WO2012028697A1 - Affinity purification system based on donor strand complementation - Google Patents

Affinity purification system based on donor strand complementation Download PDF

Info

Publication number
WO2012028697A1
WO2012028697A1 PCT/EP2011/065148 EP2011065148W WO2012028697A1 WO 2012028697 A1 WO2012028697 A1 WO 2012028697A1 EP 2011065148 W EP2011065148 W EP 2011065148W WO 2012028697 A1 WO2012028697 A1 WO 2012028697A1
Authority
WO
WIPO (PCT)
Prior art keywords
ds
molecule
tag
preferably
protein
Prior art date
Application number
PCT/EP2011/065148
Other languages
French (fr)
Inventor
Rudolf Glockshuber
Alfons Nichtl
Chasper Puorger
Christoph Giese
Michael Schraeml
Original Assignee
Eth Zürich, Institute Of Molecular Biology And Biophysics
Roche Diagnostics Gmbh
F. Hoffmann-La Roche Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP10009077.8 priority Critical
Priority to EP10009077 priority
Application filed by Eth Zürich, Institute Of Molecular Biology And Biophysics, Roche Diagnostics Gmbh, F. Hoffmann-La Roche Ag filed Critical Eth Zürich, Institute Of Molecular Biology And Biophysics
Publication of WO2012028697A1 publication Critical patent/WO2012028697A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/14Extraction; Separation; Purification
    • C07K1/16Extraction; Separation; Purification by chromatography
    • C07K1/22Affinity chromatography or related techniques based upon selective absorption processes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245Escherichia (G)

Abstract

Provided is a novel set of tags for the rapid immobilization and/or purification of proteins or other biological or organic molecules. In particular, a system based on donor strand (Ds) complementation comprising a Ds-tag and a cognate ligand of the Ds-tag for use in protein and protein complex purification, for the preparation of biochips as well as for the identification and detection of target proteins is described.

Description

Affinity purification system based on donor strand complementation

Field of the invention

The present invention relates to methods and reagents for purification and/or detection of polypeptides or other molecules. In particular, this invention relates to a system based on donor strand (Ds) complementation comprising a Ds-tag and a cognate ligand of the Ds-tag as protein tags and affinity ligands for use in immobilization and/or affinity purification procedures.

Background of the invention

A number of approaches have been developed for the isolation and purification of proteins, particularly recombinant proteins, from other components of a biological sample. One general approach exploits the non-specific affinity of a protein for a substrate. Thus, for example, proteins can be separated based upon their molecular charge using ion exchange chromatography. In such an approach, biological samples are applied to a charged chromatographic matrix, and the various proteins bind to the matrix by reversible, electrostatic interactions. The adsorbed proteins are eluted, in order of least to most strongly bound, by increasing the ionic strength or by varying the pH of the elution buffer. However, often the protein of interest will elute with other proteins with similar charge characteristics, rendering this approach undesirable for many applications.

Another general approach utilizes a protein's physical characteristics as a means of purification. For example, a protein may be separated from other proteins based upon its size, using gel filtration or other size separation methods. However, this approach is often inefficient because a protein of interest may co-elute with many other proteins of similar size.

A third general approach, affinity chromatography, is more specific and much more efficient than the above purification methods, because it makes use of the specific affinity of a protein for a purifying reagent such as an antibody or ligand to which it specifically binds. For example, a protein that is an antigen for an antibody may be purified using that antibody as an affinity ligand, or conversely, an antibody may be purified using its specific antigen as an affinity ligand. Typically, an affinity ligand such as an antibody or antigen is covalently bound to a substrate to form an affinity matrix. The matrix is contacted by a solution which includes the binding partner of the affinity ligand (i.e., a protein of interest), allowing formation of a substrate-bound affinity complex. Formation of the affinity complex may occur in a column. Alternatively, affinity complexes may be formed in solution, with the affinity ligand covalently linked to a solid particle such as sepharose or agarose, with the complexes then isolated by centrifugation. To recover the protein of interest, the affinity complex is destabilized, e.g., by exposure to buffers of very high ionic strength or high or low pH. In another example of affinity purification, immunocomplex formation may be exploited to purify an antigen or antibody by immunoprecipitation. Antigen-antibody complexes may be aggregated and precipitated following formation, followed by release of the antigen (i.e., a protein of interest) from the immunocomplex as described above.

Typically, in affinity purification, it is desirable to have a specific, but relatively low affinity interaction between binding partners in order not to impair the function of the purified recombinant protein with a harsh elution protocol. In particular, it is often desirable to elute the purified protein without using a denaturing reagent.

A number of binding pairs are known that are suitable for affinity purification.

One member of a binding pair may be used to "tag" a protein of interest, with the other member used as an affinity ligand. Such a protein "tag" may be "fused" recombinantly and expressed to produce a fusion protein with the tag attached. The "tagged" fusion protein is then affinity purified by interaction with the binding partner of the tag and the tag is then optionally cleaved to release pure protein.

A variety of fusion tags have been used to date for recombinant proteins. Such tags include peptides that recognize a specific antibody such as the myc tag (see e.g., Munro and Pelham Cell 46 (1986), 291 -300; Ward et al. (1989) Nature, 341 :, 544-546), the Flag-peptide (see e.g., Hopp et al (1988) BioTechnology, 6: 1204-1210), the KT3 epitope (Martin et al. (1990) Cell, 63 : 843-849, Martin et al (1992) Science, 255 : 192- 194), an a-tubulin epitope (Skinner et al (1991) J. Biol. Chem., 266: 14163-14166), and the T7 gene 10 protein peptide tag (Lutz- Freyermuth et al. (1990) Proc. Natl. Acad. Sci., USA, 87: 6393-6397). Other tags include poly-histidine tails that bind to nickel-chelating agarose (Skerra et al. (1991) BioTechnology, 9: 273-278; Lilius et al (1991) Eur. J. Biochem., 198,499-504), and the strep-tag, a peptide tag binding to streptavidin (see, e.g., Schmidt and Skerra, (1993) Protein Engineering, 6: 109-122). Still other tags involve a protein domain that forms a complex with a second (macro) molecule e. g. glutathione-S- transferase (Smith and Johnson (1988) Gene 67: 31-40), bovine pancreatic trypsin inhibitor (BPTI) (Borijin and Nathans (1993) Proc. Natl. Acad. Sci., USA, 90,337-341), maltose binding protein (MBP) (Bedouelle and Duplay (1988) Eur. J. Biochem. 171 541- 549; Maina et al. (1988) Gene 74 365-373), or a polypeptide sequence that can be biotinylated, allowing interaction with avidin or streptavidin (Schatz, P. J. (1993) Bio/Technology 11,1138-1143).

Currently-available fusion tagging systems suffer from drawbacks that include low solubility of tagged fusion proteins and inability to purify tagged proteins from crude cell extracts in sufficient purity and yield. Furthermore, under denaturing or reducing conditions that are common in many protein purification protocols it is hardly possible to purify protein complexes, especially active enzymes which consist of different subunits or form a multi- enzyme complex.

Thus, there is a need for an improved tagging system that allows easy purification of tagged fusion proteins and in particular enzymes and enzyme complexes in a manner that they remain enzymaticaly active after affinity purification.

The above-mentioned problems are solved by the embodiments characterized in the claims and described further below.

Summary of the invention

The invention provides methods and compositions for tagging and purification of molecules such as polypeptides and fusion proteins, using a system based on donor strand (Ds) complementation comprising a Ds-tag and a cognate ligand of the Ds-tag such as FimGt of type 1 pili from E. coli.

Thus, the present invention relates to a method of purifying a donor-strand (Ds)-tagged molecule, e.g. fusion protein, said method comprising contacting a sample comprising the Ds- tagged molecule with an affinity matrix that comprises a cognate ligand of the Ds-tag, thereby immobilizing the Ds-tagged molecule on the affinity matrix. The Ds molecule may be at the N-terminus and/or at the C-terminus of the fusion protein and may comprise in addition one or more amino acid residues between the N-terminus and the C-terminus.

In accordance with the present invention a novel affinity tag for immobilization and purification of recombinant proteins and recombinant protein-ligand complexes has been developed. The tag used for illustrating the present invention, termed DsF, is a 15-residue peptide that corresponds to the N-terminal segment of the Escherichia coli type 1 pilus subunit FimF, which can be fused to either the N-terminus or the C-terminus of a protein of interest. The binding protein that specifically recognizes the DsF peptide is cognate ligand, e.g. an N-terminally truncated variant of the Escherichia coli type 1 pilus subunit FimG, termed FimGt, in which the first 12 residues of the natural FimG protein are lacking. The FimG DsF complex is the kinetically most stable, noncovalent protein-ligand complex known to date, with an extrapolated half-life of dissociation of about 3 billion years (Puorger et al, Structure 16 (2008), 631-642). The peptide is bound specifically in a long binding groove of FimGt and completes the incomplete, immunoglobulin-like fold of FimGt through extensive β-sheet interactions with FimGt (Puorger et al, 2008); see also Fig 1C. The FimG variant FimGt was used instead of the wild type protein to prevent self-polymerization of FimG, as the N-terminal FimG segment can compete with DsF for binding and cause self- polymerization of FimG.

Due to the infinite stability of the complex against dissociation under physiological conditions and the very specific recognition of the DsF peptide (Puorger et al, 2008), the FimG DsF system is not only suitable for purification/identification of recombinant proteins through binding on covalently immobilized FimGt, but also for stable immobilization of recombinant proteins on surfaces, in particular under conditions where other, well established affinity tags dissociate from their binding proteins due to their limited kinetic stability against dissociation.

In a preferred embodiment of the present invention the Ds-tagged fusion protein comprises a linker between said Ds molecule and the target polypeptide, preferably a polypeptide linker. Thus, the fusion protein may have the formula: A-B-C or C-B-A, wherein B may be present or not, and wherein

(i) A comprises a Ds-tag; (ii) B is a polypeptide linker comprising or constituting with A or C a chemical or enzymatic cleavage site; and

(iii) C is target protein.

In a particular preferred embodiment of the present invention, said cleavage site comprises a protease recognition site, most preferably wherein said protease is a nuclear inclusion protein a (NIa) protease and derived from tobacco etch virus (TEV). Preferably, the polypeptide linker comprises the amino acid sequence S GGS GGENL YFQG S GGS GG. (SEQ ID NO: 24)

Accordingly, in one embodiment of the method of the present invention the Ds-tagged polypeptide is released from said affinity matrix by chemical or enzymatic cleavage at the cleavage site, preferably by protease cleavage at the protease recognition site. In this context, the affinity matrix may be formed by irreversibly linking the cognate ligand of the Ds-tag to a substrate via reactive amino groups of said ligand, for example wherein the affinity matrix comprises a substrate selected from the group consisting of cross-linked polysaccharide, agarose, ceramic, metal, glass, plastic, and cellulose. Preferably, the affinity matrix comprises sepharose.

In another embodiment of the present invention, the Ds-tagged polypeptide is released from said affinity matrix by a denaturing agent, i.e. by denaturing the affinity matrix bound cognate ligand of Ds such FimGt. The denaturing agent may comprise, for example, urea, guanidium hydrochloride, guanidium thiocyanat or sodium dodecyl sulfate (SDS). This embodiment is suitable for example in pull-down experiments aiming at purifying and identifying binding partners of the tagged molecule, which are subsequently subjected to analysis by, e.g., mass spectroscopy, Edman sequencing and the like, which can be performed with denatured polypeptides as well. Accordingly, in this embodiment it is not necessary that the biological activity of the tagged molecule, if any, is retained.

As could be demonstrated in the examples, the method of the present invention is advantageously applicable to samples of cell extracts and capable of purifying the target molecule within one step from the crude protein mixture. In a further aspect, the present invention relates to a molecule or molecule complex purified according to the method of the present invention described herein, in particular wherein the molecule or molecule complex comprises a Ds-tagged molecule.

In a still further aspect, the present invention relates to an affinity matrix as defined above and described further below, which is capable of specifically binding a Ds-tagged molecule. In some embodiments the affinity matrix of the present invention further comprises a bound Ds- tagged molecule or molecule complex, for example a protein or protein complex, preferably an enzyme or enzyme complex. This embodiment is particularly suitable for the manufacturing of a chip, e.g. biochip comprising the affinity matrix, which is also subject of the present invention.

Furthermore, the present invention relates to a kit comprising the mentioned affinity matrix and optionally instructions for use in a method of purifying a Ds-tagged molecule, preferably further comprising components for producing a Ds-tagged molecule.

In addition, the present invention relates to a method for detecting a Ds-tagged molecule, for example on a Western or dot blot; or on a cell sample or tissue section, comprising contacting said Ds-tagged molecule with a cognate ligand of the Ds-tag as defined herein, preferably wherein said ligand is detectably labeled. The label may, e.g., be an enzyme; a heavy metal, preferably gold; a dye, preferably a fluorescent or luminescent dye; or a radioactive label.

In this context, the present invention also relates to a kit comprising a labeled ligand as defined above and optionally instructions for use in a method of detecting a Ds-tagged molecule, preferably further comprising components for producing a Ds-tagged molecule.

Hence, the present invention relates to a system based on donor strand complementation comprising a Ds-tag and a cognate ligand of the Ds-tag as defined in any one of the preceding claims for use in an application selected from the group consisting of high throughput screening, study of receptor-ligand interaction, identification of binding partners such as in pull-down experiments, and study of binding kinetics.

Furthermore, experiments performed within the scope of the present invention surprisingly revealed that the Ds-tag/cognate ligand system of the present invention is particularly suitable for use in immunological assays by replacing the commonly used biotin/(strept)avidin system. In particular, the high specificity and remarkable low dissociation constant which seems even to decrease when either the Ds-tag or its cognate ligand is immobilized on a matrix as solid support will make the Ds-tag/cognate ligand system of the present invention an important new means in diagnostic assays.

Thus in a further aspect, the present invention relates to a specific binding assay, preferably an immunoassay, based on donor strand complementation comprising a Ds-tagged antigen binding molecule and an affinity matrix comprising the cognate ligand of the Ds-tag as defined hereinabove and illustrated below.

In one embodiment of the present invention said immunological test is an immunological sandwich test for determining an antigen of interest. In accordance with the present invention such an immunological sandwich test comprises at least one first antigen-binding molecule recognizing an antigen of interest and conjugated to the Ds-tag, at least one second antigen- binding molecule recognizing said antigen of interest which optionally is detectably labeled, and an affinity matrix comprising the cognate ligand of the Ds-tag immobilized thereon.

In addition, at least one second antigen-binding molecule, e.g., a second antibody, which recognizes the antigen of interest at an epitope different from the epitope bound by said first antigen-binding molecule, can be used in the above-mentioned immunological sandwich test.

In a preferred embodiment of the immunological test of the present invention at least one of the antibody or antigen-binding molecules as described above is labeled, for example with a label selected from the group consisting of an enzyme, a radioisotope, a fluorescent or luminescent dye, a magnetic particle, a metal, a peptide tag, a colored particle, biotin, avidin and streptavidin.

In one embodiment of the present invention said immunological test is a competitive immunoassay. In such assay for determining an antigen of interest an affinity matrix (i.e., a matrix comprising immobilized thereon a cognate ligand of the Ds-tag as defined hereinabove and below) and at least one first Ds-tagged antigen-binding molecule are used. In the assay the analyte of interest in the sample competes with a spiked, detectably labeled analyte of interest for binding to said first antigen-binding molecule. In a competitive assay the amount of spiked labeled analyte of interest bound to said first antigen-binding molecule is inversely proportional to the amount of analyte in the sample.

Typically, in the immunological test of the present invention the second antibody which recognizes the antigen or the first antigen-binding molecule is labeled. However, in some embodiments of the immunological test of the present invention alternatively or in addition the first antibody may be labeled. In this embodiment, binding of the antigen and the second antigen-binding molecule, e.g., the second antibody, to the first antigen-binding molecule (e.g., the first antibody) may be traced by a quenching effect due to the binding which results in a change of the label of said first antibody, for example in a change of fluorescence in case of a fluorescence tag or in masking of the label, for example, in case of a gold particle.

In respect of the above mentioned immunological tests, different affinity matrices both in material and shape can be used. Materials which may be used for the generation of such affinity matrices according to the present invention are known in the art and will be discussed in detail further below. Non-limiting examples of such materials are cellulose, agarose, sepharose, paper, plastic, natural and synthetic latex, glass, ceramics, metals, polysaccharides, proteins. Exemplary, but non-limiting shapes of the affinity matrix which may be used in accordance with the present invention are beads, thin films, test strips, plates and sensor chips. Further shapes will be described in the detailed description below.

Furthermore, the present invention also relates to methods for detecting an antigen of interest, characterized in that an immunological test as described herein above and below is used. In a particular preferred embodiment, the immunological test is designed as a rapid test and comprises a test strip similar to those hitherto commonly used in immunological tests described in the prior art; see also the patent literature cited infra.

While in the following the present invention will be explained in more detail with respect to FimGt - DsF complex of type 1 pili from E. coli and a cleavage linker for TEV protease, it is to be understood that unless indicated otherwise, the embodiments disclosed herein are equally applicable to any other pair of members of donor strand complementation and cleavage linker. Brief descriptions of the drawings:

Fig. 1: Scheme of one-step purification of DsF -tagged proteins / protein complexes from cell extracts via FimGt Sepharose and TEV protease cleavage. A: Work flow: E. coli cell extract containing a DsF-tagged protein/protein complex is incubated with FimGt Sepharose. After washing away impurities the target protein/protein complex is released by on-column cleavage using His-tagged TEV protease. His-tagged TEV protease can then be removed by ΝΪ2+-ΝΤΑ agarose yielding the pure protein/protein complex. B: Amino acid sequences of tagged constructs used in this study. LI and L2: Linker sequences; TEV-CS: TEV protease cleavage site. C: 1.34 A X-ray structure of the FimGt-DsF complex as described in Puorger et al, Structure 16 (2008), 631-642, the disclosure content of which is incorporated herein by reference.

Fig. 2: Binding kinetics of the DsF peptide to FimGt (5 μΜ) at four different DsF concentrations. A global fit of the four datasets according to second-order kinetics yields a second-order rate constant of 330 ± 8.9 M'V1. Together with the rate constant for dissociation obtained earlier (Puorger et al. 2008), the dissociation constant (KDiSS) for the FimGt/DsF complex can be calculated to 2.0 ± 1.8xl0"20 M. The binding kinetics demonstrate that DsF binding is sufficiently fast to guarantee immobilization of even very low concentrations of DsF-tagged proteins on FimGt- sepharose during overnight incubation.

Fig. 3: Coomassie-stained 15 % SDS-polyacrylamide gel demonstrating successful co- purification of the beta subunit of tryptophan synthase (TrpB) from cell extracts using different affinity -tagged TrpA variants and the corresponding affinity matrices, followed by TEV protease cleavage and removal of His-tagged TEV protease via Ni2+-NTA agarose. The figure demonstrates that the purification failed with StrepII- tagged TrpA, and that the highest purity could be obtained with DsF- and cmyc- tagged TrpA. M: Molecular mass standard; "untagged": negative control with untagged TrpA and FimGt-sepharose.

