WO2012038922A1 - Méthodes et systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose, et protéines, peptides et compositions associés - Google Patents

Méthodes et systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose, et protéines, peptides et compositions associés Download PDF

Info

Publication number
WO2012038922A1
WO2012038922A1 PCT/IB2011/054178 IB2011054178W WO2012038922A1 WO 2012038922 A1 WO2012038922 A1 WO 2012038922A1 IB 2011054178 W IB2011054178 W IB 2011054178W WO 2012038922 A1 WO2012038922 A1 WO 2012038922A1
Authority
WO
WIPO (PCT)
Prior art keywords
trav
cell
trbv
chain encoded
tcr
Prior art date
Application number
PCT/IB2011/054178
Other languages
English (en)
Inventor
Göran K. HANSSON
Original Assignee
Hansson Goeran K
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hansson Goeran K filed Critical Hansson Goeran K
Priority to EP11773319.6A priority Critical patent/EP2618836A1/fr
Priority to US13/825,037 priority patent/US20130189292A1/en
Priority to BR112013006571A priority patent/BR112013006571A2/pt
Priority to CA2813268A priority patent/CA2813268A1/fr
Priority to AU2011306376A priority patent/AU2011306376A1/en
Priority to JP2013529754A priority patent/JP2013540753A/ja
Publication of WO2012038922A1 publication Critical patent/WO2012038922A1/fr
Priority to IL225405A priority patent/IL225405A0/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the present disclosure relates to immunomodulatory methods and systems that are particularly suitable for treatment and/or prevention of atherosclerosis and/or conditions associated thereto and related proteins, peptides and compositions.
  • Atherosclerosis is currently viewed as a chronic lipid-related and immune- mediated inflammatory disease of the arterial walls.
  • Many immune components have been identified that participate in atherogenesis and pre-clinical studies have yielded promising results suggesting that immuno-modulatory therapies targeting these components can reduce atherosclerosis.
  • the immunomodulatory responses induced by the methods and systems of the present disclosure are associated to a therapeutic or preventive effect related to atherosclerosis in the individual or a condition associated thereto.
  • a method and system to treat and/or prevent atherosclerosis in an individual comprises: inhibiting in the individual a CD4 + T cell response to ApoB I OO, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said response.
  • the system comprises one or more agents suitable to inhibit CD4 + T cell response to ApoB I OO of the individual and one or more agents suitable to detect the reduced response in the individual.
  • a method and system to treat and/or prevent atherosclerosis in an individual comprises: inhibiting in the individual, one or more T cell receptors associated to the CD4 + T cell response to ApoB IOO, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said receptor.
  • the method can comprise: inhibiting in the individual one or more T cell receptors comprising an alpha chain encoded at least in part by the T cell receptor alpha variable gene (TRAV) 4, an alpha chain encoded at least in part by the T cell receptor alpha variable gene (TRAV) 12, an alpha chain encoded at least in part by the T cell receptor alpha variable gene (TRAV) 14 and/or an alpha chain encoded at least in part by a DNA sequence highly homologous to the DNA sequence of TRAV4, TRAV 12 or TRAV 14.
  • the method can comprises: inhibiting in the individual, one or more T cell receptors comprising a beta chain encoded at least in part by the T cell receptor beta variable gene (TRBV) 30, a beta chain encoded at least in part by the T cell receptor beta variable gene (TRBV) 31 , and/or a beta chain encoded at least in part by a DNA sequence highly homologous to the DNA sequence of TRBV 30 or TRBV 3 1.
  • the inhibiting can be performed by administering a therapeutically effective amount of a compound capable of inhibiting said receptors.
  • the system can comprise one or more agents suitable to inhibit one or more of the T cell receptors associated to the CD4 + T cell response to ApoB l OO in the individual and one or more agents suitable to detect the inhibition in the individual.
  • a method and system to treat and/or prevent atherosclerosis in an individual comprises: immunizing the individual against one or more T cell receptors that are associated to CD4 + T cell response to ApoB lOO, the T cell receptors comprising alpha variable region and/or a beta variable region.
  • the method can be performed in particular by administering to the individual one or more immunogenic fragments of the alpha and/or beta variable region of the T cell receptor, or an immunogenic portion thereof or a derivative thereof.
  • the method can comprise: administering to the individual at least one fragment of the alpha variable region encoded by TRAV 4, at least one fragment of the alpha variable region encoded by TRAV 12, at least one fragment of the alpha variable region encoded by TRAV 14, at least one fragment of the alpha variable region encoded by a DNA sequence highly homologous to TRAV 4, TRAV 12 or TRAV 14, an immunogenic portion thereof and/or a derivative thereof.
  • the method can comprise: administering to the individual a fragment of the beta variable region encoded by TRBV 30, a fragment of the beta variable region encoded by TRBV 3 1 , a fragment of the beta variable region encoded by a DNA sequence highly homologous to TRVBO or TRBV31 , an immunogenic portion thereof and/or a derivative thereof.
  • the method can comprise administering TCR TRBV3 1 peptide SEQ ID NO: 1 or other TCR TRBV31 immunogenic fragments in particular from CDR2 variable region alone or in combination with any one of the peptides of SEQ ID NO:61 , SEQ ID NO:63 and SEQ ID NO: 65 or an immunogenic portion thereof.
  • the method can comprise immunizing the individual against a T cell receptor homologous to TRBV31 , for example by administering the homologous (human) TCR TRBV30 or a TCR TRJBV30 immunogenic fragment in particular from CDR2 variable region alone or in combination with any one of the peptides of SEQ ID NO: of SEQ ID NO:61 , SEQ ID NO:63 and SEQ ID NO: 65.
  • the system then can comprises one or more agents suitable to immunize the individual against such a T cell receptor of the individual and one or more agents suitable to detect the immunization in the individual.
  • the system can comprise one or more agents suitable to immunize the individual against T cell receptor beta variable 3- 1 and/or at least one of T cell receptor alpha variable TRAV 14, TRAV 12 and TRAV4 of the individual and one or more agents suitable to detect the immunization in the individual
  • a T cell receptor associated to CD4 + T cell response to ApoB 100, or an immunogenic fragment thereof or a derivative thereof is described the T cell receptor for use as a medicament.
  • the T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12 an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof.
  • the T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31 , a beta variable region encoded by a DNA sequence highly homologous to TRBV3 1 or TRBV30, an immunogenic fragment thereof or a derivative thereof.
  • a T cell receptor associated to CD4 + T cell response to ApoB 100, or an immunogenic fragment thereof or a derivative thereof is described for use in the treatment of atherosclerosis.
  • the T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12 an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof.
  • the T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31 , a beta variable region encoded by a DNA sequence highly homologous to TRBV 1 or TRBV30, an immunogenic fragment thereof or a derivative thereof.
  • a T cell receptor highly homologous to a T cell receptor alpha variable TRAV 14, a T cell receptor alpha variable TRAV 12 or a T cell receptor alpha variable TRAV4 is used in the treatment of atherosclerosis,.
  • an antibody reactive to a T cell receptor associated to CD4 + T cell response to ApoB l OO, or a fragment thereof, or a derivative thereof is described for use as a medicament.
  • the T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12 an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof.
  • the T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 31 , a beta variable region encoded by a DNA sequence highly homologous to TRBV 1 or TRBV30, an immunogenic fragment thereof or a derivative thereof.
  • an antibody reactive to T cell receptor homologous to TRAV 14, TRAV 12 and/or TRAV4 is described for use as a medicament.
  • an antibody reactive to a T cell receptor associated to CD4 + T cell response to ApoB l OO, or a fragment thereof or a derivative thereof is described for use in the treatment of atherosclerosis.
  • the T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12 an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof.
  • the T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 3 1 , a beta variable region encoded by a DNA sequence highly homologous to TRBV 1 or TRBV30, an immunogenic fragment thereof or a derivative thereof
  • an antibody for use in the treatment of atherosclerosis wherein the antibody reactive to a T cell receptor homologous to TRBV3 1 , such as the homologous human TCR TRBV30, to a TCR TRBV30 immunogenic fragment, in particular from CDR2 variable region, and/or to a T cell receptor highly homologous to T cell receptor alpha variable TRAV 14, TRAV 12 and/or TRAV4 or a fragment thereof.
  • a composition and in particular, a vaccine comprising at least one or more T cell receptor associated to CD4 + T cell response to ApoB l OO, an immunogenic fragment thereof, a derivative thereof or an antibody together with an adjuvant and/or excipient.
  • the T cell receptor can comprise an alpha variable region encoded by TRAV 4, an alpha variable region encoded by TRAV 12 an alpha variable region encoded by TRAV 14, an alpha variable region encoded by a DNA sequence highly homologous to TRAV4, TRAV 12 or TRAV 14, an immunogenic portion thereof or a derivative thereof.
  • the T cell receptor can also comprise a beta variable region encoded by TRBV 30, a beta variable region encoded by TRBV 3 1 , a beta variable region encoded by a DNA sequence highly homologous to TRBV 1 or TRBV30, an immunogenic fragment thereof or a derivative thereof
  • the adjuvant and/or excipients are pharmaceutically acceptable and the composition is pharmaceutical composition.
  • a composition and in particular, a vaccine comprising at least one of the T cell receptor beta variable 3 1 (TCR TRBV31), at least one of T cell receptor alpha variable TRAV 14, TRAV 12 and/or TRAV4, an immunogenic fragment thereof, a derivative thereof or an antibody together with an adjuvant and/or excipient.
  • the adjuvant and/or excipients are pharmaceutically acceptable and the composition is pharmaceutical composition.
  • a hybridoma from mice immunized with oxLDL and carrying human ApoB l OO as a transgene (huB 100t9) is described and in particular the hybridoma clone 48-5 deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on January 22, 2009 with the accession number DSM ACC2986. Additional hybridomas also comprised in the scope of the present disclosure comprise hybridoma 15-2 and 45- 1 herein described.
  • the hybridoma clone 48-5 deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on January 22, 2009 with the accession number DS ACC2986 is used to identify a compound inhibiting a CD4+ T cell response to ApoB l OO.
  • the compound is identified by its ca capacity to prevent activation of 48-5 upon exposure to apoB l OO or a fragment thereof.
  • the compound is a fragment of a TCR alpha variable region or a TCR beta variable region herein described.
  • the methods and systems herein described can be used in connection with applications wherein inhibition of CD4+ T cell response to ApoB l OO, inhibition of T cell receptors of CD4+ T cells binding to ApoB l OO, and in particular, inhibition of CD4+ TRAV 14, TRAV 12 and/or TRAV4 binding to ApoB l OO alone or in combination with inhibition of CD4+ TRVB 1 , and/or TRAVB30 binding to ApoB lOO and/or a therapeutic or preventive effect for atherosclerosis in an individual is desired.
  • Figure 1 shows diagrams illustrating results related to T cell recognition of native LDL and ApoB l OO according to an embodiment herein described.
  • Figure 2 shows diagrams illustrating results supporting an inverse correlation between oxidation of LDL and T cell activation according to an embodiment herein described.
  • Figure 3 shows diagrams illustrating results supporting that in an embodiment herein described hybridoma responses are I-A b restricted.
  • Figure 4 shows a diagram illustrating results supporting that in an embodiment herein described hybridoma response is not dependent of CD 1 and MHC-I presentation.
  • FIG. 5 shows results of experiments supporting genotyping of the T Cell Receptor (TCR) in an embodiment herein described.
  • Figure 6 shows diagrams illustrating results related to TCR expression evaluated by FACS in an embodiment herein described.
  • Figure 7 shows a diagram illustrating results indicating plasma levels of cholesterol and triglycerides according to an embodiment herein described.
  • Figure 8 shows diagrams illustrating results indicating antibody titers to oxLDL and LDL in an embodiment herein described.
  • Figure 9 shows a diagram and a photographic representation indicating that, in an embodiment herein described, TRBV3 1 + cell-depletion reduces the T cell response to ApoB l OO.
  • Figure 10 shows diagrams illustrating results indicating that, in an embodiment herein described immunization against TRBV3 1 induces blocking antibodies.
  • Figure 11 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization against TRBV31 reduces atherosclerosis.
  • Figure 12 shows diagrams illustrating results related to T cell recognition of native LDL and ApoB l OO according to an embodiment herein described.
  • Figure 13 shows diagrams illustrating results related to T cell recognition of oxidized LDL and Apo B 100 according to an embodiment herein described.
  • Figure 14 shows diagrams illustrating results indicating that, in an embodiment herein described, antigen preparation are not toxic to the cells.
  • Figure 15 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization with oxLDL or ApoB 100 expands T cell populations that recognize native epitopes of LDL and induces antibodies to oxLDL, native LDL and ApoB 100.
  • Figure 16 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization is necessary for priming of T cells and detection of proliferation in vitro.
  • Figure 17 shows diagrams illustrating results indicating that, in an embodiment herein described, TRBV3 1 + T cells recognize ApoB 100.
  • Figure 18 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization against TRBV31 reduces atherosclerosis.
  • Figure 19 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization against TRBV3 1 reduces inflammation in atherosclerotic lesions.
  • Figure 20 shows diagrams illustrating results indicating that, in an embodiment herein described, immunization with TRBV3 1 peptide or LH do not influence ApoB 100 or lipid levels in plasma.
  • FIG. 21 shows a diagram illustrating results from 3 mice carrying TCR TRBV3 1 and TRAV 12 as transgenes.
  • Spleen cells from such TCR transgenic mice (mouse # 4, 3 1 and 33) or from control wild type mouse were cultured with human ApoB 100 ( 10 g/ml).
  • ApoB 100 10 g/ml
  • (A) the supematants were saved for IFNy evaluation by EL1SA, and
  • B) the cells were pulsed with ⁇ ⁇ € (3H-thymidine) for cell proliferation (analysis of DNA replication) as an indicator of T cell activation.
  • Results are expressed as mean ⁇ SEM of the results of duplicate wells for each mouse. Data show that the TCR transgenic mice, but not control mice, respond vividly to ApoB l OO antigen, by IFNy secretion and by proliferation.
  • treating indicates any activity that is part of a medical care for, or that deals with, a condition medically or surgically.
  • preventing or prevention indicates any activity, which reduces the burden of mortality or morbidity from a condition in an individual. This takes place at primary, secondary and tertiary prevention levels, wherein: a) primary prevention avoids the development of a disease; b) secondary prevention activities are aimed at early disease treatment, thereby increasing opportunities for interventions to prevent progression of the disease and emergence of symptoms; and c) tertiary prevention reduces the negative impact of an already established disease by restoring function and reducing disease-related complications.
  • condition indicates as usually the physical status of the body of an individual (as a whole or of one or more of its parts) that does not conform to a physical status of the individual (as a whole or of one or more of its parts) that is associated with a state of complete physical, mental and possibly social well-being.
