yamanaka factors or 2 of the 4 Thompson factors. It is further contemplated that overexpression of PARP-1 will enhance the reprogramming efficiency of cells expressing or made to express a cocktail of factors according to Table 1 .

Table 1

[0095] The expression level of mRNA and/or polypeptide can be quantitated by various methods well known to those in the art. One example of such method for determining the level of RNA expression in a cell is through quantitative PCR.

[0096] In one aspect, in the above methods, the PARP-1 polynucleotide or the equivalent thereof is overexpressed by a method comprising, or alternatively consisting essentially of, or yet further consisting of expressing in the cell an effective amount of a polynucleotide encoding the PARP-1 or an equivalent thereof. For example, in one aspect, the the effective amount of PARP-1 or an equivalent thereof is an amount that comprises at least 1 .5 level of RNA transcription of the PARP-1 polynucleotide as compared to endogenous expression of the PARP-1 polynucleotide.

[0097] As is known to those of skill in the art, that the polynucleotide is operationally linked to the necessary regulatory elements for transcription and/or translation. In one aspect, the polynucleotides are contained within an expression vector that optionally contains an inducible promoter for controlled expression of the polynucleotide. When multiple polynucleotides are introduced into the cell, e.g., when multiple copies of the same polynucleotide and/or copies of different polynucleotides are on a contiguous expression element, the expression element can be polycistronic. Alternatively, multiple copies of the same polynucleotide can be introduced and expressed from multiple,

independent expression elements.

[0098] In another aspect, the effective amount of PARP-1 or an equivalent thereof is expressed from an endogenous PARP-1 polynucleotide induced to overexpression and/or an exogenous PARP-1 polynucleotide or an equivalent thereof introduced into the cell and expressed in the cell. Methods to ehance expression are knowin the art, and include without limitation, operationally inserting an effective amount of an enhancer element such that endogenous PARP-1 polynucleotide is overexpressed in the cell. In one aspect, an inducible promoter is also inserted into the cell.

[0099] In one aspect, the cell is induced to reprogramming by a method comprising, or alternatively consisting essentially of, or yet further consisting of, expressing in the cell an effective amount of a polynucleotide encoding one or more of the pluripotency factors. In another aspect, the method further comprises, or alternatively consists essentially of, or yet further consists of, introducing into the cell an equivalent to one or more pluripotency factor, with the proviso that the agent is not a polynucleotide encoding the one or more pluripotency factors, e.g., a a small molecule. As is known to those of skill in the art, that the polynucleotide is operationally linked to the necessary regulatory elements for transcription and/or translation. In one aspect, the polynucleotides are contained within an expression vector that optionally contains an inducible promoter for controlled expression of the polynucleotide. When multiple polynucleotides are introduced into the cell, e.g., when multiple copies of the same polynucleotide copies of different polynucleotides are on a contiguous expression element, the expression element can be polycistronic. Alternatively, multiple copies of the same polynucleotide can be introduced and expressed from multiple, independent expression elements.

[0100] For the methods desribed herein, the polynucleotides can be detectably labeled to facilitate monitoring of expression of the endogenous poynucleotides. Examples of detectable labels are provided herein.

[0101] The methods are not limited by the method of introduction and/or expression of the polynucleotide. In one aspect, the methods further comprise, or alternatively consist essentially of, or yet further consist of, introducing into the cell an effective amount of the polynucleotide, e.g., by transduction, gene gun, or by use of an expression vector operatively linked to the polynucleotide to be expressed. Suitable expression vectors include without limitation, viral vectors, liposome, plasmids or micelles. Non-limiting examples of viral vector include a retroviral vector, an adeno-associated viral vector, or a lentiviral vector.

[0102] The method is not limited by the species of cell or cell type. The non- pluipotent cell can be a cell of the group: a human cell, an equine cell, a murine cell, a simian cell, a canine cell, a feline cell, an ovine cell or a bovine cell and in one aspect, contains one or more genetic abnormalities. In a further aspect, the genetic abnormality produces a phenotypic change in the cell related to a genetic disease or disorder. Non-limiting examples of tissue or cell type include:

fibroblasts, cardiac cell, neurons, hematopoietic cells, T cell, B cells, lung cells, brain cells, retinal cells and the like.

[0103] In a further aspect, the methods comprise, or alternatively consist essentially of, or yet further consist of, culturing the cell under conditions to produce a population of cells. In a yet further aspect, the pluripotent cells are isolated from the non-pluripotent cells upon expression of the factors and/or polynucleotides. [0104] Populations of plunpotent cells produced by the methods described herein can be differentiated into specific cell types and such methods are further provided herein by culturing the cell under specific conditions to differentiate the cell into the determined cell type. Specific cell types include, for example, Gland cells, exocrine secretory epithelial cells, Salivary gland mucous cell, Salivary gland serous cell, Von Ebner's gland cell, Mammary gland cell, Lacrimal gland cell, Ceruminous gland cell in ear, pituitary cells, Magnocellular neurosecretory cells, Gut and respiratory tract cells, Thyroid gland cells, Parathyroid gland cells, Adrenal gland cells, epithelial cells, squamous cells, Respiratory tract ciliated cell, Epidermal cells, neural cells, Schwann cells, glial cells, astrocytes,

oligodendrocytes, Hepatocytes, Adipocytes, kidney cells, chondrocytes, osteoblasts, osteocytes, hepatic cells, muscle cells, skeletal muscle cells, satellite cells, heart cells, purkinje fibers, Erythrocytes, Megakaryocytes, Osteoclasts, Dendritic cells, Microglial cell, Eosinophils, Basophils, Mast cells, cells of the immune system, T cells, B cells, Reticulocytes, Melanocytes, Germ cells,

Oogonium/Oocytes, and Spermatocytes.

[0105] Methods of differentiating pluripotent cells into specific cell types vary depending on the cell type, but are known to those skilled in the art. Typically certain factors are added to the media of cells to favor one cell lineage over another. For example, pluripotent cells can be differentiated into adipocytes by adding retinoic acid. Factors used in the differentiation of cells can be small molecules, proteins, nucleic acids, chemicals, or culturing techniques.

[0106] The methods described herein can be practiced in vitro or in vivo. When practiced in vitro, the methods can be used to screen for possible therapeutic agents. In vivo, the cells can be de-differentiated in vivo to provide a non-human transgenic animal or de-differentiated in vitro and then administered in an effective amount as a therapy for a subject or patient Such non-human

transgenic animals are also provided herein which are produced by administering to the non-human animal an effective amount of the cell or population of cells as described herein. The non-human transgenic animal can be a murine, a canine, a bovine, an equine, a feline, a canine and an ovine. The cell can be autologous or allogeneic to the animal. The pluripotent cells can also be differentiated and/or genetically modified and administered to a subject in a therapeutically effective amount to treat or prevent a disease or pathological condition.

[0107] Also desribed herein is an isolated cell produced by the method described herein, as well as a population of cells produced by the methods. In one aspect, the method is performed, the cells are cultured under conditions to reprogram the cell. The isolated pluripotent cell or population of pluripotent cells produced by the methods are further provided herein. The cells can further be combined with a carrier, such as a pharmaceutically acceptable carrier for testing or administration to a subject such as a human patient.

[0108] Further provided are compositions and/or kits containing the elements to practice the methods of this invention and optionally, with instructions to perform the methods. As an example only, a composition can contain polynucleotides encoding PARP-1 in an amount to produce overexpression and the pluripotency factors, in a carrier, such as a pharmaceutically acceptable carrier. The cells and populations can be further genetically modified as determined or required by the screen or treating physician.

[0109] In vitro, the methods can be used to screen for a possible therapeutic agent by a method comprising, or alternatively consisting essentially of, or yet further consisting of, contacting an agent to be screened with an isolated pluripotent cell or population of cells, or a cell differentiated from these cells or population of eels, as described hereinand determining if the agent is a possible therapeutic agent by observing a change or lack of change in one or more cells, wherein the change or lack of change indicates that the agent is or is not a possible therapeutic agent. Without limitation, the agent is selected from the group of small molecules, aptamers, antisense molecules, antibodies, fragments of antibodies, polypeptides, proteins, polynucleotides, organic compounds, cytokines, cells, shRNAs, siRNA, a virus, genetic material in a liposome, and an inorganic molecule.

[0110] To determine the therapeutic potential of the agent, one can determine the LD50 of the agent. To determine the LD50 of an agent, different doses of the agent can be contacted with the cells, and the dose at which 50% of the cells die is the LD50. Measuring cell death can be done by a variety of procedures such as measuring the apoptosis in the cell, measuring the caspase cleavage of the cell, or staining the cell for viability markers and determing the percentage of cells stained. Alternatively, one can detect a phenotypic or a cellular response to the agent, e.g.,: apoptosis, proliferation, gene expression, a physiological change, or an electrophysiological change.

[0111] Other aspects of the invention relate to the use of a pluripotent cell made from the above methods for screening a cell with a variation of a gene of interest for an agent to treat a disease or disorder comprising contacting an agent to be screened with the cell, observing a change or lack of change in one or more cells, wherein the change or lack of change is correlated with an ability of the agent to treat the disease or disorder. In other words, the change or lack of change can be indicative of an ability of the agent to treat the disease or disorder. Agents to be screened include potential and known therapeutics. Such

therapeutics include, but are not limited to, small molecules; aptamers, antisense molecules; antibodies and fragments thereof; polypeptides; proteins;

polynucleotides; organic compounds; cytokines; cells; genetic agents including, for example, shRNA, siRNA, a virus or genetic material in a liposome; an inorganic molecule including salts such as, for example, lithium chloride or carbonate; and the like.

[0112] The pluripotent cell made from the methods disclosed above can also be used for determining disease mechanisms wherein the use comprises contacting the cell with an agent or condition which affects a molecular pathway of interest. In a related embodiment, the molecular pathway is a disease-associated pathway. A disease-associated gene pathway generally refers to genes and gene products comprising a disease-associated gene, and may include one or more genes that act upstream or downstream of a disease-associated gene in a disease related pathway; or any gene whose gene product interacts with, binds to, competes with, induces, enhances or inhibits, directly or indirectly, the expression or activity of a disease-associated gene; or any gene whose expression or activity is induced, enhanced or inhibited, directly or indirectly, by a disease-associated gene; or any gene whose gene product is induced, enhanced or inhibited, directly or indirectly, by a disease-associated gene. A disease- associated gene pathway may refer to one or more genes or the gene products which act in a signaling pathway. Direct and indirect mechanisms refer, respectively, to direct contact or modification of a molecular actor in a pathway and contact or modification of an intermediary molecule which in turn contacts or modifies a molecular actor in a pathway, as is known in the art. Indirect mechanisms may be one or more steps removed from direct influence on a pathway. "Molecular determinants," as used herein, refers to any of the genes or gene products which may act, directly or indirectly, in a disease-associated gene pathway.

[0113] In some embodiments, the cells are subjected to a condition, which triggers the activities of known factors in response to the condition, using the activity of the naturally occurring factors to thereby identify pathways and molecules associated with the disease of interest. Such conditions include, for example, hypoxic or anoxic conditions or any condition resulting in oxidative, endoplasmic reticular or mitochondrial stress.

[0114] Certain aspects of the present invention relate to culturing the cells and isolating the pluripotent cells from the non-pluripotent cells produced by any of the aforementioned methods. Culturing cells and separating different cell populations are a technique commonly known to those of average skill in the art. The specific methods may vary depending on various differences including but not limited to the pluripotency factors used, the type of cell used, and the desired use for the cell. One example of methods for culturing and isolating such cells is described in Example 2. In a related embodiment, there is a method for treating a subject in need of treatment comprising administering to the subject an effective amount of the pluripotent cells produced by methods of the current invention.