Fig. 4: Absolute, corrected and relative enrichment factors obtained for one-step purification of the tryptophan synthase complex using the different affinity tags. Absolute enrichment factors were corrected for the slightly diffent amounts of tryptophan synthase activity present in the different cell extracts. The results show that enrichment factor obtained with the DsF-tag is at least 2fold higher compared to all other affinity tags tested.

Fig. 5: Coomassie-stained 15 % SDS-polyacrylamide gel documenting the one-step purification of E. coli ribosomes from cell extracts via DsF -tagged L23. Identical banding patterns are obtained for ribosomes purified with the DsF-tag (lane 8) or by sucrose density gradient centrifugation (lane 9).

Lane l : 3.2 μΐ of the soluble extract before the incubation with FimGt- Sepharose

Lane 2: 3.2 μΐ of the soluble extract after the incubation with FimGt-Sepharose Lane 3 : 15 μΐ of the last washing step

Lane 4: 45 μΐ of FimGt-Sepharose beads before incubation with TEV protease

Lane 5: 45 μΐ of FimGt-Sepharose beads after incubation with TEV protease

Lane 6: eluted ribosomes before addition of Ni-NTA agarose

Lane 7: Ni-NTA agarose beads after removal of TEV protease

Lane 8: ribosomes after addition of Ni-NTA agarose

Lane 9: ribosomes obtained by sucrose density gradient centrifugation

Fig. 6: Electron micrographs of negatively-stained ribosomes purified by sucrose density gradient centrifugation or using L23-DsF. Ribosomes from both preparations show identical morphologies.

Fig. 7: 1 % denaturing agarose/formaldehyde gel of rRNAs from ribosomes purified by sucrose density gradient centrifugation or using L23-DsF. Identical banding patterns corresponding to 23 S-, 16S- and 5S-rRNA are visible for both samples.

Fig. 8: Schematic representation of Assay 1, a biomolecular interaction analysis of kinetics and thermodynamics for the determination of kinetics and Ds-tag/cognate ligand (FimGt) complex stability. For the measurements, the biotinylated 15aa Ds-tag (DsF(l-15)[15-Glu(Bi-PEG)]amide) as a ligand is non-covalently captured by binding to streptavidin on a Biacore SA sensors' chip surface and the interaction with FimGt (cognate ligand of the Ds-tag) as analyte is evaluated. Fig. 9: Biacore results of interaction experiments at temperatures ranging from 13°C to 37°C confirm earlier findings. The interaction between DsF (DsF(l-15)[15-Glu(Bi- PEG)]amide; 2,3kRU immobilized, 1 : 1 binding stoichiometry, analyzed with Rmax global) and FimGt is hydrophobic with slow ka and ultraslow !¾. ka accelerates with increasing temperature while kd drops resulting in a van't Hoff anomaly with an ultra high energy barrier for dissociation. The analyte (FimGt) was injected in a concentration dependent series ranging from 0 nM to 2700 nM; see as well Example 5 and Table 2.

Fig. 10: Due to the strong temperature dependency of free binding enthalpy dG° a non linear van't Hoff plot has been used showing the relationship between the dissociation constant ΚΌ and temperature (in Kelvin) (A); Eyring plots show the relationship between the association rate constant ka (B) or the dissociation rate constant kd (C) and the temperature of the reaction in Kelvin; see as well Example 5 and Table 3 for further details.

Fig. 11: Schematic representation of assays 2a to 2c, performing the reverse analysis as in assay 1, by immobilizing the cognate ligand of the Ds-tag (FimGt as immobilized ligand on the left) and measuring the interaction with the analytes Ds-tag (DsF; =DsF(l-15)[15-Glu(Bi-PEG)]amide) (A), Ds-tag (DsF) grafted to streptavidin (Bi*SA; =SA-grafted DsF(l-15)[15-Glu(Bi-PEG)]amide) (B) and Ds-tag coupled to an antigen-binding molecule (e.g., an antibody=Ab) (C).

Fig. 12: Schematic exemplary representations of immunological assay designs according to the present invention.

(A) represents an immunological sandwich test. The Ds-tag is covalently bound (recombinantly produced or chemically coupled) to an antigen-binding molecule (e.g. an antibody = Ab I) that specifically recognizes (binds to) an antigen. The Ds- tagged Ab I is bound indirectly/immobilized to a matrix or solid phase surface by the interaction between the Ds-tag and the cognate ligand of the Ds-tag. The presence of the antigen in the sample is evaluated by observing either directly (e.g., by fluorescence) or indirectly (e.g., by the products of an enzymatic reaction) the presence of a label, fused to a second antibody (Ab II) recognizing the same antigen at another epitope. The antigen itself may as well be labeled, e.g., by incorporation of radionuclides during its composition, and its presence or absence may therefore be evaluated by visualizing said label in an analogous fashion as the label of the second antibody.

(B) represents a competitive test according to the present invention. A known amount of a labeled antigen is added to the test sample. The presence and amount of non- labeled antigen in the tested sample is then evaluated by changes in the amount of labeled-antigen bound by the antigen binding molecule immobilized to the matrix.

Detailed description of the present invention

This present invention provides methods and reagents for purification of polypeptides or other molecules which provide an improved tagging system that allows easy purification of tagged fusion proteins and in particular enzymes and enzyme complexes in a manner that they remain enzymatically active after affinity purification. In particular, this invention relates to a system based on donor strand (Ds) complementation comprising a Ds-tag and a cognate ligand of the Ds-tag as protein tags and affinity ligands for use in immobilization and/or affinity purification procedures.

Definitions

Unless otherwise stated, a term as used herein is given the definition as provided in the Oxford Dictionary of Biochemistry and Molecular Biology, Oxford University Press, 1997, revised 2000 and reprinted 2003, ISBN 0 19 850673 2.

The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The term also includes variants on the traditional peptide linkage joining the amino acids making up the polypeptide.

The terms "nucleic acid" or "oligonucleotide" or "polynucleotide" or grammatical equivalents herein refer to at least two nucleotides covalently linked together. A nucleic acid of the present invention is preferably single-stranded or double- stranded and will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al. (1993) Tetrahedron 49 (10): 1925 and references therein); Letsinger (1970) J. Org Chem. 35: 3800; Sprinzl et al. (1977) Eur. J Biochem. 81 : 579; Letsinger et al. (1986) Nucl. Acids Res. 14: 3487; Sawai et al. (1984) Chem. Lett. 805, Letsinger et al. (1988) J. Am. Chem. Soc. 110: 4470; and Pauwels et al. (1986) Chemica Scripta 26 : 1419), phosphorothioate (Mag et al. (1991) Nucleic Acids Res. 19: 1437; and U. S. Patent No. 5,644, 048), phosphorodithioate (Briu et al. (1989) J. Am. Chem. Soc. I l l : 2321), O- methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues : A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm (1992) J. Am. Chem. Soc. 114: 1895 ; Meier et al. (1992) Chem. Int. Ed. Engl. 31 : 1008; Nielsen (1993) Nature, 365: 566; Carlsson et al. (1996) Nature 380: 207). Other analog nucleic acids include those with positive backbones (Denpcy et al. (1995) Proc. Natl. Acad. Sci. USA 92 : 6097), non-ionic backbones (U. S. Patent Nos. 5,386, 023,5, 637,684, 5,602, 240, 5,216, 141 and 4,469, 863; Angew. (1991) Chers. Intl. Ed. English 30: 423; Letsinger et al. (1988) J. Am. Chem. Soc. 110: 4470; Letsinger et al. (1994) Nucleoside & Nucleotide 13 : 1597; Chapters 2 and 3, ASC Symposium Series 580), "Carbohydrate Modifications in Antisense Research, "Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al. (1994), Bioorganic & Medicinal Chem. Lett. 4: 395; Jeffs et al. (1994) J. Biomolecular NMR 34: 17; Tetrahedron Lett. 37: 743 (1996) ) and non-ribose backbones, including those described in U. S. Patent Nos. 5,235, 033 and 5,034, 506, and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense Research, Ed. Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al. (1995), Chem. Soc. Rev. pp. 169-176). Several nucleic acid analogs are described in Rawls, C & E News June 2, 1997 page 35. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to increase the stability and half-life of such molecules in physiological environments.

The terms "binding partner" or a "member of a binding pair" or "cognate ligand" refer to molecules that specifically bind other molecules to form a binding complex such as antibody/antigen, lectin/carbohydrate, nucleic acid/nucleic acid, receptor/receptor ligand {e.g. IL-4 receptor and IL-4), avidin/biotin, etc. Cognate ligands of donor strand peptide (DsF) of FimF of Type 1 pili of E. coli include the neighboring subunit FimG.

The term "donor strand complementation" and "donor strand" refer to the assembly mechanism of the subunits FimA, FimF, FimG, FimH and Fiml in the formation of type 1 pili. The structural type 1 pilus subunits are homologous, one domain proteins that share an immunoglobulin-like fold lacking the C-terminal β strand (Choudhury et al, Science 285 (1999), 1061). The subunits FimA, FimF, FimG and Fiml each possess an N-terminal extension of 15-20 residues that serves as a donor strand and completes the fold of the preceding subunit. This assembly mechanism, reminiscent of "domain swapping" (Bennett et al, Proc. Natl. Acad. Sci. USA 91 (1994), 3127-3131), is termed donor strand complementation (DSC) (Choudhury et al, Science 285 (1999), 1061; Sauer et al, Science 285 (1999), 1058-1061). FimH lacks an N-terminal donor strand and, instead, possesses an N- terminal lectin domain that is fused to the FimH pilin domain and is responsible for receptor binding (Choudhury et al. (1999), supra; Hahn et al, J. Mol. Biol. 323 (2002), 845-857).

The terms "Ds" and "DsF" refer to donor strands such as of FimF and fragments, sequence variants, mutated forms, modified forms, and analogues thereof that retain the ability to bind to a cognate ligand such as FimG and FimGt, respectively. Because FimG has a natural N- terminal donor strand, preferably an N-terminally truncated variant of FimG without donor strand (FimGt) (Vetsch et al, Nature 431 (2004), 329-333. 2004) is used as cognate ligand to prevent self-assembly of FimG and to unequivocally assess the effect of Ds. In one embodiment, the Ds-tag peptide consists of the sequence ADSTITIRGYVRDNG.

The term "cognate ligand of Ds" or "cognate ligand of Ds-tag" refers to a polypeptide capable of donor strand complementation such as FimGt with DsF and to fragments, sequence variants, modified forms, and analogues thereof that retain the ability to bind to Ds. Preferably an N-terminally truncated variant of FimG without donor strand, i.e. residues 1-12 (FimGt) is used as described in Vetsch et al, Nature 431 (2004), 329-333. 2004.

A "variant" includes peptides having an amino acid sequence sufficiently similar to the amino acid sequence of the natural DsF peptide. The term "sufficiently similar" means a first amino acid sequence that contains a sufficient or minimum number of identical or equivalent amino acid residues relative to a second amino acid sequence such that the first and second amino acid sequences have a common structural domain and/or common functional activity. For example, amino acid sequences that comprise a common structural domain that is at least about 45%, at least about 50%>, at least about 55%>, at least about 60%>, at least about 65%>, at least about 70%>, at least about 75%>, at least about 80%>, at least about 85%>, at least about 90%), at least about 91%>, at least about 92%>, at least about 93%>, at least about 94%>, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100%, identical are defined herein as sufficiently similar. Preferably, variants will be sufficiently similar to the amino acid sequence of the preferred peptides of the present invention, in particular to DsF peptide as described in the Examples. Such variants generally retain the functional activity to bind to the cognate ligand of the native Ds of the present invention. Variants include peptides that differ in amino acid sequence from the native and wt hydrophobic peptide, respectively, by way of one or more amino acid deletion(s), addition(s), and/or substitution(s). These may be naturally occurring variants as well as artificially designed ones.

"Similarity" between two peptides is determined by comparing the amino acid sequence of one peptide to the sequence of a second peptide. An amino acid of one peptide is similar to the corresponding amino acid of a second peptide if it is identical or a conservative amino acid substitution. Conservative substitutions include those described in Dayhoff, M.O., ed., The Atlas of Protein Sequence and Structure 5, National Biomedical Research Foundation, Washington, D.C. (1978), and in Argos, EMBO J. 8 (1989), 779-785. For example, amino acids belonging to one of the following groups represent conservative changes or substitutions: -Ala, Pro, Gly, Gin, Asn, Ser, Thr; -Cys, Ser, Tyr, Thr; -Val, He, Leu, Met, Ala, Phe; -Lys, Arg, His; -Phe, Tyr, Tip, His; and -Asp, Glu.

In a "chimeric molecule", two or more molecules that are capable of existing separately are joined together to form a single molecule having the desired functionality of all of its constituent molecules. The constituent molecules of a chimeric molecule can be joined synthetically by chemical conjugation or, where the constituent molecules are all polypeptides, polynucleotides encoding the polypeptides may be fused together recombinantly such that a single continuous polypeptide is expressed. Such a chimeric polypeptide is termed a "fusion protein". A "fusion protein" is a chimeric molecule in which the constituent molecules are all polypeptides and are attached (fused) to each other such that the chimeric molecule forms a continuous single chain. The various constituents can be directly attached to each other or can be coupled through one or more peptide linkers.

A "spacer" or "linker" as used in reference to a chimeric molecule refers to any molecule that links or joins the constituent molecules of the chimeric molecule. Where the chimeric molecule is a fusion protein, the linker may be a peptide that joins the proteins comprising a fusion protein. Although a spacer generally has no specific biological activity other than to join the proteins or to preserve some minimum distance or other spatial relationship between them, the constituent amino acids of a peptide spacer may be selected to influence some property of the molecule such as the folding, net charge, or hydrophobicity. A peptide linker may optionally include a site for chemical cleavage or digestion by a protease, for separation of the fused constituent polypeptides.

A "Ds-tag" or "tag" as used herein refers to a "Ds" (e.g., donor strand molecule of FimF) that is attached to a polypeptide or other biological or organic molecule such as, for example, a nucleic acid, an antibody, a lectin, a sugar, a carbohydrate, etc.

The terms "Ds-tagged" or "tagged" molecule refer to a polypeptide or other biological or organic molecule, including, but not limited to, a nucleic acid, lipid, polysaccharide, carbohydrate, or lectin, to which a Ds molecule is attached to form a chimeric molecule. In one embodiment the Ds-tagged molecule is an antigen binding molecule. The attachment may be via chemical conjugation. Alternatively, a polynucleotide encoding the Ds molecule may be fused recombinantly to polynucleotide encoding a polypeptide to form a fusion protein. A polypeptide to which a Ds molecule is attached is referred to as a "Ds-tagged polypeptide" . A "Ds-tagged fusion protein" refers to a fusion protein comprising a fusion between a Ds molecule and another polypeptide that is not a Ds molecule. Preferred tagged moieties can be immobilized and/or purified using the Ds-tag in accordance with affinity methods of the invention.

A "target" molecule refers to a molecule to which a Ds molecule is to be attached, typically a polypeptide or other molecule that one desires to detect, immobilize and/or purify.

The terms "capture ligand", "affinity reagent", and "affinity ligand" are used interchangeably to refer to an agent that specifically binds a cognate ligand with high affinity. Such agents may be attached to a support, termed "substrate" or "matrix material" herein, to form an "affinity matrix". An affinity matrix of this invention comprises an affinity reagent that is a Ds molecule, such as a DsF or a derivative, variant or fragment thereof that is capable of binding its respective cognate ligand. A cognate ligand may be "immobilized" or "retained" or "bound" on such a matrix until release with a releasing agent. A "releasing agent" refers to a composition that is capable of releasing an immobilized, bound molecule from an affinity matrix (e. g. releases a bound Ds-tagged molecule from a Ds affinity matrix). Releasing agents of this invention can work through a variety of mechanisms including chemical cleavage and protease digestion to separate a bound tag from the molecule to which it is attached.

A "denaturing reagent" refers to a reagent that denatures a protein, e.g., urea or detergents.

The terms "isolated", "purified", and "biologically pure" refer to material which is substantially or essentially free from components which normally accompany it as found in its native state, such as for example in an intact biological system.

The term "kit" refers to a collection of materials, preferably a packaged collection of materials (preferably related materials) to perform a particular function (e.g. to run a screening assay, to express a protein, to culture a cell, to purify a Ds-tagged polypeptide, etc.). A kit may optionally comprise instructional materials describing the use of the materials present in the kit.

Donor strand (Ds) complementation binding partners as tags or affinity ligands

The invention provides donor-strand (Ds)-tagged molecules, e.g. fusion proteins which may be purified by a method comprising contacting a sample comprising the Ds-tagged molecule with an affinity matrix that comprises a cognate ligand of the Ds-tag, thereby immobilizing the Ds-tagged molecule on the affinity matrix. As mentioned, the system and method of the present invention is based on the surprising finding that a Ds-tag and its cognate ligand derived from subunits of pili, i.e. type 1 pili of E. coli can be used for one-step purification of active heterooligomeric protein complexes from cell extracts.

Type 1 pili of E. coli strains are filamentous, extracellular protein complexes anchored to the outer bacterial membrane and required for bacterial attachment to target cells. They are composed of the adhesin FimH and the minor subunits FimG and FimF that form the linear tip fibrillum, and up to 3000 copies of the main structural pilus subunit FimA that assembles to the helical pilus rod. The chaperone FimC catalyzes folding of the subunits in the periplasm (Vetsch et al, Nature 431 (2004), 329) and delivers them to the assembly platform FimD in the outer membrane, which catalyzes subunit assembly and translocation to the extracellular space (Nishiyama et al, Science 320 (2008), 3762). In the assembled pilus, the subunits interact by a mechanism termed "donor strand complementation" that is reminiscent of domain-swapping: The N-terminal segment of one subunit, termed donor strand, completes the incomplete, immunoglobulin-like fold of the preceding subunit (Choudhury et al. , Science 285 (1999), 1061; Sauer et al, Science 285 (1999), 1058-1061).

Previous work of the inventors showed that the complex between the subunit FimG and the donor strand peptide (DsF) of the neighboring subunit FimF represents the kinetically most stable, noncovalent protein-ligand complex known to date: Under physiological conditions, dissociation occurs only once every 3xl09 years (Puorger et al. (2008), supra).

Though it was tempting to speculate that this extraordinary stability could have technical applications analogous to the biotin-(strept)avidin system the formation of pili from which this system is derived occurs in context with other pilus subunits in vivo. A schematic representation of Type 1 Pilus assembly via the chaperone-usher pathway and different subunit constructs are described and shown in figure 1 of Puorger et al, Structure 16 (2008), 631-642, the disclosure content of which is incorporated herein by reference.

On the other hand, while complementation of the FimGt - DsF complex in vitro has been demonstrated by Puorger et al. (2008), supra, it remained questionable whether an artifical system based thereon would also work within a fusion protein and in context with a cellular environment. For example, because of the rather small Ds peptide tag steric hindrance and/or interaction with target polypeptides were expected to interfere with the recognition of its ligand.