  • Conditions herein described include but are not limited to disorders and diseases wherein the term “disorder” indicates a condition of the living individual that is associated to a functional abnormality of the body or of any of its parts, and the term “disease” indicates a condition of the living individual that impairs normal functioning of the body or of any of its parts and is typically manifested by distinguishing signs and symptoms.
  • Exemplary conditions include but are not limited to injuries, disabilities, disorders (including mental and physical disorders), syndromes, infections, deviant behaviours of the individual and atypical variations of structure and functions of the body of an individual or parts thereof.
  • the wording "associated to" as used herein with reference to two items indicates a relation between the two items such that the occurrence of a first item is accompanied by the occurrence of the second item, which includes but is not limited to a cause-effect relation and sign/symptoms-disease relation.
  • mammals and more particularly human beings.
  • Atherosclerosis is currently viewed as a chronic lipid-related and immune- mediated inflammatory disease of the arterial walls.
  • Many immune components have been identified that participate in atherogenesis and pre-clinical studies have yielded promising results suggesting that immuno-modulatory therapies targeting these components can reduce atherosclerosis.
  • the term "atherosclerosis” as used herein indicates an inflammatory condition, and in particular a chronic inflammatory disease characterized by the accumulation of lipoproteins eliciting an inflammatory response in the intima of the arterial wall.
  • the tunica intima (or just intima) is the innermost layer of an artery or vein.
  • the intima is typically formed by one layer of endothelial cells and is supported by an internal elastic lamina. In the intima the endothelial cells are in direct contact with the blood flow.
  • Adaptive immune responses engaging clonally expanded T cell populations contribute to this inflammatory process, as well as innate immune responses mounted by macrophages and other cells.
  • LDL low density lipoprotein
  • LDL Low-density lipoprotein
  • VLDL very low-density lipoprotein
  • IDL intermediate-density lipoprotein
  • HDL high-density lipoprotein
  • a native LDL particle typically contains a single apolipoprotein B (apoB) molecule that circulates the fatty acids, keeping them soluble in the aqueous environment.
  • the apoB on the LDL particle acts as a ligand for LDL receptors in various cells throughout the body.
  • the protein occurs in the plasma in two main isoforms, ApoB48 and ApoB 100. The first is synthesized exclusively by the small intestine, the second by the liver.
  • the Apolipoprotein B- 100 molecule has 4536 amino acid residues and a MW of about 5 14 kD.
  • LDL has typically a highly-hydrophobic core consisting of a polyunsaturated fatty acid known as linoleate and about 1500 esterified cholesterol molecules. This core is surrounded by a shell of phospholipids and unesterified cholesterol as well as a single copy of the ApoB- 1 00. LDL particles are approximately 22 nm in diameter and have a mass of about 3 million Daltons. Low-density lipoprotein receptors sit on the outer surface of many types of cells, where they pick up low-density lipoproteins circulating in the bloodstream and transport them into the cell. Once inside the cell, the low-density lipoprotein is broken down to release cholesterol. The cholesterol is then used by the cell, stored, or removed from the body.
  • low-density lipoprotein receptors drop off their cargo, they are recycled back to the cell surface to pick up more low-density lipoproteins.
  • LDL particles infiltrate the intima, they are prone to undergo oxidative modifications. Such changes likely include enzymatic attacks by myeloperoxidase and lipoxygenases as well as non-enzymatic oxidative reactions.
  • oxidative modifications likely include enzymatic attacks by myeloperoxidase and lipoxygenases as well as non-enzymatic oxidative reactions.
  • double-bonds of fatty acid residues in phospholipids, cholesterol esters and triglycerides are cleaved, generating reactive aldehydes and truncated lipids.
  • modified phospholipids such as Iysophosphatidylcholine and oxidized l -palmitoyl-2-arachidonyl-sn-glycero-3- phosphocholine (ox-PAPC) can activate endothelial cells, macrophages and B l -type B cells to initiate innate immune responses, including adhesion molecule expression, chemokine production, and secretion of natural antibodies.
  • the protein moiety of LDL is also a target of oxidative modifications. They include formation of adducts of malondialdehyde (MDA), 4-hydroxynonenal and other molecular species on lysyl residues of apolipoprotein B- 100 (ApoB 100).
  • Antibodies are formed to MDA-lysine and other oxidatively generated epitopes of LDL particles ( etelhuth, D.F., Tonini, G.C., Carvalho, M.D., Ramos, R.F., Boschcov, P., and Gidlund, M. (2008). Autoantibody response to chromatographic fractions from oxidized LDL in unstable angina patients and healthy controls. Scand J Immunol 68, 456-462). Such antibodies circulate in peripheral blood and can also be found in atherosclerotic lesions.
  • anti-MDA-ApoB 100 antibodies are largely IgG molecules (Yla-Herttuala, S., Palinski, W., Butler, S.W., Picard, S., Steinberg, D., and Witztum, J.L. ( 1994).
  • Rabbit and human atherosclerotic lesions contain IgG that recognizes epitopes of oxidized LDL. Arterioscler Thromb 14, 32-40.). This implies the involvement of T cell help to activate isotype switching in the B cell.
  • the method for treating and/or preventing atherosclerosis in an individual herein described comprises: inhibiting in the individual a CD4 + Tcell response to ApoB l OO.
  • T cells indicates a group of white blood cells known as lymphocytes, which play a central role in cell-mediated immunity and can be distinguished from other lymphocyte types, such as B cells and natural killer cells by the presence of a special receptor on their cell surface called T cell receptors (TCR).
  • T T cell receptors
  • T cell stands for thymus, since it is the principal organ in the development of the T cell.
  • T cells have been identified both in hypercholesterolemic mice and among clones isolated from human atherosclerotic lesions, the molecular properties of the T cell epitopes are poorly understood due to the biochemical complexity of the LDL particle and the oxidative process.
  • Antibodies are generally produced by plasma cells, which have matured from B lymphocytes in the presence of various cytokines produced by activated CD4+ T lymphocytes and by direct T lymphocyte-B lymphocyte interactions.
  • CD4+ T lymphocytes are activated when they encounter an antigenic peptide with major histocompatibility complex class II antigen-presenting cells, such as B lymphocytes and macrophages.
  • major histocompatibility complex class II peptide complexes by T lymphocytes is therefore central to the development of immune responses and antibody production.
  • the major histocompatibility complex class II molecules are highly polymorphic heterodimeric membrane glycoproteins composed of a and ⁇ chains.
  • major histocompatibility complex class II molecules The function of major histocompatibility complex class II molecules is to bind short peptides derived mainly from extracellular proteins, in turn forming major histocompatibility complex class II peptide complexes that interact with appropriate T- cell receptors of CD4+ T lymphocytes.
  • MHC molecules are anchored in the cell membrane, where they display short polypeptides to T cells, via the T cell receptors (TCRs). All MHC molecules receive polypeptides from inside the cells they are part of and display them on the cell's exterior surface for recognition by T cells.
  • T cell receptor or TCR indicates a molecule found on the surface of T lymphocytes (or T cells) that is, in general, responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules.
  • MHC major histocompatibility complex
  • the TCR is a heterodimer consisting of an alpha and beta chain in 95% of T cells, whereas 5% of T cells have TCRs consisting of gamma and delta chains. Similar to immunoglobulins (Ig), each TCR chain is encoded by discrete gene segments that are joined by somatic recombination during development of the T cell. Functional alpha and beta chain genes are generated in the same way that complete immunoglobulin genes are created.
  • V a (TRAV) gene segment rearranges to a J a (TRAJ) gene segment to create a functional variable region exon. Transcription and splicing of the VJ a exon to C a (TRAC) generates the mRNA that is translated to yield the T-cell receptor a-chain protein.
  • variable domain of both the TCR a- chain and ⁇ -chain have three hypervariable or complementarity determining regions (CDRs), whereas the variable region of the ⁇ -chain has an additional area of hypervariability (HV4) that does not normally contact antigen and therefore is not considered to be a CDR.
  • CDRs hypervariable or complementarity determining regions
  • HV4 additional area of hypervariability
  • CDR3 is the main CDR responsible for recognizing processed antigen, although CDRl of the alpha chain can also interact with the N-terminal part of the antigenic peptide, and CDR l of the beta chain interacts with the C-terminal part of the peptide. CDR2 regions interact with the MHC molecule presenting the peptide. The signal from the T cell complex is enhanced by simultaneous binding of the MHC molecules by a specific co-receptor.
  • CD4 + Tcells indicates T cells, and in particular helper T cells and regulatory Tcells, presenting a co receptor CD4 on their surface.
  • helper T cells the CD4 exclusively binds the class II MHC.
  • the co-receptor not only ensures the specificity of the TCR for the correctly-presented antigen but also allows prolonged engagement between the antigen presenting cell and the T cell, thus enhancing the recruitment of essential molecules (e.g.Lck,) inside the cell that are involved in the signaling of that activated T lymphocyte.
  • essential molecules e.g.Lck, antigen binding to the T cell receptor (TCR) stimulates the secretion of 1L-2 and several other cytokines, and the expression of IL-2 receptors (IL-2R).
  • the CD4 + T cell are CD4 + T cell presenting a T cell receptor, wherein the TCR a-chain is encoded, at least partially, by T cell receptor alpha variable gene TRAV 4, TRAV 12 or TRAV 14.
  • the T cell receptors are referred to as TCR alpha variable TRAV 4 (TCR TRAV 4), TCR alpha variable TRAV 12 (TCR TRAV 12), and TCR alpha variable TRAV 14 (TCR TRAV 14) respectively.
  • TRAV4, TRAV 12, and TRAV 14 are also herein used with reference to DNA sequences coding at least in part for TRAV 4, TRAV 14, TRAV 12, amino acid sequences encoded thereby, as well as portions or fragments as will be understood by a skilled person in view of the present disclosure.
  • the CD4 + T cell are CD4 + T cell presenting a T cell receptor, wherein the TCR a-chain is encoded, at least partially, by a DNA sequences highly homologous to that of gene TRAV 4, TRAV 12 or TRAV 14.
  • the CD4 + T cell is CD4 + T cell presenting a T cell receptor, wherein the TCR ⁇ -chain is encoded, at least partially, by T cell receptor beta variable gene TRBV 30 or 3 1.
  • the T cell receptors are referred to as TCR beta variable TRBV 30 (TCR TRBV 30) and TCR beta variable TRBV 3 1 (TCR TRBV 3 1 ), respectively.
  • TRBV 30, and TRBV 3 1 are also herein used with reference to DNA sequences coding at least in part for TRBV 30, and TRBV 30, amino acid sequences encoded thereby, as well as portions or fragments as will be understood by a skilled person in view of the present disclosure.
  • the CD4 + T cell are CD4 + T cell presenting a T cell receptor, wherein the TCR ⁇ -chain is encoded, at least partially, by a DNA sequence highly homologous to that of TRBV 30 or TRBV31 .
  • the CD4 + T cell are CD4 + T cell presenting a T cell receptor, wherein the TCR a-chain is encoded, at least partially, by gene TRAV 4, 12 or 14 or a DNA sequences highly homologous to that of TRAV 4, TRAV 12 or TRAV 14, meanwhile, the TCR ⁇ -chain is encoded, at least partially, by gene TRBV 30 or 31 or a DNA sequence highly homologous to that of TRBV 30 or TRBV3 1 .
  • homologous or “homology” as used herein with reference to nucleic acid or protein sequences is defined in terms of shared ancestry of the sequences. For example, two DNA sequence can have shared ancestry because of either a speciation event (orthologs) or a duplication event (paralogs). Homologous sequences as used herein are also biologically functional equivalents, with particular reference to the immunogenic properties of the reference sequence as will be understood by a skilled person. Homology among protein or DNA sequences can also be identified on the basis of sequence similarity. The terms “homology” and “similarity” and “identity” are often used interchangeably with reference to sequences.
  • Homologous sequences can be orthologous or paralogs depending on the similarities with respect to a reference sequence.
  • Orthologs or orthologous sequences are sequences that can be identified by a vertical descent from a single common ancestor sequence.
  • Paralogous sequences are sequences that can be identified as separated following a duplication event of a common ancestor.
  • a T cell receptor encoded by a "DNA sequence highly homologous" to an indicated first gene refers to a T cell receptor encoded by a DNA sequence of a second gene orthologous to the first gene, which can be identifiable by one skilled in the art.
  • various database and other resources identifiable by one skilled in the art including but not limited to the TreeFam (Tree families database, www.treefam.org), can be used to identify orthologs and paralogs of a reference sequences and, possibly, evolutionary history of gene families.
  • TreeFam Tue families database, www.treefam.org
  • human orthologs of TRBV 31 gene is TRBV 30.
  • homologs of the T cell receptors, fragments and portions herein described can be encoded by DNA sequences highly similar to an original encoding gene sequence, as long as the original gene sequence is modified such that functional equivalent codons are formed to encode a same protein sequence.
  • the term "functional equivalent codons”, as well understood in the art, refer to groups of genetic condons that code for same amino acids (see the Codon Table below). Cod on Table
  • a method and system to treat and/or prevent atherosclerosis in an individual comprises: inhibiting in the individual a CD4 + T cell response to ApoB l OO, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said response.
  • the compound inhibiting the CD4+ T cell response to ApoB l OO is used can be a compound identified by its capacity to prevent activation of the hybridoma clone 48-5 upon exposure to apoB l OO or a fragment thereof.
  • the hybridoma clone 48-5 has been deposited according to the Budapest Treaty with the DSMZ- Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on January 22, 2009 with the accession number DSM ACC2986 capacity to prevent activation of 48-5 upon exposure to apoB 100 or a fragment thereof.
  • inhibiting the CD4+ T cell response to ApoB I OO is performed by inhibiting one or more T cell receptors of the CD4+ T cell that are associated to said response.
  • inhibiting the CD4+ T cell response to ApoB I OO is performed by inhibiting a T cell receptor comprising a TCR a-chain encoded, at least partially, by T cell receptor alpha variable gene TRAV 4, a TCR a-chain encoded, at least partially, by T cell receptor alpha variable gene TRAV 12, a TCR a-chain encoded, at least partially, by T cell receptor alpha variable gene TRAV 14 or a TCR a-chain encoded, at least partially, by a DNA sequence that is highly homologous to one of the genes TRAV 4, 12 and 14.
  • inhibiting the CD4+ T cell response to ApoB I OO is performed by inhibiting a T cell receptor comprising a TCR ⁇ -chain encoded, at least partially, by T cell receptor beta variable gene TRBV 30 a TCR ⁇ -chain encoded, at least partially, by T cell receptor beta variable gene TRBV 3 1 , or a a TCR ⁇ -chain encoded, at least partially, by a DNA sequence that is highly homologous to one of the genes TRBV 30 and TRBV3 1.
  • inhibiting the CD4+ T cell response to ApoB IOO is performed by inhibiting the T cell receptor, comprising a TCR a-chain and a TCR ⁇ - chain.
  • the TCR a-chain can be encoded, at least partially, by T cell receptor alpha variable gene TRAV 4, 12 or 14 or a DNA sequence that is highly homologous to one of the genes TRAV 4, 12 and 14.
  • the TCR ⁇ -chain is encoded, at least partially, by T cell receptor beta variable gene TRBV 30 or 3 1 , or a DNA sequence that is highly homologous to one of the genes TRBV 30 and 3 1.
  • TCR TRBV 31 TCR alpha variable TRAV 4, 12, 14 and/or TCR beta variable TRBV 31 (TCR TRBV 31 ) (see Examples 1.6).