[0115] As noted above, the present disclosure describes a reprogrammed cell produced by any of the above described methods. In a related embodiment, the reprogrammed cell is used for modeling mammalian diseases. Since induced pluripotency was first described in humans, a number of genetically diseased iPSC lines have been derived including Amyotrophic Lateral Sclerosis (Dimos, J. et al., (2008) Science, 321 (5893):1218-21 ), ADA Severe Combined

immunodeficiency, Shwachman-Bodian-Diamond Syndrome, Gaucher Disease type III, Duchenne and Becker muscular dystrophies, Parkinson Disease, Huntington disease, juvenile-onset type-1 diabetes, Down syndrome, Lesch- Nyhan syndrome carrier (Park, I. et al.,(2008) Cell, 134(5):877-86), Fanconi anemia (Raya, A. et al., (2009) Nature, 46053-59), Spinal Muscular Atrophy (Ebert, A. et al., (2009) Nature, 457:277-80), long-QT syndrome (Moretti, A. et al., (2010) New England Journal of Medicine, 363(15):1397-409.), familial

dysautonomia (Lee, G. et al., (2009) Nature, 461 :402-6.), LEOPARD syndrome (Carvajal-Vergara, X. et al., (2010) Nature, 465:808-12) and Progeria (Zhang, J. et al., (201 1 ) Cell Stem Cell, 8(1 ):31 -45). The utility of these lines is their ability to give rise to diseased tissue in vitro, for studying disease biology as well as drug testing, whereas previously, research on these diseases and many others was hampered by the limited availability of diseased tissue.

Methods for Increasing the Level of a Protein in a Cell

[0116] Methods for increasing the level of a protein, or polypeptide or peptide, in a cell are known in the art. In one aspect, the protein level is increased by increasing the amount of a polynucleotide encoding the protein, wherein that polynucleotide is expressed such that new protein is produced. In another aspect, increasing the protein level is increased by increasing the transcription of a polynucleotide encoding the protein, or alternatively translation of the protein, or alternatively post-translational modification, activation or appropriate folding of the protein. In yet another aspect, increasing the protein level is increased by increasing the binding of the protein to appropriate cofactor, receptor, activator, ligand, or any molecule that is involved in the protein's biological functioning. In some embodiments, increasing the binding of the protein to the appropriate molecule is increasing the amount of the molecule. In one aspect of the embodiments, the molecule is a protein. In another aspect of the embodiments, the molecule is a small molecule. In a further aspect of the embodiments, the molecule is a polynucleotide.

[0117] Methods of increasing the amount of polynucleotide encoding the protein in a cell are known in the art. In one aspect, the polynucleotide can be introduced to the cell and expressed by a gene delivery vehicle that can include a suitable expression vector. Expression vectors

[0118] Suitable expression vectors are well-known in the art, and include vectors capable of expressing a polynucleotide operatively linked to a regulatory element, such as a promoter region and/or an enhancer that is capable of regulating expression of such DNA. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the inserted DNA. Appropriate expression vectors include those that replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.

[0119] As used herein, the term "vector" refers to a non-chromosomal nucleic acid comprising an intact replicon such that the vector may be replicated when placed within a cell, for example by a process of transformation. Vectors may be viral or non-viral. Viral vectors include retroviruses, adenoviruses, herpesvirus, bacculoviruses, modified bacculoviruses, papovirus, or otherwise modified naturally occurring viruses. Exemplary non-viral vectors for delivering nucleic acid include naked DNA; DNA complexed with cationic lipids, alone or in combination with cationic polymers; anionic and cationic liposomes; DNA-protein complexes and particles comprising DNA condensed with cationic polymers such as heterogeneous polylysine, defined-length oligopeptides, and polyethylene imine, in some cases contained in liposomes; and the use of ternary complexes comprising a virus and polylysine-DNA.

[0120] Non-viral vectors may include a plasmid that comprises a heterologous polynucleotide capable of being delivered to a target cell, either in vitro, in vivo or ex-vivo. The heterologous polynucleotide can comprise a sequence of interest and can be operably linked to one or more regulatory elements and may control the transcription of the nucleic acid sequence of interest. As used herein, a vector need not be capable of replication in the ultimate target cell or subject. The term vector may include expression vector and cloning vector.

[0121] A "viral vector" is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro. Examples of viral vectors include retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors and the like. Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See, Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying, et al., (1999) Nat. Med. 5(7):823-827. In aspects where gene transfer is mediated by a retroviral vector, a vector construct refers to the polynucleotide comprising the retroviral genome or part thereof, and a therapeutic gene. As used herein, "retroviral mediated gene transfer" or "retroviral

transduction" carries the same meaning and refers to the process by which a gene or nucleic acid sequences are stably transferred into the host cell by virtue of the virus entering the cell and integrating its genome into the host cell genome. The virus can enter the host cell via its normal mechanism of infection or be modified such that it binds to a different host cell surface receptor or ligand to enter the cell. As used herein, retroviral vector refers to a viral particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.

[0122] In aspects where gene transfer is mediated by a DNA viral vector, such as, for example, an adenovirus (Ad), an adeno-associated virus (AAV), a lentivirus, or a Herpes simplex virus vector construct. A vector construct refers to the polynucleotide comprising the viral genome or part thereof, and a transgene.

[0123] Adenoviruses are able to transfect a wide variety of cell types, including non-dividing cells. There are more than 50 serotypes of adenoviruses that are known in the art, but the most commonly used serotypes for gene therapy are type 2 and type 5. Typically, these viruses are replication-defective; and genetically-modified to prevent unintended spread of the virus. This is normally achieved through the deletion of the E1 region, deletion of the E1 region along with deletion of either the E2 or E4 region, or deletion of the entire adenovirus genome except the cis-acting inverted terminal repeats and a packaging signal (Gardlik et al., (2005) Med Sci Monit, 1 1 :RA1 10-121 ).

[0124] Retroviruses are also useful as mammalian expression vectors and usually (with the exception of lentiviruses) are not capable of transfecting non- dividing cells. Retroviruses carry their genetic information in the form of RNA; however, once the virus infects a cell, the RNA is reverse-transcribed into the DNA form which integrates into the genomic DNA of the infected cell. The integrated DNA form is called a provirus. Any appropriate type of retrovirus that is known in the art may be used, including, but not limited to, HIV, SIV, FIV, EIAV, and Moloney Murine Leukaemia Virus (MoMLV). Typically, therapeutically useful retroviruses including deletions of the gag, pol, or env genes.

[0125] In another aspect, the invention features the methods of gene

expression that utilize lentivirus vectors to express PARP-1 or pluripotency factors. Lentiviruses are a type of retroviruses with the ability to infect both proliferating and quiescent cells. An exemplary lentivirus vector for use in gene therapy is the HIV-1 lentivirus. Previously constructed genetic modifications of lentiviruses include the deletion of all protein encoding genes except those of the gag, pol, and rev genes (Moreau-Gaudry et al., (2001 ) Blood. 98: 2664-2672).

[0126] Adeno-associated virus (AAV) vectors can achieve latent infection of a broad range of cell types, exhibiting the desired characteristic of persistent expression of a therapeutic gene in a patient. The invention includes the use of any appropriate type of adeno-associated virus known in the art including, but not limited to AAV1 , AAV2, AAV3, AAV4, AAV5, and AAV6 (Lee et al., (2005)

Biochem J. 387:1 -15; U.S. Patent Publication 2006/0204519).

[0127] Herpes simplex virus (HSV) replicates in epithelial cells, but is able to stay in a latent state in non-dividing cells such as the midbrain dopaminergic neurons. The gene of interest may be inserted into the LAT region of HSV, which is expressed during latency. Other viruses that have been shown to be useful in gene therapy include parainfluenza viruses, poxviruses, and alphaviruses, including Semliki forest virus, Sinbis virus, and Venezuelan equine encephalitis virus (Kennedy, (1997) Brain. 120:1245-1259).

[0128] Exemplary non-viral vectors for delivering nucleic acid include naked DNA; DNA complexed with cationic lipids, alone or in combination with cationic polymers; anionic and cationic liposomes; DNA-protein complexes and particles comprising DNA condensed with cationic polymers such as heterogeneous polylysine, defined-length oligopeptides, and polyethylene imine, in some cases contained in liposomes; and the use of ternary complexes comprising a virus and polylysine-DNA. In vivo DNA-mediated gene transfer into a variety of different target sites has been studied extensively. Naked DNA may be administered using an injection, a gene gun, or electroporation. Naked DNA can provide long- term expression in muscle. See Wolff, et al., (1992) Human Mol. Genet., 1 :363- 369; Wolff, et al., (1990) Science, 247:1465-1468. DNA-mediated gene transfer has also been characterized in liver, heart, lung, brain and endothelial cells. See Zhu, et al., (1993) Science, 261 :209-21 1 ; Nabel, et al., (1989) Science, 244:1342- 1344. DNA for gene transfer also may be used in association with various cationic lipids, polycations and other conjugating substances. See Przybylska et al., (2004) J. Gene Med., 6:85-92; Svahn et al., (2004) J. Gene Med., 6:S36-S44.

[0129] Typically, vectors made in accordance with the principles of this disclosure will contain regulatory elements that will cause constitutive or regulated expression of the coding sequence.

[0130] Vectors useful for expression of PARP-1 or pluripotency factors can contain a regulatory element that provides tissue specific or inducible expression of an operatively linked nucleic acid. One skilled in the art can readily determine an appropriate tissue-specific promotor or enhancer that allows expression of genes in a desired tissue. Any of a variety of inducible promoters or enhancers can also be included in the vector for regulatable expression of a polypeptide or nucleic acid. Such inducible systems, include, for example, tetracycline inducible system (Gossen & Bizard, (1992) Proc. Natl. Acad. Sci. USA, 89:5547-5551 ; Gossen et al., (1995) Science, 268:1766-1769); metalothionein promoter induced by heavy metals; insect steroid hormone responsive to ecdysone or related steroids such as muristerone (No et al., (1996) Proc. Natl. Acad. Sci. USA, 93:3346-3351 ; Yao et al., (1993) Nature, 366:476-479; Invitrogen); mouse mammary tumor virus (MMTV) induced by steroids such as glucocortocoid and estrogen (Lee et al., (1981 ) Nature, 294:228-232); and heat shock promoters inducible by temperature changes.

[0131] Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo, and are commercially available from sources such as Stratagene (La Jolla, CA) and Promega Biotech (Madison, Wl). In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of the clones to eliminate extra, potential inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites can be inserted immediately 5' of the start codon to enhance expression.

[0132] Genes may be delivered to the cell by a variety of mechanisms commonly known to those of skill in the art. Viral constructs can be delivered through the production of a virus in a suitable host cell. Virus is then harvested from the host cell and contacted with the target cell. Viral and non-viral vectors capable of expressing genes of interest can be delivered to a targeted cell via DNA liposome complexes, micelles and targeted viral protein-DNA complexes. Liposomes that also comprise a targeting antibody or fragment thereof can be used in the methods of this invention. In addition to the delivery of

polynucleotides to a cell or cell population, direct introduction of the proteins described herein to the cell or cell population can be done by the non-limiting technique of protein transfection, alternatively culturing conditions that can enhance the expression and/or promote the activity of the proteins of this invention are other non-limiting techniques.

[0133] Other methods of delivering vectors encoding genes of the current invention include but are not limited to, calcium phosphate transfection, DEAE- dextran transfection, electroporation, microinjection, protoplast fusion, or liposome-mediated transfection. The host cells that are transfected with the vectors of this invention may include (but are not limited to) E. coli or other bacteria, yeast, fungi, insect cells (using, for example, baculoviral vectors for expression in SF9 insect cells), or cells derived from mice, humans, or other animals (e.g., mammals). In vitro expression of a protein, fusion, polypeptide fragment, or mutant encoded by cloned DNA may also be used. Those skilled in the art of molecular biology will understand that a wide variety of expression systems and purification systems may be used to produce recombinant proteins and fragments thereof.

[0134] It is contemplated that the method of enhancing of the reprogramming of non-pluripotent cells to pluripotent cells, which method comprises overexpressing PARP-1 in the cell can be achieved with a variety of pluripotency factors and a variety of donor cells. Table 2 list examples of previously characterized cell

systems and pluripotency factors used therein.

