WO2012109788A1

WO2012109788A1 - Method for increasing protein expression efficiency and expression vector thereof

Info

Publication number: WO2012109788A1
Application number: PCT/CN2011/071030
Authority: WO
Inventors: 张庆利; 黄倢; 刘笋; 刘庆慧; 史成银; 梁艳
Original assignee: 中国水产科学研究院黄海水产研究所
Priority date: 2011-02-16
Filing date: 2011-02-16
Publication date: 2012-08-23
Also published as: CN102333870A; CN102333870B

Abstract

An expression vector for increasing protein expression efficiency is provided. A specific nucleotide sequence is introduced into the downstream of the initiation codon ATG of the expression vector, and encodes at least 3 amino acid residues. These amino acid residues process 4 or more codons. A corresponding method for increasing protein expression efficiency is also provided. The method of the present invention can be used in modification of any gene for increasing its expression efficiency. As compared to prior art, the expression vector or method of the present invention can increase the target protein expression efficiency by 2-5 times.

Description

Method for improving peptone efficiency and 3⁄4« body technology field

The invention belongs to the field of genetic engineering technology, and has a method for improving the efficiency of protein «3⁄4" and a «3⁄4 carrier.

Background technique

Sib is affected by many factors in the host cell, such as the nature of the gene of interest, transcription efficiency, mRNA stability, translation efficiency, and protein stability. The characteristics of the target gene sequence, such as rare codons, terminators, and secondary structures, often affect the surface of the protein. If the target group contains more rare codons, it is often a recombinant protein. The table 3⁄4* is lower (Sorensen et al., 1989, J. Mol. Biol. 207, 365-377); if the rare codon set appears in 3⁄43⁄4, the situation is more serious (Chen and Inouye, 1990, Nucl) Acids Res. 18, 1465-1473); 3⁄43⁄4 mutations in the gene of interest produce an unexpected stop codon resulting in a decrease in protein translation levels; the secondary structure of the » in the mRNA transcript also interferes with the initiation and extension of translation ( Tessier et al. 1984, Nucl. Acids Res. 12, 7663-7675; Looman et al. 1986, Nucl. Acids Res. 14, 5481-5496). Although the transcription level of the target gene mRNA is not complete with the level of the protein, the high transcription efficiency of the target gene mRNA/transcription stability will increase the level of the target protein at different distances; in addition, the translation efficiency of the recombinant protein Not only by the target gene sequence itself, but also by the vector sequence. The stability of the recombinant protein is also difficult to store in the host cell.

When the mRNA of the target gene is carried out in the host cell, the tRNA junction in the host cell reflects the codon usage of the host species mRNA; the rarity or lack of a sufficient tRNA may cause the translation to stop, and the sufficiency may result in translation. Delayed, pre-mature translation termination, translation of tree horses and distribution (Ikemura 1985, Mol. Biol. Evol. 2, 13-34); although the presence of a small number of rare codons usually does not have a large effect on the synthesis of the protein of interest, but if When a gene contains a string or a plurality of rare codons, the paste of the source protein is very low, rnm, so that the target gene contains too many rare codons.

One reason for the incomplete production of 3⁄43⁄4Κ (Blake RD et al. 1984, J. Biomol. Stuct. Dyn. 2, 593 06; Robinson M et al., 1984, Nucleic. Acids Res. 12, 6663-6671); When the same type of tRNA is added to the host strain, the protein yield of the rare codon gene will be high (Brinkmann U et al. 1989, Gene, 85, 109-114.). Therefore, when humans exogenous gene-recombinant fiber, the sequence of the foreign-derived gene is often P3⁄4, and the frequency of the last base of the sequence triplet codon is rare to obtain high protein expression; See the patent to increase the protein load after artificially changing the start codon of the target gene.

Among the many factors affecting the foreign gene 3⁄43⁄4*, the role of the vector is neglected, because it not only determines the copy number of the heavy granule, but also the recording efficiency and stability of the mRNA, and the effect of the slanting The stability of the recombinant protein. The study found that the vector capable of high-efficiency of one gene may not be the same for another gene. Therefore, in the recombination of the source shed, it is often necessary to select the scooping and controlling components according to the actual situation to construct the «3⁄4 vector of the ^3⁄4 vector. . A « said, the construction of the «3⁄4 carrier should meet the following requirements: (1) high protein surface, (2) a wide range of host applications, (3) the expression of the product is easy to purify. Recombinant protein expression Volume is a priority indicator. How to build a high-efficiency 3⁄43⁄4⁄4 body has a lot of fiber, the research mostly focuses on the redrawing of the promoter, multiple cloning sites, stop codon, fusion protein «, replicon, screening feiB / reporter gene, etc. It is not yet possible to use some of the citric acid multi-password codons to add the Λ sequence to construct a high-efficiency carrier.

Summary of the invention

The object of the present invention is a method and a vector for improving protein efficiency, and the method or the vector of the present invention can improve the efficiency of exogenous host in a host, and obtain high efficiency of the target gene to make up for the prior art. insufficient.

According to the present invention, according to the codon degeneracy of the common S acid in the living body, a certain number of said target coding horses are introduced after the start codon of the target gene or the start codon of the carrier sequence in the recombination of the sputum phase (4 or The above codons are the bribes of acid expansion. These nucleotides encoding multiple codons «acids, which are rich in tRNA content, can participate in protein synthesis corresponding to S acid, thus avoiding the lack of tRNA in the target gene sequence or vector sequence. The resulting mRNA translation, weighing or stopping, has the initial and extension efficiency of the high translation, and greatly improves the efficiency of the target gene or the protein picked up.

The technical scheme of the present invention is as follows:

A carrier for improving the efficiency of protein loading, the 3⁄4⁄4 carrier starts with ATG and contains a nucleotide of the MM" segment of the gestation of the woman.

(a) The specific tannic acid of the leg spoon is a difficult acid having 4 or more dense fields;

(b) The number of women in the specific volume of the leg spoon is not less than three.

(c) 3⁄43⁄4⁄4 body, temple set 3⁄4β mesh for 3, 4 or 5.

(d) Difficult 3⁄43⁄43⁄4 body, earning a sense of profit, β is 6 or 7.

(e) The leg spoon body is the male body 3⁄43⁄43⁄4 body.

A method for increasing the efficiency of a gene of interest protein 3, which inserts a nucleoside encoding a specific succinct segment after the initiation codon ATG of the gene of interest, the levy is:

The specific column of the family 3⁄4 is X1X2... Xn, wherein X f3⁄4* has 4 or more codons of S acid, n is greater than or equal to 3; the method of the present invention for the use of gene protein efficiency can be used not only Any gene of interest is used to increase its efficiency for the construction of vectors with high efficiency characteristics. Compared with the prior art, the present invention has the following method for improving the efficiency of the gene protein 3⁄4⁄4 by the present invention, and can be used for the 3⁄4it arbitrary target gene to increase the efficiency of the target protein by 2 to 5 times; By using the method of the present invention, it is also possible to carry out 3⁄4it on the existing protein fiber carrier to increase the peptone efficiency. Specific male mode

Example 1 constructs a high-efficiency fiber vector by inserting a nuclear salary column of the Kangma III constant-pay column after the start codon: a). Inserting the coding GlyGlySer (SEQ ID N0: 1) after the vector pGFPuv start codon The checklist:

1). Various primers required for synthetic loading

According to the pGFPuv vector, a X-inch primer for the 3⁄4 pGFPuv vector was designed. The upstream bow was PI (pGFPuv-S): GACATGA-GTAAAGGAGMGMC, and the downstream primer P2 (pGFPuv-A): GCGTTAnTGTAGAGCTCAT. For the first in the GFPuv vector 216 add restriction sites Cla I, designed upstream primer _{P3 (pGFPuv216-F): CTCATOGATATGACCATGATTAOG} , downstream primer _{P4 (pGFPuv216-R): GAGATOGATAGCTGTTTCCTGTG} , downstream bow | at the 5, end are added to protect the bases CTC. In addition, primers p5 and p6 for inserting the nucleic acid sequence encoding GlyGlySer, upstream primer P5 (high-efficiency-F) were designed: TCTATCGATATGGGGGGTTCTATGATTAOGCCMGCTTGCA, containing Cla I restriction site 3⁄4 ^ codon ATG, downstream bow | P6 (efficient - R): TGCMGCTTGGCjGTAATCATAGAACCCaTATATOGATAGA, containing a Hind III restriction site; this primer pair can introduce a nucleotide sequence GGGGGTTCT (SEQ ID NO: 2) encoding the amino acid GlyGlySer after the original vector start codon site, these three acids There are 4, 4, and 6 degenerate codons, respectively.