  • a method to treat and/or prevent atherosclerosis in an individual comprises: inhibiting in the individual, one or more T cell receptor that is associated to the CD4 + T cell response to ApoB l OO, in particular by administering a therapeutically effective amount of a compound capable of inhibiting said receptor.
  • treatment and/or prevention of atherosclerosis and/or a condition associated thereto in an individual can be performed by administering a therapeutically effective amount of a compound inhibiting the binding of one or more T cell receptors to molecules comprising apolipoprotein B- 100 or fragments thereof.
  • the T cell receptor comprises an alpha variable region and/or a beta variable region.
  • the binding of one or more T cell receptor to molecules comprising apolipoprotein B- 100 or fragments thereof is inhibited.
  • the one or more T cell receptor comprises an a-chain which is, at least partially, encoded by gene TRAV 4, TRAV 12 or TRAV 14 or a DNA sequence highly homologous to TRAV 4, TRAV 12 or TRAV 14.
  • the one or more T cell receptor comprises a ⁇ -chain, which is, at least partially, encoded by gene TRBV 30 or TRBV 3 1 or by a DNA sequence highly homologous to TRBV3 1 or TRBV30.
  • the one or more T cel l receptor comprises an a-chain which is, at least partially, encoded by the gene TRAV 4, TRAV 12 or TRAV 14 or a DNA sequence highly homologous to TRAV 4, TRAV 12 or TRAV 14, and further comprises a ⁇ -chain, which is, at least partially, encoded by the gene TRBV 30 or TRBV 31 or a DNA sequence highly homologous to TRBV30 or TRBV3 1 .
  • TCR TRBV 3 1 TCR alpha variable TRAV 4, 12, 14 and/or TCR beta variable TRBV 3 1
  • TCR TRBV 31 TCR alpha variable TRAV 4, 12, 14 and/or TCR beta variable TRBV 3 1
  • a method to treat and/or prevent atherosclerosis in an individual comprises: immunizing the individual against one or more T cell receptor that is associated to CD4 + T cell response to ApoB lOO, in particular by administering to the individual the T cell receptor, or an immunogenic fragment thereof or a derivative thereof.
  • Antigen-specific immunomodulation by vaccination is an attractive approach to prevent or treat chronic inflammatory diseases.
  • By mobilizing protective immune responses in an antigen-specific manner side effects due to hampered host defense against infections are avoided. Therefore, antigen-specific suppression of pathologic autoimmunity is of interest in chronic inflammatory diseases such as atherosclerosis.
  • Antigen-specific immunoprotection can be achieved through several different mechanisms, such as production of protective antibodies, deletion or inactivation (anergy) of pathogenic T cell clones, or induction of suppressive cellular immunity mediated by the family of regulatory T cells (Treg).
  • immunization can be performed by immunogenic agent, (able to block antigen recognition by the T cell receptors, and/or serve as immunogens to block antigen recognition by the T cell receptors or other antibodies), which is specific for the target T cell receptor
  • immunization can be performed by administering to the individual one or more fragments from the TCRa and/or TCRP variable region, an immunogenic portion thereof, and/or a derivative thereof.
  • the one or more peptides from the TCRa and/or TCRP variable region can be encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 3 1 or a DNA sequence highly homologous to TRAV 4, TRAV 12, TRAV 14, TRBV 30, or TRBV 31.
  • immunization can be performed by administering a fragment of the TCR TRBV 31 , which includes part of the CDR2 variable region of the ⁇ chain of the TCR (amino acid residues 45-62, ATGGTLQQLFYSITVGQV - SEQ ID NO: 1 ) herein also indicated as TRBV 31 peptide.
  • immunization can be performed by administering a fragment of the TCR V alpha 4, which includes an immunogenic portion of the variable region of the a chain of the TCR (peptide sequence SEQ ID NO: 63) herein also indicated as TRAV 4 peptide.
  • immunization can be performed by administering a fragment of the TCR V alpha 12, which includes an immunogenic portion of the variable region of the a chain of the TCR (peptide sequence SEQ ID NO: 66) herein also indicated as TRAV 12 peptide.
  • immunization can be performed by administering a fragment of the TCR V alpha 14, which includes an immunogenic portion of the variable region of the a chain of the TCR (peptide sequence SEQ ID NO: 69) herein also indicated as TRAV 14 peptide.
  • immunization can be performed by administering to the individual multiple T cell receptor immunogenic fragments described above in combination.
  • protein or "polypeptide” as used herein indicates an organic polymer composed of two or more amino acid monomers and/or analogs thereof.
  • polypeptide includes amino acid polymers of any length including full length proteins and peptides, as well as analogs and fragments thereof. A polypeptide of three or more amino acids is also called an oligopeptide.
  • amino acid amino acidic monomer
  • amino acid residue refers to any of the twenty naturally occurring amino acids including synthetic amino acids with unnatural side chains and including both D and L optical isomers.
  • amino acid analog refers to an amino acid in which one or more individual atoms have been replaced, either with a different atom, isotope, or with a different functional group but is otherwise identical to its natural amino acid analog.
  • fragment indicates a portion of a polypeptide of any length.
  • An immunogenic fragment of a T cell receptor such as TCR TRAV 4 is accordingly a portion of TCR TRAV 4 that presents immunogenic properties, such as eliciting an immune response in an individual.
  • Immunogenic fragments of the T cell receptors herein described also include any peptides however synthesized and possible derivatives thereof. Immunogenicity of a peptide can be defined by the capability of the peptide to induce an immune response, including but not limited to humoral and cell- mediated immune responses. Immunogenicity, sometimes also known as the antigenicity, of a peptide can be also reflected by the ability of the peptide to combine specifically with the final products of the immune response (such as secreted antibodies and/or T cell receptors).
  • immunogenicity of a peptide can be tested by examining whether the peptide induces antibody secretion in an specific antibody-producing cell line, such as B-cells or a hybrid cell line (hybridomas) generated by fusing a specific antibody-producing B cell with a myeloma (B cell cancer) cell.
  • an antibody-producing cell line such as B-cells or a hybrid cell line (hybridomas) generated by fusing a specific antibody-producing B cell with a myeloma (B cell cancer) cell.
  • Immunogenicity of a peptide can be tested by examining whether the peptide binds to a specific antibody through an affinity binding assay, such as an enzyme-linked immunosorbent assay (EL1SA) or immunoprecipitation assay.
  • an affinity binding assay such as an enzyme-linked immunosorbent assay (EL1SA) or immunoprecipitation assay.
  • a T cell receptor as described herein can comprise more than one immunogenic fragments suitable for using in connection with the present method and system, including antigenic fragments from both of the TCR a and ⁇ variable regions.
  • the immunogenic fragments of the T cell receptors are encoded by gene TRAV 4, TRAV 12, TRAV 14. TRBV 30, TRBV 31 and/or highly homologous DNA sequences thereof.
  • a derivative polypeptide of an antigenic fragment of TCR TRAV 4 indicates a second polypeptide that is structurally related to the first polypeptide and is derivable from the first polypeptide by a modification that introduces a feature that is not present in the first polypeptide, while retaining functional properties of the first polypeptide. Accordingly, a derivative polypeptide of an antigenic fragment of TCR TRAV 4 (or other types of T cell receptors herein described) usually differs from the original polypeptide or portion thereof by modification of the amino acidic sequence that might or might not be associated with an additional function not present in the original polypeptide or portion thereof.
  • a derivative polypeptide of an immunogenic fragment of T cell receptors retains however immunogenic properties comparable to the ones described in connection with the T cell receptors or the immunogenic fragment thereof.
  • Amino acid sequence derivatives of the proteins, polypeptides and peptides of the present invention can be substitutional, insertional or deletion variants.
  • Deletion variants lack one or more residues of the native protein that are not essential for function or immunogenic activity.
  • Another common type of deletion variant is one lacking secretory signal sequences or signal sequences directing a protein to bind to a particular part of a cell.
  • Insertional mutants typically involve the addition of material at a nonterminal point in the polypeptide. This can include the inse l tion of an immunoreactive epitope or simply a single residue. Terminal additions, called fusion proteins, are discussed below.
  • Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and can be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage, without the loss of other functions or properties.
  • Substitutions of this kind preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge.
  • Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
  • biologically functional equivalent is understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80% ; or more preferably, between about 81 % and about 90%; or even more preferably, between about 91 % and about 99%; of amino acids that are identical or functionally equivalent to the amino acids of the peptide mimetics provided the biological activity of the mimetic is maintained. [0096] The following is an exemplary approach illustrating changing of the amino acids of a protein to create an equivalent, which possible comprise an improved, second- generation molecule.
  • amino acids can be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with, structures such as, for example, antigen-antibody recognition sites of antibodies or T cell receptors, or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence and in its underlying DNA coding sequence, and nevertheless produce a protein with like properties. It is thus contemplated by the inventors that various changes can be made in the DNA sequences of genes without appreciable loss of their biological utility or activity, as discussed below.
  • the hydropathic index of amino acids can be considered.
  • the importance of the hydropathic amino acid index in conferling interactive biologic function on a protein is generally understood in the mt ( yte & Doolittle, A simple method for displaying the hydropathic character of a protein J Mol Biol. 1982 May 5; 157( 1 ): 105-32). It is accepted that the relative hydropathic character of the amino acid contlibutes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.
  • hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0 ⁇ 1 ); glutamate (+3.0 ⁇ 1 ); seline (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ⁇ 1 ); alanine (-0.5); histidine *-0.5); cysteine (- 1.0); methionine (- 1.3); valine (- 1.5); leucine (- 1.8); isoleucine (- 1 .8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).
  • an amino acid can be substituted for another having similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein.
  • substitution of amino acids whose hydrophilicity values are within ⁇ 2 is preferred, those that are within ⁇ 1 are particularly preferred, and those within ⁇ 0.5 are even more particularly preferred.
  • amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
  • Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
  • T cell receptor associated to CD4 + T cell response to ApoB lOO, or an immunogenic fragment thereof or a derivative thereof are described.
  • the T cell receptors herein described and/or fragments and/or derivative thereof can be used to identify agents, (e.g. a set of polypeptides or proteins) that are able to block antigen recognition by the T cell receptors, and/or serve as immunogens to block antigen recognition by the T cell receptors or other antibodies.
  • agents e.g. a set of polypeptides or proteins
  • the T cell receptors herein described and/or fragments and/or derivative thereof are described for use as a medicament, and in particular for use in the treatment of atherosclerosis.
  • the T cell receptors comprise an a chain encoded, at least partially, by gene TRAV 4, TRAV 12, TRAV 14 or by a DNA sequence highly homologous for TRAV 4, TRAV 12, TRAV 14 .
  • the T cell receptors comprise a beta chain encoded, at least partially, by the gene TRBV 30, TRBV 31 or by a DNA sequence highly homologous to TRBV30 or TRBV31.
  • the T cell receptors comprise an a chain encoded, at least partially, by the gene TRAV 4, a chain encoded, at least partially, by TRAV 12, a chain encoded, at least partially, by TRAV 14 or a DNA sequence highly homologous , to TRAV 4, TRAV 12, TRAV 14 and further comprises a beta chain encoded, at least partially, by the gene TRBV 30, a beta chain encoded, at least partially, by the gene TRBV 31 or a a beta chain encoded, at least partially, by a DNA sequence highly homologous to TRBV 30 or TRBV 31 .
  • the fragments of the T cell receptor are encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 3 1 and/or by a DNA sequence highly homologous to TRAV 4, TRAV 12, TRAV 14, TRBV 30 or TRBV 3 1 .
  • an antibody reactive to a T cell receptor associated to CD4 + T cell response to ApoB l OO, or a fragment thereof, or a derivative thereof is described.
  • antibody reactive to a T cell receptor associated to CD4 + T cell response to ApoB l OO herein described, or a fragment thereof, or a derivative thereof, is described for use as a medicament, and in particular for use in the treatment of atherosclerosis.
  • antibody refers to a protein of the kind that is produced by activated B cells after stimulation by an antigen and can bind specifically to the antigen promoting an immune response in biological systems.
  • Full antibodies typically consist of four subunits including two heavy chains and two light chains.
  • the term antibody includes natural and synthetic antibodies, including but not limited to monoclonal antibodies, polyclonal antibodies or fragments thereof.
  • Exemplary antibodies include IgA, IgD, IgG l , IgG2, IgG3, IgM and the like.
  • Exemplary fragments include Fab Fv, Fab' F(ab')2 and the like.
  • a monoclonal antibody is an antibody that specifically binds to and is thereby defined as complementary to a single particular spatial and polar organization of another biomolecule which is termed an "epitope". In some forms, monoclonal antibodies can also have the same structure.
  • a polyclonal antibody refers to a mixture of different monoclonal antibodies. In some forms, polyclonal antibodies can be a mixture of monoclonal antibodies where at least two of the monoclonal antibodies binding to a different antigenic epitope. The different antigenic epitopes can be on the same target, different targets, or a combination.
  • Antibodies can be prepared by techniques that are well known in the art, such as immunization of a host and collection of sera (polyclonal) or by preparing continuous hybridoma cell lines and collecting the secreted protein (monoclonal).
  • proteins including antibodies, peptides and/or agents for inhibiting T cells response herein described are comprised in a composition together with suitable adjuvant and/or excipients.
  • adjuvant indicates a pharmacological or immunological agent that modify the effect of other agents (e.g., drugs, vaccines) while having few if any direct effects when given by themselves. They are often included in vaccines to enhance the recipient's immune response to a supplied antigen while keeping the injected foreign material at a minimum.
  • agents e.g., drugs, vaccines
  • Types of adjuvants include: Immunologic adjuvant that stimulate the immune system and increase the response to a vaccine, without having any specific antigenic effect in itself.
  • excipients indicates an inactive substance used as a carrier for the active ingredients of a medication.
  • exemplary excipients can also be used to bulk up formulations that contain very potent active ingredients, to allow for convenient and accurate dosage.
  • excipients can be used in the manufacturing process to aid in the handling of the active substance concerned.
  • different excipients can be used that are identifiable by a skilled person.
  • the compositions comprises selected (immunogenic) peptide fragments of T cell receptors and possibly toxins/toxoids: tetanus toxin, diphtheria toxoid, B subunit of cholera toxin, as well as BSA, HAS, rHSA, KLH, ovalbumin.
  • the selected peptide fragments of the T cell receptors are encoded by gene TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31 or a DN A highly homologous to TRAV 4, TRAV 12, TRAV 14, TRBV 30, TRBV 31.
  • the adjuvants and excipients are pharmaceutically acceptable and the resulting composition is a pharmaceutical composition. In some of those embodiments, the pharmaceutical composition is a vaccine.