Table 2: Studies on cellular dedifferentiation

Cell type Species Target cell type Factors used References

Fibroblasts Mouse, Pluripotent (iPS Oct3/4, Sox2, Klf4, Takahashi (2006);

human, cells) c-Myc Takahashi (2007); Liu monkey, overexpression (2008); Esteban pig (2009)

Fibroblasts Rat, Pluripotent (iPS Oct3/4, Sox2, Klf4, Li (2009); Nakagawa mouse, cells) overexpression (2008)

human

Fibroblasts Human Pluripotent (iPS Oct3/4, Sox2, Yu (2007)

cells) Nanog, Lin28

overexpression

Hepatocytes, Mouse Pluripotent (iPS Oct3/4, Sox2, Klf4, Aoi (2008)

Gastric epithelial cells) c-Myc

cells overexpression

Pancreatic β cells Mouse Pluripotent (iPS Oct3/4, Sox2, Klf4, Stadtfeld (2008)

cells) c-Myc

overexpression

Neural stem cells Mouse Pluripotent (iPS Oct3/4 Eminli (2008)

cells) overexpression

Adipose stem cells Human Pluripotent (iPS Oct3/4, Sox2, Klf4, Sun (2009)

cells) c-Myc

overexpression

Keratinocytes Human Pluripotent (iPS Oct3/4, Sox2, Klf4, Aasen (2008)

cells) c-Myc

overexpression

B-lymphocytes Mouse Pluripotent (iPS C/EBPa, Oct3/4, Hanna (2008)

cells) Sox2, Klf4, c-Myc

overexpression

B-lymphocytes Mouse Multipotent (blood Pax5 gene Nutt (1999)

progenitors) knockout

Oligodendrocyte Rat Multipotent (neural PDGF, BMP4, Kondo (2000) precursors stem cells) FGF2

(recombinant

protein treatment)

Myoblasts Human Multipotent CNTF Chen (2005)

(neuroglio-, adipo- (recombinant

and myogenic) protein treatment) Myoblasts Mouse Multipotent Reversine Lee (2009)

(neuroectodermal (chemical agent)

and mesodermal)

Peripheral-blood Human Multipotent purified CR3/43 Abuljadayel (2003)

(hematopoietic, monoclonal

mononucleocytes

neurogenic and antibody

cardiomyogenic) crosslinking

[0135] The expression of transgenes delivered to cells as described by the current methods can be measured by techniques commonly known to those skilled in the art. Non-limiting examples of these techniques include quantitative PCR, real-time PCR, western blots, immunostaining, and immunohistochemistry.

Culturing of Cells

[0136] After non-pluripotent cells are introduced with PARP-1 and/or

pluripotency factors using the disclosed methods, these cells may be cultured in a medium sufficient to maintain the pluripotency. Culturing of induced pluripotent stem cells (iPSCs) generated in this invention can use various medium and techniques developed to culture primate pluripotent stem cells, more specially, embryonic stem cells, as described in U.S. patent publication 2007/0238170 and U.S. patent publication 2003/021 1603.

[0137] For example, like human embryonic stem (hES) cells, iPS cells can be maintained in 80% DMEM (Gibco #10829-018 or #1 1965-092), 20% defined fetal bovine serum (FBS), and antibiotics. Other factors may be added to culturing media such as non-essential amino acids, L-glutamine, and mercaptoethanol. Alternatively, ES cells can be maintained in serum-free medium, made with 80% Knock-Out DMEM (Gibco #10829-018) and 20% serum replacement (Gibco #10828-028). Additionally or alternatively, cells may be cultured in feeder-based systems, utilizing irradiated fibroblasts as feeder cells.

[0138] Pluripotent cells can be isolated from non-pluripotent cells by methods known to those skilled in the art. Some exemplary methods include sorting cells based on the differential expression of cell surface markers using immunostaining followed by fluorescent-activated cell sorting. Other methods include culturing the cells under conditions that favor the survival and/or propagation of pluripotent cells over non-pluripotent cells such as culture for extended periods of time, as non-pluripotent cells are rarely capable of infinite self-renewal.

Use of Cells and Cell Populations for Screening

[0139] Methods of screening the cell lines or cell populations with a variation of a gene of interest for an agent to treat a disease or disorder are also provided. The methods comprise contacting an agent to be screened with a cell line or cell population described herein, observing a change or lack of change in one or more cells, where the change or lack of change is correlated with an ability of the agent to treat the disease or disorder. In other words, the change or lack of change can be indicative of an ability of the agent to treat the disease or disorder. Agents to be screened include potential and known therapeutics. Such

[0140] In some embodiments, the methods of screening the cell lines or cell populations with a variation of a gene of interest for an agent to treat a disease or disorder include comparison of the cell lines or populations with another cell line or population. For example, the cell lines or cell populations described herein may be compared to a normal cell line or population, meaning a cell line derived from a patient with no known symptoms or who has not been diagnosed with the disease or disorder of interest. Alternatively, the cell lines or cell populations described herein may be compared to a cell line or population of idiopathic cells, meaning cell lines or populations derived from patients who present with symptoms of the disease or disorder of interest, or have been diagnosed with the disease or disorder, but who do not have a variation of the gene of interest, and where the cause of the disease or disorder may even be unknown (sporadic or idiopathic). In other embodiments, the methods of screening the cell lines or cell populations with a variation of a gene of interest for an agent to treat a disease or disorder involve comparison of the cell lines or cell populations derived from a cell containing a genetic variation of interest to both a normal cell line or cell population and an cell line isolated from a subjecting presenting with an idiopathic/unknown form of disease or population. In some embodiments, the normal cell line or cell population and the idiopathic cell line or population will have been generated using the same protocol as that used to generate the cell line or population containing the genetic variation of interest. Thus, the normal cell line or cell population may serve as a control. As well, any change or lack of change in the control cells, idiopathic cells, and cells with the genetic variation of interest upon contacting with an agent may be compared to one another.

Patients or groups of patients with idiopathic disease may thereby be compared to patients with genetic variations of interest with respect to their responsiveness to an agent, to a class of agent, to an amount of agent, and the like. In this way, idiopathic diseases are classified by their responsiveness to agents, yielding information about the etiology of the idiopathic disease and, alternatively or additionally, agents are identified which are effective across one or more classes of disease. It is envisioned that these methods are additionally used to develop treatment regimens for patients or classes of patients with a disease.

[0141] In other embodiments cell lines are created from patients presenting with an idiopathic form of disease and such cell lines are used for screening, and identification of disease mechanisms or disease diagnosis, independent of cells lines in which genetic variations exist.

[0142] In some embodiments, the cell lines or cell populations are screened by staining for a marker and observing a change. Nonlimiting examples of a change or lack of change include a change or lack of change in cell viability, cellular chemistry, cellular function, mitochondrial function, cell aggregation, cell morphology, cellular protein aggregation, gene expression, cellular secretion, or cellular uptake. Cell stains are known to those of skill in the art. Nonlimiting examples include markers of general cytotoxicity in cell viability assays, markers of apoptosis, markers of oxidative stress, markers of mitochondrial function, and combinations thereof. Additionally, screening may be effected by testing for one or more of ATP production, LDH release, activated caspase levels, expression of the gene of interest. [0143] The cells of the present method may be used for screening biological response modifiers, i.e., compounds and factors that affect the various signaling pathways. A wide variety of assays may be used for this purpose, including immunoassays for protein production, amount, secretion or binding;

determination of cell growth, differentiation and functional activity; production of hormones; measurement of reactive oxygen species and/or free radical-mediated damage; and the like.

[0144] For example, the subject cells may be used to screen for agents that enhance or inhibit apoptosis. Typically the candidate agent will be added to the cells, and the response of the cells monitored through evaluation of cell surface phenotype, functional activity, patterns of gene expression, physiological changes, electrophysiological changes and the like. In some embodiments, screening assays are used to identify agents that have a low toxicity in human cells.

[0145] Detection of change or lack of change in the cells may utilize staining of cells, performed in accordance with conventional methods. The antibodies of interest are added to the cell sample, and incubated for a period of time sufficient to allow binding to the epitope, for example, at least about 10 minutes. The antibody may be labeled with a label, for example, chosen from radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection. Fluorescers can be used as a detectable label and can include fluorophores or, alternatively, other molecules capable of producing a fluorescent signal.

Alternatively, a second stage antibody or reagent is used to amplify the signal. Such reagents are well known in the art. For example, the primary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent. Final detection uses a substrate that undergoes a color change in the presence of the peroxidase. The absence or presence of antibody binding may be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc.

[0146] Cellular gene expression may be assessed following a candidate treatment or experimental manipulation. The expressed set of genes may be compared with control cells of interest, e.g., cells also derived according to the present methods but which have not been contacted with the agent. Any suitable qualitative or quantitative methods known in the art for detecting specific mRNAs can be used. mRNA can be detected by, for example, hybridization to a microarray, in situ hybridization in tissue sections, by reverse transcriptase-PCR, or in Northern blots containing poly A+ mRNA. One of skill in the art can readily use these methods to determine differences in the size or amount of mRNA transcripts between two samples. For example, the level of particular mRNAs in cells contacted with agent is compared with the expression of the mRNAs in a control sample.

[0147] mRNA expression levels in a sample can be determined by generation of a library of expressed sequence tags (ESTs) from a sample. Enumeration of the relative representation of ESTs within the library can be used to approximate the relative representation of a gene transcript within the starting sample. The results of EST analysis of a test sample may then be compared to EST analysis of a reference sample to determine the relative expression levels of a selected polynucleotide.

[0148] Alternatively, gene expression in a sample may be assessed using hybridization analysis, which is based on the specificity of nucleotide interactions. Oligonucleotides or cDNA can be used to selectively identify or capture the DNA or RNA of specific sequence composition, and the amount of RNA or cDNA hybridized to a known capture sequence determined qualitatively or

quantitatively, to provide information about the relative representation of a particular RNA message within the pool of cellular RNA messages in a sample. Hybridization analysis may be designed to allow for concurrent screening of the relative expression of hundreds to thousands of genes by using, for example, array-based technologies having high density formats, including filters,

microscope slides, or microchips, or solution-based technologies that use spectroscopic analysis (e.g., mass spectrometry).

[0149] The mRNA expression level of samples may also be determined by other mechanisms known to those skilled in the art. For example, PCR-based techniques such as reverse transcriptase PCR or quantitative PCR can be used. Use of Induced Cells and Cell Populations to Elucidate Disease Progression and Mechanism

[0150] In some embodiments, the cell lines and cell populations described herein are used to study the mechanism of a disease of interest. In such embodiments, a molecular determinant of a disorder of interest is identified by contacting one or more test cells from a cell line derived by the method as described herein with an agent or condition which affects a pathway of interest, such as a cellular pathway, such as a disease-associated gene pathway, and observing any change or lack of change in the one or more test cells. A disease- associated gene pathway generally refers to genes and gene products

comprising a disease-associated gene, and may include one or more genes that act upstream or downstream of a disease-associated gene in a disease related pathway; or any gene whose gene product interacts with, binds to, competes with, induces, enhances or inhibits, directly or indirectly, the expression or activity of a disease-associated gene; or any gene whose expression or activity is induced, enhanced or inhibited, directly or indirectly, by a disease-associated gene; or any gene whose gene product is induced, enhanced or inhibited, directly or indirectly, by a disease-associated gene. A disease-associated gene pathway may refer to one or more genes or the gene products which act in a signaling pathway. Direct and indirect mechanisms refer, respectively, to direct contact or modification of a molecular actor in a pathway and contact or modification of an intermediary molecule which in turn contacts or modifies a molecular actor in a pathway, as is known in the art. Indirect mechanisms may be one or more steps removed from direct influence on a pathway. "Molecular determinants," as used herein, refers to any of the genes or gene products which may act, directly or indirectly, in a disease-associated gene pathway.

[0151] In some embodiments, the test cells are compared to one or more control cells. In some of these embodiments, such control cells are cells of the test cell line that have not been contacted with the agent or condition as described above. In further embodiments, such control cells are from a second cell line derived from a cell type which is the same as that of the test cell line with the exception that it lacks the genetic variation of interest; i.e., the second cell line is produced by inducing dedifferentiation according to the same method used to dedifferentiate the test cell line; and the resulting control cell line is contacted with the same agent or condition as the test cell line during experimentation.

[0152] In some embodiments, the cells are subjected to a condition, which triggers the activities of known factors in response to the condition, using the activity of the naturally occurring factors to thereby identify pathways and molecules associated with the disease of interest. Such conditions include, for example, hypoxic or anoxic conditions or any condition resulting in oxidative, endoplasmic reticular or mitochondrial stress.