2). Efficient 3⁄43⁄4⁄4 body efficient "Building of GFPuv"

P3 (pGFPuv216-F) _: CTCATOGATATGACCATGATTACG, P4 (pGFPuv216-R) _: GAGATCGATAGCTGTTTCCTGTG was used as the bowel I, and the pGFPuv plasmid was used to clone the pGFPuv, so that the pGFPuv plasmid was cleaved at position 216, and both ends were added. The enzyme cleavage site Cla I. The PCR reaction was carried out in a total volume of 50 μl, using 2 μl of the pGFPuv plasmid as a template. The reaction bovine was circulated after denaturation at 95 °C for 2 min, then denatured at 95 °C for 20 s, and annealed at 42 °C for 20 s, 72 °. C extended lmin 45 s, 8 cycles and then denatured at 95 °C for 20 s, 49. 8 °C for 20 s, 72 °C for lmin 45 s, 30 cycles of book, extended at 72 °C for 10 min „ agar The linear p3p4GFPuv fragment was recovered by the electrophoresis of the sugar lake. The P5 (high efficiency _F): TCTATOGATATGGGGGGTTCTATGATTAOGCCMGCTTGCA, P6 (high efficiency - R): TGCMGCTTGGCGTAATCATAGMCCCCCCATATCGATAGA, mixed back i ^ into p5p6 double-stranded DNA fragment, the annealing reaction was 94 ° C, 5 min , 53. Annealing at 1 °C for 5 min, extension at 72 °C for 5 min. Agar was withdrawn and electrophoresed to recover and purify the _P 5p6 double-stranded fragment.

The p3p4pGFPuv fragment carrying the Cla I restriction site was ligated with restriction endonucleases Cla I and Hind III, and the fragment of 3. 3Kb after restriction enzyme digestion was recovered; The p5p6 double-stranded DNA fragment was digested with the endonuclease Cla I and Hind III, and the fragment of about 50 bp was recovered by electrophoresis. Two anterior ligatures were ligated, and ligated to col Ϊ α5 α sensitized cells, and then coated with LB plate of 3⁄4 benzylpenicillin. After culture for 16 h, the single-sided 3⁄4 Μ microscopic microscopic examination was performed to confirm the positive clone. , the expanded culture of «heavy taken! tablets, with _Ρ 1, _ρ2 lead shot wide by 4 single vine, a further determination positive clones, extract heavy particles 1¾¾ positive clones and sequenced to determine the nucleotide» inserted correctly column GGGGGTTCT After the start codon, the / ΗΕ 繊繊 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^.

3) . Efficient "Enlarged culture and extraction of GFPuv plasmid

The high-efficiency "^FPuv plasmid was transformed into Escherichia coli DH5a, cultured at 37 °C for 16 h, 3⁄4 陬 vine, 37, 220 rmf cultured to 0D600 {tS 1. 0, and extracted with 0MAGE plasmid in small amount. The extracted heavy ISJ3⁄4 granulating was transferred into the bacterium DH5a into the fluorescent protein (using the pGFPuv vector plasmid as a control), and the fluorescence state was observed under the microscope, and the pronucleus of the fluorescing protein was subjected to 3⁄4⁄4. A single clock with pGFPuv and high-efficiency "^FPuv heavy β-particles was inoculated into the LB liquid medium of the mixed sheep of mycin, cultured at 37 °C for 8-10 h, and then 13⁄4 species were added to the LB liquid medium of the mixed sheep. When cultured at 37 °C to 0D600, the light was induced by IPTG with lm mol/L, and after induction at 28 °C for 5 h, the cells were collected by centrifugation, and the supernatant and precipitate were collected separately for SDS_PAGE. As a result, it was found that at a molecular weight of about 31 kD, the fluorescent protein was induced into the fiber, and the high-efficiency "GFPuv" The amount of vector in the vector group was significantly higher than that of the control group pGFPuv; after induction of 3⁄4⁄4 GFP samples, the incomplete denaturing of Siff-PAGE was performed using the FujiFilm (LAS 3000) system, and the blue light was excited in GFP mode, GFP. The protein band can be seen in bright green, and the other proteins ^ # less, play a role similar to Western-blot.

4). Statistical analysis of pGFPuv and high efficiency "^FPuv fluorescent protein 3⁄43⁄4"

Bradford electrophoresis scans the detection of prion protein 3⁄43⁄43⁄4, at 595 波长, the optical density of different «standard proteins, ^^ standard curve, the optical density value of the sample, the total protein content; SDS-PAGE, Cross-scanning, measuring and measuring the amount of «3⁄4 protein, protein 3⁄4®. The molecular weight of the induced «3⁄4 GFP fluorescent protein was about 1⁄2 31kD, and the amount of GFP in the control pGFPuv was less than 8% of the total bacterial protein, while the high-fiber group was 3% efficient, and the GFPuv was 23%. Thus, in the original product Adding a nuclear code of SM GlyGlySer to the start codon of the vector pGFPuv, which encodes three poly-codon acids and serines, respectively, and SM GlyGlySer, can increase the related protein expression of the vector by 3 More than one.

The nuclear intoxication column GGGGGTTCT can also be replaced by the nucleus, column, and other nuclear l ^ columns of GlyGlySer of SEQ ID N0: 3~6. When there is a facial ridge, the nuclear rafts of the primers P5 and p6 are separated, so that the nuclear 瞎 column of the book code GlyGlySer is SEQ ID N0: 3-6 „

For example, use SEQ ID N0: 3 3⁄4#{ GGGGGnCT, the specific steps are as follows:

1) . Primer sequence information

The primer for P5 was changed to 7: TCTATCGATATGGGAGGTAGCATGATTAOGCCAAGCTTGCA; the underlined is the 3⁄4S sequence of Xie弋; the primer for P6 was changed to 8 _: TGCMGCTTGGOGTAATCATGCTACCTCCCATATOGATAGA; wherein the underlined is the 3⁄4S sequence of 弋.

2) . Efficient 3⁄43⁄4⁄4 body efficient "^FPuv construction

Amplification was bow I pGFPuv plasmid p3 and p4 _{P 3p4GFPuv} fragment obtained, then p7, p8 bow | p7p8 was annealed to double-stranded DNA fragments, restriction enzymes were used Cla I and Hind III double digestion fragments _{P 3p4GFPuv} And _P 7p8 double-stranded DNA fragment, the restriction product was recovered and ligated, and after ligation to co7i DH5 a competent cells, a single colony was amplified by pl and p2 primers, positive clones were determined by electrophoresis, and positive clones were sequenced to ensure 3⁄43⁄43⁄4 ^ The column GGGGGTTCT has been inserted correctly after the start codon. The heavy particle was named p7 _P 8 efficient "Μ1⁄2 _ν plasmid.

3) . ρ7ρ8 efficient "Enlarged culture and extraction of GFPuv plasmid

The _P 7p8 high-efficiency " ^ FPuv plasmid was transferred into Bacillus DH5 a and cultured at 37 ° C for 16 h. After the culture was carried out, the single vine was expanded and the P7p8 efficient GFPuv plasmid was extracted. The extracted plasmid was transferred into Escherichia coli. DH5 a was inserted into the fluorescent protein *3⁄4, and the pGFPuv vector plasmid was used as a control. After inducing the expressed GFP protein into SDS-PAGE electrophoresis after incomplete denaturation, using FujiFilm (MS 3000)? In the GFP mode, the amount of protein in the GFP mode is 3⁄43⁄4.