  • agents for inhibiting the CD4 + T cell response to ApoB l OO and/or binding of the TCR receptor herein described with ApoB l OO can be provided as a part of systems to treat and/or prevent.
  • the systems can be provided in the form of arrays or kits of parts.
  • kits of parts the agents and other reagents to perform an assay to detect the inhibiting and/or immunizing can be comprised in the kit independently.
  • the agents can be included in one or more compositions, and each agent can be in a composition together with a suitable vehicle.
  • detect indicates the determination of the existence, presence or fact of a target in a limited portion of space, including but not limited to a sample, a reaction mixture, a molecular complex and a substrate.
  • the "detect” or “detection” as used herein can comprise determination of chemical and/or biological properties of the target, including but not limited to ability to interact, and in particular bind, other compounds, ability to activate another compound and additional properties identifiable by a skilled person upon reading of the present disclosure.
  • the detection can be quantitative or qualitative.
  • a detection is "quantitative” when it refers, relates to, or involves the measurement of quantity or amount of the target or signal (also referred as quantitation), which includes but is not limited to any analysis designed to determine the amounts or proportions of the target or signal.
  • a detection is "qualitative” when it refers, relates to, or involves identification of a quality or kind of the target or signal in terms of relative abundance to another target or signal, which is not quantified.
  • labeled molecules can include labeled molecules and in particular, labeled polynucleotides, labeled antibodies, labels, microfluidic chip, reference standards, and additional components identifiable by a skilled person upon reading of the present disclosure.
  • label and label molecule as used herein as a component of a complex or molecule referring to a molecule capable of detection, including but not limited to radioactive isotopes, fluorophores, chemiluminescent dyes, chromophores, enzymes, enzymes substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, nanoparticles, metal sols, ligands (such as biotin, avidin, streptavidin or haptens) and the like.
  • fluorophore refers to a substance or a portion thereof which is capable of exhibiting fluorescence in a detectable image.
  • labeling signal indicates the signal emitted from the label that allows detection of the label, including but not limited to radioactivity, fluorescence, chemiluminescence, production of a compound in outcome of an enzymatic reaction and the like.
  • detection of the inhibiting and/or immunizing can be carried either via fluorescent based readouts, in which the labeled antibody is labeled with fluorophore, which includes, but not exhaustively, small molecular dyes, protein chromophores, quantum dots, and gold nanoparticles. Additional techniques are identifiable by a skilled person upon reading of the present disclosure and will not be further discussed in detail.
  • kits can be provided, with suitable instructions and other necessary reagents, in order to perform the methods here described.
  • the kit will normally contain the compositions in separate containers. Instructions, for example written or audio instructions, on paper or electronic support such as tapes or CD- ROMs, for carrying out the assay, will usually be included in the kit.
  • the kit can also contain, depending on the particular method used, other packaged reagents and materials (i.e. wash buffers and the like).
  • compositions which contain at least one agent as herein described, in combination with one or more compatible and pharmaceutically acceptable vehicles, and in particular with pharmaceutically acceptable diluents or excipients.
  • the agent can be administered as an active ingredient for treatment or prevention of a condition in an individual.
  • use of a hybridoma from mice immunized with oxLDL and carrying human ApoB l OO as a transgene is described to identify suitable agents for inhibition of CD4+ Tcell response to ApoB l OO.
  • hybridoma clone 48-5 deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, Inhofftenstrasse 7 B, 38124 Braunschweig, Germany, on January 22, 2009 with the accession number DSM ACC2986 and related uses and systems.
  • the following examples illustrate exemplary methods and systems are based on the inhibition of CD4+ T cell response to ApoB l OO by immunization performed with a specific peptide from TCR TRVB31 .
  • a person skilled in the art will appreciate the applicability of the features described in detail for immunization performed with a different peptide from TCR TRVB31 or for other methods and systems for inhibiting CD4 + Tcell response to ApoB l OO and in particular CD4 + T cell presenting TCR TRVB3 1 according to the present disclosure.
  • MHC restriction assay To evaluate MHC class II restriction, we incubated 10 5 hybridoma cells with different concentrations of ApoB l OO in the presence of 4 * 105 irradiated ( 1.6 Gy) APCs from syngeneic (C57BL/6;I-Ab) or allogeneic (BALB/c; I-Ad) donors. In a separate experiment, 105 hybridoma cells were incubated with ApoB l OO in the presence of 4 * 105 irradiated ( 1 .6 Gy) APC from syngeneic donors in the presence or absence of blocking antibodies to MHC class II (BD). In both experiments, T cell activation was defined by increases in IL-2 concentration in the supernatant.
  • LDL Lipoprotein preparations.
  • LDL Highly oxidized LDL was obtained by incubating 1 ml of LDL ( 1 mg/ml protein content, determined by Bradford assay' Bio-Rad Laboratories) in the presence of 20 ⁇ CuS04 for 18 h at 37 °C; different degrees of oxidation were obtained by incubating LDL with 20 ⁇ CuS04 for 1 , 2, 4, or 8 h. The extent of oxidation was evaluated by TBARS, as previously described (Puhl et al., 1994).
  • ApoB l OO was isolated by using a modification of previously described methods (Steele and Reynolds, 1979; Wessel and Fliigge, 1984). In brief, 0.4 ml methanol, 0.1 ml chloroform, and 0.3 ml water were added to 0.1 ml of LDL ( 1 mg/ml); the suspension was then vortexed and centrifuged at 9,000 g for 1 min. The upper phase was removed and 0.3 ml of methanol added to the lower phase and interphase with precipitated protein, which was mixed again and centrifuged at 9,000 g for 2 min to pellet the protein.
  • the protein pellet was resuspended in a minimum volume of 10% SDS (Bio-Rad Laboratories) until it solubilized. These preparations first were filtered on a PD- 10 column (GE Healthcare) to remove excess SDS. They were then purified on a Superdex- 200 size-exclusion column (0.5 ml/min, in Tris-HCI, pH 7.4). ApoB l OO preparations were greater than 90% pure, as evaluated in a second injection into a Superdex-200 column (GE Healthcare) and analyzed on SDS-PAGE. Finally, protein concentration was determined by Bradford assay (Bio-Rad Laboratories).
  • TCR V domain expression Flow cytometric analysis of TCR V domain expression.
  • Commercially available anti-mouse TCR-Va and TCR-V mAb (BD) were used to detect TCR-Va and TCR-Vp. They were combined with anti-CD3- Pacific Blue and anti-CD4-APC to stain T cell hybridomas.
  • Splenocytes from unimmunized mice were used as positive controls for all antibodies.
  • the cel ls were analyzed on a CyAn ADP flow cytometer (Dako).
  • mice were washed and incubated for two additional hours with mouse plasma, diluted in TBS/gelatin 0.1 %. After washing, total IgG levels were measured using enzyme-conjugated anti-mouse antibodies (BD). The plates were washed, and colorimetric reactions were developed using TMB (BD). The absorbance was measured using a microplate reader (VersaMax; MDS Analytical Devices). Plasma cholesterol and triglycerides were measured using enzymatic colorimetric kits (Randox Laboratory, Ltd.) according to the manufacturer's protocol. ApoB l OO levels were measured by commercial ELISA following the manufacturer's instructions (ALerCHEK, Inc.).
  • Plasma cholesterol lipoprotein profiles were determined using a modification of the method of Okazaki et al. ( 1981 ).
  • plasma samples (50 ⁇ ) from mice immunized with TRBV31 -peptide or KLH were fractionated using an HR 10/30 Superose 6 column (GE Healthcare) and a Discovery BIO GFC-500 as precolumn (5 cm 7.8 i.d.; Supelco; Sigma-Aldrich) coupled to Prominence UFLC system (Shimadzu) and equilibrated with Tris-buffered saline, pH 7.4.
  • Fractions of 200 ul were collected using Foxy Jr. fraction collector (Teledyne Isco, Inc.) and total cholesterol was determined in each fraction using enzymatic colorimetric kit (Randox Laboratory, Ltd.).
  • Lesion size was determined by measuring 8 hematoxylin- and Oil Red O-stained sections, collected at every 100 ⁇ over a 1 mm segment of the aortic root. For each section, images were captured with a DM-LB2 microscope (Leica) equipped with a 20x/0.9 objective and a DC300 camera (Leica), and the surface areas of the lesion(s) and of the entire vessel were measured. Primary antibodies to CD3, CD68, and l-Ab (all rat anti-mouse from BD) were applied to acetone- fixed cryosections followed by detection with the ABC alkaline phosphatase kit (Vector Laboratories). En face lipid accumulation was determined in the aortic arch from immunized mice using Sudan IV staining.
  • RNA isolation, cDNA synthesis, and real-rime PCR RNA was isolated from the indicated tissues or cells using the RNeasy kit (QIAGEN). Total RNA was analyzed on a BioAnalyzer (Agilent Technologies). Reverse transcription was performed with Superscript-II and random hexamers (both from Invitrogen) and amplified by real time- PCR using Assay-on-demand primers and probes for Ccl2, Ccl5, CD3, and hypoxanthine guanidine ribonucleosyl transferase (HPRT) (Applied Biosystems) in an ABI 7700 Sequence Detector (Applied Biosystems).
  • the primers used in the genotyping were combined with a probe designed based on the nucleotide sequences of the constant region of TCR ⁇ chain (5'- TCCACCCAAGGTCT-3').
  • the probe was designed using ABI Primer Express software (Applied Biosystems) and it was synthesized with a 6-carboxy-fluorescein (FAM) reporter molecule attached at the 5' end (Applied Biosystems).
  • Example 1 Generation and testing of native human LDL and ApoBlOO by T cell hvbridomas
  • HuB l OOtg mice (mice carrying human ApoB l OO as a transgene) were used to characterize the T cell response to oxLDL. These mice express human full-30 length ApoB l OO in the liver as well as gut and display a humanized lipoprotein profile.
  • mice carry the full-length human APOB gene in which codon 2153 has been changed from a leucine to a glutamine to prevent formation of ApoB48, allowing production of ApoB l OO only (Boren, J., Lee, I., Zhu, W., Arnold, K., Taylor, S., and Innerarity, T.L. ( 1998). Identification of the low density lipoprotein receptor-binding site in apolipoprotein B 100 and the modulation of its binding activity by the carboxyl terminus in familial defective apo-B 100.
  • mice were first immunized subcutaneously (s.c.) with 50 ⁇ g of copper oxidized human LDL (oxLDL) mixed with complete Freund's adjuvant (CFA) and after 2 weeks the mice were boosted with 50 ⁇ g oxLDL mixed with incomplete Freund's adjuvant (IFA).
  • lymph-node (LN) cells were collected and fused with thymoma cells to generate hybridomas as follows:
  • T cell hybridomas were generated by polyethylene glycol-induced fusion of 5 x 107 l ymph node cells (LN) with 3 x 107 BW5 I47 thymoma cells as described by appler et al. ( appler, J.W., Skidmore, B., White, J., and Marrack, P. ( 1981 ).
  • Antigen- inducible, H-2- restricted, interleukin-2-producing T cell hybridomas Lack of independent antigen and H-2 recognition. J Exp Med 153, 1 198- 1214). Briefly, LN cells from the immunized mice were stimulated with 3 ⁇ g/ml oxLDL during 3 days before fusion.
  • HAT Hypoxanthine-aminopterin-thymidine
  • the 23 HAT-resistant monoclonal hybridomas were assessed for activation by their IL-2 production (antigen binding to the T cell receptor (TCR) stimulates the secretion of IL-2) after exposure to the putative antigen (native LDL, copper oxLDL, and purified unmodified ApoB 100) in the presence of syngeneic, irradiated antigen- presenting cells (APC). Such cells take up and process antigens, leading to presentation of antigenic peptides bound to MHC molecules.
  • Syngeneic APC i.e. APC from mice that carry the same MHC as the T cells are needed in order to prevent activation of T cells recognizing foreign MHC molecules as antigen.
  • T cell reactivity was determined in 96 well plate assays with 1 x 105 T hybridoma cells and 4 x l O 5 irradiated ( 1.6 Gy) APCs with the different antigens.
  • LDL and oxLDL were prepared as discussed in Example 1.
  • ApoB 100 was obtained as previously described by Wessel et al. (Wessel, D., and Flugge, U. l . ( 1984) A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids Anal Biochem 138, 141 - 143) with minor modifications.
  • ApoB l OO preparations were then " subjected to a first filtration using a PD- 10 column (GE Healthcare, previously Amersham Biosciences, Uppsala, Sweden) to remove excess of SDS and subsequent purification using size-exclusion column Superdex-200 (0.5 mLlmin, in Tris-HCI pH 7.4). The first peak containing ApoB l OO was collected and the extra peaks containing contaminant protein from the LDL purification procedure were discarded. ApoB l OO preparations showed over 90% purity when evaluated in a second injection to Superdex-200 column (GE Healthcare, Uppsala, Sweden). Finally, protein concentration was determined using Bradford assay (Bio-Rad Laboratories, Hercules, CA, USA).
  • APCs were prepared by meshing spleens on nylon filters ( 1 001-lm) followed by lysis of red blood cells and washing.
  • Concavalin A ConA was used as a positive control.
  • Cells were cultured for 24 hours, at 3rC, 7.5% C02, in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% fetal calf serum (FCS).
  • DMEM Dulbecco's modified Eagle's medium
  • FCS fetal calf serum
  • Interleukin 2 (IL-2) was measured by ELISA (R&D Systems, Abingdon, United Kingdom) in the supernatant of cultures and used as a read-out for T cell activation.
  • the cDNA produced was amplified using appropriate Va family specific 5' primers (Table 1 ) together with a constant-region Ca 3' primer, or relevant ⁇ , family-specific 5' primers (Table 2) together with a constant- region Cp3, 3' primer
  • TRBV29 5' AAAGGATACAGGGTCTCACGG 3' 49 22 TRBV30 5' GGACAAGTTTCCAA TCAGCCG 3' 50
  • IMGT international immunogenetics information system
  • the mastermix for PCR reactions contained 10 mM Tris-HCI, 50mM CI, 1 .5 mM MgCI 2 , 1 mM dNTP and 0.2U/ml Taq polymerase (Invitrogen, Carlsbad, CA, USA). All primers were added to a final concentration of 0.2 ⁇ . The reactions were carried out for 35 cycles using 94° C (40 sec) for denaturation, 58° C (40 sec) for annealing and 72° C ( 1 min) for polymerization. The PCR products were analyzed on a 1.5% agarose gel and visualized by gel red staining.
  • Example 2 T cells from mice immunized with LDL or oxLDL recognize native ApoBIOO
  • Spleen cells from huB 100 tg x Ldlr " mice immunized with LDL or oxLDL were isolated and cell suspensions prepared.
  • 5 x 10 5 spleen cells were incubated in duplicate with different antigens, as described below, in 200 ⁇ of serum- free medium, 1 : 1 00 BD ITS+ Premix (BD Biosciences, Franklin Lakes, NJ, USA), 1 mg/mL BSA (Sigma-Aldrich, St.
  • Spleen cells from huB l OOtg x Ld/r'- mice immunized with LDL or oxLDL were isolated and cell suspensions prepared as described in Example 2 above. 1 .0 x 10 5 hybridoma cells from the cell suspensions were incubated for 24 hours with 4 x 10 5 irradiated APCs together with 40 ⁇ g/ml of native LDL or oxLDL that had been incubated with 20 ⁇ M CUS04 for 1 , 2, 4, 8 or 18 hours.
  • LDL was modified by MDA adduct formation.
  • MDA is formed during lipid peroxidation and reacts with free amino groups in ApoB l OO to generate MDA-lysine and other modified residues (Fogelman et al., 1980, Haberland et al., 1988, Hamberg et al., 1974).
  • [00161] therefore, it can be considered as a chemically defined oxidative modification of LDL.
  • MDA modification reduced T cell recognition of LDL proportionally to the extent of MDA exposure of the lipoprotein particles, similar to the finding for copper oxidized LDL ( Figure 13 A).
  • a dose dependent response could be detected against MDA modified LDL particles at any given concentration but its amplitude was inversely proportional to the extent of modification of the particles ( Figure 13, A and B). Similar findings were made for copper-oxidized LDL ( Figure 13 B).
  • Example 4 The cellular immune response to native ApoBlOO is preserved in polyclonal T cell populations
  • mice were immunized with oxLDL or native ApoB l OO, followed by in vitro challenge of splenocytes from these mice with oxLDL or native ApoB l OO.
  • native ApoB l OO elicited the highest proliferative T cell response, whereas highly oxidized LDL did not trigger activation, as registered by DNA synthesis.