[0153] For assays with genetic agents, the same approach may be used. The genetic agents are added to cells, which may be derived from iPS cells obtained from a subject diagnosed with a disease. Parameters associated with the pathways related to the disease state are monitored. Where the parameters show a pattern indicating the up or down regulation of a pathway, the agent or condition is deduced to encode or affect the expression of a member of the pathway that has an effect on the disease state. In this way one can determine the role a gene plays in the physiological state of interest, as well as define targets for therapeutic application.

[0154] In some embodiments of the methods described herein, the change or lack of change in the cells is observed by staining, according to known methods. The staining may be for one or more markers, for example, one or more markers of cytotoxicity, oxidative stress, cellular transport, apoptosis, mitochondrial function, ubiquitin function, lysosomal function and proteasomal function. The change or lack of change may be observed by testing for one or more of ATP production, LDH release, and activated caspase levels according to methods as described. The change or lack of change in cells is observed by one or more of, for example, flow cytometry, quantitative real-time PCR, and induction of teratomas in mice.

Use of reprogrammed cells for making non-human transgenic animals.

[0155] Cells and cell populations described herein are useful for methods relating to the creation of non-human transgenic animals. Development of transgenic animals from pluripotent cells is known to those skilled in the art. In one aspect, reprogrammed cells can be injected into blastocysts to produce a chimeric mouse. A chimeric mouse is one that is genetically diverse, containing cells genetically identical to the host cell and cells genetically identical to the donor cell. Subsequently, a cell line developed into the germline is established, and the genetic background can be backcrossed to produce an animal that is genetically identical to the donor reprogrammed cell. Alternatively, the enhanced induced pluripotent cells can be injected into blastocysts that have been rendered tetraploid. This will result in an animal that has been wholly derived from the pluripotent cells. Tetraploid cells can be made by fusing a two cell-stage embryo back into one cell using polyethylene glycol. The host reprogrammed cell can me allogenic or autologous to the animal. The term "allogenic" refers to the production of transgenic animals from donor reprogrammed cells of the same species but with different histocompatibility. The term "autologous" refers to reprogrammed cells of derived from the host animal. The transgenic animal created using the reprogrammed cells disclosed herein may be a murine, a canine, a bovine, an dquine, a feline, or an ovine.

[0156] The following polynucleotides, represented by the sequences were utilized in the experimental section. Such sequences are exemplary only.

Genetic Sequences:

[0157] PARP-1 open reading frame (SEQ ID NO.: 1 ):

TATTCCCAAGGACTCCCTCCGCATGGCCATCATGGTGCAGTCACCCATGTTC

GATGGGAAAGTCCCACACTGGTACCACTTCTCCTGCTTCTGGAAGGTGGGC

CACTCCATCCGGCAGCCTGATGTTGAGGTGGATGGCTTCTCTGAGCTGCGC

TGGGATGATCAGCAGAAGGTCAAGAAGACGGCCGAGGCTGGAGGCGTGGC

AGGCAAAGGCCAGGATGGAAGTGGCGGCAAGGCGGAGAAGACATTGGGTG

ACTTTTTAGCGGAGTACGCCAAGTCCAACAGGAGCATGTGCAAGGGCTGCC

TGGAGAAGATAGAGAAGGGCCAGATGCGCCTGTCCAAGAAGATGGTGGATC

CAGAGAAGCCACAGCTGGGTATGATTGACCGCTGGTACCATCCAACTTGCT

TTGTCAAGAAGCGGGACGAGCTGGGCTTCCGGCCTGAGTACAGTGCCAGTC

AGCTCAAGGGCTTTAGCCTCCTCTCTGCAGAAGACAAAGAAGCTCTGAAGAA

GCAGCTCCCGGCCATCAAGAATGAAGGAAAGAGAAAAGGTGACGAGGTGG

ATG G AACAG ATG AAGTGG CCAAAAAG AAATCTAAG AAAG G G AAG G ACAAG G

ATAGTAGTAAGCTGGAGAAGGCCCTCAAGGCTCAGAATGAGCTGATCTGGA ATATCAAAGACGAGCTGAAGAAAGCGTGTTCCACCAACGACCTGAAGGAGC

TGCTCATCTTCAACCAGCAGCAGGTGCCGTCAGGAGAGTCAGCGATCTTGG

ACAGAGTTGCTGACGGCATGGCGTTTGGGGCCCTTCTGCCCTGCAAGGAGT

GTTCAGGCCAGCTGGTCTTTAAGAGCGACGCTTATTACTGTACTGGGGATGT

CACTGCCTGGACCAAGTGCATGGTCAAGACACAGAATCCTAGCCGAAAGGA

ATGGGTAACTCCAAAGGAATTCCGAGAAATATCCTACCTCAAGAAGTTAAAG

GTCAAAAAACAGGACCGAATATTCCCTCCAGAAAGCAGCGCCCCAGCACCA

CTGGCACTGCCCCTCTCTG

TCACCTCAGCACCCACAGCTGTGAACTCCTCTGCTCCAGCAGACAAGCCCC TGTCTAACATGAAGATCCTGACTCTTGGGAAGCTCTCCCAGAACAAGGACGA AGCAAAAGCTGTGATTGAGAAACTCGGAGGCAAGTTGACAGGATCTGCCAA CAAGGC

CTCCTTGTGTATCAGCACTAAAAAGGAGGTGGAGAAGATGAGTAAGAAGATG

GAGGAAGTGAAAGCGGCCAACGTTCGAGTTGTGTGTGAGGACTTCCTCCAG

GACGTGTCTGCCTCCACTAAAAGCCTCCAAGAGCTGCTCTCGGCCCACAGC

TTGTCCTCGTGGGGGGCTGAGGTGAAGGCAGAGCCTGGTGAAGTGGTGGC

CCCCAAGGGGAAGTCAGCTGCACCCTCCAAGAAGAGCAAGGGTGCTGTCAA

G G AG G AAG GTGTCAACAAATCTG AAAAG AG G ATG AAATTAACTCTG AAG G G

AGGAGCAGCCGTTGATCCTGACTCTGGTCTGGAACACTCTGCACACGTCCT

GGAGAAAGGTGGGAAGGTGTTCAGCGCCACACTTGGCCTGGTGGACATTGT

G AAAG G G ACG AACTCCTATTACAAACTGCAGCTTCTG G AG G ACG ACAAG GA

GAGCAGGTACTGGATCTTCCGGTCCTGGGGCCGGGTGGGCACAGTTATCG

GCAGTAACAAACTTGAGCAGATGCCCTCCAAAGAGGACGCTGTTGAGCACT

TCATGAAGCTGTATGAAGAGAAGACTGGGAATGCCTGGCACTCGAAAAACTT

CACAAAGTATCCCAAGAAGTTCTACCCTCTGGAGATTGACTATGGCCAGGAC

GAAGAGGCAGTAAAGAAGCTGACGGTGAAGCCTGGCACCAAGTCGAAGCT

GCCGAAGCCAGTGCAGGAGCTCGTGGGGATGATCTTCGACGTGGAGAGCA

TGAAAAAGGCCTTGGTGGAGTACGAGATTGACCTCCAGAAGATGCCCTTGG

GGAAGCTGAGCAGAAGGCAGATCCAGGCCGCCTACTCTATCCTCAGCGAG

GTCCAGCAGGCAGTGTCTCAAGGCAGCAGTGAATCCCAGATCCTAGATCTC

TCCAATCGCTTCTACACTCTGATCCCCCATGACTTTGGAATGAAGAAGCCCC

CACTCCTGAACAACGCAGACAGCGTGCAGGCCAAGGTGGAGATGCTAGACA

ACCTCCTGGACATCGAGGTGG CCTATAGTCTTCTCAG G G GTG GCTCTG ACG ACAGCAGCAAG G ATCCCATCG

ACGTCAACTACGAGAAACTCAAAACTGACATTAAGGTGGTTGACAGAGATTC

TGAAGAGGCCGAGGTCATCAGGAAGTACGTGAAGAACACTCATGCTACCAC

GCACAACGCCTATGACCTGGAAGTGATCGATATCTTCAAGATAGAGCGCGA

GGGGGAGAGCCAGCGCTACAAGCCCTTCAGGCAGCTTCACAACCGGAGGC

TGCTGTGGCACGGCTCCAGGACCACCAACTTTGCTGGCATCCTGTCGCAGG

GTCTGCGGATAGCCCCACCTGAAGCGCCTGTGACAGGCTACATGTTTGGGA

AAGGGATCTACTTTGCCGACATGGTGTCCAAAAGTGCAAACTACTGCCACAC

ATCTCAGGGAGACCCGATTGGCTTAATACTGCTGGGAGAGGTTGCCCTTGG

AAACATGTATGAACTCAAGCATGCTTCACATATCAGCAAGTTACCCAAGGGC

AAGCACAGTGTCAAAGGTTTGGGAAAAACCACCCCTGACCCTTCGGCCAGC

ATCACCCTG GAGG GTGTAG AG GTTCCACTG G G AACAG G GATCCCATCTG GT

GTCAACGACACCTGCCTGCTGTATAATGAGTACATTGTCTACGACATTGCTC

AGGTGAATCTCAAATACCTGCTGAAACTCAAGTTCAATTTTAAGACATCCCTG

TGGTAA

[0158] Oct3/4 open reading frame (SEQ ID NO.: 2):

atggcgggacacctggcttcggatttcgccttctcgccccctccaggtggtggaggtgatgggccaggggggcc ggagccgggctgggttgatcctcggacctggctaagcttccaaggccctcctggagggccaggaatcgggccg ggggttgggccaggctctgaggtgtgggggattcccccatgccccccgccgtatgagttctgtggggggatggc gtactgtgggccccaggttggagtggggctagtgccccaaggcggcttggagacctctcagcctgagggcgaa gcaggagtcggggtggagagcaactccgatggggcctccccggagccctgcaccgtcacccctggtgccgtg aagctggagaaggagaagctggagcaaaacccggaggagtcccaggacatcaaagctctgcagaaagaa ctcgagcaatttgccaagctcctgaagcagaagaggatcaccctgggatatacacaggccgatgtggggctca ccctgggggttctatttgggaaggtattcagccaaacgaccatctgccgctttgaggctctgcagcttagcttcaag aacatgtgtaagctgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaatcttcaggaga tatgcaaagcagaaaccctcgtgcaggcccgaaagagaaagcgaaccagtatcgagaaccgagtgagagg caacctggagaatttgttcctgcagtgcccgaaacccacactgcagcagatcagccacatcgcccagcagcttg ggctcgagaaggatgtggtccgagtgtggttctgtaaccggcgccagaagggcaagcgatcaagcagcgact atgcacaacgagaggattttgaggctgctgggtctcctttctcagggggaccagtgtcctttcctctggccccaggg ccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccctttccctgaggggga agcctttccccctgtctccgtcaccactctgggctctcccatgcattcaaactga [0159] Sox2 open reading frame (SEQ ID NO.: 3):

Atgtacaacatgatggagacggagctgaagccgccgggcccgcagcaaacttcggggggcggcggcggca actccaccgcggcggcggccggcggcaaccagaaaaacagcccggaccgcgtcaagcggcccatgaatg ccttcatggtgtggtcccgcgggcagcggcgcaagatggcccaggagaaccccaagatgcacaactcggag atcagcaagcgcctgggcgccgagtggaaacttttgtcggagacggagaagcggccgttcatcgacgaggct aagcggctgcgagcgctgcacatgaaggagcacccggattataaataccggccccggcggaaaaccaaga cgctcatgaagaaggataagtacacgctgcccggcgggctgctggcccccggcggcaatagcatggcgagc ggggtcggggtgggcgccggcctgggcgcgggcgtgaaccagcgcatggacagttacgcgcacatgaacg gctggagcaacggcagctacagcatgatgcaggaccagctgggctacccgcagcacccgggcctcaatgcg cacggcgcagcgcagatgcagcccatgcaccgctacgacgtgagcgccctgcagtacaactccatgaccag ctcgcagacctacatgaacggctcgcccacctacagcatgtcctactcgcagcagggcacccctggcatggctc ttggctccatgggttcggtggtcaagtccgaggccagctccagcccccctgtggttacctcttcctcccactccagg gcgccctgccaggccggggacctccgggacatgatcagcatgtatctccccggcgccgaggtgccggaaccc gccgcccccagcagacttcacatgtcccagcactaccagagcggcccggtgcccggcacggccattaacggc acactgcccctctcacacatgtga