4). Statistical analysis of the amount of peptone

The protein fibrosis was determined by Bradford method and electrophoresis scanning. The statistical results showed that the GFP protein of pGFPuv in the control group was less than 8% of the whole bacterial protein, while the high 3⁄4£4 group of p7p8 was highly efficient. GFPuv 3⁄43⁄4 GFP Protein shell U reached 25%. b) Insert the other coded three 1^ temple to do the checklist after the vector pGFPuv start codon:

After the vector pGFPuv start codon, the GlyGlySer nucleoside sequence can be replaced by the other three-fixed alcohol column, and the recombinant fluorescent protein 3⁄4⁄4 is improved by 2 to 3 times. For example, GlyGlySei^ ff is listed as a difficult alcohol column substitution of SEQ ID NO: 7-21, and the corresponding 3⁄4 ^ pay column is SEQ ID NO: 22-31, respectively, corresponding to the following table. Even 5! — —— fiM ——— it avoids i——

SEQ ID NO: 7 SerAlaAi3⁄4 SEQ ID NO: 22 / SEQ ID NO: 23 AGCGCAAGA TCTGCAAGA

SEQ ID NO: 8 ProSerGly SEQ ID NO: 24 CCCAGCGGA

SEQ ID NO: 9 ProThrLeu SEQ ID NO: 25 / SEQ ID NO: 26 CCCACACTC/CCTACACTC

SEQ E) NO: 10 GlySerAla SEQ ID NO: 27/SEQ ID NO: 28 GGAAGCGCA/GGATCTGCA

SEQ ID NO: ll GlyThrPro SEQ ID says NO: 29/SEQ ID NO: 30 GGAACACCC GGAACGCCC

SEQ ID NO: 12 ThrProSer SEQ ID O: 31 / SEQ ID NO: 32 ACACCCAGC / ACGCCTAGC

SEQE)NO:13 LeuSerPro SEQE)NO:33 CTCAGCCCC

SEQ ID NO: 14 LeuThrAla SEQ ID NO: 34 / SEQ ID NO: 35 CTCACAGCA / CTCACGGCA

SEQ ID NO: 15 AlaSerGly SEQ ID O: 36/SEQ ID NO: 37 GCAAGCGGA/GCATCTGGA

SEQ ID NO: 16 AlaLeuThr SEQ ID O: 38/SEQ ID NO: 39 GCACTCACA/GCACTCACG

SEQ ID NO: 17 A3⁄4 GlySer SEQ ID O: 40/SEQ ID NO: 41 AGAGGAAGC/AGAGGATCT

SEQE) NO: 18 ValSa-Thr SEQ ID NO: 42 / SEQ ID NO: 43

E) NO: 19 ValAlaSer SEQ ID NO: 44/SEQIDNO book GTGAGCACA/GTGTCTACA

SEQ :45 GTGGCAAGaGTGGCAAGC

SEQE) NO: 20 AigThrLeu SEQ ID NO: 46 / SEQ ID NO: 47 AGAACACTa CGAACACTC

S, E, Q, ,, E,,,,, N,, O,,: 2,, 1, 1, , , , , , , , V,, a, l, A,, l, a , S, e,, r,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, , 8, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , G, T, G, G C,, A, A, G, C,,,,,,,,,,,,, For example, GlySerAla of SEQ ID NO: 10 is substituted for GlyGlySer:

First, the nucleic acid sequences of primers P5 and p6 were engineered such that the nucleotide sequence GGGGGTTCT encoding GlyGlySer was encoded with the nucleoside Mff column GGMGCGCA (SEQ ID NO: 27) f弋 of GlySerAla (SEQ ID NO: 10) to form a new one. Primers p9, ρ10. The specific loading steps are as follows:

1) . Primer sequence information

P9: TCTATCGATATGGGAAGOGCMTGATTACGCCAAGCTTGCA; wherein the underline is an alternate base sequence;

P10: TGCMGCTTGGOGTAATCATTGOGCTTCCCATATOGATAGA; wherein the underline is an alternate base sequence.

2) . Efficient 3⁄43⁄4⁄4 body efficient ^FPuv construction

Amplification pGFPuv plasmid p3 and p4 bow I was obtained _P 3p GFPuv fragment, then p9, plO bow | _{P 9pl0} was back into double-stranded DNA fragment with restriction enzymes Cla I and Hind III double digestion fragments p3p4GFPuv And the p9pl0 double-stranded DNA fragment, the restriction enzyme product is recovered and then ligated, and the ligation product is transformed into a coli ma sensation fine «, and the vine is amplified by pl, p2, and the electrophoresis tree is determined to be correct. After entering the initial sputum, the granule I was named Ρ9ρ10 highly efficient "GFPuv plasmid.

3) . p9pl0 efficient "Extraction and extraction of Pu _V plasmid

_P 9pl0 efficient " ^ FPuv plasmid was transferred into : Bacillus DH5 a, cultured at 37 ° C for 16 h, then 陬陬 vine, after single vine expansion culture, extract P9pl0 highly efficient " GFPuv plasmid, 3⁄43⁄4 plasmid transfer The fluorescent protein was assayed in J. bacillus DH5a and the pGFPuv vector plasmid was used as a control. The induced expression of the GFP protein was subjected to incompletely denaturing SDS-PAGE electrophoresis, and the amount of protein was measured by 5±blue»3⁄4 in GFP mode using FujiFilm (LAS 3000). Instruction manual

4). Statistical analysis of the amount of peptone

The Bradford method and electrophoresis scanning method were used to determine the amount of peptone. The statistical results showed that the GFP protein expression of pGFPuv in the control group was less than 8% of the total bacterial protein, while the high-efficiency recombination table P9pl0 was highly efficient. GFP-expressing GFP protein Then it reaches 19%.

Use SEQ ID NO: 27 with other nucleotides encoding 3 3⁄4 acids! ^弋, alternative bribes are listed as SEQ ID NO: 22-26, SEQ ID NO: 28-48, and the Sfe fluorescent protein 3⁄43⁄4β of the vine carrier has a 2 to 3 fold increase.

Example 2: After the 3⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4⁄4 :

1) . Primer sequence information

Designed to construct high-efficiency bows:

Upstream primer Pll (S^正AF): TCTATCGATATGTCTTCCGGTC- TGATTACGCCAAGCnGCA, containing C/s I restriction site 3⁄43⁄4 start codon ATG, downstream bow I P12 (3⁄4ffiA-R): TGCAAGCTTGGCGTMTCATACCGGMGACATATCJGATAGA, containing 〃ίίΠ cleavage site; The cytosine can be TCTTCOGGTCTG (SEQ ID NO: 50) after the original vector start codon site, and the four amino acids have 6, 6, 4, and 6 degenerate passwords. child.

2) . Efficient 3⁄43⁄4⁄4 body efficient "^FPuv construction

The p3p4GFPuv fragment, and the pll and pl2 primers were annealed in the same manner as in Example 1 to form a pllpl2 double-stranded DA fragment, which was digested, ligated, and cloned to obtain a 3⁄4⁄4 initial codon and inserted into the TCTTCOGGTCTG (SEQ ID NO: 50). The granule, named pllpl2 efficient "GFPuv plasmid.

3) . pllpl2 efficient "Enlarged culture and extraction of GFPuv plasmid

The pi 1ρ12 efficient " ^ FPuv plasmid was transferred into Escherichia coli DH5 α, and the pi 1ρ12 high efficiency " ^ FPuv plasmid was extracted after expansion, and the extracted plasmid was transformed into E. coli DH5 CI into 3⁄4⁄4 fluorescent protein 3⁄4⁄4, and the pGFPuv vector was used. The plasmid served as a control. After SDS-PAGE electrophoresis, which induces incomplete denaturing of the GFP protein ship, the FujiFilm (LAS 3000) 成像成像 imaging system, in GFP mode, δ±^ light stimulates the amount of protein in 3⁄43⁄4.

4) . Statistical analysis of protein loading

The Bradford method and electrophoresis scanning method were used to determine the amount of protein 3⁄4⁄4. The statistical results showed that the GFP protein fibrosis of the control pGFPuv was 8% of the whole bacterial protein, while the high 3⁄4£ group of 3⁄4»body pllpl2 was highly efficient" GFPuv plasmid fiber The GFP protein reached 35%.

The nucleic acid sequence TCTTCCGGTCTG (SEQ ID NO: 50) can also be replaced with a nucleotide sequence of AGSCTGCACTC (SEQ ID NO: 51), AGCTCTGCATTG (SEQ ID NO: 52), SerSerAlaLeu, which encodes SerSerAlaLeu. In the case of facial sputum, the nuclear enthalpy of primers P11 and Pl2 is 3⁄4⁄4, so that the hoof alcohol column encoding SerSerAlaLeu is SEQ ID NO: 51-52 or other sequences, respectively.