Hence, in accordance with the experiments performed in accordance with the present invention and illustrated in the Examples it could be surprisingly shown that the DsF-tag can be used in context with a heterologous fusion protein and together with its cognate ligand for one-step purification from cell extracts.

Accordingly, in a preferred embodiment of the present invention the Ds-tag is derived from DsF of subunit FimF and its cognate ligand is derived from subunit FimGt of type 1 pili from E. coli. However, functional fragments or analogues or variants of the FimGt - DsF complex may be used as well. For example, the design of self-complemented variants, protein expression and purification, determination of protein and peptide concentrations, production of FimGt - DSF variants and structure determination of FimGt -DSF which can serve as guide for designing variants similar like in antibody technology are described in the Supplemental Data available with the article by Puorger et al, Structure 16 (2008), 631-642, the disclosure content of which is incorporated herein by reference; see also the molecular interactions of the FimGt - DsF complex that are described and shown in figure 6 of Puorger et al. (2008), supraM, the disclosure content of which is incorporated herein by reference.

The nucleotide and amino acid sequences of FimG and FimF of E. coli are known in the art and described, e.g., in X05672 (EMBL accession number).

Furthermore, other sources of donor strand complementation comprising FimGt - DsF complex or the like are known to the person skilled in the art and described for example in the biogenesis of Haemophilus influenzae haemagglutinating pili by Krasan et al, Mol. Microbiol. 35 (2000), 1335-1347. Likewise, other pathogenic Gram-negative bacteria such as Salmonella enteriditis, Salmonella typhimurium, Bordetella pertussis, Yersinia enterocolitica, Yersinia perstis, Helicobacter pylori and Klebsiella pneumoniae assemble hair-like adhesive organelles called pili on their surface and thus may be used as a source for the tagging system of the present invention.

In addition, donor strand complementation mechanism that may be employed in accordance with the present invention also exist in the biogenesis of non-pilus systems; see, e.g., Zavialov et al, Mol. Microbiol. 45 (2002), 983-995, for the Fl antigen of Yersinia pestis, which belongs to a class of non-pilus adhesins assembled via a classical chaperone-usher pathway

Furthermore, the preparation of modified pilus-derived polypeptides containing Ds pilus- derived peptide sequences and donor complementary sequences which may be employed in accordance with the present invention are described in international applications WO2001/004148 and WO2002/059156, the disclosure content of which is incorporated herein by reference.

In accordance with the present, the Ds-tag comprises a donor strand wherein said donor strand is less than a complete chaperone or pilus protein. Similarly, the cognate ligand of the Ds molecule comprises less than a complete chaperone or pilus protein and is preferably devoid of any Ds sequence. Preferably, the Ds-tag comprises or consists of a peptide of about 10 to 20 amino acids, typically 12 to 17 amino acids and as illustrated in the Examples 15 amino acids for the DsF tag; most preferably the Ds-tag comprises or consists of the amino acid sequence AD S TITIRGYVRDNG (SEQ ID NO: 19) or a fragment, analogue or variant thereof.

The Ds-tag binds to a cognate ligand, e.g., FimGt with a KDiSS smaller than 100 nM, generally in the range of 10 nM to 10"15 M. KDiss may be determined by any well known method in the art, including, for example, surface plasmon resonance measurement; see, for example, Pierce et al. J. Biol. Chem. 273 (1998), 23448-23453 or as described in Puorger et al. (2008), supra. Preferably, the affinity of binding between the Ds-tag and said cognate ligand comprises a KDiss in the range of 10"12 to 10"20 M. Preferably, the affinity of binding between the Ds-tag and said cognate ligand is substantially identical to that of FimGt -DsF described in the Supplemental Data available with the article by Puorger et al., Structure 16 (2008), 631-642 and used in the Examples of the present application, respectively, and preferably higher than that of the (strep)avidin/biotin complex.

A Ds-tagged molecule may be immobilized on an affinity matrix that includes the cognate ligand of the Ds-tag. For example, a DsF-tagged polypeptide may be immobilized on a FimGt affinity matrix.

Using known nucleic acid and/or amino acid sequences, Ds molecules may be prepared via recombinant expression using standard methods well known to those of skill in the art. Further, Ds fusion proteins including these sequences may be prepared recombinantly as well.

However, Ds molecules used in this invention are not limited to those that are prepared recombinantly. Particularly, where the molecule is to be used as a chemically conjugated tag or incorporated into an affinity matrix, purified native forms or chemically synthesized molecules are suitable.

Ds-tagged polypeptides may include one or more Ds molecules at the C-terminus and/or N- terminus and/or at an internal position on the polypeptide (e.g., attached to amino acid residue side chain(s)). A Ds molecule may be directly attached to a polypeptide or attached via a linker. In some embodiments, the Ds-tagged polypeptide is a recombinantly-produced fusion protein and the linker is a peptide linker. In one embodiment, the peptide linker includes cleavage site, preferably a protease recognition site. Thus, the fusion protein preferably has the formula: A-B-C or C-B-A, wherein B may be present or not, and wherein

(i) A comprises a Ds-tag;

(ii) B is a polypeptide linker comprising or constituting with A or C a chemical or enzymatic cleavage site; and

(iii) C is target protein.

In this embodiment of the method of the present invention, said Ds-tagged molecule is released from said affinity matrix by adding an agent that cleaves the Ds-tag form the molecule.

Proteases and cleavage sites:

Suitable selective chemical cleavage sites include (i) tryptophan residues cleaved by 3- bromo-3-methyl-2-(2-nitrophenylmercapto)-3H-indole,. (ii) cy stein residues cleaved by 2- nitroso-5-thiocyano benzoic acid, (iii) the amino acid dipeptides Asp-Pro or Asn-Gly which can be cleaved by acid and hydroxylamine, respectively, and preferably (iv) a methionine residue which is specifically cleaved by cyanogen bromide (C Br).

In a preferred embodiment of the present invention said cleavage site in the fusion protein comprises a protease recognition site. Suitable proteases and cleavage sites to be used as fusion partner B are known to the person skilled in the art; see for review, e.g., Barrett et al, Handbook of proteolytic enzymes, Academic Press (1998). Therein, Table 2 provides some proteases commonly used for tag removal including information about cleavage site, location, residual amino acids, pH range, chaotrope sensitivity, salt sensitivity and enzyme-to-target ratio. In order to identify a suitable protease and cleavage site, respectively, computer aided selection may be used such as the ExPASy PeptideCutter tool; see, e.g., Gasteiger et al, Protein Identification and Analysis Tools on the ExPASy Server; John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press (2005).

The enzyme, i.e. protease and its cognate cleavage site are preferably selected such that after cleavage the resultant peptide C is the authentic peptide and not a variant which for example extends at its N-terminus due to the remaining amino acids of the cleavage site of the enzyme. It is also possible to adapt the cleavage site of a given enzyme such that after cleavage the remaining amino acids of the cleavage site at the C-terminal part of the fusion protein, i.e. the N-terminus of the peptide is identical with the amino acid sequence of the native peptide. Thus, in one embodiment of the method of the present invention with the fusion protein being of formula A-B-C fusion partner B comprises at least the N-terminal part of a unique protease cleavage site and the N-terminus of fusion partner C supplements the C-terminal part of said cleavage site where appropriate. An equivalent embodiment may be used for fusion protein being of formula C-B-A.

In a preferred embodiment, said protease is a nuclear inclusion protein a (NIa) protease. Most preferably, the NIa protease of tobacco etch virus (TEV) protease is used, which is the 27 kDa catalytic domain of the NIa protein encoded by TEV. Because its sequence specificity is far more stringent than that of factor Xa, thrombin, or enterokinase, TEV protease is a very useful reagent for cleaving fusion proteins. It is also relatively easy to overproduce and purify large quantities of the enzyme. TEV protease recognizes a linear epitope of the general form E- Xaa-Xaa-Y-Xaa-Q-(G/S), with cleavage occurring between Q and G or Q and S. The most commonly used sequence is ENLYFQG. However, it has been described that high cleavage efficiencies after substitution of the glycine by other proteinogenic amino acids are retained in most cases so that it can be replaced by most other amino acids. In some embodiments of the method of the present invention the tobacco vein mottling virus (TVMV) protease and its recognition site may be a useful alternative to TEV protease when a recombinant protein happens to contain a sequence that is similar to a TEV protease recognition site; see Nallamsettya et al, in Prot. Expr. Puri. 38 (2004), 108-115. In a preferred embodiment of the present invention the fusion protein comprises a polypeptide linker comprising the amino acid sequence SGGSGGENLYFQGSGGSGG (SEQ ID NO: 24).

In various embodiments, a Ds-tag may be either chemically conjugated to a molecule or expressed as a component of a fusion protein. Methods of preparing "tagged" molecules and of preparing and using affinity matrices in accordance can be adapted from the prior art protocols such described in international application WO2004/092214 which relates to an affinity purification system using troponin molecules as affinity ligands; see in particular paragraph [0076] at page 22 until paragraph [00103], the disclosure content of which is incorporated herein by reference. Vectors:

To express the fusion protein in a host cell, the nucleic acid molecule encoding the fusion protein may be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding a polypeptide of interest and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook et al, Molecular Cloning, A Laboratory Manual (1989), and Ausubel et al, Current Protocols in Molecular Biology (1989); see also the literature cited in the Examples section.

A variety of expression vector/host systems may be utilized to contain and express polynucleotide sequences. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems.

To express the fusion protein in a host cell, a procedure such as the following can be used. A restriction fragment containing a DNA sequence that encodes the fusion protein may be cloned into an appropriate recombinant plasmid containing an origin of replication that functions in the host cell and an appropriate selectable marker. The plasmid may include a promoter for inducible expression of the fusion protein (e.g., pTrc (Amann et al, Gene 69 (1988), 301 315) and pETl Id (Studier et al, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990), 60 89). The recombinant plasmid may be introduced into the host cell by, for example, electroporation and cells containing the recombinant plasmid may be identified by selection for the marker on the plasmid. Expression of the fusion protein may be induced and detected in the host cell using an assay specific for the fusion protein. Host cells and in-vitro synthesis:

A suitable host cell for expression of the fusion protein may be any prokaryotic or eukaryotic cell; e.g., bacterial cells such as E. coli or B. subtilis, insect cells (baculovirus), yeast, or mammalian cells such as Chinese hamster ovary cell (CHO). In some embodiments, the DNA that encodes the peptide may be optimized for expression in the host cell. For example, the DNA may include codons for one or more amino acids that are predominant in the host cell relative to other codons for the same amino acid.

Alternatively, the expression of the fusion protein may be performed by in vitro synthesis of the protein in cell-free extracts which are also particularly suited for the incorporation of modified or unnatural amino acids for functional studies; see also infra. The use of in vitro translation systems can have advantages over in vivo gene expression when the over- expressed product is toxic to the host cell, when the product is insoluble or forms inclusion bodies, or when the protein undergoes rapid proteolytic degradation by intracellular proteases. The most frequently used cell-free translation systems consist of extracts from rabbit reticulocytes, wheat germ and Escherichia coli. All are prepared as crude extracts containing all the macromolecular components (70S or 80S ribosomes, tRNAs, aminoacyl-tRNA synthetases, initiation, elongation and termination factors, etc.) required for translation of exogenous RNA. To ensure efficient translation, each extract must be supplemented with amino acids, energy sources (ATP, GTP), energy regenerating systems (creatine phosphate and creatine phosphokinase for eukaryotic systems, and phosphoenol pyruvate and pyruvate kinase for the E. coli lysate), and other co-factors (Mg2+, K+, etc.). Appropriate transcription/translation systems are commercially available, for example from Promega Corporation, Roche Diagnostics, and Ambion, i.e. Applied Biosy stems.

Affinity matrix and purification:

Once expressed, the Ds-tagged proteins can be purified according to standard procedures of the art, including, but not limited to affinity purification, ammonium sulfate precipitation, ion exchange chromatography, or gel electrophoresis (see generally, R. Scopes, (1982) Protein Purification, Springer- Verlag, N. Y.; Deutscher (1990) Methods in Enzymology Vol. 182 : Guide to Protein Purification., Academic Press, Inc. N. Y. ).

In one embodiment, the Ds-tagged fusion proteins are purified on a cognate ligand affinity matrix, wherein said affinity matrix is formed by irreversibly linking the cognate ligand of the Ds-tag to a substrate via reactive amino groups of said ligand; see also the Example. The affinity matrix may comprise a substrate selected from the group consisting of cross-linked polysaccharide, agarose, ceramic, metal, glass, plastic, and cellulose, preferably wherein the affinity matrix comprises sepharose.

It will be apparent to one of skill in the art that modifications may be made to a Ds-tagged polypeptide without diminishing its biological activity. Some modifications may be made to facilitate the cloning and/or expression of the subject molecule (s). Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids introduced as a linker to provide a protease cleavage site, etc.; see also supra.

As mentioned above and illustrated in the Examples the purification system of the present invention is particularly suited for the isolation of proteins and protein complexes from crude mixtures and cell extracts thereby rendering intermediate purification steps superfluous. Therefore, in a preferred embodiment the method of the present invention is employed with a sample of crude protein mixtures, cell extracts, and the like.

Naturally the present invention also extends to the molecule or molecule complex purified according to the method of the present invention, in particular to molecules and molecule complexes comprising a Ds-tag as described herein-above.

In a further aspect, the present invention relates to an affinity matrix as defined above, i.e. comprising a covalently linked cognate ligand of a Ds-tag and thus being capable of specifically binding a Ds-tagged molecule, for example for use in the purification method of the present invention.

In another embodiment of the present invention, the affinity matrix further comprises a bound Ds-tagged molecule or molecule complex, preferably wherein said molecule or molecule complex is a protein or protein complex. In one embodiment, an enzyme or enzyme complex is bound to the affinity matrix via the Ds-tag and its cognate ligand.

The term "affinity matrix" refers to a substrate to which an affinity reagent (capture ligand) is attached. An affinity matrix of this invention comprises an affinity ligand that is capable of binding to a Ds-tag as described herein, attached to or complexed with a"matrix material" (i.e., a substrate or support). Generally, the affinity matrix comprises a matrix material attached to molecules of the ligand such as FimGt, or fragments, analogues or variants thereof. Each of these molecules acts as a capture ligand. Release of the bound molecule is generally effected by cleavage (e.g. chemical cleavage or protease digestion) to effect separation from the bound Ds-tag. The capture ligand is covalently attached to or associated with a matrix material.

Matrix materials and morphologies:

Non-limiting examples of matrix materials include solids, gels, pastes, membranes, slurries, or liquids. Suitable matrix materials include, but are not limited to, glass beads, controlled pore glass, magnetic beads, various membranes or rigid various polymeric resins such as polystyrene, polystyrene/latex, and other organic and inorganic polymers, both natural and synthetic. Illustrative polymers include polyethylene, polypropylene, poly (4-methylbutene), polystyrene, polymethacrylate, poly (ethylene terephthalate), rayon, nylon, poly (vinyl butyrate), polyvinylidene difluoride (PVDF), silicones, polyformaldehyde, cellulose, cellulose acetate, and nitrocellulose. Other materials that can be employed, include paper, glass, minerals (e.g. quartz), ceramics, metals, metalloids, plastics, cellulose, semiconductive materials, or cements. In addition, substances that form gels, such as proteins (e.g., gelatins), lipopolysaccharides, silicates, agarose, and polyacrylamides can be used. Polymers that form several aqueous phases, including, but not limited to, dextrans, polyalkylene glycols or surfactants, such as phospholipids, or long chain (12-24 carbon atoms) alkyl ammonium salts are also suitable.

The matrix material can take any of a number of morphologies. These include, but are not limited to solid or porous beads or other particles, solid surfaces (e.g. array substrates), columns, capillaries, or wells. In some embodiments, a plurality of different materials can be employed to form the affinity matrix, e.g., as laminates, to obtain various properties. For example, protein coatings, such as gelatin can be used to avoid nonspecific binding, simplify covalent conjugation, and/or enhance signal detection.

If covalent binding between the cognate ligand and the matrix material is desired, the surface can be polyfunctional or can be capable of being polyfunctionalized. Functional groups that can be present on the surface and used for linking include, but are not limited to, carboxylic acids, aldehydes, amino groups, cyano groups, ethylenic groups, hydroxyl groups, mercapto groups, and haloacetyl groups (i.e. iodoacetyl groups).

Preferred matrix materials include resins, such as for example synthetic resins (e.g. cross- linked polystyrene, divinyl benzene, etc.), and cross-linked polysaccharides (e.g. cellulose, dextran (sephadex), agarose (sepharose), and the like). In some embodiments, the matrix material includes reactive groups capable of forming a covalent link with a Ds cognate ligand molecule. In one embodiment, the matrix material includes a glyoxal activated agarose. In another embodiment, the matrix material includes a sulfhydryl reactive group. In a still further embodiment, the matrix material is activated with cyanogen bromide. In other embodiments, a cognate ligand molecule is attached to an agarose resin by the use of a cross-linking reagent. Such reagents are well known to those of skill in the art and include, but are not limited to carbodiimides, maleimides, succinimides, and reactive disulfides. In other embodiments, a Ds ligand is joined to a matrix material via a linker. Suitable linkers include, but are not limited to straight or branched- chain carbon linkers, heterocyclic carbon linkers, peptide linkers, and carbohydrates, e.g., as described above.

An affinity matrix of the present invention can take any convenient form. In certain embodiments, the affinity matrix is packed into a column, a mini-column, or a capillary or microcapillary (e.g., in a "lab on a chip" application), or a capillary electrophoresis tube. In some embodiments, the affinity matrix is suspended in one phase of a multiphase solution. In such embodiments, the affinity matrix thus acts to partition the tagged molecule into that particular phase of the multiphase (e.g., two-phase) system. Such multi -phase purification systems are well suited to large volume/high throughput applications.

In some embodiments, the affinity matrix comprises the walls of a vessel or the walls of a well (e.g., in a microtiter plate). In other embodiments, the affinity matrix comprises one or more porous or non-porous membranes or various gels or hydrogels. In one embodiment, the affinity matrix takes the form of a gel, such as for example a slab gel or a tube gel.

The present invention also relates to compositions such as Ds-tagged molecules, affinity matrices that comprise cognate ligand molecules, and molecules purified according to the methods of the invention. In one aspect, a composition is provided that includes an affinity matrix with an attached cognate ligand molecule (e.g., FimGt), the preparation of which is described above.

In some embodiments, the affinity matrix includes a cognate ligand of the Ds-tag, such as FimGt or a Ds binding fragment, analogue or variant thereof, attached to a substrate. The substrate may include any of the materials described above. In one embodiment, the substrate includes an agarose. For example, as described in the Examples a Ds binding polypeptide with either an N-or C-terminal cysteine residue may be linked to agarose via a thioether bond. In other embodiments, the affinity matrix includes a Ds cognate binding ligand attached via reactive amino groups of said ligand.

