WO2012070795A2 - Ipomoea batatas-derived ibor-ins gene mutation, and use thereof - Google Patents

Abstract

The present invention relates to a method for producing: an IbOr-Ins gene mutation in which a certain sequence is artificially inserted into an Ipomoea batatas-derived IbOrange gene; a recombinant vector including the gene mutation; a host cell mutated by the recombinant vector; and a transformed plant body that has an improved carotenoid content and resistance to saline stress by means of the mutation of the recombinant vector in a plant cell. The present invention also relates to a method for producing a transformed plant body having increased resistance to saline stress using the transformed plant body or seeds thereof produced by the above method and having an improved carotenoid content and resistance to saline stress, and using an Ipomoea batatas-derived IbOrange gene. The invention also relates to a transformed plant body produced by the above method and having increased resistance to saline stress, and to the seeds thereof.

Description

Sweet potato-derived IvOr-kinase gene variants and uses thereof

The present invention relates to IbOr-Ins gene variants derived from sweet potatoes and their use, and more particularly to IbOr-Ins gene variants in which IbOrange genes are artificially inserted into IbOrange genes derived from sweet potatoes ( Ipomoea batatas ). Recombinant vector comprising, a host cell transformed with the recombinant vector, a method for producing a transformed plant having a high carotenoid content or salt stress resistance by transforming the recombinant vector into plant cells, the carotenoid content produced by the method or Transformed Plants with Increased Salt Stress Tolerance and Seeds thereof, Methods for Producing Transgenic Plants with Increased Salt Stress Resistance Using IbOrange Gene from Sweet Potato ( Ipomoea batatas ) To converting plants and their seeds.

Sweet potato ( Ipomoea batatas L. Lam) can be grown on relatively poor lands and is a representative root crop used for food and livestock feed with a yield of about 30 tonnes per hectare. Colored sweet potatoes, such as purple and yellow, contain various antioxidants, especially yellowish yellow sweet potatoes contain 14.7-20 mg / 100 g of beta-carotene, and purple sweet potatoes contain 2.28 g / 100 g of anthocyanin. It is an antioxidant that promotes aging and removes free radicals that cause various adult diseases. In addition, since the 1990s, sweet potato has been transformed by co-culturing Agrobacterium , and has developed a plant regeneration system by inducing embryogenic culture cells and somatic embryogenesis from apical and temporal meristems (Lim). et al. Mol Breeding 19, 227-239, 2007). However, no sweet potatoes have been reported that produce high molecular weight antioxidants such as carotenoids, anthocyanins and polyphenols. Therefore, the development of crops with complex stress tolerance and high production of low molecular weight antioxidants could contribute to solving the food, energy and environmental problems faced by humans in the 21st century.

The World Health Organization (WHO) has announced that more than 100 million children worldwide suffer from a lack of vitamin A, which causes more than half a million children to lose sight each year. Beta-carotene is a precursor of vitamin A, and has the physiologically active functions of nutrient enhancers and food supplements. Therefore, metabolic engineering studies on carotenoid accumulation in foods are essential subjects for enhancing nutritional value. Through these efforts, research is being conducted to increase the nutritional value of crops by applying molecular biological and metabolic engineering of carotenoid metabolic pathway related genes.

Carotenoids are substances with high antioxidant activity and are known to play an important role not only in physiological activity but also in the defense mechanism against oxidative stress of the plant itself. Recently, carotenoid biosynthesis is influenced by Abs acid (ABA), one of the plant hormones. As it turned out, the need for research on these antioxidants and environmental stresses emerged. In many parts of the world, the high salinity of the soil has resulted in loss of crop yields of up to 70% or the inability to cultivate barren land. Therefore, the development of flame resistant varieties has emerged as an immediate problem to be solved urgently.

Korean Patent No. 10-0813284 discloses a method of increasing the content of carotenoids by transforming a plant-derived phytoene biosynthetic enzyme gene from citrus fruits, and Korean Patent Publication No. 2010-0100097 discloses a sweet potato-derived MuS1 gene in plants. Methods of increasing salt stress tolerance by transformation are disclosed.