2) Insert the other nuclear-encoded column of the four-cage cage column after the vector pGFPuv start codon:

The 3⁄43⁄4^ column of the code SerSerAlaLeu (SEQ ID NO: 49) inserted after the vector pGFPuv start codon can be substituted with the other 4^(= Temple column 3⁄4f3⁄4^ column. For example, SerSerAlaLeu can be listed as SEQ ID NO : 53-64 S With the column, the corresponding nucleoside alcohol columns are SEQ ID NO: 65-88, respectively, and the 3⁄4f should be as follows:

SEQE)NO:53 ProSerGlyThr SEQ ID NO:65/SEQ ID NO:66 CCCAGCGGAACA/CCTAGCGGAACA SEQE)NO:54 SerSe jlyAla SEQ ID NO:67/SEQ ID NO:68 AGCAGCGGAGCA TCTAGCGGAGCA SEQE)NO:55 ProSerThrLeu SEQ ID NO:69/SEQIDNO:70 CCCAGCACACTC/ CCTAGCACACTC SEQE)NO:56 GlySerProAla SEQ ID NO:71/SEQIDNO:72 GGAAGCCCCGCA/GGATCTCCCGCA SEQE)NO:57 GlySerLeuSer SEQ ID NO:73/SEQ ID NO:74 GGAAGCCTCAG YGGArCTCTCAGC SEQE)NO:58 ThrSerSerArg SEQ ID NO:75/SEQIDNO:76 ACAAGCAGCAGA/ ACGAGCTCTAGA SEQE)NO:59 ThrSerThrLeu SEQ ID NO:77/SEQ ID NO:78 ACAAGCACACTC7ACGAGCTCTAGA SEQE)NO:60 LeuSerThrPro SEQ ID NO:79/SEQ ID NO:80 CTCAGCACACCC/CTCTCTACACCC SEQ ID NO:61 LeuSerThrLeu SEQ ID O:81/SEQIDNO:82 CTCAGCACACTC/CTCTCTACACTC SEQIDNO :62 AlaSerSerArg SEQ ID: NO: 83 / SEQ ID NO: 84 GCAAGCAGCAGA / GCATCTAGCAGA SEQ ID NO: 63 AlaSerProVal SEQ ID NO: 85 / SEQ ID NO: 86 GCAAGCCCCGTG / TCAAGTGCTGTG SEQ ID NO: 64 ValSerSerPro SEQ ID O: 87 / SEQ ID NO: 88 GTGAGCAGCCCC / GTGAGCTCTCCT For example, The steps and expression of the LeuSerThrPro of SEQ ID NO: 60 in place of SerSerAlaLeu are as follows:

Firstly, the nuclear pi 1 and pl2 are listed as fi3⁄4i, and the nucleoside yeast TCTTCCGGTCTG (SEQ ID NO: 50) encoding SerSerAlaLeu is replaced by the nucleoside salary SEQ ID NO: 79 or 80. Book pl3, pl4. The specific steps are as follows:

1) . Primer sequence information

P13: TCTATOGATATG CTCAGCACACCCATGATTAOGCCAAGCTTGCA; wherein the underlined is an alternative 3⁄48 sequence; P14: TGCMGCTTGGCGTAATCATGGGTGTGCTGAGCATATCGATAGA; wherein the MS sequence underlined is 弋.

2) . Efficient 3⁄43⁄4⁄4 body efficient "^FPuv construction

Amplification was bow I p3 and p4 pGFPuv plasmid fragment obtained _{P 3p4GFPuv,} then PL3, PL4 bow | ρ13ρ14 was annealed to double-stranded DNA fragment with restriction enzymes Cla I and Hind III double digestion fragments and _{P 3p4GFPuv} _P 13pl4 double-stranded DNA fragment, the restriction enzyme product is recovered and ligated, and the ligation product is transformed into: ^ coii DH5 a sense of free state, using pl, p2 bow | amplification of single vine, electrophoresis detection and measurement of positive clones, determine guess The queue has been correctly difficult after the start of the codon. The heavy bell is named ρ13 _Ρ 14 highly efficient "GFPuv plasmid.

3) . _P 13pl4 high efficiency "^ FPuv plasmid expansion culture and extraction

The ρ13ρ14 high IH Puv plasmid was transformed into Escherichia coli DH5 a, and cultured at 37 ° C for 16 h. Then, the single sap was picked, and the single vine was expanded and cultured. The Pl3pl4 high efficiency FPuv plasmid was extracted, and the extracted plasmid was transferred into Escherichia coli DH5. The expression of fi3⁄4 fluorescent protein was introduced into ct, and the pGFPuv vector plasmid was used as a control. Will induce 3⁄43⁄4⁄4 GFP protein «Incompletely denatured SDS-PAGE after electrophoresis, ί FujiFilm OAS 3000)? In the laparoscopic imaging system, the amount of protein in the GFP mode is 3⁄43⁄4⁄4 light.

4) . Statistical analysis of protein «3⁄4 quantity

The Bradford method and electrophoresis scanning method were used to determine the amount of peptone. The statistical results showed that the GFP protein expression of pGFPuv in the control group was less than 8% of the total bacterial protein, while the highly efficient recombinant epigenetic group _P 13pl4 was highly efficient. The protein reached 34%.

The results showed that the insertion of four «acid nucleus columns behind the start codon of the vector resulted in a 3⁄4⁄4 efficiency of the target protein being 1 to 2 times higher than that of the three difficult acid-coded columns.

3 3⁄43⁄43⁄4 codon post-insertion Mi code four or more specific i« column δ ^ 歹 J* construct high body: a). After the start codon, insert the five hard-to-acid nuclear columns

诵付卜游 primer P5 (3⁄4B-F): TCTATCGATATGGCTGCATCTCTGAOGATTAOGCCMGCTTGCA, containing Cla l restriction site A start codon ATG, downstream primer P6 (3⁄4i positive B-R): TGCAAGCTTGGOGTAATCATAGATGCAGCCATATOGATAGA, containing Hindin restriction site. A five-codon-encoded amino acid, AlaAlaSerLeuThr (SEQ ID NO: 89), which has 4, 4, 6, 6, 4, respectively, can be introduced after the original vector start codon site. The degenerate codon, the nucleoside Mff of the primer encoding AlaAlaSerLeuThr is: GCTGCATCTCTGACG (SEQ ID NO: 90). The results of the configuration of the 3⁄4⁄4⁄4 scoop 3⁄4 ^ body step m m showed that the efficiency of the recombinant "high-efficiency" GFPUV s & fluorescent protein fiber efficiency increased more than three times.

AlaAlaSerLeuThr (SEQ ID NO: 89) says that it is also possible to replace with five other multi-codon amino acids. For example, with a 3⁄4⁄4 acid substitution of the sequence SEQ ID NO: 91"93, the efficiency of the recombination of the high-efficiency "^1 ^ fluorescent protein 3⁄4⁄4 is approximately 2 to 4 times higher.

2). After the start of the post-codon, insert the six citrate nuclear enzymes

Begging Buoy Primer (3⁄4i positive C-F): TCTATOGATATGGTTGTCTCGAGTGGGGGTATTACGCCMGCTTGCA, containing Cla I restriction site 3⁄43⁄4 initial codon ATG, downstream primer (3⁄4ffi C-R): TGCAAGCTTGGCGTAATCATOGAGACMCCATATOGATAGA, containing HindlllH cleavage site. The sulphate can be conjugated to the six-codon-encoded S-acid ValValSer SerGlyGly (SEQ ID NO: 94), which has 4, 4, respectively. 6, 6, 4, 4 degenerate codons; the 3⁄4^ leaven of ValValSer Sei€lyGly (SEQ ID NO: 94) in the bow kiss is: GTTGTCTOGAGTGGGGGT (SEQ ID N0: 95) „ i m7 of the constructor The result of the & mi results showed that the efficiency of the § & PON protein in the recombinant FPUV was increased by about 2.5 times.

ValValSerSei^lyGly (SEQ ID NO: 94) can also be replaced with another six multicodon 3⁄4⁄4 acid. For example, with the substitution of ^ for SEQ ID NO: 96" 98, the efficiency of the absolute fluorescent protein is approximately 2 to 3 times higher.

c). After the start of the post-codon, the nucleus of ΡΗ^β acid

Begging Buoy Primer (3⁄4i positive D-F): TCTAT1XATATG CTTGTCGGCAAGCACACTCATTACGCCAAGCTTGCA, containing Cla I restriction site 3⁄43⁄4 initial codon ATG, downstream primer (3⁄4i positive D-R): TGCMGCTTGGOGTAATCATOGACMGAGCATATOGATAGA, containing Hindlll restriction site. Through the primer, seven multi-codon-encoded amino acids LeuLeuSerAlaGlyGlySer (SEQ ID NO: 99) can be introduced after the original vector start codon site, and the seven 3⁄4 acids are 6, 6, 6, 4, 4, 4, respectively. Six degenerate codons, the primer encoding LeuLeuSerAlaGlyGlySer is listed as: CTCTTGTCGGCMGCACACTC (SEQ ID NO: 100) „The carrier of the ship is reported in 3⁄4 steps 3⁄4 lines, and the results show that the amount of fluorescent protein is 3⁄4⁄4 Increased by 3 times.