Biochips:

In a further aspect, the present invention relates a chip, for example biochip comprising the affinity matrix of as described above. For example, chips and in particular biochips are capable of discriminating complex biological samples or enviroment such as air via an array of discrete biological sensing elements immobilized onto a solid support; see, e.g., international applications WO97/049989 and WOOl/040796, the disclosure content of which is incorporated herein by reference. Sensing elements include biological material such as nucleic acids, peptides, enzymes, glycans, and the like. Hitherto, the sensing elements were immobilized on a preferably streptavidin coated sensing surface via biotin or a derivative thereof. In accordance with the present invention, streptavidin would be substituted by a cognate ligand of the Ds-tag and biotin by the Ds-tag. Due to the high specificity and low dissociation constant of Ds and its cognate ligand coating of an appropriate surface such as glass or gold is much more efficient and can be performed with lower amounts of Ds-tagged sensing elements. In addition, also due to the low dissociation constant of Ds and its cognate ligand, and in particular due to its extremely long half-life of dissociation (extremely low koff rate), the chip in accordance with the present invention is more stable and less prone of artefacts.

One important advantage of the donor strand complementation based tag system of the present invention is that due to the rather infinite stability of the complex formed by the tag and its cognate ligand and its resistance against flow conditions and extensive washing steps the Ds-tags are in particular suited for continuous use, for example in microfluidic devices and capillary and microfluidic platforms, wherein the Ds-cognate ligand system of the present invention substitutes the commonly used avidin-biotin system; see for review, e.g., Baker et al, Bioanalysis. 1 (2009), 967-975. For example, a flow cell, which is covered with the cognate ligand of the DsF tag, e.g., FimGt can be subjected to continuous flow of a fluid over days and weeks in order to detect a DsF tagged molecule, which might be present in the fluid in only minor amounts, which hitherto might not be amenable to detection with common means. In contrast, in the biotin/(strept)avidin system for example, which is commonly considered as the most stable complex in diagnostic use, molecules might get lost because this complex nevertheless dissociates statistically one or more times a week with the consequence that the associated molecule will be washed away and thus would not be detected. Accordingly, in this as well as in other embodiments of the present invention the very high half life of DsF-cognate ligand complex of the present invention is of particular advantage. Therefore, the affinity matrix and chip of the present invention, respectively, can also be used in devices which are continuously in contact with a fluid such as in high throughput screening or effluent water control and sewage from, for example laboratories and industry.

In another aspect, a composition is provided that includes a molecule purified according to any of the methods described herein. In some embodiments, the Ds-tagged molecule comprises a polypeptide. In one embodiment, the polypeptide is produced recombinantly as a Ds-tagged fusion protein. Compositions are also provided that comprise any of the Ds ligand containing affinity matrices described herein with one or more noncovalently bound Ds- tagged molecules.

Kits:

The reagents described herein can be packaged in kit form. In one aspect, the present invention provides a kit that includes reagents useful for preparation of Ds- tagged molecules and/or purification of such molecules on a Ds affinity matrix, in suitable packaging. Kits of the invention include any of the following, separately or in combination: a Ds-linked affinity matrix (such as, for example, a cross-linked polysaccharide affinity matrix material (e.g. acrylamide, agarose, sepharose, etc.) comprising a cognate ligand of Ds such as FimGt or fragment, analogue or variant thereof), reagents for production of a Ds affinity matrix, reagents for production of a Ds-tagged molecule, such as for example an expression vector for production of a Ds-tagged fusion protein (optionally comprising a multiple cloning site for introduction of a nucleic acid encoding a polypeptide "in frame" with Ds sequences), linkers, buffers, or other reagents for affinity purification of a Ds-tagged molecule according to the methods described above. Each reagent is supplied in a solid form or liquid buffer that is suitable for inventory storage, and later for exchange or addition into a reaction or culture medium. In another embodiment, the kit comprises a cognate ligand of Ds as comprising a detectable label and optionally instructions for use in a method of detecting a Ds-tagged molecule, preferably further comprising components for producing a Ds-tagged molecule.

Suitable packaging is provided. As used herein, "packaging" refers to a solid matrix or material customarily used in a system and capable of holding within fixed limits one or more of the reagent components for use in a method of the present invention. Such materials include glass and plastic (e.g., polyethylene, polypropylene, and polycarbonate) bottles, vials, paper, plastic, and plastic-foil laminated envelopes and the like. The kits can optionally further comprise means for chemical or enzymatical cleavage (e.g. CnBr, TEV protease, or the like), a column or other suitable structure for containing an affinity matrix, cells for expressing a polypeptide, transfection reagent (s), and/or other reagents for use in the methods of the invention as described above.

Labels, tags and detection:

In addition, the kits optionally include labeling and/or instructional materials providing directions (i.e., protocols) for the practice of the methods of this invention. While the instructional materials typically comprise written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to Internet sites that provide such instructional materials.

In a further aspect, the present invention relates to a method for detecting a Ds-tagged molecule, comprising contacting said Ds-tagged molecule with a cognate ligand of the Ds-tag as defined hereinbefore, preferably wherein said ligand is detectably labeled.

Thus, in a further embodiment the cognate ligand of the Ds-tag of the present invention such as FimGt or a functional derivative thereof comprises a label (e.g., fluorescent, radioactive, enzyme, nuclear magnetic, heavy metal) and may be used as a peptide probe to detect specific targets in vivo or in vitro including "immunochemistry" like assays in vitro. The specific label chosen may vary widely, depending upon the analytical technique to be used for analysis including detection of the probe per se and detection of the structural state of the probe. The label may be complexed or covalently bonded at or near the amino or carboxy end of the peptide. One example of indirect coupling is by use of a spacer moiety. In using radioisotopically conjugated peptides of the invention for, e.g., immunotherapy, certain isotopes may be more preferable than others depending on such factors as leukocyte distribution as well as stability and emission. Depending on the autoimmune response, some emitters may be preferable to others. In general, a and β particle emitting radioisotopes are preferred in immunotherapy. Preferred are short range, high energy a emitters such as 212Bi. As mentioned said label may be an enyme; a heavy metal, preferably gold; a dye, preferably a fluorescent or luminescent dye; or a radioactive label.

General methods in molecular and cellular biochemistry useful for diagnostic purposes can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al, Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al, John Wiley & Sons 1996). Reagents, detection means and kits for diagnostic purposes are available from commercial vendors such as Pharmacia Diagnostics, Amersham, BioRad, Stratagene, Invitrogen, and Sigma-Aldrich as well as from the sources given any one of the references cited herein, in particular patent literature.

In one embodiment of the present invention, the method may be performed on a western or dot blot; or on a cell sample or tissue section. In context with for example fluorescence micrcoscopy and in particular in vivo imaging the cognate ligand of the Ds-tag of the present invention such as FimGt or a functional derivative thereof in one embodiment may be fused to non-cell damaging fluorescent protein such as GFP and EGFP.

Tests based on the Ds-tag cognate ligand binding pair:

In one further aspect, the present invention relates to a test, especially an immunological test for determining an antigen of interest which makes use of the above described system based on donor strand complementation comprising a Ds-tag and a cognate ligand of the Ds-tag.

Additional experiments performed in accordance with the present invention described in Examples 5 and 6 and shown in Figures 8 to 10 revealed that the interaction between the molecules provided by the present invention, i.e. the Ds-tag and its cognate ligand shows a quite surprising kinetic, in particular a fast association rate followed by a very low dissociation rate, especially, if the cognate ligand is bound to a solid phase. Thus, the binding between Ds-tag and its cognate ligand exhibits a stability which is unmatched by other binding pairs known and used in the art, which is even superior to biotin-streptavidin system. This interaction stability makes the system provided by the present invention based on donor strand complementation comprising a Ds-tag and a cognate ligand of the Ds-tag suitable for many diagnostic applications, e.g., for the use in immunological tests. In this respect, by use of the system of the present invention, for example, longtime expositions of an immunological test matrix to a sample are possible, or the provision of the sample as a continuous flow due to the extreme stability of the Ds-tag/cognate ligand binding. Therefore, due to the observation of the surprising aspects of the interaction kinetics between the Ds-tag and its cognate ligand, in an independent aspect the present invention also relates to test comprising the Ds-tag and its cognate ligand, respectively, wherein one of the two is immobilized on a suitable matrix and the other one is bound to an antigen-binding molecule.

An "antigen binding molecule" is any molecule that has at least an affinity of 107 1/mol for its corresponding target molecule, e.g. an antigen of interest or a nucleic acid of interest. An antigen binding molecule for example is a peptide, a peptide mimetic, an aptamer, a spiegelmer, a darpin, a lectine, an ankyrin repeat protein, a Kunitz type domain, a single domain antibody (see: Hey, T. et al., Trends Biotechnol 23 (2005) 514-522); a receptor; an antibody or a fragment thereof (= immunologically reactive substance); or a hybridizable nucleic acid.

The antigen-binding molecule preferably has an affinity of 108 1/mol or also preferred of 109 1/mol for its target molecule. Preferably the antigen-binding moleclue specifically binds to the target of ineterest. As the skilled artisan will appreciate, the term specific is used to indicate that other biomolecules present in the sample do not significantly bind to the antigen-binding molecule. Preferably, the level of binding to a biomolecule other than the target molecule results in a binding affinity which is at most only 10% or less, only 5% or less only 2% or less or only 1% or less of the affinity to the target molecule, respectively. A preferred specific binding agent will fulfill both the above minimum criteria for affinity as well as for specificity. In one embodiment the Ds-tagged antigen-binding molecule is a hybridizable nucleic acid. The hybridizable nucleic acid may compromise any naturally occurring nucleobase or an analogue thereto and may have a modified or an un-modified backbone as described above, provided it is capable of forming a stable duplex via multiple base pairing with the target nucleic acid of interest. Stable means that the melting temperature of the duplex is higher than 37°C under the conditions used to perform the binding assay. Preferably, the hybridizable nucleic acid sequences consist of between 12 and 50 nucleotides. Also preferred such nucleic acid sequences will consist of between 15 and 35 nucleotides.

In one embodiment the antigen-binding molecule is an antibody or antigen-binding fragment thereof. Any antibody fragment retaining the above criteria of a specific binding agent can be used. Antibodies are generated by state of the art procedures, e.g., as described in Tij ssen (Tijssen, P., Practice and theory of enzyme immunoassays, 1 1, Elsevier Science Publishers B.V., Amsterdam, the whole book, especially pages 43-78). In addition, the skilled artisan is well aware of methods based on immunosorbents that can be used for the specific isolation of antibodies. By these means the quality of polyclonal antibodies and hence their performance in immunoassays can be enhanced. (Tij ssen, P., supra, pages 108-1 15).

Methods for producing a monoclonal antibody in hybridoma cells, for example a human antibody are known in the art and are described, e.g., in Goding, "Monoclonal Antibodies: Principles and Practice", Academic Press, pp 59-103 (1986). Methods for producing a chimeric antibody, murinized antibody, single-chain antibody, Fab-fragment, bi-specific antibody, fusion antibody, labeled antibody or an analog of any one of those are known as well to the person skilled in the art and are described, e.g., in Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor (1988). The production of chimeric antibodies is described, for example, in international application WO89/09622. Methods for the production of humanized antibodies are described in, e.g., European application EP-A1 0 239 400 and international application WO90/07861. Further sources of antibodies to be utilized in accordance with the present invention are so-called xenogeneic antibodies. The general principle for the production of xenogeneic antibodies such as human-like antibodies in mice is described in, e.g., international applications WO91/10741, WO94/02602, WO96/34096 and WO 96/33735. As discussed above, the antibody of the invention may exist in a variety of forms besides complete antibodies; including, for example, Fv, Fab and F(ab)2, as well as in single chains; see e.g. international application WO88/09344. The term "immunological test" or "immunoassay" is defined as any method for measuring the concentration or amount of an analyte in a solution based on the immunological binding or interaction of a polyclonal or monoclonal antibody and an antigen. Such method frequently (a) requires a separation of bound from unbound analyte; (b) often employs a direct label such as radioisotopic, fluorometric, enzymatic, chemiluminescent or other label as the means for measuring the bound and/or unbound analyte; and (c) may be described as "competitive" if the amount of bound measurable label is generally inversely proportional to the amount of analyte originally in solution or "non-competitive" if the amount of bound measurable label is generally directly proportional to the amount of analyte originally in solution.

Label may be in the antigen, the antibody, or in double antibody methods, the second antibody. The label may be selected from a group consisting of an enzyme, a radioisotope, a fluorophore, and a colored particle to name a few preferred labels.

Immunoassays are exemplified by, but are not limited to radioimmunoassays (RIA), immunoradiometric assays (IRMA), radioimmunoprecipitation assay (RIPA), radioallergosorbent tests (RAST), fluorescence polarization immunoassays (FPIA), chemiluminescence assays (CIA), enzyme immunoassays (EIA), enzyme-multiplied immunoassays (EMIT), enzyme-linked immunosorbent assays (ELISA), IgM antibody capture ELISA (MAC ELISA), microparticle enzyme immunoassays (MEIA), magnetic particle-based assays (MPA), fluoroimmunoassays (PIA), flourescence polarization immunoassay (FPIA) and sandwich method immunoassays.

Radioimmunoassay (RIA) uses fixed-dose, low-level, radioactive-isotope- labeled antigen ("tracer") to compete with unlabeled antigen from the patient specimen for a fixed number of antibody binding sites. Traditional RIA is done with specific antibodies in liquid solution. Solid-phase RIA involves the use of antibody bound to solid support (e.g., tubes, glass beads or plastic fins). The amount of antigen in the specimen is determined by comparing the bound radioactivity with a standard curve.

Immunoradiometric assay (IRMA) uses low-level radioactively labeled specific antibody to quantitate low concentration compounds. In IRMA, a first antibody is presented on solid- phase (coated on tubes or beads). After binding the antigen present in the sample, a second radioactively labeled antibody is added. Radioactivity remaining after washing the solid phase is proportional to the concentration of antigen present in the sample and is quantitated by comparison to a standard curve.

198 212

Non-limiting examples of suitable radionuclides (radioisotopes) for labeling are Au, Bi,

U C, U C, 57 Co, 67 Cu, 18T F7, 67^ Ga, 68^ Ga, 3τ Hτ, 197χ Hτg, 166χ Hτo, 1 HT In, 113m τ In, 123τ I, 125τ I, 127τ I, 131τ I, 111τ In,

177

Lu, 150, 13N, 32P, 33P, 203Pb, 186Re, 188Re, 105Rh, 97Ru, Sm and yym Tc.

Magnetic particles suitable for use in magnetic particle-based assays (MP As) may be selected from paramagnetic, diamagnetic, ferromagnetic, ferromagnetic and superparamagnetic materials. Typically, paramagnetic ions are selected from the non-limiting group consisting of chromium(III), gadolinium(III), iron(II), iron (III), holmlum(III), erbium(III), manganese(II), nickel(II), copper(II), neodymium(III), yttrium(III), samarium(III), and dysprosium(III). More typically, the paramagnetic ion is gadolinium (III). Diamagnetic agents are selected from the non-limiting group consisting of gadolinium, cobalt, nickel, manganese or copper complexes, graphite, beryllium, bismuth, carbon, copper, lead, gold, silver and zinc. Suitable ferromagnetic, ferrimagnetic, paramagnetic and superparamagnetic materials which may be used in magnetic labels include, but are not intended to be limited to, metals such as iron, nickel, cobalt, chromium, manganese and the like; lanthanide series elements such as neodymium, erbium and the like; alloys such as magnetic alloys of aluminum, nickel, cobalt, copper and the like; oxides such as ferric oxide (Fe3 04), γ-ferric oxide (Y-Fe304), chromium oxide (Cr02), cobalt oxide (CoO), nickel oxide (Ni02), manganese oxide (Mn203) and the like; composite materials such as ferrites and the like; and solid solutions such as magnetite with ferric oxide and the like. Preferred magnetic materials are magnetite, ferric oxide (Fe304) and ferrous oxide (Fe203).

Radioallergosorbent test (RAST) is the name given to an in vitro technique which detects the presence of IgE (and IgG) antibodies to allergens, proteins which may give rise to hypersensitivity reactions seen in allergies. Allergens are coated on a complex carbohydrate matrix called a sorbent. Antibodies specific for the allergen being tested bind to the allergen and, if present, are detected by a low-level radioactively labeled antibody to either human IgE or IgG, depending upon the isotype being tested. Fluorescence polarization immunoassay (FPIA) is a technique which takes advantage of the increased polarization (non-random propagation of emission) of fluorescent light emissions when a fluorescently labeled antigen is bound by reagent antibody. The higher the concentration of unlabeled patient antigen present in the test mixture, the less bound fluorescent antigen is present and, consequently, the lower the polarization of the fluorescent light emission. Standard calibration yields quantitative results.

Chemiluminescence assays (CIA), including a subcategory using bioluminescence (biologically derived chemiluminescence agents), use the generation of light from oxidative chemical reactions as an indicator of the quantity of unbound luminescently labeled antigen. This allows quantitation of unlabeled antigen from patient specimens in a variety of homogeneous (single phase) or heterogeneous (multiple phase) immunoassay techniques.

Enzyme immunoassay (EIA) is the general term for an expanding technical arsenal of testing which allows a full range of quantitative analyses for both antigen and antibodies. These tests use color-changed products of enzyme-substrate interaction (or inhibition) to measure the antigen-antibody reaction. Examples of EIA procedures (EMIT, ELISA, MAC, MEIA) follow. Typically, enzymes which are suitable as label are selected from the non-limiting group consisting of hydrolases such as β-galactosidase or peroxidases such as horse radish peroxidase (HRPO).

Enzyme multiplied immunoassay technique (EMIT) is a homogeneous (single phase) EIA procedure in which the antigen being measured competes for a limited number of antibody binding sites with enzyme labeled antigen. The reagent antibody has the ability to block enzymatic activity when bound with the reagent enzyme-antigen complex preventing it's formation of product in the presence of substrate. The free antigen- enzyme complexes resulting from competition with measured antigen in the sample forms color-change products proportional to the concentration of antigen present in the specimen.

Enzyme-linked immunosorbent assay (ELISA) is a sensitive, heterogenous (multiple phase) analytical technique for quantitation of antigen or antibody in which enzyme-labeled antibody or antigen is bound to a solid support (e.g., tubes, beads, microtiter plate wells, plastic tines or fins). After addition of patient specimen and substrate, antigen, antibody or complex are detected by a color change indicating the presence of the product of an enzyme-substrate reaction. Direct ELISA is a technique for measuring antigen using competition for antibody binding sites between enzyme-labeled antigen and patient antigen. Indirect ELISA, or enzyme immunometric assay, measures antibody concentrations using bound antigen to interact with specimen antibodies. Enzyme-labeled reagent antibodies can be isotype-specific (i.e., capable of determining the presence of IgG, IgA, IgM or IgE classes which react with the antigen of interest). The specificity of indirect ELISA assays for IgM isotypes in some infectious diseases is limited by false-positive results due to IgM rheumatoid factor in the presence of IgG-specific antibodies.