  • This activation pattern was similar in oxLDL- and ApoB lOO-immunized mice ( Figure 15).
  • antibody responses were detected against oxLDL, native LDL, and ApoB l OO ( Figure 15 B).
  • T cell responses to native ApoB l OO can help B cells produce antibodies to a variety of epitopes on oxidized as well as native LDL epitopes.
  • T cell responses to native ApoB l OO were not detectable in spleen cell preparations from nonimmunized mice, possibly because of limited sensitivity of the assay, thus expansion of autoreactive T cell clones by immunization with ApoB l OO was necessary to detect a response (Figure 16) Similar to the findings in huB l OO' 8 x Ldlr-I- mice, immunization of Apoe-I- mice with native murine LDL elicited a T cell response to the native LDL particles, indicating that such responses were not limited to the huB l OOtg model.
  • I_A d haplotypes together with different concentrations of human ApoB l OO.
  • hybridoma cells were challenged with ApoB l OO in the presence of irradiated APCs of the I-A b haplotype, together with anti-MHC class II blocking antibody. After 24 hours incubation IL-2 secretion was evaluated in the supernatant of cultured cells.
  • TCR of T cell hybridomas were characterized on the mRNA level using RT- PCR amplification of rearranged variable domains. RNA isolation and cDNA synthesis was performed as mentioned in Example 1.
  • the cDNA produced was amplified using appropriate ⁇ family-specific 5' primers (Table 2) together with a constant-region CP 3' primer, or relevant Va family- specific 5' primers (Table 1) together with a constant-region Ca 3' primer.
  • the design of all primers was based on previously published sequences (Lefranc, M.P., Pommie, C, Ruiz, M., Giudicelli, V., Foulquier, E., Truong, L., Thouvenin-Contet, V., and Lefranc, G. (2003).
  • the mastermix for PCR reactions contained l OmM Tris-HCI, 50mM KCI, 1 .5 mM MgCI 2 , 1 mM dNTP and 0.2U/ml Taq polymerase (Invitrogen). All primers were added to a final concentration of 0.2 ⁇ . The reactions were carried out for 35 cycles using 94° C (40 seconds) for denaturation, 56°C (40 seconds) for annealing and 72°C ( 1 minute) for polymerization. The PCR products were analyzed on a 1 .5% agarose gel and visualized by ethidium bromide staining.
  • genotyping primers were used in combination with a probe that was designed based on the nucleotide sequences of the constant region of TCR ⁇ chain (5'-TCCACCCAAGGTCT-3'-SEQ ID NO:53).
  • the probe was designed using ABI Primer Express software (Applied Biosystems, Foster City, CA, USA) and it was synthesized with a 6-carboxy-fluorescein (FAM) reporter molecule attached at the 5' end (Applied Biosystems, Foster City, CA, USA).
  • FAM 6-carboxy-fluorescein
  • the fusion-partner thymoma BW5 147 used to generate the hybridoma cells expressed the rearranged TRAV20 and TRBV 12.1 variable chains and all hybrid om as were also expressing these chains at the mRNA level (Tables 1 , 2 and 3 and Figure 5).
  • All T cell hybridomas specific for native human LDL and ApoB 100 uniformly expressed the TCR TRBV31 (T cells carrying the T cell receptor beta variable 3-1 ) and no other ⁇ family was identified among them.
  • the usage of Va chains among the reactive hybridomas included different families; TRAV3, 4 and 13 for 15-2, 45- 1 and 48-5 respectively (Table 3).
  • ⁇ as well as Va TCR variable chains were expressed in a non-restricted fashion, and did not include TRBV31 (data not shown).
  • surface expression of the TRBV3 1 T cell receptor chain was confirmed by flow cytometry analysis (Table 3 and Figure 6). All commercially available anti-mouse TCR- Va and TCR-Vp monoclonal antibodies (mAb, BD PharMingen, San Diego, CA, USA) were used to stain the TCR-Va and TCR-Vp on the selected T cell hybridomas.
  • the TCR-V mAbs were conjugated to PE, FITC or biotin/streptavidin-Cy5.
  • anti-CD3-Pacific Blue and anti-CD4-APC were used.
  • Spleen cells from nonimmunized mice were used as positive controls for all antibodies.
  • the cells were analyzed on a CyAnTM ADP flow cytometer (Dako, Glostrup, Denmark).
  • mice were immunized and boosted with ApoB l OO followed by in vitro depletion of TRBV31 + T cells from spleen.
  • HuB l OO* x Ldl mice were immunized and boosted s.c. with ApoB lOO.
  • Spleen cells were harvested and followed by in vitro depletion of TRBV3 1 + or TRBV 19+ T cells from spleen by Fluorescence- Activated Cell Sorting (FACS).
  • FACS Fluorescence- Activated Cell Sorting
  • TRBV 19 was used as a control for the sorting procedure since none of the hybridomas recognizing ApoB l OO presented TRBV 19 usage.
  • TRB V31 +/TRB V 19- or TRBV 19+/TRBV31 - spleen cells were challenged in vitro with different concentrations of human ApoB l OO. Stimulation index was obtained by H3 -thymidne incorporation as described in Example 2.
  • the depletion of TRBV3 1 + T cells from spleen led to a significant reduction in the response to the ApoB 100 antigen upon in vitro challenge, which was not observed when T cells expressing the variable chain, TRBV 19, were depleted from the spleenocyte population (Figure 7). Therefore, a significant proportion of the cellular immune response to ApoB 100 in this model is carried out by TRB V3 1 + T cells.
  • mice with TRBV3 1 peptide induced the production of blocking antibodies that prevented TCR TRBV3 1 from recognizing LDL protein.
  • TRBV3 1 mRNA in aorta and spleen at sacrifice possibly because antibodies binding to their TCR interfered with the expansion of TRBV31 + T cells.
  • huB 100 lg x Ldlr" - mice were immunized with a peptide derived from TCR TRBV3 1.
  • eleven week-old male huB l OO' 8 x Ldlr" mice (C57BLI6, 129_Apob tm2Sgy Ldlr ,m l Her (Skalen. K., Gustafsson, M., Rydberg, E.K., Hulten, L.M., Wiklund, 0., Innerarity, T.L., and Boren, J. (2002).
  • TRBV3 1 peptide includes part of the CDR2 variable region of the ⁇ chain of the TCR (amino acid residues 45-62, "ATGGTLQQLFYSITVGQV" - SEQ ID NO: 1 ).
  • the peptide is synthesized and conjugated to keyhole limpet hemocyanin ( LH) by Anaspec, San Jose, CA, USA).
  • KLH is a natural protein isolated from the marine mollusc keyhole limpet and is an immunogenic carrier protein that, in vivo, increases antigenic immune responses to haptens and other weak antigens such as idiotype proteins.
  • the TRBV31 peptide - KLH conjugate was emulsified with complete Freund's adjuvant, and the mice were boosted 4 weeks later with the same antigen emulsified with IFA.
  • a control group of mice was immunized s.c. with 100 ⁇ g of KLH using the same protocol as for the peptide. The mice were kept on high fat diet (0.15% cholesterol) starting 5 days after the immunization until sacrifice 10 weeks later with C02.
  • irradiated spleen cells from mice on C57BLI6 background were used as antigen presenting cell (APC) in the hybridoma experiments. All experiments were approved by the local ethics committee.
  • the different antibodies were added at the beginning of culture, at the concentrations 0. 1 , 1 , 10 and 100 g/ml, as indicated in Figure 8C and were present throughout. After 24 h of incubation, IL-2 was measured in the supernatant.
  • Figure 8C it can be seen that IgG from TRBV3 1 -peptide immunized mice inhibited activation of T cell hybridoma (clone 48-5) in response to ApoB 100. Thus, immunization led to production of antibodies that prevented TCR TRBV31 recognition of antigen.
  • Hybridoma clone 48-5 has been deposited according to the Budapest Treaty with the DSMZ-Deutsche Sammlung von Mikro-organismen und zellkulturen GmbH, Inhoffenstrape 7 B, 38124 Braunschweig, Germany, on January 22, 2009 with the accession number DSM ACC2986.
  • TRBV3 1 + T cells were tested in experiments with HuB 100 ,g x Ldlr ' mice. These animals were immunized with the TRBV3 1 -peptide conjugated to KLH carrier protein, followed by a single booster injection; atherosclerotic lesions were analyzed 10 weeks after immunization. Mice that were immunized with KLH only were used as control.
  • TRBV31 immunization led to a 57% reduction in lesion area.
  • Plasma cholesterol, triglycerides, ApoB l OO levels, and lipoprotein profiles were unchanged (Figure 20), as well as antibody titers to LDL and oxLDL.
  • Immunohistochemistry of the lesions showed that macrophage levels were reduced by 50% ( Figure 19 A), whereas no significant effect was registered on T cell infiltration ( Figure 19 C).
  • aortic mRNA for the chemokine CCL2 (monocyte chemoattractant protein- 1 ) was significantly reduced in peptide immunized mice, whereas CCL5 (RANTES) mRNA was unchanged ( Figure 19, D and E).
  • abrogation of TCR TRBV3 1 recognition of native ApoB l OO reduces vascular inflammation and inhibits the development of atherosclerosis.
  • mice After sacrifice, blood from mice was collected through cardiac puncture. This was followed by vascular perfusion with sterile RNase-free PBS. Thoracic aorta and heart were dissected and saved for lesion analysis. Two thirds of the spleen was saved for cell experiments and one third snap-frozen for later RNA isolation. Draining lymph nodes from the inguinal region and also the abdominal aorta were snap-frozen and saved for RNA isolation. Lesion analysis was performed as described previously (Nicoletti, A., averi, S., Caligiuri, G., Bariety, J., and Hansson, G. . ( 1998). Immunoglobulin treatment reduces atherosclerosis in apo E knockout mice.
  • Plasma cholesterol and triglycerides were evaluated by enzymatic colorimetric specific kits (Randox Lab. Ltd. Crumin, UK) according to the manufacturer's protocol.
  • TCR TRBV3 1 mRNA was quantified by real time-PCR in aorta of both immunized groups as follows: RNA isolation and cDNA synthesis was performed as previously mentioned (see above). Real time-PCR was carried out using assay-on- demand primers and probes for CD3 and hypoxanthine guanidine ribonucleosyl transferase (HPRT) (Applied Biosystems, Foster City, CA, USA) in an ABI 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA).
  • HPRT hypoxanthine guanidine ribonucleosyl transferase
  • the genotyping primers were used in combination with a probe that was designed based on the nucleotide sequences of the constant region of TCR 13 chain (5'-TCCACCCAAGGTCT-3 - SEQ ID NO:54).
  • the probe was designed using ABI Primer Express software (Applied Biosystems, Foster City, CA, USA) and it was synthesized with a 6-carboxy- fluoresce in (FAM) reporter molecule attached at the 5' end (Applied Biosystems, Foster City, CA, USA).
  • TCR TRBV31 mRNA was present in the aorta of immunized as well as control mice ( FigurelOD), confirming that this population of T cells was not eliminated but prevented from recognizing their cognate antigen.
  • abrogation of TCR TRBV3 1 recognition of native ApoB l OO protein inhibits atherosclerosis.
  • oxLDL particles trigger a strong immune response (for example, see Palinski, W., Yla-Herttuala, S vigorous Rosenfeld, M.E., Butler, S.W., Socher, S.A., Parthasarathy, S., Curtiss, L.K., and Witztum, J.L. ( 1990).
  • T-cell dependent antibodies are formed to aldehyde adducts on ApoB I OO and exposure of APC-T cell cultures to oxLDL can elicit CD4+ T cell activation, it has been assumed that T cells recognize epitopes on ApoB I OO induced by oxidation of the native apolipoprotein.
  • the present invention shows that T cells from oxLDL immunized mice preferentially recognize motifs on native LDL. These epitopes are components of the native ApoB I OO protein and their immunoreactivity is extinguished rather than increased by oxidative modification of the LDL particle.
  • autoreactivity is not completely eliminated by central tolerance in early life, autoimmune reactions must be avoided by peripheral tolerance mechanisms. They depend on active inhibition of autoreactivity, e.g. by cel ls secreting immunoregulatory cytokines such as M2 macrophages and regulatory T cells. Furthermore, proteins synthesized in the liver have been reported to preferentially induce tolerogenic immunity. Since ApoB l OO is produced in the liver, it can escape autoimmune attack under normal circumstances. However, accumulation in the artery wall under conditions that favor activation of Th l effector cells can lead to break of tolerance and induction of immune reactions to ApoB 100 components.
  • the present data pinpoint CD4+ T cells carrying TCR TRBV31 and recognizing native ApoB 100 protein of LDL as proatherogenic contributors to the disease process. However, they do not rule out the involvement of other antigens and immune cells. Thus, it cannot be ruled out that certain types of LDL modifications induce autoimmune reactions towards the particle. The oxidative changes induced in the particle in vivo may differ from those induced by metal ions such as copper. Furthermore, the hybridoma strategy provides detailed information on a small subset of cells and certain reactivities may not have been represented in the hybridoma repertoire analyzed. Finally, the present strategy focused on antigens presented by professional APC through the endocytic, MHC class II restricted pathway to CD4+ T cells. Additional important contributions to LDL immunoreactivity can arise from NKT cells recognizing lipid antigens presented via CD 1 , CD8+ T cells recognizing MHC class I restricted antigens and B cells.
  • T cell recognition of oxLDL T cell hybridomas from mice immunized with oxLDL were created, which mice were carrying human ApoB l OO as a transgene (huB 100t9). These mice produce high levels of ApoB l OO and are also expected to be tolerant to native human LDL.
  • T cell responses against native LDL and purified ApoB l OO in such mice carrying T cell hybridomas from mice immunized with oxLDL and carrying human ApoB lOO as a transgene (huB 100t9) were registered, whereas oxidation of LDL blunted these responses.
  • the responding T cells were MHC class II restricted CD4+ cells and expressed a T cell receptor (TCR) containing a variable 13 domain of the TRBV31 type.
  • Example 10 Inhibition of T cell response to native low density lipoprotein and related effect on atherosclerosis
  • Example 11 Sequences of TRBV31 TRAV14. TRAV12 and/or TRAV4
  • TCR beta variable 3 1 and TCR alpha variable 14, 12 and 4 from hybridomas 15-2, 48-5 and 45- 1 were sequenced and the sequence are indicated in Table 4 below. TABLE 4
  • V beta 3 Gene ATGCTGTACTCTCTCCTTGCCTTTCTCCT SEQ ID NO: 53 hybridomas 45 sequence GGGCATGTTCTTGGGTGTTAGTGCTCAGA
  • amino acid sequence is the one SEQ ID NO: 54 identifiable by a skilled person as derivable
  • Protein MLYSLLAFLLGMFLGVSAQTIHQWPVAEI SEQ ID NO:55 sequence KAVGSPLSLGCTIKGKSSPNLYWYWQATG
  • amino acid sequence is the one SEQ ID NO: 57 identifiable by a skilled person as derivable
  • Protein MLYSLLAFLLGMFLGVSAQTIHQWPVAEI SEQ ID NO:58 sequence KAVGSPLSLGCTIKGKSSPNLYWYWQATG
  • V beta 3 1 Gene ATGCTGTACTCTCTCCTTGCCTTTCTCCT SEQ ID NO:59 TABLE 4
  • V alpha 14 Gene ATGGACAAGATCCTGACAGCATCGTTTTT SEQ ID NO: 61 hybridomas 15 sequence ACTCCTAGGCCTTCACCTAGCTGGGGTGA
  • GAGGAGATCAGGTGGAGCAGAGTCCTTCA GCCCTGAGCCTCCACGAGGGAACCGGTTC TGCTCTGAGATGCAATTTTACGACCACCA TABLE 4
  • amino acid sequence is the one SEQ ID NO: 68 Sequence identifiable by a skilled person as derivable
  • Protein MQRNLGAVLGILWVQICWVRGDQVEQSPS SEQ ID NO: 69 sequence ALSLHEGTGSALRCNFTTTMRAVQWFQQN
  • TRBV30 Protein 73 Fragment Sequence [00204] Further data concerning the above sequences can be found in Figures 1-6 of the present application and of PCT/SE2010/050299 herein incorporated by reference in its entirety.
  • a skilled person will be able to identify further immunizing agents, e.g. inhibiting proteins or fragments and/or derivatives thereof, suitable to inhibit T cell response and/or provide a therapeutic effect on atherosclerosis in view of the present disclosure.
  • further agents will be identifiable using one of the hybridomas as herein described in detail for TRBV31 , TRAV 4, TRAV 12 and TRAV 14
  • DNA encoding TCR chains were subcloned into expression vectors and used to create transgenic mice (Hoist, J. et al., Nat Protoc, 1 , 406. 2006). Stimulation of spleen cells from TCR trangenic mice demonstrates that T cells carrying the TCR TRBV31 vividly respond to human ApoB l OO.
  • a skilled person will be able to identify further effects of the compounds herein described and in particular with reference to TRBV31 , TRAV 4, TRAV 12 and TRAV 14 and additional compound described in the hybridomas in connection with inhibition of T cell response and/or provide a therapeutic effect on atherosclerosis in view of the present disclosure.
  • T cell responses against modified LDL were investigated by immunizing mice with oxLDL.
  • T cell hybridomas were established from such mice and analyzed for their reactivity towards oxidized and native forms of LDL. None of the reactive clones responded to oxidized LDL but only to native LDL and purified apo lipoprotein B- 100. Responding hybridomas were CD3+4+8-, restricted by MHC class II antigen I-Ab, and expressed one single T cell receptor variable (V) beta chain (TRBV3 1 ) in combination with different V alpha chains.
  • V T cell receptor variable