The present invention is derived from the above requirements, the present inventors are carotenoid content and salt stress resistance in plants transformed with sweet potato-derived IbOrange gene and IbOr-Ins gene variant that artificially inserted a specific sequence into the gene By confirming the increase of the present invention was completed.

In order to solve the above problems, the present invention provides an IbOr-Ins gene variant in which a specific sequence is artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ).

The present invention also provides a recombinant vector comprising the genetic variant.

The present invention also provides a host cell transformed with the recombinant vector.

In addition, the present invention provides a method for producing a transformed plant having a carotenoid content or salt stress resistance is increased by transforming the recombinant vector into plant cells.

The present invention also provides a transgenic plant and its seed having increased carotenoid content or salt stress resistance produced by the above method.

In addition, the present invention provides a method for producing a transgenic plant having increased salt stress resistance using IbOrange gene derived from sweet potato ( Ipomoea batatas ).

The present invention also provides a transgenic plant with increased salt stress tolerance produced by the above method and its seeds.

In another aspect, the present invention provides a composition for increasing the carotenoid content or salt stress resistance of plants, including IbOr-Ins gene variants in which a specific sequence is artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ).

In addition, the present invention provides a composition for increasing salt stress resistance of plants, including IbOrange gene derived from sweet potato ( Ipomoea batatas ).

According to the present invention, carotenoid content and salt stress resistance were increased in plant cells transformed with IbOrange gene and IbOr-Ins gene variant, which was more effective in IbOr-Ins transformants. Therefore, the use of the IbOrange gene and the IbOr-Ins gene variant of the present invention is expected to be able to develop transgenic plants that are resistant to salt stress as well as functional enhancement.

Figure 1 shows the nucleotide sequence of the IbOr-Ins gene artificially mutated by using IbOrange derived from sweet potato (breed yellow rice), and the amino acid sequence inferred therefrom. The boxed part is inserted with a specific sequence that makes -KSQNPNL- amino acid different from the existing IbOrange, and a total of 924 bp cDNA encodes 307 amino acids.

Figure 2 compares and confirms the amino acid sequence of sweet potato-derived IbOrange and the amino acid sequence of IbOr-Ins. The boxed part shows the difference.

Figure 3 shows the plant expression vector of sweet potato derived IbOrange gene and IbOr-Ins gene.

Figure 4 shows the yellow phenotype of sweet potato-derived IbOrange gene and IbOr-Ins gene-transformed sweet potato culture cells due to increased carotenoid content.

5 is a result of analyzing the carotenoid content such as beta carotene through the HPLC analysis of the transformed culture cells.

FIG. 6 shows the results of RT-PCR and electrophoresis of the expression patterns of carotenoid biosynthetic pathways in sweet potato-derived IbOrange gene and IbOr-Ins transgenic sweet potato cultured cells. FIG.

FIG. 7 shows the sweet potato cultured cells transformed with sweet potato-derived IbOrange gene and IbOr-Ins gene, treated with 150 and 200 mM of NaCl, and then subjected to DAB staining of the cultured cells (top) and oxidative stress received by the cultured cells. (Below).

8 is a result of measuring the beta carotene content in the seed phenotype (top) and leaves of Arabidopsis transformed with sweet potato-derived IbOrange gene and IbOr-Ins gene using a spectrophotometer (below). WT: Wild type ( Col-0 ).

9 shows the results of RT-PCR and electrophoresis of the expression patterns of carotenoid biosynthesis-related genes, Arabidopsis Orange gene and IbOrange gene in Arabidopsis transformed with sweet potato-derived IbOrange gene and IbOr-Ins gene.

10 shows the results of RT-PCR and electrophoresis of the expression patterns of NCED, one of the stress-inducing genes, in Arabidopsis transformed with IbOrange and IbOr-Ins genes.

FIG. 11 shows germination rates in media treated with 0, 50, 100 and 150 mM NaCl in Arabidopsis transgenic IbOrange and IbOr-Ins genes.

Figure 12 shows the bioweight of wild type and IbOrange and IbOr-Ins transgenic Arabidopsis control group treated with various concentrations of NaCl.

FIG. 13 compares the Arabidopsis transformed with IbOrange and IbOr-Ins genes under the 100 mM NaCl condition, and the root phenotype of the control wild type.