IgM antibody capture ELISA (MAC ELISA) has been developed to impart significant improvement in assay specificity to indirect ELISA procedures for IgM isotype antibodies. Solid-phase support (usually microtiter plate wells) are coated with anti-human IgM antibodies capable of binding all IgM isotype antibodies present in the specimen. Reagent antigen is then added, followed by enzyme-labeled antigen-specific antibodies. If IgM antibodies specific for the antigen in question are present, the "sandwich" complex will result in enzymatic color-change proportional to the concentration of IgM-specific antibody present. This technique appears to be the method of choice in many highly specific and more sensitive assays for IgM infectious disease antibodies.

Microparticle enzyme immunoassay (MEIA) is a technique in which the solid-phase support consists of very small microparticles in liquid suspension. Specific reagent antibodies are covalently bound to the microparticles. Antigen, if present, is then "sandwiched" between bound antibodies and antigen-specific, enzyme-labeled antibodies. Antigen-antibody complexes are detected and quantitated by analysis of fluorescence from the enzyme-substrate interaction.

Radioimmunoprecipitation assay (RIP A) is the term used to describe the qualitative assay used as a confirmatory procedure for some antibodies to viral antigens. Viral-infected cell cultures are radioactively labeled and lysed to yield radiolabeled antigen fragments. Specific antibodies, if present, will bind these antigen fragments and the resulting antigen-antibody complexes are precipitated using protein A, boiled to free the immune complexes which are then separated by electrophoresis. The pattern of antigenic moieties to which antibodies are present may then be detected using autoradiography (the exposure of sensitive X-ray film by the radioactive emissions of the bound, labeled antigens). Comparison to labeled molecular weight standards electrophoresed in the same run allows determination of the molecular weight "bands" of antigen to which antibodies are present.

Fluoroimmunoassays (PIA) are based on the labeling of an antigen-binding molecule or a fluorescent labeled particle. Commercial fluorescent probes suitable for use as labels in the present invention are listed in the Handbook of Fluorescent Probes and Research Products, 8th Edition, the disclosure contents of which are incorporated herein by reference. The colored particles are not particularly limited, as long as they can be visually detected. There can be used, for instance, colloidal particles comprising metals such as gold, silver and copper; colored latex prepared by coloring latex with pigments and dyes represented by Sudan Blue or Sudan Red IV, Sudan 111, Oil Orange, Quinizaline Green, or the like. From the aspect of the visual verification, it is preferable to use gold colloid or colored latex colored in blue, red, green or orange. In addition, in consideration of such aspects as the dispersion stability and the ease in adjustment of the detection sensitivity of an analyte, it is more desirable to use colored latex comprising water-dispersible polymeric particles colored in blue, red, or the like. Methods of generation and use of such particles are described for example in US patent Nos. 4,837,168; 4,419,453, 4,780,422.

Flourescence polarization immunoassay (FPIA) differs from ELISA in that it is a homogeneous assay conducted in solution phase. When a fluorophore in solution is exposed to plane-polarized light at its excitation wavelength the resulting emission is depolarized. The depolarization results from the motion of the fluorophore during the processes of excitation and emission. Because of this, the more rapid the motion of the fluorophore the more the emission is depolarized. The fluorescence emission can be segregated, using polarizers, into horizontal and vertical components.

An "electrochemiluminescence assay" or "ECLA" is an electrochemical assay in which bound analyte molecule is detected by a label linked to a detecting agent (target molecule). An electrode electrochemically initiates luminescence of a chemical label linked to a detecting agent. Light emitted by the label is measured by a photodetector and indicates the presence or quantity of bound analyte molecule/target molecule complexes. ECLA methods are described, for example, in U.S. Patent Nos. 5,543, 112; 5,935,779; and 6,316,607. Signal modulation can be maximized for different analyte molecule concentrations for precise and sensitive measurements. In an ECLA procedure microparticles can be suspended in the sample to efficiently bind to the analyte. For example, the particles can have a diameter of 0.05 μιη to 200 μπι, 0.1 μιη to 100 μπι, or 0.5 μιη to 10 μπι, and a surface component capable of binding an analyte molecule. In one frequently used ECLA-system (Elecsys®, Roche Dagnsotics, Germany), the microparticles have a diameter of about 3 μιη. The microparticles can be formed of crosslinked starch, dextran, cellulose, protein, organic polymers, styrene copolymer such as styrene/butadiene copolymer, acrylonitrile/butadiene/styrene copolymer, vinylacetyl acrylate copolymer, vinyl chloride/acrylate copolymer, inert inorganic particles, chromium dioxide, oxides of iron, silica, silica mixtures, proteinaceous matter, or mixtures thereof, including but not limited to sepharose beads, latex beads, shell-core particles, and the like. The microparticles are preferably monodisperse, and can be magnetic, such as paramagnetic beads. See, for example, U.S. Patent Nos. 4,628,037; 4,965,392; 4,695,393; 4,698,302; and 4,554,088. Microparticles can be used in an amount ranging from about 1 to 10,000 μg/ml, preferably 5 to 1,000 μg/ml.

When providing an immunological test according to the present invention, immunologically reactive substances are indirectly bound to a matrix, this means indirectly bound to an affinity matrix consisting of a Ds-tag or cognate ligand of the Ds-tag which is covalently bound or adsorbed to an immunologically inert carrier or solid phase.

In one embodiment, several immunologically reactive substances (several different substances) can be conjugated or adsorbed on the carrier. Such carrier comprising the various immunologically active substances can be then used in an immunological test. In this assay, for example, the presence or absence of an antigen can be determined by binding of several different immunologically reactive substances to different epitopes of the same antigen. However, said several different immunologically reactive substances can as well be used for binding of different antigens, providing the possibility to determine the presence or absence of several antigens at once in a tested sample. When the later test setup is envisaged, also different spatial arrangements can be used when constructing the affinity matrix. For example, said several immunologically reactive substances binding different epitopes can be arranged on one affinity matrix in different compartments, providing thereby a convenient means to visualize the presence or absence or the quantification of several antigens in one sample simultaneously. The term "immunologically reactive substance" means an antibody or an antigen-binding fragment thereof. In certain embodiments the present invention is based on the use of several immunologically reactive substances, which then are denoted a "first antibody" or a further or "second antibody

In one embodiment of the present invention the immunological test as defined hereinabove is provided, comprising at least one antigen-binding molecule binding to an antigen of interest and conjugated to

(i) the Ds-tag, if the affinity matrix comprises the cognate ligand of the Ds-tag immobilized thereon; or

(ii) the cognate ligand of the Ds-tag, if the affinity matrix comprises the Ds-tag immobilized thereon.

In one embodiment of the present invention, the immunological test as described above is provided, further comprising at least one second antigen-binding molecule which recognizes the antigen of interest at an epitope different from said first antigen-binding molecule.

In one preferred embodiment of the present invention the above-mentioned immunological test is an immunological sandwich test for determining an antigen of interest comprising an affinity matrix that comprises immobilized thereon a Ds-tag or a cognate ligand of the Ds-tag as defined hereinabove. The term "immunological sandwich test" means that the antigen of interest is not immobilized non-specifically to the affinity matrix, but specifically by an immunologically reactive substance, i.e. by said first antigen-binding molecule, e.g. by an antibody.

In one embodiment the first antigen-binding molecule is not directly bound to the carrier, but indirectly via the Ds-tag/cognate ligand binding pair, wherein the said first antigen-binding molecule is covalently linked to a Ds-tag and the affinity matrix has been constructed by covalently binding or adsorbing the cognate ligand of the Ds-tag thereon. Linking or coupling methods of the Ds-tag or its cognate ligand to the immunologically invisible material of the matrix are described hereinabove and in the material and methods part of the Examples below. In one embodiment the present invention relates to a method comprising a) contacting a sample with a Ds-tagged antigen-binding molecule binding to an antigen of interest and with an affinity matrix comprising the cognate ligand of the Ds-tag, thereby forming a complex between the antigen-binding molecule, the antigen of interest and the affinity matrix and b) detecting the amount of antigen of interest in the complex formed in (a).

As the skilled artisan will appreciate the incubation of the sample, known or suspected to comprise the antigen of interest, with a Ds-tagged antigen-binding molecule binding to the antigen of interest and with an affinity matrix comprising the cognate ligand of the Ds-tag can be performed sequentially in any order, or simultaneously. In certain embodiments it is advantageous if one or more washing step(s) are included in the assay procedure.

The affinity matrix to be used in the immunological test of the present invention can take any convenient form and can be constructed from several materials. Concerning the materials to be used and the shapes the affinity matrix may take, materials and shapes can be used as defined hereinabove in section matrix materials and morphologies.

In a further embodiment of the present invention the immunological test of the present invention is provided, wherein the affinity matrix comprises a substrate composed primarily from material selected from the group consisting of cellulose, teflon™, nitrocellulose, agarose, sepharose, dextran, chitosan, polystyrene, polyacrylamide, polyester, polycarbonate, polyamide, polypropylene, nylon, divinyl benzene, polydivinylidene difluoride, latex, polyvinyl acetate, styrene-butadiene, silica, glass, glass fiber, gold, platinum, silver, copper, iron, stainless steel, ferrite, silicon wafer, ceramics, polyethylene, polyethyleneimine, polylactic acid, resins, polysaccharides, proteins (e.g., albumin), carbon or combinations thereof. Preferably the matrix material is selected from cellulose, nitrocellulose, agarose, sepharose, polystyrene, polyacrylamide, polyester, polycarbonate, latex, silica, glass, and ceramics.

In a preferred embodiment the present invention provides the immunological test as defined hereinabove, wherein the shape of the affinity matrix is selected from the group consisting of beads, e.g. latex beads or magnetic beads, thin films, microtubes, filters, test strips, plates, microplates, carbon nanotubes and sensor chips or arrays. Preferably the shape of the affinity matrix is selected from the group consisting of beads, e.g. latex beads or magnetic beads, test strips and sensor chips or arrays.

In an ECLA procedure microparticles can be suspended in the sample to efficiently bind to the analyte. For example, the particles can have a diameter of 0.05 μπι to 200 μπι, 0.1 μπι to 100 μπι, or 0.5 μπι to 10 μπι, and a surface component capable of binding an analyte molecule. In one frequently used ECLA-system (Elecsys®, Roche Dagnsotics, Germany), the microparticles have a diameter of about 3 μπι. The microparticles can be formed of crosslinked starch, dextran, cellulose, protein, organic polymers, styrene copolymer such as styrene/butadiene copolymer, acrylonitrile/butadiene/styrene copolymer, vinylacetyl acrylate copolymer, vinyl chloride/acrylate copolymer, inert inorganic particles, chromium dioxide, oxides of iron, silica, silica mixtures, proteinaceous matter, or mixtures thereof, including but not limited to sepharose beads, latex beads, shell-core particles, and the like. The microparticles are preferably monodisperse, and can be magnetic, such as paramagnetic beads. See, for example, U.S. Patent Nos. 4,628,037; 4,965,392; 4,695,393; 4,698,302; and 4,554,088. Microparticles can be used in an amount ranging from about 1 to 10,000 μg/ml, preferably 5 to 1,000 μg/ml.

In one preferred embodiment the test of the present invention based on the use of the Ds-tag and cognate ligand binding pair is an immunological rapid test.

Immunological rapid tests are test strips or biochips which comprise an affinity matrix as defined above, comprising either the Ds-tag or the cognate ligand of the Ds-tag immobilized on the matrix. Typically, a test strip system takes advantage of a reaction between an analyte in the body fluid to be tested and an antigen-binding molecule present in the test system. Various body fluid specimen and first and second antigen-binding molecules as described hereinabove can be applied to the test strips or biochips and the presence/amount or absence of an antigen of interest can be evaluated either directly on the test strip or biochip, if all of the reaction reagents, e.g., enzyme substrates or labels are provided within the test strip or biochip. In many cases such an evaluation occurs by optical means and such an optical test strip will generally rely upon a color change, i.e., a change in the wavelength absorbed or reflected by dye formed or label used in the reagent system; see, e.g., U.S. Pat. Nos. 3,802,842; 4,061,468; and 4,490,465. Alternatively, evaluation can be performed in an adequate rapid diagnosis device, e.g. if other means as optical (e.g., reflectance, absorption, fluorescence, Raman spectroscopy, etc.), e.g., electrochemical, and magnetic means for analyzing the sampled fluid are used or the optical means themselves require additional reagents or means for evaluation such as heating, for example. Examples of such test systems include those in U.S. Pat. Nos. 5,824,491 ; 5,962,215 and 5,776,719. Such a device can thus provide a heating element required to bring the test strip/biochip to a specific temperature, permitting optimum evaluation of the specimen being measured

Analytical systems with test media cassettes which allow multiple testing can also be used in this respect. There are available dispensers which contain a limited number of test elements; as for example, 1 to 2 dozen test strips which are individually sealed. Blood glucose meter using such a test strip dispenser are in the market under the brands AccuChek® Compact (Roche Diagnostics GmbH) and DEX® (Bayer Corporation).

In a particular preferred embodiment of the present invention, a test strip is used and an immunological test performed thereon. Test strips and methods of their preparation and use are known in the art and are described for example in European applications EP 1 642 1 17, EP 2 194 381, EP 1 642 125 and EP 1 536 232. In particular, European patent application EP 1 536 232 describes a test which can be adapted to the immunological test of the present invention. EP 1 536 232 describes a common method by which the antibodies are linked on the matrix on the test strip by the use of the biotin/streptavidin interaction. The interaction between the Ds-tag and its cognate ligand can improve such tests if adapted to be used therein in a similar way as but instead of biotin/streptavidin. Such an adaptation would provide a profoundly higher binding stability, thereby e.g. increasing the reliability of the tests. All embodiments described in European patent application EP 1 536 232 in respect of immunological tests are incorporated by reference herein and are subject of the present invention, wherein the binding partners biotin/(strept)avidin are replaced in an analogous manner by the Ds-tag and its cognate ligand.

The present invention also relates to a method for detecting an antigen of interest, characterized in that an immunological test as defined hereinabove is used. In one embodiment the immunological test used is characterized in that it is competitive immunoassay wherein a labeled antigen of interest is used for competition. In one embodiment the immunological test used is characterized in that it is a sandwich immunoassay, wherein a labeled second antibody is used.

In summary, the present invention relates to a system based on donor strand complementation comprising a Ds-tag and a cognate ligand of the Ds-tag as defined hereinbefore and illustrated in the Examples for use in an application selected from the group consisting of high throughput screening, study of receptor-ligand interaction, identification of binding partners such as in pull-down experiments, study of binding kinetics and specific binding assays, e.g. immunoassays. In this context the present invention also relates to a composition useful in the mentioned system based on donor strand complementation comprising a Ds-tag and a cognate ligand of the Ds-tag as described hereinabove, comprising a kit of parts:

(i) a Ds-tag or its cognate ligand conjugated to a label as defined hereinabove and below; and

(ii) a cognate ligand of said Ds-tag or the Ds-tag of said cognate ligand conjugated to an antigen-binding molecule.

The components of this composition may be designed to be contributed simultaneously, individually or subsequently. In this context, the term "label" also includes agents such as chemotherapeutic agents; cytotoxins; growth factors, cytokines; bacterial, plant, or fungal

188 186 203 endotoxins and further radioisotopes than indicated hereinabove including Re, Re, Pb,

212Pb, 109Pd, 64Cu, 67Cu, 90Y, 77Br, 211At and 199Ag.

In a particular preferred embodiment, the use of the Ds-tag/cognate ligand system of the present invention in the mentioned application of screening and identification of binding partners is performed in context with an immunological assay, wherein the Ds-tag and cognate ligand are designed as an immunological test as described herein before and illustrated in Figures 11 and 12.

These and other embodiments are disclosed and encompassed by the description and examples of the present invention. Further literature concerning any one of the materials, methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries and databases, using for example electronic devices. For example the public database "Medline" may be utilized, which is hosted by the National Center for Biotechnology Information and/or the National Library of Medicine at the National Institutes of Health. Further databases and web addresses, such as those of the European Bioinformatics Institute (EBI), which is part of the European Molecular Biology Laboratory (EMBL) are known to the person skilled in the art and can also be obtained using internet search engines. An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness are given in Berks, TIBTECH 12 (1994), 352-364.

The above disclosure generally describes the present invention. Several documents are cited throughout the text of this specification. Full bibliographic citations may be found at the end of the specification immediately preceding the claims. The contents of all cited references (including literature references, issued patents, published patent applications as cited throughout this application and manufacturer's specifications, instructions, etc) are hereby expressly incorporated by reference; however, there is no admission that any document cited is indeed prior art as to the present invention.

A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only and are not intended to limit the scope of the invention.

EXAMPLES

The Examples which follow further illustrate the invention, but should not be construed to limit the scope of the invention in any way. Detailed descriptions of conventional methods, such as those employed herein can be found in the cited literature; see also "The Merck Manual of Diagnosis and Therapy" Seventeenth Ed. ed. by Beers and Berkow (Merck & Co., Inc., 2003).

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art.