[0160] Klf4 open reading frame (SEQ ID NO.: 4):

atgaggcagccacctggcgagtctgacatggctgtcagcgacgcgctgctcccatctttctccacgttcgcgtctg gcccggcgggaagggagaagacactgcgtcaagcaggtgccccgaataaccgctggcgggaggagctctc ccacatgaagcgacttcccccagtgcttcccggccgcccctatgacctggcggcggcgaccgtggccacagac ctggagagcggcggagccggtgcggcttgcggcggtagcaacctggcgcccctacctcggagagagaccga ggagttcaacgatctcctggacctggactttattctctccaattcgctgacccatcctccggagtcagtggccgcca ccgtgtcctcgtcagcgtcagcctcctcttcgtcgtcgccgtcgagcagcggccctgccagcgcgccctccacctg cagcttcacctatccgatccgggccgggaacgacccgggcgtggcgccgggcggcacgggcggaggcctcc tctatggcagggagtccgctccccctccgacggctcccttcaacctggcggacatcaacgacgtgagcccctcg ggcggcttcgtggccgagctcctgcggccagaattggacccggtgtacattccgccgcagcagccgcagccgc caggtggcgggctgatgggcaagttcgtgctgaaggcgtcgctgagcgcccctggcagcgagtacggcagcc cgtcggtcatcagcgtcagcaaaggcagccctgacggcagccacccggtggtggtggcgccctacaacggcg ggccgccgcgcacgtgccccaagatcaagcaggaggcggtctcttcgtgcacccacttgggcgctggacccc ctctcagcaatggccaccggccggctgcacacgacttccccctggggcggcagctccccagcaggactaccc cgaccctgggtcttgaggaagtgctgagcagcagggactgtcaccctgccctgccgcttcctcccggcttccatc cccacccggggcccaattacccatccttcctgcccgatcagatgcagccgcaagtcccgccgctccattaccaa gagctcatgccacccggttcctgcatgccagaggagcccaagccaaagaggggaagacgatcgtggccccg gaaaaggaccgccacccacacttgtgattacgcgggctgcggcaaaacctacacaaagagttcccatctcaa ggcacacctgcgaacccacacaggtgagaaaccttaccactgtgactgggacggctgtggatggaaattcgcc cgctcagatgaactgaccaggcactaccgtaaacacacggggcaccgcccgttccagtgccaaaaatgcgac cgagcattttccaggtcggaccacctcgccttacacatgaagaggcatttttaa

[0161] c-Myc open reading frame (SEQ ID NO.: 5):

atgcccctcaacgttagcttcaccaacaggaactatgacctcgactacgactcggtgcagccgtatttctactgcg acgaggaggagaacttctaccagcagcagcagcagagcgagctgcagcccccggcgcccagcgaggatat ctggaagaaattcgagctgctgcccaccccgcccctgtcccctagccgccgctccgggctctgctcgccctccta cgttgcggtcacacccttctcccttcggggagacaacgacggcggtggcgggagcttctccacggccgaccag ctggagatggtgaccgagctgctgggaggagacatggtgaaccagagtttcatctgcgacccggacgacgag accttcatcaaaaacatcatcatccaggactgtatgtggagcggcttctcggccgccgccaagctcgtctcagag aagctggcctcctaccaggctgcgcgcaaagacagcggcagcccgaaccccgcccgcggccacagcgtctg ctccacctccagcttgtacctgcaggatctgagcgccgccgcctcagagtgcatcgacccctcggtggtcttcccc taccctctcaacgacagcagctcgcccaagtcctgcgcctcgcaagactccagcgccttctctccgtcctcggatt ctctgctctcctcgacggagtcctccccgcagggcagccccgagcccctggtgctccatgaggagacaccgcc caccaccagcagcgactctgaggaggaacaagaagatgaggaagaaatcgatgttgtttctgtggaaaagag gcaggctcctggcaaaaggtcagagtctggatcaccttctgctggaggccacagcaaacctcctcacagccca ctggtcctcaagaggtgccacgtctccacacatcagcacaactacgcagcgcctccctccactcggaaggact atcctgctgccaagagggtcaagttggacagtgtcagagtcctgagacagatcagcaacaaccgaaaatgca ccagccccaggtcctcggacaccgaggagaatgtcaagaggcgaacacacaacgtcttggagcgccagag gaggaacgagctaaaacggagcttttttgccctgcgtgaccagatcccggagttggaaaacaatgaaaaggcc cccaaggtagttatccttaaaaaagccacagcatacatcctgtccgtccaagcagaggagcaaaagctcatttct gaagaggacttgttgcggaaacgacgagaacagttgaaacacaaacttgaacagctacggaactcttgtgcgt aa

Primers used in the construction of pLVTHN PARP-1 :

TetO minimal CMV2 promoter:

TetO CMV F (SEQ ID NO.: 6):

GGGG AC CAC TTT GTA CAA GAA AGC TGG GTA ACTCCCTATCAGTGATAGAG

TetO CMV R (SEQ ID NO.: 7):

GGGG ACA ACT TTG TAT ACA AAA GTT G AGGCTGGATCGGTCCC

Template: TetO-FUW-OSKM (provided by Dr. Rudolf Jaenisch, Whitehead Institute and MIT)

Mouse wt PARP-1 open reading frame:

PARP1 B5r F (SEQ ID NO.: 8):

GGGGACAACTTTTGTATACAAAGTTGTATGGCGGAGGCCTCG PARP1 Bl R (SEQ ID NO.: 9):

GGGGACAAGTTTGTACAAAAAAGCAGGCTTTACCACAGGGATGTCTTA

A

Template: pAdVC-PARPwt (provided by Dr. Valina Dawson, Johns Hopkins Univ.) Taqman Primer-Probe Sets used for qRT-PCR: mOct3/4: Mm03053917_gl mPARP-1 : Mm00500171_gl mNanog: Mm0617762_gl mPARP-2: Mm01319555_ml mRexl : Mm01605325_gl mPARP-2: Mm00467486_ml mSox2: Mm00488369_sl mPDRG:

Mm00724869_ml

mcMyc: Mm00487804_ml mp53: Mm01731290_gl mDNMTl : MmOl 151065_gl mGAPDH: Mm03302249_gl mCTCF:

shRNAs against PARP-1 :

#1 TRC 4 AAJ14-B-09 TRCN0000071208

#2 TRC 4 AAJ14-B-10 TRCN0000071209

#3 TRC 4 AAJ14-B-11 TRCN0000071210

#4 TRC 4 AAJ14-B-12 TRCN0000071211

#5 TRC 4 AAJ14-C-1 TRCN0000071212

[0162] The invention is further understood by reference to the following examples, which are intended to be purely exemplary of the invention. The present invention is not limited in scope by the exemplified embodiments, which are intended as illustrations of single aspects of the invention only. Any methods that are functionally equivalent are within the scope of the invention. Various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and

accompanying figures. Such modifications fall within the scope of the appended claims. EXPERIMENTAL EXAMPLES

Example 1 : Cell culture and reprogramming

[0163] Wildtype and PARP-1 MEFs were derived from E13.5 embryonic primary cultures using the common protocol. For use as pluripotency controls, mouse wildtype ES Cells were obtained from ATCC (#SCRC-1019), and WT iPS Cells from Stemgent (NNeo line). For propagation, ESCs, iPSCs and putative iPSCs were cultured on γ-irradiated MEFs (GlobalStem) in MEF-conditioned embryonic stem cell medium containing 20% serum and antibiotics. For characterization and differentiation studies, they were grown on growth factor- reduced Matrigel (BD Biosciences) with the same medium.

[0164] Reprogramming of differentiated cells was performed according to the following: lentiviruses were derived from the TetO-FUW series of lentiviral plasmids carrying the Yamanaka human transgenes Oct3/4, Sox2, Klf4 and cMyc as well as the FUW M2rtTA, as previously described using HEK293T packaging cells (Barambrink, T. et al., (2008) Cell Stem Cell, 2(2):151 -9). Lentiviral stocks in the original cell culture medium were generated and then quantitated using the QuickTiter™ Kit (commercially available from Cell Biolabs, Inc.) and frozen for further use.

[0165] Lentiviral stocks were thawed on ice and combined before incubation with fibroblasts to be reprogrammed. The exogenous PARP-1 lentivirus was constructed using a modified pLVTHM backbone. Briefly, the Gateway vector- conversion cassette C (Invitrogen) was inserted backwards between positions 1878 and 4336 on the pLVTHM plasmid, and sequences corresponding to the TetO-minimal CMV2 promoter from the TetO-FUW-OSKM plasmid (Carey, B. et al., (2009) Proceedings of the National Academy of Sciences, 106(1 ):157-62), and the PARP-1 open reading frame from pAdVC-PARPwt plasmid were simultaneously inserted in order using the Gateway Multi-Site kit (Invitrogen). The resulting lentiviral vector, pLVTHN PARP-1 , has been submitted to the Addgene plasmid bank. A complete list of primers used in the construction of pLVTHN PARP-1 appears in the supplementary section. Example 2: Cell Characterization

[0166] Lysis and RNA extraction from cell cultures was done using an RNA miniprep kit (available commercially from QIAgen), and reverse transcription with the TaqMan kit (available commercially from Applied Biosystems). qRT-PCR was done using Taqman primer-probe sets (available commercially from Applied Biosystems), a full list of which can be found in Table 3.

Table 3: Taqman Primer-Probe Sets used for qRT-PCR:

[0167] Alkaline phosphatase staining was performed according to the manufacturer's protocol on reprogrammed cultures using the Alkaline

Phosphatase Leukocyte kit (available commercially from Sigma Aldrich). Plates were digitally photographed and AP+ colonies were quantitated using ImageJ Particle Count with identical threshold between experimental and control groups.

[0168] Stem cell cultures for immunocytochemistry were grown on Lab-Tek 2- well Permanox Chamber Slides, either on γ-irradiated MEF feeders or on a gelatin substrate. Cultures were fixed with a 1 % paraformaldehyde PBS solution for 15 minutes at room temperature, permeabilized with 0.2% Triton PBS for 30 minutes, and blocked with 3% BSA (Promega) for 1 hour. Immunocytochemical staining was done using mouse anti-SSEA1 (Solter, D. and B.B. Knowles, (1978) Proc Natl Acad Sci U S A, 75(1 1 ):5565-9.) and anti-Oct4 (eBioscience) antibodies in blocking buffer at 4°C overnight. After washing three times with PBS, cells were incubated with FITC conjugated secondary antibody for 1 hour at room temperature, washed, and mounted with DAPI Fluoromount G (available commercially from SouthernBiotech).

[0169] For flow cytometry, cells to be characterized were trypsinized and stained with 1 :50 anti-SSEA1 antibody followed by 1 :1000 IgM Goat-anti-mouse Alexa 488 conjugated antibody (Invitrogen). Flow cytometry and analysis was performed on a CyAn ADP instrument (Dako Cytomation).

[0170] Teratoma experiments were initiated by the flank-injection of

immunodeficient NSG mice with 100 μΙ_ cell suspensions at concentrations of 2 million cells in a 50% Matrigel (BD Biosciences) and PBS solution, per injection. After injections, mice were observed for 3 weeks for tumor formation. Animals with tumors were sacrificed with CO2 and surgically excised tumors were fixed overnight with 4% paraformaldehyde sucrose solution and embedded in paraffin blocks. Paraffin sections (10 μιτι) on slides were stained with Mayer's

Hematoxylin and Eosin Y (Sigma-Aldrich) according to the manufacturer's instructions and assessed microscopically.