Figure 14 shows the results of measuring the relative moisture content of the Arabidopsis transformed IbOrange and IbOr-Ins genes and the wild type control group at 150 mM NaCl conditions.

In order to achieve the object of the present invention, the present invention provides an IbOr-Ins gene variant consisting of a nucleotide sequence of SEQ ID NO: 2 artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ). In the present invention, the IbOr-Ins gene variant was prepared by inserting the KSQNPNL amino acid, but is not particularly limited as long as it is a variant capable of increasing carotenoid content or increasing flame resistance.

The present invention also provides a recombinant vector comprising the genetic variant.

The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes are modified and reintroduced into cells by artificial means.

In the present invention, the IbOr-Ins gene variant sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. In principle, any plasmid and vector can be used as long as it can replicate and stabilize in the host. An important feature of the expression vector is that it has a origin of replication, a promoter, a marker gene and a translation control element.

Expression vectors comprising an IbOr-Ins protein-encoding DNA sequence and appropriate transcriptional / translational control signals can be constructed by methods well known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to a suitable promoter in the expression vector to drive mRNA synthesis. Expression vectors may also include ribosomal binding sites and transcription terminators as translation initiation sites.

Preferred examples of recombinant vectors of the invention are Ti-plasmid vectors capable of transferring part of themselves, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences to protoplasts from which plant cells or new plants can be produced which properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors, such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. Resistance genes include, but are not limited to.

In the recombinant vector of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the possibility of selection.

In the recombinant vectors of the present invention, conventional terminators can be used, for example nopalin synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens) Terminator of the octopine gene, but is not limited thereto. With regard to the need for terminators, such regions are generally known to increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

The present invention also provides a host cell transformed with the recombinant vector of the present invention. A host cell capable of continuously cloning and expressing the vector of the present invention in a prokaryotic cell while being stable can be used in any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1. , Bacillus genus strains, such as E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcensons, and various Pseudomonas Enterobacteria such as species and strains.

In addition, when transforming the vector of the present invention into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293) as host cells. , HepG2, 3T3, RIN and MDCK cell lines) and plant cells and the like can be used. The host cell is preferably a plant cell.

The method of carrying the vector of the present invention into a host cell is performed by using the CaCl ₂ method or one method (Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)) when the host cell is a prokaryotic cell. And the electroporation method. In addition, when the host cell is a eukaryotic cell, the vector may be injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, gene bombardment, or the like. Can be.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), (DNA or RNA-coated) particle bombardment of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumulopasis by plant infiltration or transformation of mature pollen or vesicles And infection with (incomplete) virus (EP 0 301 316) in en mediated gene transfer. Preferred methods according to the invention include Agrobacterium mediated DNA delivery. Especially preferred is the use of the so-called binary vector technology as described in EP A 120 516 and US Pat. No. 4,940,838.

The present invention also provides a method for producing a transgenic plant having an increased carotenoid content, comprising overexpressing the IbOr-Ins gene variant by transforming the recombinant vector of the present invention into plant cells.

The present invention also provides a transgenic plant with increased carotenoid content produced by the above method and its seeds. The plant may be a dicotyledonous plant, but is not limited thereto.