LeuLeuSerAlaGlyGlySer can also be replaced with other seven multi-codon amino acids. For example, by replacing the S acid with the sequence SEQ ID NO: 101-103, the efficiency of the recombinant high-efficiency "GFP-GFP fluorescent protein is approximately 2-3 fold higher.

Example 4: Adding 10 or more multi-codon encodings to give out the 3⁄43⁄4if target gene to improve the protein 3⁄43⁄4 efficiency. a), the boat adds 10 multi-codons to the target gene to improve the efficiency of peptone

1 ) . Cloning of the Trx gene mature peptide cDNA

Extracting the total scent of the blood cells of the shrimp, and reverse transcribed into cDNA, according to the Trx gene into the cDNA sequence and the table 3⁄43⁄4 body pCR"T7/NT The characteristics of TOPCfTA were designed as primers Trx-F (5, ~GCTAGCATGTCGTTGCTCGCMGCACACTCATGAGCMCACTGTCCCA-3, underlined with A3⁄4e I restriction sites) and Trx-R (5, -GAAnCGAAGTATTCTTTGCTGCCA-3, underlined for restriction sites) It was thought that PCR amplification was carried out to obtain a gene fragment encoding the mature peptide of i clock.

PCR reaction: 94 Ό denatured 1⁄2 in, 1 cycle; 94 °C denaturation 50 s, 55 ° C annealing 50 s, 72 ° C extension lmin, 35 cycles; 72 ° C extension 10 min, 1 cycle. The PCR product was electrophoresed in 1.2% of the Qiongyi, and the imaging system was photographed and the specific purpose was cut. The target fragment was purified by DM-retraction recovery kit, 3⁄4A pMD18-T vector, and transformed into TOP10F' sense. Wei cells were then screened for positive clones by PCR and assayed for positive.

2) . mme wm says

Insert the nuclear weight column CCTTCTGGATCTTCTAGAGTGCCTCCTACA (SEQ ID NO: 105) encoding a 10-multiple codon amino acid ProSerGlySerSerArgValProProThr (SEQ ID NO: 104) into the _P CRT7 3⁄43⁄43⁄4 body by following the instructions in pCR® T7/NT T0P0® TA Expression Kits. Medium, then Trx recombines the SA3⁄43⁄4 vector. The 3⁄4⁄4⁄4⁄4tetraploid T0P10F' competent cells of the vine were coated with I plate containing ampicillin (100 ug/mL) and cultured overnight, with gene-specific primer Trx-EF and vector primer Reverse T7 promoter (5). '-TAGTTATTGCT book CAGCGGTGG-3 ') screened for transformants. Select positive gram beta lines for sequencing.

3) . Recombination 3⁄43⁄43⁄4 body induced miscellaneous

The correct positive clones were sequenced and transferred into LB liquid medium containing arginine (100 μg/mL), 200 r/min, and cultured overnight at 37 °C. EZ Spin Column Plasmid Mini-Preps Kit The plasmid was extracted and 10n _g plasmid was transformed into 3⁄43⁄4 host strain BL21 (DE3) pLysS sensible cells (with #tt as reference pClf T7/NT T0P0* TA Expression Kits) „ The transformation product was inserted into lOmL LB medium containing 100 μg /mL ampicillin, 34 μg/mL chloramphenicol), 200r/min, cultured overnight at 37 °C.

Take 0.5 mL of the overnight culture solution into 5 mL of mixed sheep in LB medium (containing 100 μg/mLmycin, 34 μg/mL chloramphenicol), 200 r/min, 37 . C culture for 2_3h, when it is 0D600 0· 5~0·8, IPTG with a concentration of 0·1mM at the end of the mouth is further cultured for 6h, sampled every lh, and the collected culture solution is taken every time 500 u Lo Centrifuge at 4 ° C, 12 000 r / min for 2 min, discard the supernatant, then store the slime at -20 ° C, and set aside. Add 600 μ 1 ^ 3⁄4| to the sample, freeze-thaw in liquid nitrogen and 42 ° C water bath, and analyze the supernatant and precipitated proteins by SDS-PAGE after centrifugation, and analyze the 3⁄4⁄4 passage after IPTG induction. As a result, it was found that the protein 3⁄43⁄4 map of the host strain changed, and a protein ship BIO appeared in the ffi of 27 kDa at the ^3⁄4^ about 27kDa. The expression of the recombinant protein constructed by Trx) after 10 multi-codon entangled tags accounted for 42% of the total protein of the whole cell, while the amount of recombinant protein constructed using only Trx proprotein only accounted for the amount of protein Igσ3⁄4.

Correspondingly, ProSerGlySerSerArgValProProThr can be replaced by SEQ ID NO: 106-107; the results indicate that the Truffle of the recombinant Trx protein has a 3 to 5 fold increase.

b) «Add more than 10 multi-codon encoded i«»3⁄4it genes to improve protein efficiency

1 ) . Cloning of the cDNA encoding the mature peptide of Trx gene Cloning and encoding the Trx gene by using the method in the first) of this example

2). Recombination 3⁄43⁄43⁄4

The nucleic acid sequence CCTTCT (3⁄4ATCTTCTAGAGTGCCTCCTACAGGMCA (3⁄4AGTGCTOGCMCAGCATCTCCT (SEQ ID NO: 109)) encoding a 20-codon amino acid ProSerGlySerSerArgValProProThrAlySerPro (SEQ ID NO: 108) was inserted into pCRT7 as described in the pC ® T7/NT T0P0® TA Expression Kits. 3⁄43⁄43⁄4 body, then Trx is heavy «Λ3⁄43⁄43⁄4 body. The facet spoon is loaded with the 7-cell bacillus T0P10F' sense-free cells, coated with LB plate containing ammonia-spermidine (100 ug/mL), cultured overnight, The gene-specific bow Trx-EF and the vector bow | Reverse T7 promoter (5, -TAGTTATTGCTCAGCGGT said GG-3 ') were screened for transformants. Positive gram sequencing. Sampling the method in the first example of this example for recombination «3⁄4 vector into fiH show 3⁄43⁄4, SDS-PAGE analysis of Trx 3⁄43⁄4 changes, found that the use of the start codon inserted into the Λ 列列 column (add 20 multi-codon 13⁄4 resistance after Trx) constitutes the amount of recombinant protein 3⁄4 of the total protein content of the bacteria is 35%, and the recombinant protein constructed using only the Trx proprotein only accounts for 10% of the total bacterial protein.

Correspondingly, ProSerGlySerSerArgValProProThrGlyThrGlyValLeuAlaThrAlaSerPro can be replaced by SEQ ID NO: 110-112; the amount of Trx protein is 1. 5 to 4 times higher. Book

Example 5 Ships in male cells Λ Adding multiple codons Difficult ethers of thrips Target genes enhancing protein «3⁄4 efficiency

1 ) .

According to the full sequence of the vector, a X-inch primer for PEGFP-C Xie sample was designed. The upstream primer was (pEGFP^-S): GACATG-AGTAAAGGAGAAGAAC, downstream primer (pEGFP-CA): GCGTTATTTGTAGAGCTCAT„ Special primer design at pEGFP~ The 216th cleavage site Cla I of the C vector, the upstream primer (pEGFP "C216-F") is: CTCATOGATATGACCATGATTACG, and the downstream primer (pEGFP "C216-R") is: GAGATOGATAGCTGTTTCCTGTG, both upstream and downstream, plus the CTC. Primer that is more efficient than the high-efficiency 3⁄43⁄4ί,, upstream primer F5 (high-efficiency-F): TCTATCGA- TATGGGGGGnCTATGATTAOGCCAAGCTTGCA, containing Cla I restriction site and initiation codon ATG, downstream primer F6 (high efficiency-R): TGCAAGCTTGGCGTAATCATA GMCCCCCCATATCGATAGA, containing Hind III cleavage site; by this primer, three polycodon-encoded acids GlyGlySer can be introduced after the original vector start codon site, and the 3⁄4 ≡ acids have 4, 4, and 6 short codes, respectively.