Example 3: PARP-1 deficiency causes a deficit in reprogramming

fibroblasts into a pluripotent state

[0171] To determine whether PARP-1 has a role in induced pluripotency, Applicants reprogrammed four fibroblast lines of the C57BL/6 genetic

background: A19 (wildtype), A1 1 (PARP-1 ^"'^") (Wang, Z.Q. , et al., Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev, 1995. 9(5): p. 509-20), AP49b (PARP-1 ^"'^"P53^"'^") and AP21 b (P53^"'^"). Reprogramming was performed as previously described (Barambrink, T., et al., Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells. Cell Stem Cell, 2008. 2(2): p. 151 -9) using the same lentiviruses encoding the Yamanaka transgenes and a transactivator to allow doxycycline(DOX)-controllable gene expression. On day 15 of reprogramming, cell cultures were fixed and stained for alkaline phosphatase (AP), and the number of AP-positive stem cell-like colonies was counted for each plate (Fig 1 A). AP is an early marker of reprogramming which distinguishes

undifferentiated cells from fibroblasts. Colony formation was increased threefold in the p53-knockout fibroblasts, consistent with results from prior studies. See for example, Hong, H. et al., (2009) Nature, 460(7259):1 132-5; Kawamura, T. et al., (2009) Nature, 460(7259):1 140-4; Li, H. et al., (2009) Nature, 460(7259):1 136-9; Marion, R.M. et al., (2009) Nature, 460(7259):1 149-53; Utikal, J. et al., (2009) Nature, 460(7259):1 145-8. Surprisingly, 20-fold fewer colonies formed from the reprogrammed PARP-1 knockout cultures under identical conditions. When colony morphology was compared microscopically, the PARP-1 knockout colonies stained lightly and were large, disorganized and had undefined edges compared to wildtype controls, which typically produced characteristic small, dense and well-defined round colonies (Fig 1 B). Interestingly, the double knockout PARP-1 ^"'^"Ρ53^"'^" cell line displayed a partial rescue of the reprogramming deficit of the PARP-1 knockout, with AP-positive colony counts approaching that of the wildtype when reprogrammed (Fig 1 A) and colony morphologies of varying quality (data not shown).

[0172] Reprogramming was terminated with the withdrawal of DOX from culture medium, and when wildtype reprogrammed cells were clonally selected and propagated, the resulting cell lines displayed normal colony formation and immunocytochemical staining positive for the pluripotency markers SSEA-1 and Oct3/4 (Fig 1 C). However, the cell lines derived from PARP-1 ^"'^" colonies could not establish stable colonies following withdrawal of DOX, although these reprogrammed PARP-1 ^"'^" cells grew at higher densities than normal fibroblasts (Fig 1 C). It was possible to propagate a line of Oct3/4 and SSEA-1 staining cells from the reprogrammed PARP-1 knockout cells, but only in the continued presence of DOX (data not shown). The inability of PARP-1 ^"'^" cells to retain a stem cell-like phenotype upon DOX withdrawal indicates a failure to reprogram completely.

[0173] To confirm the results in primary somatic cell cultures, Applicants derived wildtype and PARP-1 -/- mouse embryonic fibroblasts (MEFs) from S129 mice, which were reprogrammed and characterized as described above. PARP- 1 -/- MEFs ("S129 KO") failed to give rise to any AP-positive colonies in the first two weeks of reprogramming, while wildtype ("S129 WT") cultures formed colonies with typical morphology and pluripotency marker staining after 2 weeks (Fig 1A). To evaluate their quality, reprogrammed S129 WT were characterized as putative iPSCs (Fig 5) and found to give rise to a stable line of cells growing in normal colonies that stained positively for SSEA-1 and Oct3/4 (Fig 5A). When injected into immunodeficient mice, these cells formed teratomas in three weeks. Histological examination of teratomas after hematoxylin and eosin staining identified tissues in these tumors representative of the three germinal layers (Fig 5B-D). These results demonstrate successful reprogramming of the S129 WT to pluripotency. A pluripotent-like clonal line from the reprogrammed S129 KO for a teratoma experiment could not be isolated. Instead, immunodeficient mice were injected with the reprogrammed A1 1 PARP-1 -/- cells. None of the four mice injected with reprogrammed PARP-1 -/- cells developed tumors after 8 weeks (data not shown).

Example 4: PARP-1 inhibition reduces reprogramming efficiency and causes ESCs to lose their pluripotency

[0174] PARP-1 has several molecular roles not directly related to its enzymatic activity, such as promoter (Zampieri, M. et al., (2009) PLoS One, 4(3):e4717) and repressor (Lin, Y. et al., (2010) Archives of Biochemistry and Biophysics, (Epub ahead of print)) occupancy and binding to sites of DNA breakage (Kirsten, E. et al., (1982) FEBS Letters, 139(1 ):1 17-20), and these interactions are understood to take place regardless of PARP-1 enzymatic activity or inhibition. See for example, Soldatenkov, V. et al., (2002) Journal of Biological Chemistry,

277(1 ):665-70; Kun, E., (1998) International Journal of Molecular Medicine, 2(2):131 -42; Soldatenkov, V. and V. Potaman, (2004) Current Drug Targets, 5(4):357-65. To differentiate between the enzymatic and non-enzymatic functions of PARP-1 in pluripotency, cultures of the wildtype fibroblast line were reprogrammed as described above in the presence of increasing amounts of the highly specific PARP-1 enzymatic inhibitor PJ34, a phenanthridinone derivative, and they were assayed after 2 weeks for the formation of AP-positive colonies (Figure 2A). PARP-1 enzymatic activity was completely inhibited by PJ34 at 10 μΜ (Tramontane F., M. et al., (2007) MHR: Basic science of reproduction, 13(1 1 ):821 -8). A 24% reduction in colony formation at only 0.1 μΜ was observed. At 1 μΜ, there were 40% fewer colonies and at 10 μΜ there were 96% fewer AP-positive colonies than control cultures (0 μΜ PJ34). Inhibition of PARylation therefore resulted in a similar reprogramming deficit as that observed in PARP-1 knockout cells, indicating that the role that PARP-1 plays in induced pluripotency is related to its enzymatic activity, PARylation.

[0175] Induction and maintenance of pluripotency might share many common pathways. See for example, Takahashi, K. and S. Yamanaka, (2006) Cell, 126(4):663-76; Okita, K. et al., (2007) Nature, 448(7151 ):313-7. It was determined whether PARP-1 could also be important for the maintenance of pluripotency. Wildtype mouse ESCs were cultured in feeder-free conditions in PJ34-containing medium for 24 hours, and then analyzed by flow cytometry for expression of the stem cell surface marker SSEA-1 . Compared to the control, PJ34 (10 μΜ) treatment caused approximately a quarter of the culture to lose SSEA-1 expression (Figure 2B). Microscopic inspection of the treated cultures also identified extensive differentiation. Not only did the inhibitor cause a significant portion of ESC cultures to lose pluripotency, Applicants also observed the same effect in mouse iPSCs (Figure 6). These results indicate that

PARylation plays an important role in the maintenance of pluripotency in ESCs and iPSCs.

Example 5: PARP-1 deficiency causes abnormal Sox2 and p53 levels

[0176] Having identified a reprogramming deficit in PARP-1 deficient cells, Applicants then attempted to locate a specific defective pluripotency pathway in them. Transcription levels of a battery of pluripotency-related genes, including Nanog, Oct3/4 and Sox2, were analyzed by qRT-PCR (Figure 3A) in three of the fibroblast cell lines used in our reprogramming experiments: A19 (wildtype), A1 1 (PARP-1 ^"'^") and AP49b (PARP-1 ^"'^"P53^"'^"). Although most of the genes analyzed showed no significant transcriptional differences amongst the three lines, Sox2 transcription in the PARP-1 knockout was 13-fold higher than in the

corresponding wildtype or double knockout cells. Applicants were able to replicate this result with shRNA expression in which 5 different PARP-1 shRNAs tested independently produced at least a 7-fold increase in Sox2 transcription (Fig 3B), as well as with the PARP-1 inhibitor PJ34, which also produced a 14- fold increase in Sox2 transcription in wildtype fibroblasts (Fig 3C). In all cases, inhibition or knockdown of PARP-1 in fibroblasts caused significant increases in Sox2 transcription when compared to the corresponding control. Sox2 is known to be critical for pluripotency, and as little as a two-fold disruption in Sox2 expression causes ESCs to lose their pluripotency (Kopp, J. et al., (2008) Stem Cells, 26(4):903-1 1 ). Applicants also observed a twofold increase in p53 expression in PARP-1 knockout fibroblasts. The increased expression of p53 in PARP-1 deficient fibroblasts may in part contribute to their failure to reprogram.

[0177] Transcription of pluripotency genes in fibroblasts is extremely low compared to pluripotent cells, and even a 14-fold up-regulation in transcription in fibroblasts might represent an insignificant response. To investigate whether the same relationship existed in pluripotent cells, Sox2 expression in wildtype mouse ESCs and iPSCs grown in feeder-free conditions with PJ34 for 24 hours was analyzed. Similar to the results from knockout fibroblasts, it was found that full inhibition of PARP-1 by PJ34 (10 μΜ) also caused a two-fold increase of Sox2 transcription in pluripotent cells, although a lower concentration of the inhibitor (0.1 μΜ) caused Sox2 transcription to increase 10-fold. Expression of several genes in PARP-1 ^"'^" ESCs was analyzed (Fig 7) and it was found that while transcription of Oct3/4 was normal when compared to WT ESCs, small but significant increases in Sox2 and p53 transcription (<2-fold) were observed in PARP-1 ^"'^" ESCs.

Example 6: PARP-1 deficiency causes abnormal Sox2 and p53 levels

[0178] Having identified a reprogramming deficit in PARP-1 deficient cells, location of a specific defective pluripotency pathway was sought after in these cells. Transcription levels of a battery of pluripotency-related genes, including Nanog, Oct3/4 and Sox2, were analyzed by qRT-PCR (Figure 3A) in three of the fibroblast cell lines used in our reprogramming experiments: A19 (wildtype), A1 1 (PARP-1 ^"'^") and AP49b (PARP-1 ^"'^"Ρ53^"'^"). Although most of the genes analyzed showed no significant transcriptional differences amongst the three lines, Sox2 transcription in the PARP-1 knockout was 13-fold higher than in the

corresponding wildtype or double knockout cells. This result was replicated with shRNA expression in which 5 different PARP-1 shRNAs tested independently produced at least a 7-fold increase in Sox2 transcription (Fig 3B), as well as with the PARP-1 inhibitor PJ34, which also produced a 14-fold increase in Sox2 transcription in wildtype fibroblasts (Fig 3C). In all cases, inhibition or knockdown of PARP-1 in fibroblasts caused significant increases in Sox2 transcription when compared to the corresponding control. Sox2 is known to be critical for pluripotency, and as little as a two-fold disruption in Sox2 expression causes ESCs to lose their pluripotency (Kopp, J. et al., (2008) Stem Cells, 26(4):903-1 1 ). Applicants also observed a twofold increase in p53 expression in PARP-1 knockout fibroblasts. The increased expression of p53 in PARP-1 deficient fibroblasts may in part contribute to their failure to reprogram.

[0179] Transcription of pluripotency genes in fibroblasts is extremely low compared to pluripotent cells, and even a 14-fold up-regulation in transcription in fibroblasts might represent an insignificant response. To investigate whether the same relationship existed in pluripotent cells, Sox2 expression in wildtype mouse ESCs and iPSCs grown in feeder-free conditions with PJ34 for 24 hours was analyzed. Similar to the results from knockout fibroblasts, it was found that full inhibition of PARP-1 by PJ34 (10 μΜ) also caused a two-fold increase of Sox2 transcription in pluripotent cells, although a lower concentration of the inhibitor (0.1 μΜ) caused Sox2 transcription to increase 10-fold. Expression of several genes in PARP-1 ^"'^" ESCs was analyzed (Fig 7) and it was found that while transcription of Oct3/4 was normal when compared to WT ESCs, small but significant increases in Sox2 and p53 transcription (<2-fold) were observed in PARP-1 ^"'^" ESCs.

[0180] When assayed by western blot, however, it was found that Sox2 protein levels were actually decreased when PARP-1 was inhibited or eliminated from the cells (Fig 3E-G). A line of knockdown ESCs using PARP-1 shRNAs due to an apparent survival problem of ESCs (data not shown) could not be derived, but PARP-1 ^"'^" ESCs also displayed reduced levels of Sox2 protein when compared to the wildtype (Fig 3G). In summary, the knockout, knockdown or inhibition of PARP-1 in differentiated cells where Sox2 protein levels are extremely low, results in aberrant Sox2 transcription, but in pluripotent cells where PARP-1 deficiency or inhibition causes a large decrease in Sox2 protein levels. Example 7: Inclusion of exogenous PARP-1 enhances reprogramming to pluripotency.