Methods in molecular genetics and genetic engineering are described generally in the current editions of Molecular Cloning: A Laboratory Manual, (Sambrook et al, (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press); DNA Cloning, Volumes I and II (Glover ed., 1985); Oligonucleotide Synthesis (Gait ed., 1984); Nucleic Acid Hybridization (Hames and Higgins eds. 1984); Transcription And Translation (Hames and Higgins eds. 1984); Culture Of Animal Cells (Freshney and Alan, Liss, Inc., 1987); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, eds.); Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd Edition (Ausubel et al, eds.); and Recombinant DNA Methodology (Wu, ed., Academic Press). Gene Transfer Vectors For Mammalian Cells (Miller and Calos, eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al, eds.); Immobilized Cells And Enzymes (IRL Press, 1986); Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (Weir and Blackwell, eds., 1986). Reagents, cloning vectors, and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as BioRad, Stratagene, Invitrogen, and Clontech. General techniques in cell culture and media collection are outlined in Large Scale Mammalian Cell Culture (Hu et al., Curr. Opin. Biotechnol. 8 (1997), 148); Serum -free Media (Kitano, Biotechnology 17 (1991), 73); Large Scale Mammalian Cell Culture (Curr. Opin. Biotechnol. 2 (1991), 375); and Suspension Culture of Mammalian Cells (Birch et al, Bioprocess Technol. 19 (1990), 251. Material and Methods

Large-scale production and purification of N-terminally truncated FimGt from inclusion bodies

FimGt is a variant of the type 1 pilus subunit FimG of E. coli which lacks the first 12 N- terminal amino acid residues (Vetsch et al. 2004). For production of FimGt, E.coli BL21 (DE3) cells were transformed with the plasmid pFimGt-cyt (Dworkowski 2010) and grown in 2YT medium containing 0.1 mg/ml ampicillin at 37 °C. At OD6oo = LO, gene expression was induced by adding isopropyl-P-D-thiogalactopyranoside (IPLG) to a final concentration of 1 mM. After 4 h of incubation, cells were harvested by centrifugation, resuspended in 100 mM Lris-HCl pH 8.0 (4 °C), 1 mM EDLA (3 ml/g cells) and disrupted by passing the solution three times through a Microfluidizer M-110L (Microfluidics, USA) with a chamber pressure of approximately 14Ό00 PSI. After addition of 0.5 volumes of 60 mM EDLA-NaOH pH 7, 1.5 M NaCl, 6 % (v/v) Lriton-X-100 the solution was stirred for 30 min at 4 °C. Lhe inclusion bodies containing FimGt were pelleted by centrifugation for 30 min at 48000 g and 4 °C and washed five times with 100 mM Lris-HCl pH 8.0 (4 °C), 20 mM EDLA. For solubilization of FimGt, the inclusion body pellet was dissolved in 6 M GdmCl, 100 mM Lris-HCl pH 8.0 (RL), 1 mM EDLA, 100 mM DLL (20 ml/g of IBs) and stirred for 2 h at RL. After ultracentrifugation for 30 min at 100Ό00 g, 20 °C, the supernatant was passed over a Superdex 200 26/60 gel filtration column (GE Healthcare) equilibrated in 6 M GdmCl, 20 mM acetic acid-NaOH pH 4.0. Fractions containing FimGt were pooled. For refolding and formation of the disulfide bond in FimGt, denatured FimGt was rapidly diluted in 100 mM Lris-HCl pH 8.5 (RL), 1 mM GSH, 0.5 mM GSSG to a final FimGt concentration of 2 μΜ; the final concentration of GdmCl was < 0.2 M. After incubation for 1 h at RL, the solution was concentrated to approx. 75 ml by ultrafiltration at 4 °C using a YMlO-membrane (Merck, Germany) with a nominal molecular weight limit (NMWL) of 10 kDa. All of the following purification steps were performed at 4 °C and the protein was kept at 4 °C or on ice throughout. FimGt was then dialyzed twice against 5 1 of 20 mM Lris-HCl pH 8.0 (RL), passed through a 0.2 μπι cellulose acetate syringe filter (Sartorius, Germany) and loaded onto a Resource Q column (GE Healthcare) equilibrated in 20 mM Lris-HCl pH 8.0 (RL). Bound protein was eluted with a linear gradient from zero to 400 mM NaCl. Fractions containing FimGt were pooled and passed over a Superdex 75 26/60 gel filtration column (GE Healthcare) equilibrated with 20 mM Lris-HCl pH 8.0 (4 °C), 150 mM NaCl. Monomeric FimGt was desalted into 20 mM Lris-HCl pH 8.0 (RL) using a HiPrep 16/10 column (GE Healthcare), shock-frozen in liquid nitrogen and stored at -80 °C. Lhe concentration of FimGt was determined by UV-spectroscopy at 280 nm using an extinction coefficient of 12'210 M" ^m"1. The final yield of purified FimGt protein was 35 milligram per liter of bacterial culture.

Production of FimGt-Sepharose

For coupling of FimGt to N-hydroxysuccinimidylester ( HS)-activated sepharose 4 FF (GE Healthcare) the last gel filtration run of the purification protocol of FimGt was performed in 200 mM NaHCC-3 pH 8.3 (RT), 150 mM NaCl. The coupling reaction was performed according to the manufacturer's instructions. Typically, 2 ml of a FimGt stock solution (10 mg/ml) were mixed with 2 ml of column material and incubated overnight at 4 °C under gentle agitation. Excess N-hydroxysuccinimidylester molecules on the column material were blocked with 0.1 M Tris-HCl pH 8.5 (4°C) at 4 °C. The blocking solution was renewed regularly until the absorance of the supernatant at 260 nm dropped below 0.05 after a 24 h incubation. FimGt-Sepharose was stored in H20 at 4 °C.

Determination of the rate constant of binding of the DsF peptide to FimGt

FimGt (5 μΜ) was incubated with 5, 10, 25 or 50 μΜ of the donor strand peptide of FimF (DsF) at pH 8.0 and 25 °C. After defined incubation times, the samples were transferred to 6 M GdmCl, 180 mM histidine-HCl pH 1.0 and unfolding kinetics were measured by following the decrease in tryptophan fluorescence at 330 nm (excitation at 280 nm). Under these conditions, free FimGt unfolds within the dead time of the measurement and any further change in fluorescence can be attributed to the unfolding/dissociation of the FimGt/DsF complex. Thus, the amplitudes of the slow unfolding phase directly correspond to the fraction of the FimGt/DsF complex present in the sample and were obtained by fitting the unfolding kinetics according to a first-order reaction. The rate constant for binding of DsF to FimGt (k2 = 330 ± 8.9 M'V1) was obtained by globally fitting the binding kinetics measured for the four different DsF concentrations according to a second-order reaction.

Affinity purification of tryptophan synthase from E. coh with various affinity tags fused to the tryptophan synthase subunit TrpA

Expression plasmids and expression

For affinity purification of tryptophan synthase (TS) via different affinity tags, the trpA gene encoding the alpha subunit of TS was amplified from genomic DNA of E. coli W3110 (Bachmann 1972) by PCR. The DNA sequence encoding a DsF-, His-, FLAG-, StrepII- and cmyc-tag was fused between the start codon and the codon encoding the first amino acid after of the tip A gene. A TEV protease cleavage site (ENLYFQG - SEQ ID NO: 17) was placed between the tag and the N-terminus of TrpA. To guarantee access of the protease to its cleavage site, a SGGSGG-linker (SEQ ID NO: 18) was introduced between DsF and the TEV-cleavage site and between the TEV site and the N-terminus of TrpA. For cloning, plasmid pAC-PTetT7-HIV (Neuenschwander et al.2007) was used which contains a pi 5 A origin of replication, a cat gene to provide resistance to chloramphenicol, the tetR gene encoding the repressor TetR and a ieiA/T7-tandem promoter. The DNA sequences of the different TrpA constructs were inserted using the Ndel and Spel restriction sites and are listed together with the corresponding amino acid sequences in Table 1.

Table 1 : DNA and amino acid sequences of TrpA and L23 constructs.

name of protein

DNA and corresponding amino acid sequence

construct

1 ATGGCAGACTCTACCATTACTATTCGCGGCTATGTCAGGGATAACGGCAGCGGTGGAAGT

1 M A D S T I T I R G Y V R D N G S G G S

61 GGTGGCGAGAACCTCTATTTCCAGGGCAGCGGTGGAAGTGGAGGTGAACGCTACGAATCT

21 G G E N L Y F Q G S G G S G G E R Y E S

121 CTGTTTGCCCAGTTGAAGGAGCGCAAAGAAGGCGCATTCGTTCCTTTCGTCACGCTCGGT

41 L F A Q L K E R K E G A F V P F V T L G

181 GATCCGGGCATTGAGCAGTCATTGAAAATTATCGATACGCTAATTGAAGCCGGTGCTGAC

61 D P G I E Q S L K I I D T L I E A G A D

241 GCGCTGGAGTTAGGTATCCCCTTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAAC

81 A L E L G I P F S D P L A D G P T I Q N

301 GCCACTCTGCGCGCCTTTGCGGCAGGTGTGACTCCGGCACAATGTTTTGAAATGCTGGCA

101 A T L R A F A A G V T P A Q C F E M L A

361 CTGATTCGCCAGAAACACCCGACCATTCCCATTGGCCTGTTGATGTATGCCAATCTGGTG

121 L I R Q K H P T I P I G L L M Y A N L V

421 TTTAACAAAGGCATTGATGAGTTTTATGCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTG

141 F N K G I D E F Y A Q C E K V G V D S V

DsF-TrpA

481 CTGGTTGCCGATGTGCCAGTTGAAGAGTCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCAT

161 L V A D V P V E E S A P F R Q A A L R H

541 AATGTCGCACCTATCTTCATCTGCCCGCCAAATGCCGATGACGACCTGCTGCGCCAGATA

181 N V A P I F I C P P N A D D D L L R Q I

601 GCCTCTTACGGTCGTGGTTACACCTATTTGCTGTCACGAGCAGGCGTGACCGGCGCAGAA

201 A S Y G R G Y T Y L L S R A G V T G A E

661 AACCGCGCCGCGTTACCCCTCAATCATCTGGTTGCGAAGCTGAAAGAGTACAACGCTGCA

221 N R A A L P L N H L V A K L K E Y N A A

721 CCTCCATTGCAGGGATTTGGTATTTCCGCCCCGGATCAGGTAAAAGCAGCGATTGATGCA

241 P P L Q G F G I S A P D Q V K A A I D A

781 GGAGCTGCGGGCGCGATTTCTGGTTCGGCCATTGTTAAAATCATCGAGCAACATATTAAT

261 G A A G A I S G S A I V K I I E Q H I N

841 GAGCCAGAGAAAATGCTGGCGGCACTGAAAGTTTTTGTACAACCGATGAAAGCGGCGACG

281 E P E K M L A A L K V F V Q P M K A A T

901 CGCAGTTAA (SEQ ID NO: 1)

301 R S * (SEQ ID NO: 2) 1 ATGCATCATCACCATCATCATAGCGGTGGAAGTGGTGGCGAGAACCTCTATTTCCAGGGC

1 M H H H H H H S G G S G G E N L Y F Q G

61 AGCGGTGGAAGTGGAGGTGAACGCTACGAATCTCTGTTTGCCCAGTTGAAGGAGCGCAAA

21 S G G S G G E R Y E S L F A Q L K E R K

121 GAAGGCGCATTCGTTCCTTTCGTCACGCTCGGTGATCCGGGCATTGAGCAGTCATTGAAA

41 E G A F V P F V T L G D P G I E Q S L K

181 ATTATCGATACGCTAATTGAAGCCGGTGCTGACGCGCTGGAGTTAGGTATCCCCTTCTCC

61 I I D T L I E A G A D A L E L G I P F S

241 GACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCCTTTGCGGCAGGT

81 D P L A D G P T I Q N A T L R A F A A G

301 GTGACTCCGGCACAATGTTTTGAAATGCTGGCACTGATTCGCCAGAAACACCCGACCATT

101 V T P A Q C F E M L A L I R Q K H P T I

361 CCCATTGGCCTGTTGATGTATGCCAATCTGGTGTTTAACAAAGGCATTGATGAGTTTTAT

121 P I G L L M Y A N L V F N K G I D E F Y

His-TrpA 421 GCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTGCTGGTTGCCGATGTGCCAGTTGAAGAG

141 A Q C E K V G V D S V L V A D V P V E E

481 TCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCATAATGTCGCACCTATCTTCATCTGCCCG

161 S A P F R Q A A L R H N V A P I F I C P

541 CCAAATGCCGATGACGACCTGCTGCGCCAGATAGCCTCTTACGGTCGTGGTTACACCTAT

181 P N A D D D L L R Q I A S Y G R G Y T Y

601 TTGCTGTCACGAGCAGGCGTGACCGGCGCAGAAAACCGCGCCGCGTTACCCCTCAATCAT

201 L L S R A G V T G A E N R A A L P L N H

661 CTGGTTGCGAAGCTGAAAGAGTACAACGCTGCACCTCCATTGCAGGGATTTGGTATTTCC

221 L V A K L K E Y N A A P P L Q G F G I S

721 GCCCCGGATCAGGTAAAAGCAGCGATTGATGCAGGAGCTGCGGGCGCGATTTCTGGTTCG

241 A P D Q V K A A I D A G A A G A I S G S

781 GCCATTGTTAAAATCATCGAGCAACATATTAATGAGCCAGAGAAAATGCTGGCGGCACTG

261 A I V K I I E Q H I N E P E K M L A A L

841 AAAGTTTTTGTACAACCGATGAAAGCGGCGACGCGCAGTTAA (SEQ ID NO: 3)

281 K V F V Q P M K A A T R S * (SEQ ID NO: 4)

1 ATGGATTACAAGGATGACGATGATAAGAGCGGTGGAAGTGGTGGCGAGAACCTCTATTTC

1 M D Y K D D D D K S G G S G G E N L Y F

61 CAGGGCAGCGGTGGAAGTGGAGGTGAACGCTACGAATCTCTGTTTGCCCAGTTGAAGGAG

21 Q G S G G S G G E R Y E S L F A Q L K E

121 CGCAAAGAAGGCGCATTCGTTCCTTTCGTCACGCTCGGTGATCCGGGCATTGAGCAGTCA

41 R K E G A F V P F V T L G D P G I E Q S

181 TTGAAAATTATCGATACGCTAATTGAAGCCGGTGCTGACGCGCTGGAGTTAGGTATCCCC

61 L K I I D T L I E A G A D A L E L G I P

241 TTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCCTTTGCG

81 F S D P L A D G P T I Q N A T L R A F A

FLAG-TrpA 301 GCAGGTGTGACTCCGGCACAATGTTTTGAAATGCTGGCACTGATTCGCCAGAAACACCCG

101 A G V T P A Q C F E M L A L I R Q K H P

361 ACCATTCCCATTGGCCTGTTGATGTATGCCAATCTGGTGTTTAACAAAGGCATTGATGAG

121 T I P I G L L M Y A N L V F N K G I D E

421 TTTTATGCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTGCTGGTTGCCGATGTGCCAGTT

141 F Y A Q C E K V G V D S V L V A D V P V

481 GAAGAGTCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCATAATGTCGCACCTATCTTCATC

161 E E S A P F R Q A A L R H N V A P I F I

541 TGCCCGCCAAATGCCGATGACGACCTGCTGCGCCAGATAGCCTCTTACGGTCGTGGTTAC

181 C P P N A D D D L L R Q I A S Y G R G Y

601 ACCTATTTGCTGTCACGAGCAGGCGTGACCGGCGCAGAAAACCGCGCCGCGTTACCCCTC

201 T Y L L S R A G V T G A E N R A A L P L 661 AATCATCTGGTTGCGAAGCTGAAAGAGTACAACGCTGCACCTCCATTGCAGGGATTTGGT 221 N H L V A K L K E Y N A A P P L Q G F G

721 ATTTCCGCCCCGGATCAGGTAAAAGCAGCGATTGATGCAGGAGCTGCGGGCGCGATTTCT 241 I S A P D Q V K A A I D A G A A G A I S

781 GGTTCGGCCATTGTTAAAATCATCGAGCAACATATTAATGAGCCAGAGAAAATGCTGGCG 261 G S A I V K I I E Q H I N E P E K M L A

841 GCACTGAAAGTTTTTGTACAACCGATGAAAGCGGCGACGCGCAGTTAA

281 A L K V F V Q P M K A A T R S *

(SEQ ID NO: 5)

(SEQ ID NO: 6)

1 CATATGTGGTCACATCCACAATTCGAGAAAAGCGGTGGAAGTGGTGGCGAGAACCTCTAT

1 H M W S H P Q F E K S G G S G G E N L Y

61 TTCCAGGGCAGCGGTGGAAGTGGAGGTGAACGCTACGAATCTCTGTTTGCCCAGTTGAAG 21 F Q G S G G S G G E R Y E S L F A Q L K

121 GAGCGCAAAGAAGGCGCATTCGTTCCTTTCGTCACGCTCGGTGATCCGGGCATTGAGCAG 41 E R K E G A F V P F V T L G D P G I E Q

181 TCATTGAAAATTATCGATACGCTAATTGAAGCCGGTGCTGACGCGCTGGAGTTAGGTATC 61 S L K I I D T L I E A G A D A L E L G I

241 CCCTTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCCTTT 81 P F S D P L A D G P T I Q N A T L R A F

301 GCGGCAGGTGTGACTCCGGCACAATGTTTTGAAATGCTGGCACTGATTCGCCAGAAACAC 101 A A G V T P A Q C F E M L A L I R Q K H

361 CCGACCATTCCCATTGGCCTGTTGATGTATGCCAATCTGGTGTTTAACAAAGGCATTGAT 121 P T I P I G L L M Y A N L V F N K G I D

421 GAGTTTTATGCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTGCTGGTTGCCGATGTGCCA

StrepII-TrpA 141 E F Y A Q C E K V G V D S V L V A D V P

481 GTTGAAGAGTCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCATAATGTCGCACCTATCTTC 161 V E E S A P F R Q A A L R H N V A P I F

541 ATCTGCCCGCCAAATGCCGATGACGACCTGCTGCGCCAGATAGCCTCTTACGGTCGTGGT 181 I C P P N A D D D L L R Q I A S Y G R G

601 TACACCTATTTGCTGTCACGAGCAGGCGTGACCGGCGCAGAAAACCGCGCCGCGTTACCC 201 Y T Y L L S R A G V T G A E N R A A L P

661 CTCAATCATCTGGTTGCGAAGCTGAAAGAGTACAACGCTGCACCTCCATTGCAGGGATTT 221 L N H L V A K L K E Y N A A P P L Q G F

721 GGTATTTCCGCCCCGGATCAGGTAAAAGCAGCGATTGATGCAGGAGCTGCGGGCGCGATT 241 G I S A P D Q V K A A I D A G A A G A I

781 TCTGGTTCGGCCATTGTTAAAATCATCGAGCAACATATTAATGAGCCAGAGAAAATGCTG 261 S G S A I V K I I E Q H I N E P E K M L

841 GCGGCACTGAAAGTTTTTGTACAACCGATGAAAGCGGCGACGCGCAGTTAA

281 A A L K V F V Q P M K A A T R S *

(SEQ ID NO: 7)

(SEQ ID NO: 8)

1 ATGGAACAGAAGTTAATCTCGGAAGAGGATCTTAGCGGTGGAAGTGGTGGCGAGAACCTC

1 M E Q K L I S E E D L S G G S G G E N L

61 TATTTCCAGGGCAGCGGTGGAAGTGGAGGTGAACGCTACGAATCTCTGTTTGCCCAGTTG 21 Y F Q G S G G S G G E R Y E S L F A Q L

121 AAGGAGCGCAAAGAAGGCGCATTCGTTCCTTTCGTCACGCTCGGTGATCCGGGCATTGAG 41 K E R K E G A F V P F V T L G D P G I E cmyc-TrpA

181 CAGTCATTGAAAATTATCGATACGCTAATTGAAGCCGGTGCTGACGCGCTGGAGTTAGGT 61 Q S L K I I D T L I E A G A D A L E L G

241 ATCCCCTTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCC 81 I P F S D P L A D G P T I Q N A T L R A

301 TTTGCGGCAGGTGTGACTCCGGCACAATGTTTTGAAATGCTGGCACTGATTCGCCAGAAA 101 F A A G V T P A Q C F E M L A L I R Q K 361 CACCCGACCATTCCCATTGGCCTGTTGATGTATGCCAATCTGGTGTTTAACAAAGGCATT 121 H P T I P I G L L M Y A N L V F N K G I

421 GATGAGTTTTATGCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTGCTGGTTGCCGATGTG 141 D E F Y A Q C E K V G V D S V L V A D V

481 CCAGTTGAAGAGTCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCATAATGTCGCACCTATC 161 P V E E S A P F R Q A A L R H N V A P I