The dicotyledonous plants are Asteraceae (Dolaceae, Diapensiaceae), Asteraceae (Clethraceae), Pyrolaceae, Ericaceae, Myrsinaceae, Primaceae (Primulaceae), Plumbaginaceae, Persimmonaceae (Ebenaceae) , Styracaceae, Stink bug, Symplocaceae, Ash (Oleaceae), Loganiaceae, Gentianaceae, Menyanthaceae, Oleaceae, Apocynaceae , Asclepiadaceae, Rubiaceae, Polemoniaceae, Convolvulaceae, Boraginaceae, Verbenaceae, Labiatae, Solanaceae, Scrophulariaceae , Bignoniaceae, Acanthaceae, Sesame (Pedaliaceae), Fructose (Orobanchaceae). Gesneriaceae, Lentibulariaceae, Phrymaceae, Plantaginaceae, Caprifoliaceae, (Perox Adoxaceae), Valerianaceae, Dipsacaceae, Campanaceae ( Campanulaceae, Compositae, Myricaceae, Sapaceae, Juglandaceae, Salicaceae, Birchaceae, Beechaceae, Fagaceae, Elmaceae, Moraceae , Urticaceae, Santalaceae, Mistletoe, Lothanthaceae, Polygonaceae, Landaceae, Phytolaccaceae, Nyctaginaceae, Pomegranate, Azizaceae (Portulacaceae), Caryophyllaceae, Chinopodiaceae, Amaranthaceae, Cactaceae, Magnoliaceae, Illiciaceae, Lauraceae, Cassia family, Cecidiphyllaceae, Ranunculus eae), Berberidaceae, Lardizabalaceae, Bird breeze (Mentaceae, Menispermaceae), Nymphaeaceae, Ceratophyllaceae, Cabombaceae, Saururaceae , Piperaceae, Chloranthaceae, Aristolochiaceae, Actinidiaceae, Camellia, Theaceae, Guttaiferae, Droseraceae, Papaveraceae ), Capparidaceae, Cruciferaceae (Mustaceae, Cruciferae), Planeaceae (Plataceae, Platanaceae), Verruaceae, Hamamelidaceae, Pheasant (Snaphaceae, Crassulaceae), Panaxaceae (Saxifragaceae) Eucommiaceae, Pittosporaceae, Rosaceae, Leguminosae, Oxalidaceae, Geraniaceae, Tropaeolaceae, Zygophyllaceae, Linaceae Euphorbiaceae), star moss (Callitrichaceae), Rutaceae, Simaroubaceae, Meliaceae, Polygalaceae, Anacardiaceae, Mapleaceae, Aceraceae, Sapindaceae, Mapleaceae Hippocastanaceae, Sabiaceae, Balsam, Balsaminaceae, Aquifoliaceae, Nova, Celastraceae, Staphyleaceae, Buxaceae, Empetraceae, Rhamnaceae, Vitaceae, Elaeocarpaceae, Tiliaceae, Malvaceae, Sterculiaceae, Adenaceae, Thymelaeaceae, Eraeagnaceae (Flacourtiaceae), Violaceae, Passifloraceae, Tamaricanaceae, Elatinaceae, Begoniaceae, Cucurbitaceae, Buddha (Lythraceae), Pomegranate Punica ceae), Onnagraceae, Haloragaceae, Bataceae (Alangiaceae), Dogwood (Hornaceae, Cornaceae), Arboraceae (Agaraceae) or Umbelliferae (Apiaceae) It may be, but is not limited thereto.

The present invention also provides a method for producing a transformed plant having increased salt stress resistance, comprising the step of transforming the recombinant vector of the present invention into plant cells, overexpressing the IbOr-Ins gene variant.

The present invention also provides a transgenic plant with increased salt stress tolerance produced by the above method and its seeds. The plant may be a dicotyledonous plant, but is not limited thereto. The dicotyledonous plants are as described above.

In addition, the present invention is to increase the salt stress resistance comprising the step of overexpressing the IbOrange gene by transforming the plant cell with a recombinant vector comprising the IbOrange gene from sweet potato ( Ipomoea batatas) consisting of the nucleotide sequence of SEQ ID NO: 1 Provided are methods for producing a transgenic plant.

The present invention also provides a transgenic plant with increased salt stress tolerance produced by the above method and its seeds. The plant may be a dicotyledonous plant, but is not limited thereto. The dicotyledonous plants are as described above.

In another aspect, the present invention provides a composition for increasing the carotenoid content of the plant, comprising the IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas) consisting of the nucleotide sequence of SEQ ID NO: 2 do. The composition of the present invention comprises an IbOr-Ins gene variant consisting of the nucleotide sequence of SEQ ID NO: 2 as an active ingredient, by increasing the carotenoid content of the plant by transforming the gene variant in the plant.

In addition, the present invention comprises a nucleotide sequence of SEQ ID NO: 2, comprising a IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas), a composition for increasing salt stress resistance of plants to provide. The composition of the present invention comprises an IbOr-Ins gene variant consisting of the nucleotide sequence of SEQ ID NO: 2 as an active ingredient, it is possible to increase the salt stress resistance of the plant by transforming the gene variant in the plant.