[0181] Having established a critical role for PARP-1 in induced pluripotency, it was then sought to determine whether exogenous PARP-1 included as a "fifth factor" in the standard Yamanaka four-factor reprogramming repertoire could enhance induced pluripotency. S129 wildtype MEFs were transfected with a lentivirus encoding a DOX-inducible mouse PARP-1 gene in addition to the standard lentiviruses carrying the four Yamanaka factors and the accompanying DOX transactivator. On the 14th day of reprogramming, the number of AP+ colonies was counted (Figure 4A). Cultures reprogrammed with the accessory PARP-1 virus produced 5-fold more colonies and when picked and sub-cultured, the PARP-1 accessory iPSCs displayed normal morphology (data not shown) and expressed Oct3/4, Sox2 and Nanog at levels similar to those in ESCs (Fig 4B). Furthermore, reprogramming PARP-1 knockout fibroblasts with the extra PARP-1 virus rescued the reprogramming deficit in these cells (Fig 4A), and the resulting iPSCs also expressed Oct3/4, Sox2 and Nanog at normal levels (Fig 4B). When injected into immunodeficient animals, PARP-1 accessory lines from the wildtype as well as the rescued knockout gave rise to teratomas containing a diverse compliment of tissue types representing all three germ layers (Fig 4C).

[0182] It is interesting to note that the rescued iPSCs, reprogrammed from PARP-1 knockout fibroblasts with the accessory PARP-1 virus, retained a pluripotent phenotype after withdrawal of DOX upon the completion of

reprogramming, even though this resulted in a decrease in PARP-1 expression (Fig 4B, KO P+1 and P+2). This finding, together with our early results (Fig 2), suggests that the expression level of PARP-1 required for induced pluripotency could be much higher than that required for the maintenance of pluripotency.

Example 8: Overexpression of PARP-1

[0183] To quantitate the level of overexpression of PARP-1 and early changes in gene transcription induced by the PARP-1 lentivirus, MEFs were infected with an aliquot of PARP-1 lentivirus. Following 24 hours of treatment with medium containing lentiviral aliquot, 50% MEF medium and 10 ng / mL PolyBreen, overexpression of PARP-1 was induced with MEF medium containing 10 ug / mL DOX for 24 hours. Afterwards, gene transcription was analyzed using Taqman qRT-PCR as previously described.

Figure 8 depicts that PARP-1 transcription in cultures treated with the PARP-1 virus was increased 38% ± 8% when compared to cultures treated with an empty virus. However no significant changes in Sox2 or p53 trancription were noticed after 24 h of PARP-1 over-expression.

[0184] The increase in PARP-1 transcription in experimental MEF cultures is similar to that observed in pluripotent cells, which express PARP-1 approximately 50% higher than untreated MEFs do (Fig 9). In that experiment WT MEFs and iPSCs were cultured in standard conditions and then the gene transcription was analyzed using Taqman qRT-PCR.

Example 9 - PARP-1 Expresssing Chimeric Mice

[0185] To generate PARP-1 expressing chimeras, 129 ES cells are injected into a C57BL/6 recipient blastocyst. Resulting chimera then have patches of agouti (brown) and patches of black. Progeny are either agouti (brown) when the 129 ES cells have contributed to the chimera's germline, or progeny are black when cells from the C57BL/6 recipient blastocyst have contributed to the germline. All the agouti pups are then genotyped to find out which ones have received the targeted allele. To maintain a mutation on a pure 129 background, one can then mate the germline transmitting chimeras to 129 mice. All progeny will then be agouti, so all pups are genotyped.

[0186] Chimeras are set up when they are -6-7 weeks of age. Three of the highest percentage chimeras are taken and set with 2 females each. Mice are bred until they produce one or more heterozygous or 40 wildtype pups.

Discussion

[0187] These studies show that cells deficient in the PARP-1 gene failed to reprogram while their wildtype counterparts of the same genetic background went on to generate stable iPSC lines. Moreover, the addition of exogenous PARP-1 as an additional fifth factor to the standard reprogramming cocktail resulted in a significant increase in reprogramming. These results show that PARP-1 has a critical role in induced pluripotency. As p53 functions as a roadblock to reprogramming, the results show that p53 knockout partially rescues

reprogramming in PARP-1 knockout suggests a functional relationship between the two in the context of induced pluripotency. p53 is a known substrate of PARP- 1 , and p53 PARylation can either activate it in response to radiation-induced DNA damage (Valenzuela, M.T. et al. (2002) Oncogene 21 (7): 1 108-16), or inhibit it in response to chemical DNA alkylating agents. PARP-1 and p53 play opposing roles in cancer, and several PARP-1 inhibitors are in clinical trials as

chemotherapeutics and p53-deficient cancers are especially vulnerable to PARP- 1 inhibitors (Papeo, G. et al. (2009) Expert opinion on therapeutic patients 19(10): 1377-400). Given the similarities between induced pluripotency and oncogenic transformation, it is therefore not surprising that PARP-1 and p53 play opposite roles in reprogramming. The small (approximately 2-fold) but consistent increase in p53 expression observed in PARP-1 knockout fibroblasts and knockout ESCs is also consistent with the required functions of these genes for genomic maintenance, and may contribute to the reprogramming deficit observed in the PARP-1 knockout.

[0188] The finding that PARP-1 inhibition causes pluripotent cells to

differentiate is consistent with previous studies on teratocarcinoma cells (Ohashi, Y. et al. (1984) Proceedings of the National Academy of Sciences 81 : 7132-6) and establishes a role for PARP-1 in the maintenance of pluripotency. The accompanying aberrant Sox2 levels in PARP-1 deficient or inhibited cells are characterized by elevated Sox2 transcription and reduced Sox2 translation in pluripotent cells. Without being bound by theory, these results together with prior identification of Sox2 as a target for PARylation (Gao et al. (2009) J Biol Chem 284(33): 22263-73) indicates that PARylation can be critical for the maintaining the stability of Sox2 protein. It is interesting to note, however, that PARylation of a transcription factor has usually been assumed to be inactivating due to the large and negatively-charged PAR molecules blocking DNA-binding (Chang et al.

(2001 ) J Biol Chem 276(50): 47664-70), but this study suggests a more complex relationship. Just as PARP-1 can either activate or inactivate p53 via PARylation, so can PARP-1 inactivate Sox2 during normal differentiation or, as demonstrated by this study, be required for maintenance of normal Sox2 levels. The increased Sox2 transcription accompanying protein depletion appears to be the cell's futile attempt to increase Sox2 levels, most likely through the action of Oct3/4 and Nanog (Boyer et al. (2005) Cell 122(6): 947-56); the expression of neither appears to be affected by PARP-1 inhibition. This model is also consistent with the notion that Oct3/4, Sox2 and Nanog together form the core of the pluripotency transcription network that regulates itself as well as the expression of the pluripotency genes. The lack of stable Sox2 protein in the PARP-1 knockout could explain why these cells fail to reprogram as Sox2 is an essential

component of induced pluripotency. Thus, it is shown that PARP-1 exerts its critical role in induced pluripotency via a Sox2-dependent mechanism.

[0189] It is Applicants' belief that this is the first report to demonstrate that PARP-1 is essential in induced pluripotency and its maintenance. It also is Applicants' belief that the data are unexpected, but also exciting because they suggest that PARP-1 is a novel fifth factor in cell reprogramming. PARP-1 , a key DNA repair protein, critically regulates induced pluripotency because it is required for the maintenance of normal Sox2 and p53 levels. Applicants reveal that PARP- 1 's enzymatic activity is critical for the maintenance of normal Sox2 levels in pluripotent cells, suggesting that PARP-1 exerts its critical role in induced pluripotency via a Sox2-dependent mechanism. Inhibition of PARP-1 activity in pluripotent cells destabilizes their pluripotent state and leads to cell differentiation, due at least in part to stabilization problem of Sox2 in the absence of PARP-1 . This data also suggest that PARP1 -KO have endogenously higher levels of DNA damage, which activate p53 and limit reprogramming.

[0190] Overall, PARP-1 deficiency or inhibition in somatic cells causes a tremendous decline in their ability to reprogram to induced pluripotent stem cells by the forced expression of defined transcription factors. Conversely, PARP-1 overexpression boosts the reprogramming efficiency. These findings contribute importantly to the understanding of induced pluripotency and identify a method to enhance it.

[0191] It should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features,

modification, improvement and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this invention. The materials, methods, and examples provided here are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.

[0192] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0193] In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0194] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.

References

Aasen, T., et al. (2008) Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes. Nat. Biotechnol., 26:1276-1284.

Abuljadayel, I.S. (2003) Induction of stem cell-like plasticity in mononuclear cells derived from unmobilised adult human peripheral blood. Curr. Med. Res. Opin. 19, 355-375.

Aoi, T., et al. (2008) Generation of pluripotent stem cells from adult mouse liver and stomach cells. Science 321 , 699-702.

Ausubel, et al. eds. (1987) Current Protocols In Molecular Biology; the series Methods in Enzymology (Academic Press, Inc.)

Ausubel et al., eds. (1987) Current Protocols in Molecular Biology, Supplement 30, section 7.7.18, Table 7.7.1 .

Barambrink, T., et al., (2008) Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells. Cell Stem Cell, 2(2):151 -9.

Carey, B., et al., (2009) Reprogramming of murine and human somatic cells using a single polycistronic vector. Proceedings of the National Academy of Sciences, 106(1 ):157-62.

Carvajal-Vergara, X., et al., (2010) Patient-specific induced pluripotent stem-cell- derived models of LEOPARD syndrome. Nature, 465:808-12.

Chen, X. et al., (2005) Dedifferentiation of adult human myoblasts induced by ciliary neurotrophic factor in vitro. Mol. Biol. Cell, 16:3140-3151 .

Dimos, J. et al., (2008) Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science, 321 (5893):1218-21 .

Ebert, A. et al., (2009) Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature, 457:277-80.

Eminli, S. et al. (2008) Reprogramming of neural progenitor cells into induced pluripotent stem cells in the absence of exogenous Sox2 expression. Stem Cells, 26:2467-2474.

Esteban, M.A., et al. (2009) Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J. Biol. Chem. 284:17634-17640.

Evans, M.J. and M.H. Kaufman, (1981 ) Establishment in culture of pluripotential cells from mouse embryos. Nature, 292(5819):154-6. Gandlik et al., (2005) Med Sci Monit., 1 1 :RA1 10-121 .

Gossen & Bizard, (1992) Proc. Natl. Acad. Sci. USA, 89:5547-5551 .

Gossen et al., (1995) Science, 268:1766-1769.

Hanna, J., et al. (2008) Direct reprogramming of terminally differentiated mature B lymphocytes to pluripotency. Cell, 133:250-264.

Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual.

Harlow and Lane, eds. (1999) Using Antibodies, a Laboratory Manual.

Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6th ed.).

Hong, H. et al., (2009) Suppression of induced pluripotent stem cell generation by the p53-p21 pathway. Nature, 460(7259):1 132-5.

Kawamura, T. et al., (2009) Linking the p53 tumour suppressor pathway to somatic cell reprogramming. Nature, 460(7259):1 140-4.

Kennedy, (1997) Brain, 120:1245-1259.

Kirsten, E., T. Minaga, and K. Kun, (1982) Coincidence of subnuclear distribution of poly(ADP-ribose) synthetase and DNA polymerase beta in nuclei of normal and regenerating liver. FEBS Letters, 139(1 ):1 17-20.

Kondo, T., and Raff, M. (2000) Oligodendrocyte precursor cells reprogrammed to become multipotential CNS stem cells. Science 289, 1754-1757.

Kopp, J. et al., (2008) Small increases in the level of Sox2 trigger the

differentiation of mouse embryonic stem cells. Stem Cells, 26(4):903-1 1

Kun, E. et al. (1998) Poly(ADP-ribose) polymerase, a potential target for drugs: cellular regulatory role of the polymer and the polymerase protein mediated by catalytic and macronnolecular colligative ends. International Journal of Molecular Medicine, 2(2):131 -42.

Lee et al., (2005) Biochem J., 387:1 -15.