2) . Efficient 3⁄43⁄4⁄4 body HiglH Puv construction

(pEGFP "C216-F": CTCATOGATATGACCATGATTACG, (pEGFP-C216-R) _: GAGATOGATAGCTGTTTCCTGTG was used as the stalk, and the extracted PEGFP plasmid was used as a template to clone the full length of pEGFP^: and the pEGFP plasmid was detached at position 216. The restriction enzyme site Cla I was added to both ends. The PCR reaction was carried out in a total volume of 50 μl, using 2 μl of pEGFP~C plasmid as a template, and the cycle was started after denaturation at 95 °C for 2 min, and then denatured at 95 °C. 20 s, 42. Annealing at 3 °C for 20 s, extension of lmin for 45 s at 72 °C, denaturation at 95 °C for 20 s after 8 cycles, annealing at 49 °C for 20 s, extension of lmin for 45 s at 72 °C, 30 After one cycle, the linear GFPuv fragment was recovered and purified by agarose gel electrophoresis at 72 °C for 10 min. Using a primer (high efficiency _F): TCTAT0GATATG- GGGGGTTCTATGATTAOGCCMGCTTGCA, primer (high efficiency-R): TGCMGCTTGGOGTAATCATAGAACCCCCCATATOGATAGA, a double-stranded DNA fragment was synthesized by hydrazine synthesis, the reaction bovine was 94 V, 5 min, 53. 1 °C annealing for 5 min, 72 °C extends for 5 min. Qiongyue reclaimed and purified the high-efficiency 3⁄43⁄4ί column. The 3⁄4 DM fragments were constructed into a highly efficient 3⁄4⁄4 vector for the j3⁄4S group. "^FPuv. The neuroma cells were cultured in sputum containing 10% fetal bovine serum, 1 X 12 U/L penicillin, 1 X 10 U/L streptomycin. In the middle culture, the cake was cultured at 37 °C, 53⁄43⁄4, and the fine stalks were observed regularly. The cells were subcultured with 0. 250/0 trypsin every 3 days; the neuroma was finely deleted 0 h before the transfection. After 25% trypsin digestion, inoculate at a density of (3~6) X 10 ⁸ cells/L in a 12-well culture, and add 1 mL of a fine boat suspension to each well, set at 37 ° C, 5% 3⁄4*f Under bovine culture, transfection was performed when the cell confluence reached 80%.

Lipofection reagent Lip _O f _eC tamine2000, GFP expression vector pEGFP "Cl, reference to method Lip _O f _ec tami _ne 2000 transfection kit instructions, associated solution containing 5 h after transfection complex Discard, add the 10% fetal bovine serum containing the amphibian culture, continue to incubate at 37 ° C, 5 said % C cattle. Take the cell separation protein at different time points, the total protein sample obtained SDS-PAGE, it can be seen that at a good amount of about 30 kDa, the heterofluorescent protein was induced to be 3⁄43⁄4, and the amount of sputum in the highly efficient recombinant vector group was significantly higher than that of the control group.

Correspondingly, GlyGlySer can also be replaced by the columns in Examples 1, 2, 3 and 4, and the experimental results show that the amount of the fluorescent protein in the pGFPuv vector is 2 to 6 times higher.

The method for constructing a vector of the present invention can also be used as a method for improving the efficiency of protein loading, and specifically, a nucleotide which is inserted into a cleavage sequence after ATG, which is characterized by:

The specific aminosaline is X1X2...Xn, wherein X represents an amino acid having 4 or more codons, and n is greater than or equal to 3. Specific examples are as follows:

Example 6 Insertion of the target gene 繊 codon λϋ5马三定 Earnings:

a) The start codon of the SOD gene is inserted into the core of the ProSerGly (SEQ ID N0:8) to increase the efficiency of expression of the SOD protein. Among them, Pro, Ser, and Gly have 6, 4, and 4 triplet codons, respectively.

1). Prepare the shrimp blood cell ray and reverse-transcribe into cDNA by using the code of ProSe ly, CCCAGOGGA (SEQ ID NO: 24), and insert the primer according to the shrimp SOD gene. S0D-F1: 5-TAGCTAGC^ 73⁄4XTAGCGGACAGCAGMGCACACC-3 (where GCTAGC % Nhe I cleavage site, ATG is the start codon; CCTAGCGGA is the inserted nuclear ϋ column of ProSerGly) and SOD-R: 5-CGGMnCCTCTATnAGAAGCAGC -3 (GMTTC is &^ / restriction site), the following cell cDNA is used as a template, and the transformation-SOD gene fragment of the S0D gene mature peptide inserted into CCTAGOGGA after PCR is amplified by the 3⁄43⁄4 initial codon. The normal primer S0D-F2 (5'-TAGCTAGCCAGCAGAAGCACACC-3', underlined for the Nhe I restriction site) and S0D-R (5'-CGGAATTCCTC-TATTTAGMGCAGC-3', underlined with the normal amplification of the shrimp S0D gene design, underlined For the EcoR I cleavage site, PCR is performed by cDNA amplification to obtain a normal-SOD gene fragment encoding the mature peptide of the gene.

The -SOD gene fragment and the normal-SOD gene fragment were respectively transformed into a PMD18-T plasmid vector, transformed into T0P10F'-sensing cells, and then positive clones were screened by PCR and sequenced 3⁄4i positive to obtain a positive clone into which the amplified fragment was inserted. The positive clones were expanded and cultured, and the income and reorganization were carried out by Xie Yujian.

2). mmemwm Refer to the pCR® T7/NT TOPOB TA Expression Kits for the pC > T7/ T T0P0® TA 3⁄43⁄4 vector and the SI sequencing 3⁄4i positive 3⁄4it_S0D gene fragment and the normal-SOD gene fragment in step 1) respectively. , constructed recombinant 3⁄43⁄4

The constructive «3⁄4 X. faecalis T0P10F' sense-free cells were plated with LB plates containing ammoniamycin (100 μg/), cultured overnight, and positive clones containing recombinant sputum vectors were determined by sequencing with positive gram. .

3). Recombination 3⁄43⁄43⁄4 body induction load

The correct positive clones identified by 3⁄4± sequencing were transferred to LB liquid medium containing ampicillin (100 ug/mL), 200 r/min, and cultured overnight at 37 ° C. He IJ used EZ Spin Column to describe the Plasmid Mini- The plasmid was extracted from Preps Kit, and the lOng plasmid was transformed into 3⁄43⁄4 host strain BL21 (DE3) pLysS competent cells. The transformed production was caged into 10 mL LB medium (containing 100 y _g / nL ampicillin, 34 g/mL chloramphenicol). Incubate overnight at 37 ° C at 200 r/min.

Take 0.5 mL of the overnight culture solution into 5 mL of mixed sheep in LB medium (containing 100 μg/mLmycin, 34 μg/mL chloramphenicol), 200 r/min, and incubate at 37 ° C to 0D600. When reaching 0·5_0·8, the IPTG of the end of the force is 0. ImM is maintained for 6h after g3⁄4t, and is sampled every lh, taking 500 μί each time. The collected culture broth was centrifuged at 4 ° C, 12 000 r/min for 2 min, the supernatant was discarded, and the slime was stored at -2 (TC standby).

Add 500 y L3⁄4 of the sample to the sample, in liquid nitrogen with 42. Repeated freezing and thawing in the C water bath. He J was analyzed by SDS-PAGE to analyze the expression level of the target protein. The results showed that the recombinant plasmid pC > T7/NT TOP0® TA/S0D containing the DNA fragment encoding the SOD mature peptide was transferred to the 3⁄4«3⁄4 host strain BL21 (DE3) pLysS and was induced by IPTG, and the peptone map of the host strain occurred. With the change, a specific protein appeared at the position of about 24kDa, and BI (H?AD cross-scan system analysis found that the expression of SOD protein containing the recombinant vector of the modified-SOD gene fragment accounted for the total protein of the whole cell. 40% of the amount, while the amount of SOD protein using only the normal-SOD gene fragment vector is only 12% of the amount of bacterial protein, which indicates that the insertion of the S0D gene of the shrimp S0D gene is encoded by ProSerGly (SEQ ID). NO: 8) The nuclear Mff column is larger than the efficiency of the SOD protein.

The nuclear scavenger CCCAG0GGA can also be used with other cores encoding ProSerGly, as listed in SEQ ID NO: 113-140. In the specific operation, the CCCAGCGGA in the S1D-F1 and the S0D-R is respectively obtained by using the nucleotide sequence of SEQ ID NO: 113-140, and the SOD gene is subjected to the steps 1) to 3), SDS-PAGE. Electrophoresis showed a 3 to 5 fold increase in the target protein after 3⁄4it.