In another aspect, the present invention provides a composition for increasing salt stress resistance of plants, comprising the IbOrange gene derived from sweet potato ( Ipomoea batatas) consisting of the nucleotide sequence of SEQ ID NO: 1. The composition of the present invention comprises an IbOrange gene consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, by increasing the salt stress resistance of the plant by transforming the gene variant in the plant.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1 Cloning and Sequence Analysis of IbOr-Ins Genes

PCR primers were prepared for cloning the Orange gene in sweet potatoes and the primer sequence was as follows: forward primer (5'-atggtatattcaggtagaatcttgtcgctc-3 '; SEQ ID NO: 3) and reverse primer (5'-ttaatcaaatgggtcaattcgtgggtcatg-3'; SEQ ID NO: 4 ). The IbOr obtained therefrom was subjected to overlapping PCR with a template to carry out an artificial mutation of a specific nucleotide sequence of IbOr. PCR primers were prepared to insert nucleotide sequences estimated to be -KSQNPNL- from amino acid 133 in the amino acid sequence of the IbOrange gene, and the primer sequences used were as follows: forward primer (5'- gaaaagcaagaaaataaacttaa atcccagaaccctaac -3 '; Number 5) and reverse primer (5′-aagatttgcggatgtcaggtt agggttctgggatttaag-3 ′; SEQ ID NO: 6). As a result, a PCR product of about 921bp was obtained and cloned into pGEM-T-vector, and sequencing confirmed the mutation inserted into amino acid number 133 through -KSQNPNL- (FIG. 1). PCR was performed using Clonetech's advantage2 polymerase, and the PCR product of the expected size was cloned using pGEMeasy cloning vector (Promega), followed by sequencing to confirm the entire nucleotide sequence. The cDNA gene was named IbOr-Ins. The total length of the IbOr-Ins gene of the present invention is that 924 bp cDNA encodes 307 amino acids (FIG. 1). The isoelectric point (pI) and molecular weight (Mw) predicted by the amino acid sequence are 8.45 and 33.74 kDa, respectively.

In order to use the gateway expression system of Invitrogen, the nucleotide sequence of the primer was added with an adapter sequence (upper case) at the 5 'end of the primer. The base sequences are forward primers (5'- CAAAAAAGCAGGCTNN a tggtatattcaggtagaatcttgtcgctc-3 '; SEQ ID NO: 7) and reverse primers (5'- CAAGAAAGCTGGGTN ttaatcaaatgggtcaattcgtgggtcatg-3'; SEQ ID NO: 8). First, the PCR product of the expected size was cloned using a pGEMeasy cloning vector (Promega), followed by sequencing to confirm the entire sequence. The cDNA gene was named IbOr-Ins. Two pGEMeasy vectors, each of which had cloned IbOrange gene and IbOr-Ins gene, were cloned BP and cloned into pDONR207 vector. Then, plant expression vectors of IbOrange and IbOr-Ins genes cloned by pDONR207 and pGWB11 vectors, which are plant expression vectors, were subjected to LR reactions (FIG. 3).

Example 2: IbOrange and IbOr-Ins Transgenic Sweet Potato Cultured Cell Phenotyping

Yukmi cultured cells, which are off-white sweet potatoes, were transformed through Agrobacterium mediated transformation of the plant expression vector of FIG. 3. As a result, in the case of Yumi, which is a non-transformant, there was no change in off-white color, whereas in IbOrange and IbOr-Ins transformed culture cells, the color was dark yellow, and in particular, IbOr-Ins was darker. 4).

Example 3: Analysis of Carotenoid Content in Sweet Potato Cultured Cells Transformed with IbOrange and IbOr-Ins Vectors

The phenotypes of sweet potato cultured cells transformed with IbOrange and IbOr-Ins vectors showed off-white color for Yumi, a non-transformed cultured cell, whereas dark yellow for cultured cells transformed with IbOrange and IbOr-Ins. Phenotype is shown (FIG. 4). In fact, the carotenoid content of each transformed sweet potato cultured cell was quantified by HPLC analysis. As a result, the total carotenoid content of IbOrange cultured cells increased more than four times than that of Yulmi cultured cells, and about 13 times more than that of IbOr-Ins. In particular, in the case of beta carotene, IbOrange cultured cells increased about 4 times more than Yumi cultured cells, and IbOr-Ins increased 10 times or more. In addition, compared to IbOrange cultured cells, IbOr-Ins cultured cells increased the total carotenoid more than three times, and beta-carotene more than two times increased (Fig. 5).