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des méthodes et des systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose et/ou un état associé chez un individu, et des composés et des compositions associés.
PCT/IB2011/054178 2009-03-17 2011-09-22 Méthodes et systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose, et protéines, peptides et compositions associés WO2012038922A1 (fr)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP11773319.6A EP2618836A1 (fr) 2010-09-22 2011-09-22 Méthodes et systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose, et protéines, peptides et compositions associés
US13/825,037 US20130189292A1 (en) 2009-03-17 2011-09-22 Immunomodulatory methods and systems for treatment and/or prevention of atherosclerosis and related proteins, peptides and compositions
BR112013006571A BR112013006571A2 (pt) 2010-09-22 2011-09-22 métodos imunomoduladores e sistemas para tratamento e/ou prevenção de aterosclerose e proteínas, peptídeos e composições relacionadas
CA2813268A CA2813268A1 (fr) 2010-09-22 2011-09-22 Methodes et systemes immunomodulateurs pour traiter et/ou prevenir l'atherosclerose, et proteines, peptides et compositions associes
AU2011306376A AU2011306376A1 (en) 2010-09-22 2011-09-22 Immunomodulatory methods and systems for treatment and/or prevention of atherosclerosis and related proteins, peptides and compositions
JP2013529754A JP2013540753A (ja) 2010-09-22 2011-09-22 アテローム性動脈硬化の治療及び／又は予防のための免疫調節方法及びシステム、並びに関連するタンパク質、ペプチド及び組成物
IL225405A IL225405A0 (en) 2010-09-22 2013-03-21 Methods for immune modulation and systems for the treatment and/or prevention of atherosclerosis, proteins, peptides and preparations.