Other cores encoding ProSerGly The list of SEQ ID NOs: 113-140 is as follows:

SEQID OS ProSaGly SEQID O:113/SEQIDNO:114 CCCAGCGGT/CCTAGCGGA

CCGAGCGGA

SEQ ID O: 115 / SEQ ID NO: 117 CCAAGCGGA / CCCTCTGGA

SEQ ID O: 118 / SEQ ID NO: 119 CCCAGTGGA / CCCTCGGGA

SEQ ID O: 120 / SEQ ID O: 121 CCCTCAGGA / CCCTCCGGA

SEQ ID NO: 122^EQ IDNO: 123 CCAAGCGGG/ CCATCTGGA

SEQ ID NO: 124/ SEQ ID NO: 125 CCAAGTGGA/CCATCGGGA

SEQ ID NO: 126 / SEQ ID NO: 127 CCATCAGGA / CCATCCGGA

SEQ ID NO: 128 «EQ IDNO: 129 CCTAGCGGG / CCTTCTGGA

SEQ ID NO: 130 / SEQ ID NO: 131 CCTAGTGGA / CCTTCGGGA SEQ ID NO: 132 «EQ IDNO: 133 CCTTCAGGA/CCTTCCGGA

SEQ ID NO: 134 / SEQ ID NO: 135 CCGAGCGGG / CCGTCTGGA

SEQ ID NO: 136 / SEQ ID O: 137 CCGAGTGGG / CCGTCGGGA

SEQ ID NO: 138 «EQ ID O: 139 CCGTCAGGA/CCGTCCGGA

SEQ ID NO: 140 CCCAGCGGG II). SOD gene initiation initiation codon insertion Λ 6 yards 4tk≡1 ^ Temple-listed nuclear column to improve the efficiency of SOD protein

After the initiation of the SOD gene, the nucleoside salary of the Kangma ProSe ly can be increased by 2 to 5 times. E.g,

Listed as a column substitution of SEQ ID NO: 7-21, the corresponding nucleoside M/f column is SEQ ID NO: 22-31 ₀

For example, use AlaLeuArg instead of GlyGlySer's 3⁄4]±程:

1) . g3⁄4 and acquisition of normal SOD fragments

Using the method of this example 1), the column encoding AlaLeuArg can be SEQ ID NO: 1 or SEQ ID NO: 7-21

Instead of the nucleus, the GCACTCAGA (nucleus, which can be replaced by SEQ ID NO: 2-4 or SEQ ID NO: 22-48) inserts the start codon ATG of the λ-inch shrimp SOD gene to obtain the 3⁄4i-S0D gene fragment. The same method was used to obtain the normal-SOD gene fragment; the ±3⁄4 SOD fragments were divided into 3⁄43⁄4A pMD18-T plasmid vector, transformed into T0P10F' sense-free cells, and then the ffi3⁄4 PCR hooves were selected for positive clones and sequenced.

2) . Reorganization 3⁄43⁄43⁄4働建

The recombinant 3⁄43⁄4⁄4 body containing the 3⁄43⁄4_5 (» and normal-SOD gene fragments was constructed by the method of Example 1).

The constructed bacillus bacillus T0P10F' sense-free cells were plated, coated with LB plates containing ammoniamycin (100 μg/), cultured overnight, and positively cloned to determine positive clones containing recombinant «3⁄4 vector. .

3) . Recombination 3⁄43⁄43⁄4 body induction load

Referring to the method of the first embodiment, the recombinant host strain containing the 3⁄4it_S0D and normal-SOD gene fragments was induced by IPTG, and the 3D 43⁄44 line analysis of the target protein was carried out by SDS-PAGE analysis. It was found that the expression level of SOD protein containing the recombinant vector of 3⁄4i -S0D gene fragment accounted for 36% of the total protein of the whole cell, while the amount of SOD protein using the recombinant vector containing only the normal-SOD gene fragment accounted for only 3⁄4 ^ The 13%, which indicates that the insertion of the nuclear coding sequence of AlaLeuArg (GCACTCAGA) after the start codon of the SOD gene in the insects significantly increased the 3⁄4⁄4⁄4⁄4 rate of the SOD protein.

Example 7. Inserting a gene encoding the four 4 ^ sedation » acid after the start codon of the gene of interest to improve protein efficiency

a) SOD gene start codon post-insertion The SerLeuGlyArg nucleus enhances the 3⁄4⁄4 efficiency of SOD protein. Among them, Ser, Leu, Gly, and Arg have 6, 6, 4, and 6 codons, respectively.

1). Put the nucleus, column AGCCT0GGAAGA, insert the initial codon of the SOD gene after ATG

RNA was prepared from shrimp blood cells and reverse transcribed into cD A.

Wo ¹ J uses a silk I S0D-F1 designed according to the shrimp SOD gene: 5-TAGCTAGCATGAGCCT0GGAAGACAGCAG- AAGCACACC-3 The GCTAGC is a Nhe / restriction site, ATG is the start codon; AGCCT0GGAAGA is the inserted nucleic acid sequence encoding SerLeuGlyArg); S0D-R: 5- OGGMTTCCTCTATTTAGMGCAGC-3 (GMTTC is &ο/? / restriction site), The cDNA was amplified by PCR to obtain a gene fragment of the 3⁄48-derived mature peptide inserted into the core»column AGCCTCGGAAGA after the start codon. Wo" uses the normal amplified pre-primer SOD-F2 (5'-TAGCTAGCCAGCAGAAGCACACC-3, underlined as Nhe I restriction site) and S0D-R designed according to the shrimp SOD gene.

(5'-0GGMTTC CTCTATTTAGAAGCAGC-3', underlined for the EcoR I restriction site) PCR amplification with cD A as the model, and the gene fragment encoding the mature peptide of i clock was obtained.

The PCR product was electrophoresed in 1.2% of the Qiong earning, and the nucleus was photographed, and the specific target DNA was cut and recovered. The purified target fragment was ligated into the PM to express the D18-T plasmid vector. T0P10F' competent cells were then screened for positive clones and tested positively.

2) . m mm

The recombinant expression vector was constructed by following the instructions in the pCR® T7/NT T0P0B TA Expression Kits, the plasmid containing the pC > T7/ T TPO0® TA expression vector and the recovered gene fragment containing the SOD gene mature peptide. The constructed expression vector was transformed into E. coli T0P10F' sense-free cells, and the L-book B plate containing ampicillin (100 _{y &} mL) was coated and cultured overnight. ^ Positive gram β-sequence was determined to contain recombinant «3⁄43⁄4 body Positive clone.

3) . Recombination 3⁄43⁄43⁄4 body induction load

The positive clones identified by δ! sequencing were transferred to LB liquid medium containing ammonia (100 g/mL) and cultured overnight.禾I" using EZ Spin Column Plasmid Mini-Preps Kit | 3⁄43⁄4 granules, 10 ng plasmid was transformed into 3⁄43⁄4 host bacteria BL21 (DE3) pLysS sensitized cells (with #S for reference pC > T7/ T T0P0® TA Expression Kits) . The transformed product was introduced into 10 mL of LB medium (containing 100 w g/nL ampicillin, 34 u g/mL chloramphenicol), 200 r/min, and cultured overnight at 37 °C.

Take 0.5 mL of the overnight culture solution into 5 mL of mixed sheep in LB medium (containing 100 μg/mLmycin, 34 μg/mL chloramphenicol), 200 r/min, and culture at 37 ° C to 0D600. When the concentration reaches 0·5_0·8, the IPTG of the end of the force is 0. ImM is maintained for 3h, and is sampled every lh. The culture medium collected at 500 u Lo each time is 4 ° C, 12 , 000 r/min »T3⁄4^ 2min, discard the supernatant, then store the slime at - 20 ° C for later use.

Add 500 spikes to the sample for secondary treatment, in liquid nitrogen with 42. Repeated freezing and thawing in the C water bath. The analysis of the target protein by SDS-PAGE 3⁄4^i/ showed that the recombinant plasmid containing the DA fragment encoding the SOD mature peptide pC > T7/NT T0P0® TA/ S0D to 3⁄43⁄43⁄4 host strain BL21 (DE3) pLysS After sensing the cells and inducing with IPTG, the protein map of the host strain changed, and a specific protein appeared at the position of about 24kDa, which was analyzed by the "reversal scan system". The amount of recombinant protein constructed by the post-insertion sequencer accounted for 40% of the total amount of the total bacterial protein, while the amount of the recombinant protein constructed using only the original sequence containing the SOD accounted for only 13% of the amount of the bacterial protein.

b) 3⁄43⁄4 inch shrimp S0D gene insertion after the codon is inserted into the core of the ThrArgProAla (which can be replaced by the sequence of SEQ ID NO: 53-64) to increase the efficiency of the SOD protein.