Example 4: Analysis of carotenoid biosynthesis related genes and IbOrange gene expression

Two sweet potato transformed culture cells including Yumi were analyzed for carotenoid biosynthesis-related genes and IbOrange genes by RT-PCR. The base sequences of the primers used in the analysis were forward (5'-atcttgtcgctctcgtcctccacgacg ccg-3 '; SEQ ID NO: 9) and reverse (5'-cgtgggtcatgctcgcttgccatagccatc-3'; SEQ ID NO: 10). As a result, in the case of Yumi, the expression of carotenoid biosynthesis related genes except for PSY and CHY-β was very weak or not expressed, and IbOrange transgenic cultured cells were hardly expressed. However, in IbOr-Ins transformed cells, expression of almost all genes except IbOrange gene showed similar expression pattern. But in IbOr-Ins transgenic cells, not only the IbOrange gene,LCY-β,CHY-β It was found that the expression was higher than Yumi and IbOrange transgenic culture cells (FIG. 6).

Example 5: Salt Stress Tolerance Analysis in IbOrange and IbOr-Ins Transgenic Sweet Potato Cultured Cells

DAB (3 ', 3-diaminobenzidine) combines with intracellular H ₂ O ₂ to form a brown precipitate, the higher the oxidative stress, the browner the cells appear. After immersion of IbOrange and IbOr-Ins transformed sweet potato cultured cells in MS1D liquid medium containing 150 and 200 mM NaCl for 24 hours, oxidative stress received by the cultured cells was observed through DAB staining. As a result, in the case of Yulmi, the degree of brown was severe as NaCl concentration increased, and the absorbance of DAB solution at 460 nm showed high oxidative stress, but IbOrange and IbOr-Ins transformed sweet potato cultured cells showed low oxidative stress. (FIG. 7). It was confirmed that IbOrange and IbOr-Ins transformed sweet potato cultured cells show resistance to NaCl.

Example 6: IbOrange and IbOr-Ins Transgenic Arabidopsis Assays

Seed phenotypes of Arabidopsis transformed with IbOrange and IbOr-Ins vectors were observed. As a result, it was confirmed that the transformants had a yellow bell color than the wild type (Col-0), which is a non-transformant (FIG. 8).

In order to determine whether the carotenoid content changes in IbOrange and IbOr-Ins transgenic Arabidopsis, the beta-carotene content in the leaf tissues of two transgenic Arabidopsis plants was measured at spectrophotometer at absorbance of 440 nm. As a result, the control wild type and IbOrange transgenic Arabidopsis showed no significant difference, while the IbOr-Ins transgenic Arabidopsis showed an increased beta-carotene content of about 1.5 times (Fig. 8). However, in order to measure more accurate carotenoid content, it is necessary to compare tissues that function as sinks.

In addition, as a result of confirming the expression pattern of carotenoid biosynthesis genes in these transformants through RT-PCR, there was no significant change in the expression of the existing carotenoid biosynthesis gene and Arabidopsis original orange gene. However, the expression of the inserted IbOrange was expressed only in the transformants and not in the control wild type. This confirmed that the primer used in the present invention is specific to sweet potatoes (FIG. 9).

Example 7: Analysis of Stress Inducible Gene NCED Expression in IbOrange and IbOr-Ins Transgenic Arabidopsis

The prolonged carotenoid biosynthesis pathway synthesizes a typical plant hormone, Apsis acid, which plays an important role in overcoming dry and cold stress as well as one of the important hormones for plant development such as seed germination, dormancy and seedling growth. In the present invention, the expression of NCED was analyzed in order to determine whether abscitic acid is induced by increased carotenoid content in IbOrange transgenic Arabidopsis plants. In Arabidopsis, NCED has been reported with nine families and increased expression of abscidic acid content and stress (Rodrigo et al., 2006). RT-PCR showed high expression of NCED1 in all three transformants and the control group. However, NCED3, NCED6 and NCED4 showed higher expression patterns in IbOr-Ins transgenic Arabidopsis plants than controls. Therefore, based on these results, IbOr-Ins transgenic Arabidopsis plants may be highly resistant to environmental stresses such as high abscidic acid content and salt, dehydration and osmotic stress (FIG. 10).