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US38554810P 2010-09-22 2010-09-22
US61/385,548 2010-09-22
US201113257045A 2011-09-16 2011-09-16
US13/257,045 2011-09-16

Publications (1)

Publication Number Publication Date
WO2012038922A1 true WO2012038922A1 (fr) 2012-03-29

Family

ID=44936316

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2011/054178 WO2012038922A1 (fr) 2009-03-17 2011-09-22 Méthodes et systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose, et protéines, peptides et compositions associés

Country Status (7)

Country Link
EP (1) EP2618836A1 (fr)
JP (1) JP2013540753A (fr)
AU (1) AU2011306376A1 (fr)
BR (1) BR112013006571A2 (fr)
CA (1) CA2813268A1 (fr)
IL (1) IL225405A0 (fr)
WO (1) WO2012038922A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8524234B2 (en) 2011-11-03 2013-09-03 Tolera Therapeutics, Inc Antibody for selective inhibition of T-cell responses
US8609605B2 (en) 2009-03-17 2013-12-17 Cardiovax, Llc Immunomodulatory methods for treatment of atherosclerosis via inhibition of CD4+ T cell response to APOB100
US8722049B2 (en) 2011-11-03 2014-05-13 Tolera Therapeutics, Inc. Antibody and methods for selective inhibition of T-cell responses
WO2018236909A1 (fr) * 2017-06-20 2018-12-27 La Jolla Institute For Allergy And Immunology Récepteurs de lymphocytes t modifiés et leurs procédés d'utilisation dans la modulation de réponses inflammatoires et le traitement de l'athérosclérose

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
US20040002111A1 (en) * 2000-03-15 2004-01-01 Goran Hansson Atherosclerosis vaccine
US20090208538A1 (en) * 2007-07-05 2009-08-20 Darnell Robert B Methods and compositions for tumor vaccination and therapy
WO2010107380A1 (fr) * 2009-03-17 2010-09-23 Forskarpatent I Syd Ab Procédés immunomodulateurs et systèmes de traitement et/ou de prévention de l'athérosclérose et protéines, peptides et compositions apparentés

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
US20040002111A1 (en) * 2000-03-15 2004-01-01 Goran Hansson Atherosclerosis vaccine
US20090208538A1 (en) * 2007-07-05 2009-08-20 Darnell Robert B Methods and compositions for tumor vaccination and therapy
WO2010107380A1 (fr) * 2009-03-17 2010-09-23 Forskarpatent I Syd Ab Procédés immunomodulateurs et systèmes de traitement et/ou de prévention de l'athérosclérose et protéines, peptides et compositions apparentés