Lee et al., (1981 ) Nature, 294:228-232

Lee, E.K. et al. (2009) Reversine increases the plasticity of lineage-committed cells toward neuroectodermal lineage. J. Biol. Chem., 284:2891-2901 .

Lee, G. et al., (2009) Modelling pathenogenesis and treatment of familial dysautonomia using patient-specific iPSCs. Nature, 461 :402-6. Li, H., et al., (2009) The Ink4/Arf locus is a barrier for iPS cell reprogramnning. Nature, 460(7259):1 136-9.

Li, W., et al. (2009) Generation of rat and human induced pluripotent stem cells by combining genetic reprogramming and chemical inhibitors. Cell Stem Cell, 4:16-19.

Lin, Y., et al., (2010) Identification of PARP-1 as one of the transcription factors binding to the repressor element in the promoter region of Cox2. Archives of Biochemistry and Biophysics, (Epub ahead of print).

Liu, H., et al. (2008) Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3, 587-590.

MacPherson, B.D. Hames and G.R. Taylor eds, (1995) PCR 2: A Practical Approach.

Marion, R.M. et al., (2009) A p53-mediated DNA damage response limits reprogramming to ensure iPS cell genomic integrity. Nature, 460(7259):1 149-53.

Moreau-Gaudry et al., (2001 ) Blood. 98:2664-2672.

Moretti, A. et al., (2010) Patient-specific induced pluripotnent stem-cell models for long- QT syndrome. New England Journal of Medicine, 363(15):1397-409.

Nabel, et al., (1989) Science, 244:1342-1344.

Nakagawa, M., et al. (2008) Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 26, 101-106.

New York Academy Sciences Meeting, (1977) "Liposomes and Their Use in Biology and Medicine."

No et al., (1996) Proc. Natl. Acad. Sci. USA, 93:3346-3351 .

Nutt, S.L. et al. (1999) Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature, 401 , 556-562.

O'Keefe et al. (2009) Proc. Nat. Acad. Sci. USA, 106(15):6099-6104.

Okita, K., T. Ichisaka, and S. Yamanaka, (2007) Generation of germline- competent induced pluripotent stem cells. Nature, 448(7151 ):313-7.

Park, I. et al., (2008) Disease-Specific Induced Pluripotent Stem Cells. Cell, 134(5):877-86.

Przybylska et al., (2004) J. Gene Med., 6: 85-92.

R.I. Freshney, ed. (1987) Animal Cell Culture. Raya, A. et al., (2009) Disease-corrected maematopoietic progenitors from Fanconi anemia induced pluripotent stem cells. Nature, 460:53-59.

Sambrook, Fritsch and Maniatis (1989) Molecular Cloning: A Laboratory Manual, 2nd edition.

Schlesinger & Dubensky (1999) Curr. Opin. Biotechnol., 5:434-439.

Soldatenkov, V. and V. Potaman, (2004) DNA-Binding properties of poly(ADP- ribose) polymerase: a target for anticancer therapy. Current Drug Targets, 5(4):357-65.

Soldatenkov, V. et al., (2002) Transcriptional repression by binding of poly(ADP- ribose) polymerase to promoter sequences. Journal of Biological Chemistry, 277(1 ):665-70.

Solter, D. and B.B. Knowles, (1978) Monoclonal antibody defining a stage- specific mouse embryonic antigen (SSEA-1 ). Proc. Natl. Acad. Sci. U S A, 75(1 1 ):5565-9.

Stadtfeld, M. et al. (2008) Reprogramming of pancreatic beta cells into induced pluripotent stem cells. Curr. Biol. 18:890-894.

Sun, N. et al., (2009) Feeder-free derivation of induced pluripotent stem cells from adult human adipose stem cells. Proc. Natl. Acad. Sci. U. S. A. 106, 15720- 15725.

Svahn, et al., (2004) J. Gene Med., 6:S36-S44.

Takahashi, K. and S. Yamanaka, (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell,.

126(4):663-76.

Takahashi, K. et al., (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131 :861-872.

Tramontano, F., M. Malanga, and P. Quesada, (2007) Differential contribution of poly(ADP-ribose) polymerase-1 and -2 (PARP-1 and -2) to the poly (ADP- pibosyl)ation reaction in rat primary spermatocytes. MHR: Basic science of reproduction, 13(1 1 ):821 -8.

Utikal, J., et al., (2009) Immortalization eliminates a roadblock during cellular reprogramming into iPS cells. Nature, 460(7259): 1 145-8.

Wang, Z.Q. et al., (1995) Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev, 9(5):509-20 Wolfe et al., (2002) Identification of a discrete promoter region of the human GnRH gene that is sufficient for directing neuron-specific expression: a role for POU homeodomain transcription factors. Mol. Endocrinol., 16:435-449.

Wolff et al., (1992) Human Mol. Genet., 1 :363-369.

Wolff et al., (1990) Science, 247:1465-1468.

Yao et al., (1993) Nature, 366:476-479.

Ying et al. (1999) Nat. Med. 5(7):823-827.

Yu, J. et al., (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science, 318:1917-1920.

Zampieri, M. et al., (2009) Parpl localizes within the Dnmtl promoter and protects its unmethylated state by its enzymatic activity. PLoS One, 4(3):e4717.

Zhang, J. et al., (201 1 ) A Human iPSC Model of Hutchinson Gilford Progeria Reveals Vascular Smooth Muscle and Mesenchymal Stem Cell Defects. Cell Stem Cell, 8(1 ):31 -45.

Zhu, et al., (1993) Science, 261 :209-21 1 .

U.S. Patent Publication 2003/021 1603.

U.S. Patent Publication 2007/0238170

U.S. Patent Publication 2006/0204519

Claims

CLAIMS:

1 . A method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising expressing in the cell an effective amount of pluripotency factors and overexpressing an effective amount of a PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement, thereby enhancing the efficiency of reprogramming the non- pluripotent cell to the pluripotent cell.

2. A method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising overexpressing an effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its

complement in a cell induced to reprogramming, thereby enhancing the efficiency of reprogramming the non-pluripotent cell to the pluripotent cell.

3. The method of claim 2, wherein the cell is induced to reprogramming prior to, subsequent to, or concurrently with overexpressing the effective amount of PARP-1 or an equivalent thereof.

4. A method for enhancing the efficiency of reprogramming a non-pluripotent cell to a pluripotent cell, comprising overexpressing an effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its

complement in a cell having pluripotency-inducing transgenes.

5. The method of any one of claims 1 to 3, wherein the pluripotency factors are selected from the Yamanaka factors, the Thompson factors, pluripotency-inducing transgenes or an equivalent of each thereof.

6. The method of claim 5, wherein PARP-1 or the equivalent thereof is

overexpressed by a method comprising expressing in the cell an effective amount of a polynucleotide encoding the PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement.

7. The method of claim 6, wherein the effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement is an amount that comprises at least an increase of about 20% of RNA transcript of the PARP-1 polynucleotide as compared to endogenous RNA transcript of the PARP-1 polynucleotide.

8. The method of claim 6 or 7, wherein the effective amount of PARP-1 or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement is expressed from an endogenous PARP-1 polynucleotide induced to overexpression or an exogenous PARP-1 polynucleotide or an equivalent thereof introduced into the cell and expressed in the cell.

9. The method of claim 8, wherein the endogenous PARP-1 polynucleotide, or an equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement is induced to overexpression by a method comprising operationally inserting an effective amount of an enhancer element such that endogenous PARP- 1 polynucleotide is overexpressed in the cell.

10. The method of claim 1 , wherein expressing in the cell an effective amount of pluripotency factors comprises expressing in the cell an effective amount of a polynucleotide encoding one or more of the pluripotency factors.

1 1 .The method of claim 2, wherein the cell is induced to reprogramming by a method comprising expressing in the cell an effective amount of a polynucleotide encoding one or more of the pluripotency factors.

12. The method of claim 10 or 1 1 , further comprising introducing into the cell an equivalent to one or more pluripotency factor, with the proviso that the agent is not a polynucleotide encoding the one or more pluripotency factors.

13. The method of claim 12, wherein the agent is a small molecule.

14. The method of claim 6 or 8, wherein the PARP-1 polynucleotide or an

equivalent thereof or a polynucleotide that encodes PARP-1 and hybridizes under stringent conditions to SEQ ID NO:1 or its complement further comprises a viral vector operationally joined to the PARP-1 polynucleotide or an equivalent thereof.

15. The method of 10, wherein the polynucleotide encoding the one or more pluripotency factors further comprises a viral vector operationally joined to the polynucleotide encoding the one or more pluripotency factors, thereof.

16. The method of claim 14 or 15, wherein the viral vector is selected from the group consisting of a retroviral vector, an adeno-associated viral vector, or a lentiviral vector.

17. The method of claim 12, wherein the cell comprises a cell of the group: a human cell, an equine cell, a murine cell, a simian cell, a canine cell, a feline cell, an ovine cell or a bovine cell.

18. The method of any preceding claim wherein the non-pluripotent cell is a cell containing one or more genetic abnormalities.

19. The method of claim 18, wherein the genetic abnormality produces a

phenotypic change in the cell related to a genetic disease or disorder.

20. The method of any preceding claim, further comprising culturing the cell under conditions to produce a population of cells.

21 .The method of claim 20, further comprising isolating the pluripotent cells from the non-pluripotent cells.

22. The method of claim 20 further comprising differentiating the pluripotent cells into a specific cell type.

23. The method of claim 22 wherein the specific cell type is of the group a gland cell, a hormone secreting cell, a neural cell, a metabolic cell, a blood cell, a germ cell, an immune cell, a contractile cell, or a secretion cell

24. An isolated cell produced by the method of any one of claims 1 to 22.

25. A population of cells produced by the method of claim 20.

26. A population of cells produced by the method of claims 22 or 23.

27. An isolated pluripotent cell or population of pluripotent cells produced by the method of claim 20.

28. A non-human transgenic animal comprising an isolated cell or population of cells of any of claims 24 to 27.

29. The non-human transgenic animal of claim 28 wherein the isolated cell or the isolated pluripotent cell is allogeneic or autologous to the animal.

30. The non-human transgenic animal of claim 28 or 29, wherein the animal is of the group: a murine, a canine, a bovine, an equine, a feline, a canine and an ovine.

31 .A method for screening a cell for a possible therapeutic agent comprising contacting an agent to be screened with an isolated cell or population of cells of any one of claims 24 to 27, and determining if the agent is a possible therapeutic agent by observing a change or lack of change in one or more cells, wherein the change or lack of change indicates that the agent is or is not a possible therapeutic agent.

32. The method of claim 31 , wherein the agent is selected from the group of small molecules, aptamers, antisense molecules, antibodies, fragments of antibodies, polypeptides, proteins, polynucleotides, organic compounds, cytokines, cells, shRNAs, siRNA, a virus, genetic material in a liposome, and an inorganic molecule.

33. The method of claim 31 , wherein the determining if the agent is a possible therapeutic agent comprises determining the LD50 of the agent.

34. The method of claim 31 , wherein the determining if the agent is a possible therapeutic agent comprises detecting a phenotypic or a cellular response to the agent.

35. The method of claim 31 , wherein the cellular response comprises one or more of the group: apoptosis, proliferation, gene expression, a

physiological change, or an electrophysiological change.

36. Use of a cell or a population of cells according to any one of claims 24 to 27 for screening a cell with a variation of a gene of interest for an agent to treat a disease or disorder comprising contacting an agent to be screened with the pluripotent cell, observing a change or lack of change in one or more cells, wherein the change or lack of change is correlated with an ability of the agent to treat the disease or disorder.

37. Use of a cell or a population of cells according to any one of claims 24 to 27 for determining disease mechanisms comprising contacting the cell with an agent or condition which affects a molecular pathway of interest.

38. Use of a cell or a population of cells according to any one of claims 24 to 27, wherein the molecular pathway is a disease-associated pathway.

39. Use of a cell or a population of cells according to any one of claims 24 to 27, wherein the cells are subjected to a condition, which triggers the activities of known factors in response to the condition, using the activity of the naturally occurring factors to thereby identify pathways and molecules associated with the disease of interest.

40. Use of a cell or a population of cells according to claim 39 wherein the condition is hypoxic or anoxic conditions or any condition resulting in oxidative, endoplasmic reticular or mitochondrial stress.