Example 8: Phenotypic analysis of IbOrange and IbOr-Ins transgenic Arabidopsis treated with NaCl

NaCl is the biggest stress factor in plant development and growth. Moisture stress and NaCl stress are understood to be the same mechanism because NaCl stress first causes cell dehydration and loss of swelling. However, NaCl stress actually shows greater dehydration effects than water stress in plant cells. To confirm that IbOrange is indeed resistant to NaCl stress at the plant level, IbOrange and IbOr-Ins transgenic Arabidopsis plants were grown for 2 weeks in 1/2 MS solid medium containing 0, 50, 100 and 150 mM NaCl. Growing. After seeding in the medium, the germination rate was observed on the 7th day, but the transformants showed a high germination rate even though NaCl concentration was higher than that of the control group (FIG. 11). In addition, in the wild type control group, the biomass is also rapidly reduced as NaCl concentration is increased, but IbOrange and IbOr-Ins transgenic Arabidopsis showed higher bio weight compared to the control group (FIG. 12).

In addition, IbOrange and IbOr-Ins transgenic Arabidopsis at 100 mM NaCl had longer root roots than the control. In particular, IbOr-Ins was about 2 times longer than the control group. In the case of IbOrange transgenic Arabidopsis, the long root root phenotype was observed in the high NaCl condition compared to the control (FIG. 13).

In addition, as a result of measuring the relative moisture content at 150 mM NaCl concentration, the control group has a water content of about 70% at 150 mM, whereas the IbOrange and IbOr-Ins transgenic Arabidopsis plants differ significantly from the untreated group. I didn't see it. Therefore, IbOrange and IbOr-Ins transgenic Arabidopsis plants have a high proportion of in vivo bound water at high salt conditions, and thus have a relatively high water content.

Claims (18)

1. IbOr-Ins gene variant comprising artificially inserting a specific base sequence into the IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 2.
2. Recombinant vector comprising the gene variant of claim 1.
3. A host cell transformed with the recombinant vector of claim 2.
4. A method for producing a transgenic plant having increased carotenoid content, comprising overexpressing IbOr-Ins gene variants by transforming the recombinant vector of claim 2 to plant cells.
5. Transgenic plant with increased carotenoid content produced by the method of claim 4.
6. The transgenic plant of claim 5, wherein the plant is a dicotyledonous plant.
7. Seeds of plants according to claim 5.
8. A method for producing a transformed plant having increased salt stress resistance, comprising the step of transforming the recombinant vector of claim 2 into a plant cell to overexpress the IbOr-Ins gene variant.
9. A transgenic plant having increased salt stress resistance produced by the method of claim 8.
10. 10. The transgenic plant of claim 9, wherein the plant is a dicotyledonous plant.
11. Seeds of plants according to claim 9.
12. Preparation of a transgenic plant having increased salt stress resistance comprising the step of overexpressing the IbOrange gene by transforming a plant cell with a recombinant vector comprising an IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1 Way.
13. Transgenic plant with increased salt stress tolerance produced by the method of claim 12.
14. The transforming plant according to claim 13, wherein the plant is a dicotyledonous plant.
15. Seeds of plants according to claim 13.
16. Comprising the nucleotide sequence of SEQ ID NO: 2, comprising a IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ), carotenoid content of the plant.
17. Comprising the nucleotide sequence of SEQ ID NO: 2, comprising a IbOr-Ins gene variant artificially inserted a specific base sequence into the IbOrange gene derived from sweet potato ( Ipomoea batatas ), a composition for increasing salt stress resistance of plants.
18. Comprising the nucleotide sequence of SEQ ID NO: 1, comprising a IbOrange gene derived from sweet potato ( Ipomoea batatas ), a composition for increasing salt stress resistance of plants.

Images