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
A. HERMANSSON ET AL: "Inhibition of T cell response to native low-density lipoprotein reduces atherosclerosis", JOURNAL OF EXPERIMENTAL MEDICINE, vol. 207, no. 5, 10 May 2010 (2010-05-10), pages 1081 - 1093, XP055015851, ISSN: 0022-1007, DOI: 10.1084/jem.20092243 *
BOREN, J., LEE, I., ZHU, W., ARNOLD, K., TAYLOR, S., INNERARITY, T.L.: "Identification of the low density lipoprotein receptor-binding site in apolipoprotein B100 and the modulation of its binding activity by the carboxyl terminus in familial defective apo-B100", J CLIN INVEST, vol. 101, 1998, pages 1084 - 1093
CHOU PY, FASMAN GO, ADV ENZYMOL RELAT AREAS MOL BIOI., vol. 47, 1978, pages 45 - 148
FREIGANG, S., HORKKO, S., MILLER, E., WITZTUM, J.L., PALINSKI, W.: "Immunization of LDL receptor-deficient mice with homologous malondialdehyde-modified and native LDL reduces progression of atherosclerosis by mechanisms other than induction of high titers of antibodies to oxidative neoepitopes", ARTERIOSCLER THROMB VASC BIOL, vol. 18, 1998, pages 1972 - 1982
GIULIETTI, A, OVERBERGH, L., VALCKX, D., DECALLONNE, B., BOUILLON, R., MATHIEU, C.: "An overview of real-time quantitative PCR: applications to quantify cytokine gene expression", METHODS, vol. 25, 2001, pages 386 - 401, XP002272122, DOI: doi:10.1006/meth.2001.1261
HAVEL, RJ., EDER, H.A., BRAGDON, J.H.: "The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum", J CLIN INVEST, vol. 34, 1955, pages 1345 - 1353
HERMANSSON ET AL.: "Inhibition of T cell response to native low-density lipoprotein reduces atherosclerosis", J EXP MED 2010, vol. 207, 3 May 2010 (2010-05-03), pages 1081 - 1093, XP055015851, DOI: doi:10.1084/jem.20092243
HOLST, J. ET AL., NAT PROTOC, vol. 1, 2006, pages 406
JAMESON BA, WOLF H.: "Division of Biology", vol. 4, March 1988, CALIFORNIA INSTITUTE OF TECHNOLOGY, pages: 181 - 6
KAPPLER, J.W., SKIDMORE, B., WHITE, J., MARRACK, P.: "Antigen- inducible, H-2- restricted, interleukin-2-producing T cell hybridomas. Lack of independent antigen and H-2 recognition", J EXP MED, vol. 153, 1981, pages 1198 - 1214
KETELHUTH, D.F., TONINI, G.C., CARVALHO, M.D., RAMOS, R.F., BOSCHCOV, P., GIDLUND, M.: "Autoantibody response to chromatographic fractions from oxidized LDL in unstable angina patients and healthy controls", SCAND J IMMUNOL, vol. 68, 2008, pages 456 - 462
KYTE, DOOLITTLE: "A simple method for displaying the hydropathic character of a protein", J MOL BIOL., vol. 157, no. 1, 5 May 1982 (1982-05-05), pages 105 - 32, XP024014365, DOI: doi:10.1016/0022-2836(82)90515-0
LAURA RADDRIZZANI, JUERGEN HAMMER, BRIEFINGS IN BIOINFORMATICS, vol. I, no. 2, May 2000 (2000-05-01), pages 179 - 189
LEFRANC, M.P., POMMIE, C., RUIZ, M., GIUDICELLI, V., FOULQUIER, E., TRUONG, L., THOUVENIN-CONTET, V., LEFRANC, G.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", DEV COMP IMMUNO, vol. 127, 2003, pages 55 - 77, XP055144492, DOI: doi:10.1016/S0145-305X(02)00039-3
LEFRANC, M.P., POMMIE, C., RUIZ, M., GIUDICELLI, V., FOULQUIER, E., TRUONG, L., THOUVENIN-CONTET, V., LEFRANC, G.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", OEV COMP IMMUNOL, vol. 27, 2003, pages 55 - 77, XP055144492, DOI: doi:10.1016/S0145-305X(02)00039-3
LINTON, M.F., FARESE, RV., JR., CHIESA, G., GRASS, D.S., CHIN, P., HAMMER, RE., HOBBS, H.H., YOUNG, S.G.: "Transgenic mice expressing high plasma concentrations of human apolipoprotein B 100 and lipoprotein(a", J CLIN INVEST, vol. 92, 1993, pages 3029 - 3037, XP008020873, DOI: doi:10.1172/JCI116927
LU: "Common Principles in Protein Folding and Antigen Protection", TIBTECH, vol. 9, July 1991 (1991-07-01), pages 238 - 242, XP023571887, DOI: doi:10.1016/0167-7799(91)90077-U
MAKSYUTOV AZ, ZAGREBELNAYA ES, COMPUT APPL BIOSCL, vol. 9, no. 3, June 1993 (1993-06-01), pages 291 - 7
MARGALIT H, SPOUGE JL, CORNETTE JL, CEASE KB, DELISI C, BERZOFSKY JA, J., IMMUNOL., vol. 138, no. 7, 1 April 1987 (1987-04-01), pages 2213 - 29
NICOLETTI, A., KAVERI, S., CALIGIURI, G., BARIETY, J., HANSSON, G.K.: "Immunoglobulin treatment reduces atherosclerosis in apo E knockout mice", J CLIN INVEST, vol. 102, 1998, pages 910 - 918
PALINSKI, W., YLA-HERTTUALA, S., ROSENFELD, M.E., BUTLER, S.W., SOCHER, S.A., PARTHASARATHY, S., CURTISS, L.K., WITZTUM, J.L.: "Antisera and monoclonal antibodies specific for epitopes generated during oxidative modification of low density lipoprotein", ARTERIOSCLEROSIS, vol. 10, 1990, pages 325 - 335
PELLEQUER JL, WESTHOF E., J MOL GRAPH., vol. 11, no. 3, September 1993 (1993-09-01), pages 204 - 10,1912
PUHL, H., WAEG, G., ESTERBAUER, H.: "Methods to determine oxidation of low-density lipoproteins", METHODS ENZYMOL, vol. 233, 1994, pages 425 - 441
REYES VE, LEW RA, LU S., HUMPHREYS RE, METHODS ENZYMOL., vol. 202, 1991, pages 22538
SKALEN, K., GUSTAFSSON, M., RYDBERG, E.K., HULTEN, L.M., WIKLUND, 0., INNERARITY, T.L., BOREN, J.: "Subendothelial retention of atherogenic lipoproteins in early atherosclerosis", NATURE, vol. 417, 2002, pages 750 - 754
URBAN, R.G., CHICZ, R.M., STROMINGER, J.L.: "Selective release of some invariant chain-derived peptides from HLA-DR 1 molecules at endosomal pH", J EXP MED, vol. 180, 1994, pages 751 - 755
WESSEL, D., FLUGGE, U.I.: "A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids", ANAL BIOCHEM, vol. 138, 1984, pages 141 - 143, XP024764511, DOI: doi:10.1016/0003-2697(84)90782-6
YAO, Z.M., BLACKHART, B.D., JOHNSON, D.F., TAYLOR, S.M., HAUBOLD, K.W., MCCARTHY, B.J.: "Elimination of apolipoprotein B48 formation in rat hepatoma cell lines transfected with mutant human apolipoprotein B cDNA constructs", J BIOL CHEM, vol. 267, 1992, pages 1175 - 1182
YLA-HERTTUALA, S., PALINSKI, W., BUTLER, S.W., PICARD, S., STEINBERG, D., WITZTUM, J.L.: "Rabbit and human atherosclerotic lesions contain IgG that recognizes epitopes of oxidized LDL", ARTERIOSCLER THROMB, vol. 14, 1994, pages 32 - 40
ZHOU X ET AL., ARTERIOSCLER THROMB VASC BIOL, vol. 21, 2001, pages 108 - 114

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8609605B2 (en) 2009-03-17 2013-12-17 Cardiovax, Llc Immunomodulatory methods for treatment of atherosclerosis via inhibition of CD4+ T cell response to APOB100
US8524234B2 (en) 2011-11-03 2013-09-03 Tolera Therapeutics, Inc Antibody for selective inhibition of T-cell responses
US8722049B2 (en) 2011-11-03 2014-05-13 Tolera Therapeutics, Inc. Antibody and methods for selective inhibition of T-cell responses
US8968739B2 (en) 2011-11-03 2015-03-03 Tolera Therapeutics, Inc. Antibody and methods for selective inhibition of T-cell responses
WO2018236909A1 (fr) * 2017-06-20 2018-12-27 La Jolla Institute For Allergy And Immunology Récepteurs de lymphocytes t modifiés et leurs procédés d'utilisation dans la modulation de réponses inflammatoires et le traitement de l'athérosclérose

Also Published As

Publication number Publication date
AU2011306376A1 (en) 2013-04-04
JP2013540753A (ja) 2013-11-07
EP2618836A1 (fr) 2013-07-31
BR112013006571A2 (pt) 2017-11-14
IL225405A0 (en) 2013-06-27
CA2813268A1 (fr) 2012-03-29

Similar Documents

Publication Publication Date Title
Hermansson et al. Inhibition of T cell response to native low-density lipoprotein reduces atherosclerosis
US20130189292A1 (en) Immunomodulatory methods and systems for treatment and/or prevention of atherosclerosis and related proteins, peptides and compositions
JP6364352B2 (ja) 部分的ｍｈｃコンストラクト及びその使用方法
US10730919B2 (en) Peptides
AU2018266562A1 (en) Human alpha fetoprotein-specific T cell receptors and uses thereof
US20040002111A1 (en) Atherosclerosis vaccine
CA2110055C (fr) Utilisation de peptides du recepteur de lymphocytes t contre les maladies du systeme immunitaire
EA019370B1 (ru) Пептиды fviii и их применение для индукции толерантности у больных гемофилией
WO2012038922A1 (fr) Méthodes et systèmes immunomodulateurs pour traiter et/ou prévenir l'athérosclérose, et protéines, peptides et compositions associés
Lu et al. Human abdominal aortic aneurysm (AAA): Evidence for an autoimmune antigen-driven disease.
RU2322260C2 (ru) Пассивная иммунизационная терапия на основе пептидов для лечения атеросклероза
EP0753005B1 (fr) Regulation de l'activite des lymphocytes t cytotoxiques par des peptides de cmh de classe i
US10858422B2 (en) Methods for treating systemic lupus erythematosus with an anti-apolipoprotein B antibody
Myers et al. PART III. Autoimmunity An Altered Peptide Ligand of Type II Collagen Suppresses Autoimmune Arthritis
Berrih-Aknin Myasthenia gravis, a model of organ-specific autoimmune disease
OFFNER et al. Prevention, suppression, and treatment of experimental autoimmune encephalomyelitis with a synthetic T cell receptor V region peptide
Musselli et al. Antigenized antibodies expressing Vβ8. 2 TCR peptides immunize against rat experimental allergic encephalomyelitis
Holmdahl et al. Elucidation of pathways leading to rheumatoid arthritis by genetic analysis of animal models
CA2299678A1 (fr) Sequence nucleique du recepteur rii du tgf.beta., peptide code, et utilisations
WO2020096965A1 (fr) Antigènes du paludisme sur la surface d'érythrocytes et de mérozoïtes et anticorps protecteurs
EP3860644A1 (fr) Polypeptides recombinants comprenant des domaines dra1 de classe ii du cmh modifiés et procédés d'utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11773319

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2013529754

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 225405

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2813268

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011773319

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2011306376

Country of ref document: AU

Date of ref document: 20110922

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13825037

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2013118318

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013006571

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013006571

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130322