1). The code T3⁄4rArgProAla (the SMi^ column can be replaced by SEQ ID N0: 53~64) is paid by ACMGACC0GCA (this The nucleic acid sequence corresponding to SEQ ID NO: 65-88 can be inserted into the start codon ATG of the shrimp SOD gene to prepare shrimp blood cell RNA and reverse transcribed into cDNA.

Wo ¹ J uses primer S0D-F1 designed according to the shrimp SOD gene: 5- TAGCTAGCATGH I^m^/CAGCAGMGCACACC-3 (the obliquely underlined core lli column can be replaced by SEQ ID NO: 65-88); SOD- : 5~ 0GGMnCCTCTATTTAGMGCAGC- 3 (GAAHC is EcoR / restriction site), m±PCR amplification of cDNA was obtained into lj3⁄4^ codon and inserted into the nucleus, and the gene fragment of the mature peptide of AGCCT0GGMGA was listed. The normal primer S0D-F2 (5, -TAGCTAGCCAGCAGMGCACACC-3 ', underlined as Nhe I restriction site) and S0D-R (5, -QGGMTTCCTCTATT TAGAAGCAGC-3', underlined using the normal amplified primer designed according to the shrimp SOD gene The site was digested with EcoR I. The cDNA was amplified by cDNA and a gene fragment encoding the mature peptide of the gene was obtained.

PCR reaction M/3⁄4 Denaturation at 94 °C 1⁄2iin, 1 cycle; Denaturation at 94 °C for 50s, annealing at 55 °C for 50s, extension at 72°C for 1min, 35 cycles; extension at 72°C for 10min, 1 cycle. The PCR product was electrophoresed in 1.2% of the Qiongyue sputum, and the Sl-class imaging system was photographed and then cut for specific purposes. The target fragment was purified by DNA-crossing recovery kit, 3⁄4A pMD18-T plasmid vector, and transformed into TOP10F' Competent cells were then screened for positive clones by PCR and tested for miscellaneous. Book

2) . Restructuring

The recombinant expression vector was constructed by following the instructions in the pCR® T7/NT T0P0® TA Expression Kits, the pC > T7/ T T0P0® TA expression vector and the recovered gene fragment containing the SOD gene mature peptide. The constructed expression vector was transformed into E. coli T0P10F' sensitized cells, and LB plate containing ampicillin (100 ug/mL) was applied and cultured overnight. The positive gram was tested with the recombinant sputum. Positive clone.

3) . Recombination 3⁄43⁄4⁄4 body induction 3⁄43⁄4

The correct positive clones identified by δ! sequencing were transferred to LB liquid medium containing aminomycin (100 μg/niL), cultured at 200 r/min, 37 V overnight. Adding a 10 ng plasmid to transform the host strain BL21 (DE3) pLysS sense-free cells (with lateral reference pC > T7/NT T0P0® TA Expression Kits). The transformed product was introduced into 10 mL of LB medium (containing 100 w/mL ammonia, penicillin, 34 g/mL chloramphenicol), 00r/min, 37. C was cultured overnight.

Take 0.5 mL of the overnight culture solution into 5 mL of mixed sheep in LB medium (containing 100 μg/mLmycin, 34 μg/mL chloramphenicol), 200 r/min, and culture at 37 ° C to 0D600. When reaching 0·5_0·8, the IPTG of the end of the force is 0. ImM is maintained for 6h, and is sampled every lh. Each time 500 Lo is taken, the collected nights are respectively at 4 ° C, 12, Centrifuge for 2 min at 000 r/min, discard the supernatant, and then store the slime at - 20 ° C for later use.

The sample was treated with 500 y L cracking night, and repeatedly frozen and thawed in liquid nitrogen and 42 ° C water bath.

The SJ-PAGE analysis of the target protein by SDS-PAGE showed that the amount of the recombinant protein constructed by inserting the A sequence with the start codon was 3⁄4 ^ The total amount of the total protein was 26 Between % and 48, the recombinant protein constructed with only the original sequence of SOD was used as a 3⁄4⁄4⁄4% of the amount of the protein.

The reagents and materials of the present invention: bow kiss synthesized by Shanghai Bioengineering Co., Ltd.; PCR cymbal pMD18_T, restriction Endonuclease, Taq enzyme, Lianjun were purchased from Bao Bioengineering Co., Ltd., IPTG, etc. were purchased from Shanghai Bioengineering Co., Ltd., and the original nuclear 3⁄43⁄4# pCR® T7/NT TOPO® TA and pEGFP, pGFPuv were purchased from Clontech. Ε· coli DH5 a Roots Biochemical Technology (Beijing) Co., Ltd.

l k practicality

Wo|J uses the method of the advancement of the gene peptone efficiency of the present invention, and the target gene can be efficiently realized by simply performing the target gene or vector, and the vector with high efficiency characteristics can be constructed. Compared with the prior art, the method of the invention can increase the efficiency of the protein of any gene of interest by more than 2 times, or the carrier of the existing protein 3⁄4⁄4 carrier, thereby increasing the efficiency of the protein 3⁄4⁄4 by more than 2 times. A simple and easy-to-use method will play an important role in the regulation of genes, protein clocks, and so on.

Book

Claims

Claim

An expression vector for increasing the efficiency of protein expression, the expression vector start codon ATG comprising a nucleotide encoding a specific amino acid fragment, characterized in that:

(a) the specific amino acid described above is an amino acid having four or more codons;

(b) The number of amino acid residues of the above specific amino acid fragment is not less than three.

The expression vector according to claim 1, wherein the amino acid fragment has the number of amino acid residues of three.

The expression vector according to claim 1, wherein the amino acid fragment has the number of amino acid residues of four.

The expression vector according to claim 1, wherein the amino acid fragment has the number of amino acid residues of five.

The expression vector according to claim 1, wherein the amino acid amino acid fragment has a number of amino acid residues of 6 or more.

The expression vector according to claim 2, wherein the amino acid fragment has the sequence of any one of SEQ ID NO: 1 or SEQ ID NO: 7-21.

The expression vector according to claim 3, wherein the amino acid fragment has the sequence of any one of SEQ ID NO: 49 or SEQ ID NO: 53-64.

The expression vector according to claim 4, wherein the amino acid fragment has the sequence of any one of SEQ ID NO: 89 or SEQ ID NO: 91-93.

The expression vector according to claim 5, wherein the amino acid fragment has the sequence of SEQ ID NO: 94. SEQ ID NO: 96-99, SEQ ID NO: 101-104, SEQ ID NO: 106- 108 or any one of SEQ ID NOs: 110-112.

The expression vector according to claim 2, wherein the amino acid fragment has a nucleotide sequence of SEQ ID NO: 2-6, SEQ ID NO: 22-48 or SEQ ID NO: 113- Any of 140.

The expression vector according to claim 3, wherein the amino acid fragment has a nucleotide sequence of SEQ ID NO: 50-52 or SEQ ID NO: 65-88.

The expression vector according to claim 4, wherein the amino acid fragment has a nucleotide sequence of SEQ ID NO: 90.

The expression vector according to claim 5, characterized in that the amino acid fragment has a nucleotide sequence of SEQ ID NO: 95, SEQ ID NO: 100, SEQ ID NO: 105 or SEQ ID NO: 109. Any of them.

The expression vector according to any one of claims 1 to 13, wherein the expression vector is a prokaryotic expression vector or a eukaryotic expression vector.

1 Claim

A method for increasing the efficiency of expression of a protein of interest by inserting a nucleotide encoding a specific amino acid fragment after the initiation codon ATG of the gene of interest, characterized in that:

The method according to claim 15, wherein the amino acid sequence has three amino acid numbers.

The method according to claim 15, wherein the amino acid fragment has the number of amino acid residues of four.

18. The method of claim 15 wherein said amino acid fragment has from 5 to 7 amino acid residues.

19. The method of claim 15 wherein the sequence of the amino acid fragment is SEQ ID NO: 1, SEQ ID NO: 7-21, SEQ ID NO: 49, SEQ ID NO: 53-64, SEQ ID NO: 89, SEQ ID NO: 91-94, SEQ ID NO: 96-99, SEQ ID NO: 101-104 or SEQ ID NO: 106-112.

20. The method according to claim 15, wherein said amino acid fragment has a nucleotide sequence of SEQ ID NO: 2-6, SEQ ID NO: 22-48, and SEQ ID NO: 50-52. SEQ ID NO: 65-88, SEQ ID NO: 90, SEQ ID NO: 95, SEQ ID NO: 100, SEQ ID NO: 105, SEQ ID NO: 109 or SEQ ID NO: 113-140 .

2