541 TTCATCTGCCCGCCAAATGCCGATGACGACCTGCTGCGCCAGATAGCCTCTTACGGTCGT 181 F I C P P N A D D D L L R Q I A S Y G R

601 GGTTACACCTATTTGCTGTCACGAGCAGGCGTGACCGGCGCAGAAAACCGCGCCGCGTTA 201 G Y T Y L L S R A G V T G A E N R A A L

661 CCCCTCAATCATCTGGTTGCGAAGCTGAAAGAGTACAACGCTGCACCTCCATTGCAGGGA 221 P L N H L V A K L K E Y N A A P P L Q G

721 TTTGGTATTTCCGCCCCGGATCAGGTAAAAGCAGCGATTGATGCAGGAGCTGCGGGCGCG 241 F G I S A P D Q V K A A I D A G A A G A

781 ATTTCTGGTTCGGCCATTGTTAAAATCATCGAGCAACATATTAATGAGCCAGAGAAAATG 261 I S G S A I V K I I E Q H I N E P E K M

841 CTGGCGGCACTGAAAGTTTTTGTACAACCGATGAAAGCGGCGACGCGCAGTTAA 281 L A A L K V F V Q P M K A A T R S *

(SEQ ID NO: 9)

(SEQ ID NO: 10)

1 ATGAGCGGTGGAAGTGGTGGCGAGAACCTCTATTTCCAGGGCAGCGGTGGAAGTGGAGGT 1 M S G G S G G E N L Y F Q G S G G S G G

61 GAACGCTACGAATCTCTGTTTGCCCAGTTGAAGGAGCGCAAAGAAGGCGCATTCGTTCCT 21 E R Y E S L F A Q L K E R K E G A F V P

121 TTCGTCACGCTCGGTGATCCGGGCATTGAGCAGTCATTGAAAATTATCGATACGCTAATT 41 F V T L G D P G I E Q S L K I I D T L I

181 GAAGCCGGTGCTGACGCGCTGGAGTTAGGTATCCCCTTCTCCGACCCACTGGCGGATGGC 61 E A G A D A L E L G I P F S D P L A D G

241 CCGACGATTCAAAACGCCACTCTGCGCGCCTTTGCGGCAGGTGTGACTCCGGCACAATGT 81 P T I Q N A T L R A F A A G V T P A Q C

301 TTTGAAATGCTGGCACTGATTCGCCAGAAACACCCGACCATTCCCATTGGCCTGTTGATG 101 F E M L A L I R Q K H P T I P I G L L M

361 TATGCCAATCTGGTGTTTAACAAAGGCATTGATGAGTTTTATGCCCAGTGCGAAAAAGTC 121 Y A N L V F N K G I D E F Y A Q C E K V untagged TrpA 421 GGCGTCGATTCGGTGCTGGTTGCCGATGTGCCAGTTGAAGAGTCCGCGCCCTTCCGCCAG

141 G V D S V L V A D V P V E E S A P F R Q

481 GCCGCGTTGCGTCATAATGTCGCACCTATCTTCATCTGCCCGCCAAATGCCGATGACGAC 161 A A L R H N V A P I F I C P P N A D D D

541 CTGCTGCGCCAGATAGCCTCTTACGGTCGTGGTTACACCTATTTGCTGTCACGAGCAGGC 181 L L R Q I A S Y G R G Y T Y L L S R A G

601 GTGACCGGCGCAGAAAACCGCGCCGCGTTACCCCTCAATCATCTGGTTGCGAAGCTGAAA 201 V T G A E N R A A L P L N H L V A K L K

661 GAGTACAACGCTGCACCTCCATTGCAGGGATTTGGTATTTCCGCCCCGGATCAGGTAAAA 221 E Y N A A P P L Q G F G I S A P D Q V K

721 GCAGCGATTGATGCAGGAGCTGCGGGCGCGATTTCTGGTTCGGCCATTGTTAAAATCATC 241 A A I D A G A A G A I S G S A I V K I I

781 GAGCAACATATTAATGAGCCAGAGAAAATGCTGGCGGCACTGAAAGTTTTTGTACAACCG 261 E Q H I N E P E K M L A A L K V F V Q P

841 ATGAAAGCGGCGACGCGCAGTTAA (SEQ ID NO: 11) 281 M K A A T R S * (SEQ ID NO: 12)

1 ATGATTCGTGAAGAACGTCTGCTGAAGGTGCTGCGTGCACCGCACGTTTCTGAAAAAGCG

L23-DsF 1 M I R E E R L L K V L R A P H V S E K A

61 TCTACTGCGATGGAAAAATCCAACACCATCGTACTCAAAGTTGCTAAAGACGCGACCAAA 21 S T A M E K S N T I V L K V A K D A T K 121 GCAGAAATCAAAGCTGCTGTGCAGAAACTGTTTGAAGTCGAAGTCGAAGTCGTTAACACC

41 A E I K A A V Q K L F E V E V E V V N T

181 CTGGTAGTTAAAGGGAAAGTTAAACGTCACGGACAGCGTATCGGTCGTCGTAGCGACTGG 61 L V V K G K V K R H G Q R I G R R S D

241 AAAAAAGCTTACGTCACCCTGAAAGAAGGCCAGAATCTGGACTTCGTTGGCGGCGCTGAG 81 K K A Y V T L K E G Q N L D F V G G A E

301 AGCGGTGGAAGTGGTGGCGAGAACCTCTATTTCCAGGGCAGCGGTGGAAGTGGAGGTGCA 101 S G G S G G E N L Y F Q G S G G S G G A

361 GACTCTACCATTACTATTCGCGGCTATGTCAGGGATAACGGCTAA ( SEQ ID NO: 13) 121 D S T I T I R G Y V R D N G * (SEQ ID NO: 14)

1 ATGATTCGTGAAGAACGTCTGCTGAAGGTGCTGCGTGCACCGCACGTTTCTGAAAAAGCG

1 M I R E E R L L K V L R A P H V S E K A

61 TCTACTGCGATGGAAAAATCCAACACCATCGTACTCAAAGTTGCTAAAGACGCGACCAAA 21 S T A M E K S N T I V L K V A K D A T K

121 GCAGAAATCAAAGCTGCTGTGCAGAAACTGTTTGAAGTCGAAGTCGAAGTCGTTAACACC 41 A E I K A A V Q K L F E V E V E V V N T untagged L23 181 CTGGTAGTTAAAGGGAAAGTTAAACGTCACGGACAGCGTATCGGTCGTCGTAGCGACTGG

61 L V V K G K V K R H G Q R I G R R S D W

241 AAAAAAGCTTACGTCACCCTGAAAGAAGGCCAGAATCTGGACTTCGTTGGCGGCGCTGAG 81 K K A Y V T L K E G Q N L D F V G G A E

301 AGCGGTGGAAGTGGTGGCGAGAACCTCTATTTCCAGGGCAGCGGTGGAAGTGGAGGTTAA 101 S G G S G G E N L Y F Q G S G G S G G *

(SEQ ID NO: 15)

(SEQ ID NO: 16)

Transformation-competent BW25113 AtrpA768::kan cells (National BioResource Project, Japan) were prepared as described (Chung et al. 1989), transformed with the corresponding plasmid and spread onto LB-agar plates containing 30 μg/ml chloramphenicol and kanamycin. A single clone was used to inoculate 6 ml of 2YT -medium containing the same two antibiotics and grown overnight at 37 °C with agitation. Then, cells were diluted 1:1000 into 1.5 1 M9 medium (Sambrook & Russell 2001) containing antibiotics as above and supplemented with 40 mg/1 of all L-amino acids except tryptophan, 0.1 ml/10.5 % (w/v) vitamine Bl and 0.2 ng/ml anhydrotetracycline to induce gene expression. Cells were grown at 37 °C until OD600 ~ 1.5, harvested by centrifugation (10 min, 4200 g, 4 °C) and resuspended with 3 ml per gram of cells of resuspension buffer having the following composition:

For His-TrpA: 100 mM Tris-HCl pH 7.8 (4 °C), 180 mM NaCl, 10 mM imidazole, 50 μΜ pyridoxal-phosphate (PLP), 40 mM L-serine, 10 mM β-mercaptoethanol.

For all other TrpA fusion constructs: 100 mM Tris-HCl pH 7.8 (4° C), 180 mM NaCl, 1 mM EDTA, 50 μΜ PLP, 40 mM L-serine, 10 mM β-mercaptoethanol. All resuspension buffers were supplemented with one tablet of Roche "COMPLETE" EDTA- firee protease inhibitor cocktail per 50 ml of buffer. Cells were disrupted by 10 passages through a Microfluidizer M-110L with a chamber pressure of approximately 14Ό00 PSI and centrifuged for 60 min at 48000 g and 4 °C. 150 μΐ of the supernatant were saved for determination of the total protein concentration and TS-activity as described below, the remainder (typically approx. 30 ml) was used for affinity chromatography.

All of the following steps were performed at 4 °C unless otherwise noted.

Preparation of affinity column materials and sample application:

In a 5 ml chromatography column (Mobitec, Germany) 0.5 ml of anti-FLAG M2 affinity gel (Sigma, USA) was equilibrated at RT with 3 column volumes (CV) 0.1 M glycine-HCl pH 3.5 followed by 2x2 CV of resuspension buffer. Similarly, 1 ml of anti-cmyc agarose conjugate (Sigma, USA) was equilibrated with 3x2.5 CV of 20 mM Na2HP04-NaOH pH 11.5 and 2x2 CV resuspension buffer. 2x0.5 ml of FimGt-Sepharose, Ni-NTA agarose (Qiagen, Germany) and Strep-Tactin Sepharose (IBA, Germany) were equilibrated with 2x2 CV of corresponding resuspension buffer. Equilibrated beads were then mixed with the corresponding cell extracts (untagged TrpA was incubated with FimGt-Sepharose as a control) and incubated for 16 h on a rotating tube mixer. After centrifugation (2 min, 50 g) the beads were transferred to 5 ml chromatography columns and washed with resuspension buffer until A260 < 0.05.

For His-TrpA, bound proteins were eluted with 8x0.5 ml of corresponding resuspension buffer containing 250 mM imidazole. In a 4 ml centrifugal filter device ( MWL: 3 kDa, Merck, Germany) this solution was concentrated to less than 400 μΐ and filled up twice with TEV cleavage buffer (10 mM Tris-HCl pH 8.0 (4 °C), 180 mM NaCl, 40 mM L-serine, 10 mM β-mercaptoethanol, 50 μΜ PLP).

Release of affinity-bound TrpA constructs with TEV protease cleavage

Removal of the His-tag was achieved by adding TEV protease (produced as described in Finder et al. 2010) to a final concentration of 0.5 μΜ in a total volume of 1 ml and incubating the sample for 16 h with gentle shaking. All other affinity beads were equilibrated with 2x2CV of TEV cleavage buffer. The beads were transferred to 2 ml Eppendorf tubes. For cleavage, 1 ml TEV cleavage buffer containing 0.5 μΜ TEV protease was added to the beads and the samples incubated as above. After centrifugation (1 min, 50 g, RT) the supernatant was removed and kept at 4 °C. The beads were washed with 6x0.5 ml TEV cleavage buffer which was added to the 1st supernatant. This solution should in theory contain cleaved product and TEV protease only. To remove TEV protease, 100 μΐ Ni-NTA agarose equilibrated in TEV cleavage buffer were added to each sample. For His-TrpA, 700 μΐ Ni-NTA agarose were used. After incubating for 30 min on a rotating tube mixer the samples were centrifuged (2 min, 50 g), the supernatant kept at 4 °C and the Ni-NTA agarose beads washed with 2x0.5 ml TEV cleavage buffer which was added to the 1st supernatant. These samples were concentrated as above to a volume of approx. 100 μΐ.

Determination of protein concentrations and enrichment factors

The total protein concentration of the individual cell extracts and the concentration of purified TS samples were determined using the BCA Protein Assay Kit (Thermo Fisher Scientific, USA), using bovine serum albumin dissolved in TEV cleavage buffer as a reference. To prevent interference from β-mercaptoethanol contained in the TEV cleavage buffers, 25 μΐ of each sample were first mixed with 25 μΐ of 100 mM iodoacetamide, 100 mM Tris-HCl pH 8.0 (RT) and incubated for 15 min at 37 °C.

TS activity was determined using the spectroscopic assay described previously (Miles et al. 1987) and the extinction coefficient Δε = 1.89 mM' m"1 (Woehl & Dunn 1995). Cell extracts and purified TS samples were appropriately diluted with 100 mM Tris-HCl pH 7.8 (RT), 180 mM NaCl, 40 mM L-serine, 50 μΜ PLP and the reaction initiated by adding indole (20 mM dissolved in H20) to 0.2 mM. Before each measurement, all solutions and the cuvette were pre-incubated at 37 °C for 5 min.

Absolute enrichment factors for the one-step purification of TrpA fusions with the different affinity tags were calculated by dividing the specific activity of purified TS by the specific activity in the corresponding cell extract. As the specific TS activities in the cell extracts were not identical for the different TrpA constructs (differences were less than a factor of two), the enrichment factors were corrected for this difference (see corrected enrichment factors in figure 4). The purified TS samples were analyzed by reducing SDS-PAGE. In case of the DsF-, His-, FLAG- and cmyc-tagged TS, 6 mU were loaded onto the gel to allow comparison of the purity of the samples. For untagged and StrepII-tagged TS the sample volume was 15 μΐ (lanes "untagged" and "StrepII" in figure 3).

Affinity purification of E. coli ribosomes

The rplW gene encoding protein L23 of the large ribosomal subunit of E. coli was amplified from genomic DNA of E. coli strain W3110 by PCR. The DNA sequence for a DsF -tag was fused to the C-terminus of L23. TEV protease cleavage site and SGGSGG-linker sequences (SEQ ID NO: 18) were introduced as described above for the TrpA constructs. The DNA sequence of L23-DsF was inserted into pAC-PTetT7-HIV using the Ndel and Spel restriction sites and is listed together with the corresponding amino acid sequence in Table 1.

Transformation-competent MC4100 ArplW::kan [pL23] cells (Kramer et al. 2002) were prepared as above, transformed with the corresponding plasmid and spread onto LB-agar plates containing 10 μΜ IPTG and 30 μg/ml chloramphenicol, ampicillin and kanamycin. A single clone was used to inoculate 6 ml of 2YT-medium containing the same additives and grown overnight at 37 °C with agitation. 1.5 ml of this pre-culture was centrifuged (4500 g, 2 min, RT) and the cell pellet resuspended four times in 1.5 ml of the same medium but lacking IPTG. 150 μΐ of this cell suspension were used to inoculate 150 ml of 2YT-medium containing antibiotics as above and 2 ng/ml anhydrotetracycline. Cells were grown at 37 °C to OD60o ~ 0.5, harvested by centrifugation (10 min, 4200 g, 4 °C) and resuspended with 5 ml per gram of cells of resuspension buffer (20 mM HEPES-NaOH pH 7.4 (4 °C), 0.5 mM EDTA, 20.5 mM MgCl2, 200 mM NH4C1, 5 mM β-mercaptoethanol) supplemented with one tablet of Roche "COMPLETE" EDTA-free protease inhibitor cocktail per 50 ml of buffer. Cells were lysed by sonication and centrifuged for 30 min at 46000 g and 4 °C.

0.5 ml FimGt-Sepharose was equilibrated with 2x2CV resuspension buffer, mixed with cell extract containing L23-DsF and incubated for 24 h at 4 °C with gentle mixing. Centrifugation, washing and equilibration of the beads with TEV cleavage buffer (10 mM Tris-HCl pH 8.0 (4 °C), 6.5 mM MgCl2, 60 mM NH4C1, 10 mM β-mercaptoethanol) as well as on-column TEV cleavage (here for 21 h) was performed as described above for TS. After centrifugation (1 min, 50 g, RT) the supernatant was removed and kept at 4 °C. The beads were washed with 6x0.5 ml TEV cleavage buffer which was added to the Is supernatant (For SDS-PAGE, the washed beads were resuspended in 450 μΐ TEV cleavage buffer; 90 μΐ of the suspension were removed, centrifuged and incubated with SDS-sample buffer for 5 min at 95 °C). To remove TEV protease, 50 μΐ Ni-NTA agarose equilibrated in TEV cleavage buffer were added to each sample, incubated for 20 min on a rotating tube mixer and centrifuged (2 min, 50 g, 4 °C). The supernatant was kept at 4 °C and the Ni-NTA agarose beads were washed with 2x0.5 ml TEV cleavage buffer which was added to the 1st supernatant. The buffer was exchanged against 20 mM HEPES-NaOH pH 7.4 (4 °C), 0.5 mM EDTA, 6.5 mM MgCl2, 60 mM NH4C1, 2 mM DTT by concentrating/diluting the samples three times using 4 ml centrifugal filter devices (NMWL: 100 kDa).

In parallel, ribosomes were purified from MRE600 cells by standard sucrose density gradient centrifugation as described (Bingel-Erlenmeyer et al. 2008).

The concentration of ribosomes was determined by UV-spectroscopy using A26o(l% w/v) = 145 (Hill et al. 1969). rRNA was isolated from one A260 unit as described (Spedding 1990). 2 μg of rRNA were analyzed by denaturing agarose gel electrophoresis with formaldehyde (Sambrook & Russell 2001). To analyze ribosomes by transmission electron microscopy, 2.5 μΐ of a 1 A26o/ml solution were adsorbed to glow-discharged carbon-coated copper grids (Quantifoil, Germany) and negatively stained using 1 % (w/v) uranyl-actetate dissolved in H20. Images were acquired with a FEI Morgagni 268 microscope.

Example 1: Performed proof-of principle experiments, general strategy

To demonstrate the suitability of the FimGtDsF system for purification of recombinant proteins and, in particular, identification of ligands bound DsF-tagged proteins in vivo and in vitro, DsF was fused to the N-terminus of the subunit TrpA of E. coli tryptophan synthase, a heterotetrameric enzyme (type α2β2) essential for tryptophan biosynthesis in E. coli. Tryptophan synthase was chosen because the enzyme is only present in very low quantities in wild type E. coli cells, so that affinity purification of the tryptophan synthasea2 2 complex (consisting of two copies each of the subunits TrpA and TrpB) would yield high enrichment factors if the FimGtDsF system worked successfully.

The DsF-TrpA fusion was then expressed recombinantly at very low levels (equal to or slightly below those of TrpB) in a TrpA-deficient E. coli strain that still expressed the natural levels of TrpB, and it was tested whether the restored, intact tryptophan synthasea2 2 complex could be purified in a single step from cell extracts via FimGt covaletly immobilized via its amino groups to sepharose beads. Figure 1A summarizes the performed enrichment and purification strategy: after application of the cell extract containing the tryptophan synthase complex with DsF-tagged TrpA subunit, the FimGt-sepharose was extensively washed and the bound complex was specifically released from the affinity material by specific cleavage with tobacco etch virus (TEV) protease. For this purpose, the TEV protease cleavage sequence E LYFQG had been introduced between the DsF tag and the N-terminus of TrpA. Moreover, the fusion construct contained the flexible hexapeptide linker sequence SGGSGG (SEQ ID NO: 18) on both sides of the TEV recognition sequence to allow for optimal accessibility of the cleavage sequence by the protease (Figure IB). After TEV protease cleavage, the supernatant was analyzed for i) the presence of DsF-tagged TrpA, the copurification of TrpB and the purity of the tryptophan synthase complex with SDS-PAGE, ii) for the activity of the purified tryptophan synthase complex, and iii) for the enrichment factor relative to the specific activity (expressed in units per milligram of total protein) of the tryptophan synthase complex in the initial cell extract.

In addition, the efficiency of the FimG DsF system was compared with analogous TrpA fusions to well-established affinity tag systems that are commercially available (Figure IB). The enrichment factors achieved with these affinity tags were then compared with those obtained with the FimG DsF system.

In another set of experiments that demonstrate the power of the FimGtDsF system, we established the one-step purification of the biggest macromolecular assembly in the cell, namely the E. coli ribosome. Here, we fused the DsF tag to the C-terminus of the subunit L23 of the large ribosomal subunit, and succeeded in purifying entire ribosomes, consisting of the large and small ribosomal subunit and all ribosomal proteins and RNAs, in the same manner as desribed above for the tryptophan synthase complex.

Example 2: Optimization of large-scale expression and purification of FimGt from inclusion bodies and reaction conditions to allow for rapid binding of DsF to FimGt

Technical applications of the FimGtDsF system require the availability of large quantities of functional, recombinant FimGt that can be coupled covalently to activated sepharose beads or other matrices. For this purpose, an efficient expression and purification system for FimGt was developed. It is based on the large-scale expression of FimGt in the cytoplasm of E. coli in the form of insoluble aggregates (inclusion bodies). The FimGt aggregates can then be i) solubilized under denaturing conditions with highly concentrated guanidimium chloride (GdmCl) solutions, ii) refolded in vitro and iii) soluble, functional FimGt can then be obtained by conventional chromatography. Specifically, the refolding protocol was optimized such that the refolding reaction contained a redox buffer consisting of oxidized and reduced glutathione to allow for formation of the single disulfide bond in FimGt. All further details of FimGt production, purification and covalent immobilization on N-hydroxysuccinimidylester- activated sepharose are provided below under Materials and Methods.

Using purified FimGt and the soluble, synthetic DsF peptide, we optimized the conditions for binding of DsF to FimGt such that the reaction proceeds fast enough to allow binding of DsF - tagged proteins to FimGt-sepharose on an experimentally affordable time scale. The experiments are summarized in Figure 2 and yielded a rate constant of binding (kon) of 330 M" V1. Together with the previously published off-rate of dissociation of the DsF-FimGt complex (Puorger et al, 2008), the data revealed that the DsF-FimGt complex is not only the kinetically, but also the thermodynamically most stable noncovalent protein-ligand complex known to date, with a dissociation constant (KDiSS) of 2 10"20 M.

Example 3: Enrichment factors obtained with affinity purification of DsF-tagged proteins via the DsF-FimGt system and comparison with other commercially available affinity purification systems

Using the tryptophan synthase purification strategy outline above, we compared the efficiency of the one-step purification of tryptophan synthase from total cell extracts with the DsF- FimGt system with those obtained with established and commercially available affinity tag purification systems, i.e., the hexahistidine tag, the FLAG-tag, the StrepII tag, and the cmyc tag. Figures 3 and 4 summarize the corresponding experiments and show that the DsF-FimGt system showed the best enrichment factors among all tested affinity tags, and that it yielded the highest purity of the tryptophan synthase complex, together with the cmyc tag. Example 4: Purification of entire E. coli ribosomes with the C-terminally DsF-tagged subunit L23 of the large ribosomal subunit of E. coli.

To demonstrate that the DsF-FimGt system is also applicable for i) fusion of the DsF tag to the C-terminus of target proteins and ii) suitable for purification of most complex macromolecular complexes and identification of their molecular components, the DsF tag was fused to the C-terminus of the subunit L23 via the same strategy was described above for the TrpA fusions (with the TEV protease cleavage site flanked by the flexible hexapepetide linkers; for details see Materials and Methods for sequences of all recombinant protein constructs used). The L23-DsF fusion was then expressed in E. coli under conditions where expression of the natural, untagged L23 subunit is essentially suppressed (see Materials and Methods for details), and entire ribosomes could successfully be purified in a single step from cell extracts via affinity chromatography on FimGt-sepharose followed by TEV protease cleavage. Figures 5-7 document the purity of the obtained ribosome preparation, show that the ribosomes still contain all protein and RNA components, and demonstrate that the ribosomes purified via the DsF-FimGt system are indistinguishable from conventionally purified ribosomes prepared via density gradient centrifugation.

Conclusions

The type 1 pilus subunit FimG could be engineered such that binding of DsF (50 μΜ) occurs rapidly with a half-live of less than one minute at pH 8.0 and 25 °C. Using a DsF-tagged a- subunit, active tryptophan synthase from E. coli could be purified by affinity chromatography. Compared to other established affinity tags, the DsF-tag shows the highest enrichment factor. DsF-tagging of L23 of the large ribosomal subunit allowed one-step purification of 70 S ribosomes from E. coli extracts.

Example 5: Biomolecular FimGt/DsF Interaction Analysis by Biacore Assays

Assay setup - 1 : T200 FimGt/DsF thermodynamics

A Biacore T200 instrument (GE Healthcare) was used with a Biacore SA sensor mounted into the system at T = 25 °C and was preconditioned by a 1 min injection at 100 μΐ/min of 1M NaCl in 50 mM NaOH and a 1 min injection of 10 mM HCl. The system buffer was PBS-T (10 mM Na2HP04, 0.1 mM KH2P04, 2.7 mM KC1 NaCl 137 mM, 0.05 % Tween® 20). The sample buffer was the system buffer supplemented with 1 mg/ml CMD (Carboxymethyldextrane). The Biacore T200 System was driven under the control software VI .1.1. The flow cells of the SA sensor were immobilized with biotinylated ligands. On flow cell 1, 53 RU amino PEO-biotin (Pierce) were immobilized. On flow cell 2, 218 RU DsF(l- 15)[15-Glu(Bi-PEG)]amid (Roche) were immobilized. Prior to the analyte injection, the system was washed at 100 μΐ/min with system buffer. The analyte was injected at 100 μΐ/min in a concentration-dependent series at 0 nM, 300 nM, 11 nM, 33 nM, 100 nM, 300 nM, 900 nM, 2700 nM, and again 0 nM for 3.5 min association time and 10 min dissociation time. The system was regenerated at 20 μΐ/min by a 25 sec injection of lOx HBS-ET + DMSO buffer (100 mM HEPES pH 7.4, 1.5 M NaCl, 10 mM EDTA, 0.5 % Tween® 20, 2 % DMSO) followed by a 1 min injection of 100 mM HC1 at the respective temperature. The interaction was measured at different temperatures starting at 13 °C and increasing the temperature in steps of + 4°C up to 37 °C (see Fig. 8 for schematic representation and details and Fig. 9 for the measurement results). The temperature-dependent kinetics were evaluated according to a Langmuir model with Rmax global using the Biacore evaluation software V.1.1.1. The same software was used to calculate thermodynamic parameters. The Molar Ratio was calculated according to the Ratio Rmax (RU) of analyte to binding to surface presented ligand RU.

Results and Discussion

Using this assay setup, the kinetic measurements of the FimGt/DsF interaction revealed the kinetic rate properties of a highly entropy-burdened protein-protein interaction. In the given temperature gradient, slow association rate constants ka were determined. The dissociation rate constants kd were extremely slow and thus, out of the instruments specifications (o.o.s= out of specifications limit = 1.0 E-05 1/s; see also Table 2 below). According to Puoroger et ah, Structure 16 (2008), 631-642, the FimGt/DsF interaction is characterized by hydrophobicity and structural rearrangements as well as an ultra high energy barrier for dissociation. These findings are supported by these kinetic measurements. The FimGt/DsF interaction shows a very high complex stability. There is no measureable FimGt/DsF complex decay in the measured time window of the dissociation phase. Since the chi values of the kinetic data indicate a small error, the data were appropriate to calculate thermodynamics for further characterization of the nature of the FimGt/DsF interaction (see Table 3 below). Since the free binding enthalpy AG° is strongly temperature dependent, the non-linear van' Hoff equation was used. The free binding enthalpy (AG° = -50 kJ/mol) is generated from a positive binding enthalpy term (ΔΗ° = 210 kJ/mol +/- 8.2 kJ/mol) and a positive entropic term (TAS° = 260 kJ/mol). This indicates that entropy, but not enthalpy is the driving force of the FimGt/DsF interaction. The non-linear van' Hoff equation produces a large negative heat capacity change ACp° = -8.2, typical for interactions characterized by a hydrophobic effect. Also typical for hydrophobic or entropy-burdened interactions are slow association rate constants ka. The association rates are catalyzed by temperature and accelerate with increasing temperature, whereas the dissociation rate constants remain unaffected. The transition state is thereby characterized by a high association phase entropy (AS°Jass = 100 J/Kmol +/- 30 J/Kmol), which is underlined by a high activation/association phase enthalpy (AFPJass = 91 kJ/mol +/- 8.9 kJ/mol) and an elevated association phase energy (Arrhenius) parameter (Ea ass = 94 kJ/mol +/- 8.9 kJ/mol).

Tab.2: Temperature-dependent kinetic data of the FimGt/DsF interaction. The interaction is characterized by slow association rate constants and ultra-stable dissociation rate constants

(out of specifications, o.o.s)

Figure imgf000063_0002

Tab.3.:Thermodynamic Parameters of the FimGt/DsF interaction as obtained in assay setup 1

Figure imgf000063_0001
Example 6: Biomolecular DsF/FimGt Interaction Analysis by Biacore Assays

A Biacore 4000 instrument (GE Healthcare) is used with a Biacore CM5 (carboxy methyl coated) series S sensor mounted into the system at T = 25 °C and is hydrodynamically addressed accrding to the instruments specifications. The system buffer is PBS-T (10 mM Na2HP04, 0.1 mM KH2P04, KC1 2.7 mM KC1, NaCl 137 mM, 0.05 % Tween® 20The Biacore 4000 System is driven under the control software VI .0. FimGt-ligands are unspecifically adsorbed on different sensitive measurement spots in the range of 300 RU to 1500 RU to the CM5 sensor matrix using 10 μg/ml to 150 μg/ml FimGt in 10 mM sodium acetate buffer pH 3.9. Spot 3 on each flow cell serves as control spot. The DsF analyte of interest is injected at 100 μΐ/min in a concentration-dependent series at 0 nM and 300 nM and 0 nM and 2700 nM for 2.5 min association time and 10 min dissociation time.

The sensor surface is regenerated by a 1 min injection of 6M guanidinium hydrochloride pH 7.4, followed by a 1 min injection of 100 mM NaOH at 20 μΐ/min each. Finally the system is washed for 3 min at 100 μΐ/min with system buffer. The interaction can be measured at different temperatures, preferably at 25 °C. The temperature-dependent kinetics are evaluated according to a so called "two over two" model with varying ligand surface density and analyte in solution concentrations, respectively. A Langmuir model with Rmax global can be either applied. The Biacore evaluation software V.1.0 is used to evaluate the data. The Molar Ratio is calculated according to the Ratio Rmax (RU) of analyte to binding to surface presented ligand RU.

In this assay the binding of a Ds-peptide (either in free form or bound to a molecule of interest, e.g. an antigen-binding molecule) to its cognate ligand is analyzed. In one example molecules binding to FimGt are analyzed. Non exhaustive examples of such molecules which are tested according to this assay are DsF(l-15)[15-Glu(Bi-PEG)]amid (Roche), DsF(l- 15)[15-Glu(Bi-PEG)]amid singly grafted on streptavidin or the DsF(l-15)[15-Glu(Bi- PEG)]amid (Roche) coupled to an antibody, an antigen-binding fragment or a similar antigen- binding molecule. (Bi-PEG stands for a linker with four PEG units. It is biotinylated at one end and covalently coupled to glutamic acid at position 15 of DsF at the other end.)

With the cognate ligand bound or adsorbed to a solid phase surprisingly a rapid association of a Ds-peptide to the cognate ligand is observed. Conclusion

As already discussed in context with Example 5, the immunological test illustrated with the above-described assay setup is characterized by an unusual high entropy-burden protein- protein interaction. In particular the findings with a cognate ligand bound or adsorbed to a solid phase (set-up of Example 6), with a high association rate constant on the one hand and extremely slow dissociation rate constant on the other hand provide a large area of applications where hitherto common immunological test were either not applicable or prone to artificial results. For example, the highly specific association of the Ds-tag and cognate ligand system allows a permanent use of the test, for example in long term measurements without the risk of receiving false positive results. Furthermore, the stability of association of the Ds-tag with the cognate ligand allows storage of the test, for example in the form of test strips or biochips for long time until the actual analyses take place.

Moreover, the fact that the test seems to be rather temperature insensitive, in particular in respect to the dissociation rate constant, allows applications under various conditions which hitherto were not amenable to ready-to-use immunological assays.

In this context, experiments performed in accordance with the present invention revealed that the association kinetics for the Ds-tag and its cognate ligand with the cognate ligand being immobilized on the matrix and the Ds-tag being in solution provides a different and in fact advantageous effect over the FimGt/DsF interaction when both molecules are in solution. Without intending to be bound by theory it is believed that upon binding to the matrix, a cognate ligand, like FimGt, experiences a conformational change which makes it more "attractive", i.e. accessible for its respective Ds-tagged counterpart. Adsorption could provide for an "induced fit" mechanism as known from other protein/protein interactions. When the Ds-tag binds to its cognate ligand which is immobilized on the matrix, the cognate ligand undergoes a sort of transition back into its native state, thereby forming a very stable complex with the Ds-tag.

Accordingly, the advantageous and surprising properties of the interaction between a cognate ligand and a Ds-tagged molecule, as exemplified by the FimGt/DsF interaction, when used in context of an immunological test represent an important finding which can be expected to mature into advantageous immunological tests. References

Bachmann BJ. Pedigrees of some mutant strains of Escherichia coli K-12. Bacteriol Rev, 1972, 36:525-57.

Bingel-Erlenmeyer R, Kohler R, Kramer G, Sandikci A, Antolic S, Maier T, Schaffitzel C, Wiedmann B, Bukau B, Ban N. A peptide deformylase-ribosome complex reveals mechanism of nascent chain processing. Nature, 2008, 452: 108-11.

Chung CT, Niemela SL, Miller RH. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci U S A, 1989, 86:2172-5.

Dworkowski F, PhD Thesis, PhD Thesis, ETH Zurich, 2010.

Finder VH, Vodopivec I, Nitsch RM, Glockshuber R. The recombinant amyloid-beta peptide Abetal-42 aggregates faster and is more neurotoxic than synthetic Abetal-42. Mol Biol, 2010, 396:9-18.

Hill WE, Rossetti GP, Van Holde KE. Physical studies of ribosomes from Escherichia coli. Mol Biol, 1969, 44:263-77.

Kramer G, Rauch T, Rist W, Vorderwulbecke S, Patzelt H, Schulze-Specking A, Ban N, Deuerling E, Bukau B. L23 protein functions as a chaperone docking site on the ribosome. Nature, 2002, 419: 171-4.

Miles EW, Bauerle R, Ahmed SA. Tryptophan synthase from Escherichia coli and Salmonella typhimurium. Methods Enzymol, 1987, 142:398-414.

Neuenschwander M, Butz M, Heintz C, Kast P, Hilvert D. A simple selection strategy for evolving highly efficient enzymes. Nat Biotechnol, 2007, 25: 1145-7.

Sambrook J, Russell D, Molecular cloning, a laboratory manual, Cold Spring Harbor Laboratory Press, New York, 2001

Spedding G, Ribosomes & Protein Synthesis, a practical approach, Oxford University Press, New York, 1990, 175-76.

Vetsch M, Puorger C, Spirig T, Grauschopf U, Weber-Ban EU, Glockshuber R. Pilus chaperones represent a new type of protein-folding catalyst. Nature, 2004, 431 :329-33.

Woehl EU, Dunn MF. Monovalent metal ions play an essential role in catalysis and intersubunit communication in the tryptophan synthase bienzyme complex. Biochemistry, 1995, 34:9466-76.

Claims

Claims
A method of purifying a donor-strand (Ds)-tagged molecule, said method comprising contacting a sample comprising the Ds-tagged molecule with an affinity matrix that comprises a cognate ligand of the Ds-tag, thereby immobilizing the Ds-tagged molecule on the affinity matrix.
The method of claim 1, wherein the Ds-tag and its cognate ligand are derived from subunits of pili, preferably wherein the pili are type 1 pili from Escherichia coli; most preferably wherein the Ds-tag is derived from DsF of subunit FimF or a fragment, analogue or variant thereof and its cognate ligand is derived from subunit FimG or a fragment, analogue or variant thereof, and most preferably wherein the Ds-tag comprises or consists of the amino acid sequence ADSTITIRGYVRDNG or a fragment, analogue or variant thereof.
The method of claim 1 or 2, wherein the affinity of binding between the Ds-tag and said cognate ligand comprises a KDiSS value in the range of 10"7 M to 10"20 M.
The method of any one of claims 1 to 3, wherein said Ds-tagged molecule is released from said affinity matrix by adding an agent that cleaves the Ds-tag from the molecule or by adding a denaturing agent that dissociates the Ds-tag from the molecule.
The method of any one of claims 1 to 4, wherein the Ds -tagged molecule is a fusion protein that comprises a Ds molecule and a polypeptide that is not a Ds molecule, preferably wherein said fusion protein is produced recombinantly and/or said fusion protein comprises a linker between said Ds molecule and said polypeptide, preferably wherein said linker is a polypeptide.
The method of claim 5, wherein said fusion protein comprises at least one Ds molecule at the N-terminus or at the C-terminus and/or wherein said fusion protein comprises at least one Ds molecule at an amino acid residue between the N-terminus and the C- terminus.
7. The method of claim 5 or 6, wherein the fusion protein has the formula: A-B-C or C- B-A, wherein B may be present or not, and wherein
(i) A comprises a Ds-tag;
(ii) B is a polypeptide linker comprising or constituting with A or C a chemical or enzymatic cleavage site; and
(iii) C is target protein.
8. The method of claim 7, wherein said cleavage site comprises a protease recognition site; preferably wherein said protease is a nuclear inclusion protein a (NIa) protease, preferably wherein said NIa protease is derived from tobacco etch virus (TEV), amd most preferably wherein the polypeptide linker comprises the amino acid sequence SGGSGGENLYFQGSGGSGG (SEQ ID NO: 24).
9. The method of any one of claims 4 to 8, wherein said polypeptide is released from said affinity matrix by chemical or enzymatic cleavage at the clevage, preferably by protease cleavage at the protease recognition site.
10. The method of any of claims 1 to 9, wherein said affinity matrix is formed by irreversibly linking the cognate ligand of the Ds-tag to a substrate via reactive amino groups of said ligand, preferably wherein the affinity matrix comprises a substrate selected from the group consisting of cross-linked polysaccharide, agarose, ceramic, metal, glass, plastic, and cellulose, preferably wherein the affinity matrix comprises sepharose.
11. A molecule or molecule complex as defined in or purified according to the method of any of claims 1 to 10, preferably wherein the molecule or molecule complex comprises a Ds-tagged molecule.
12. An affinity matrix as defined in any one of claims 1 to 10, or a chip, for example biochip comprising said affinity matrix, which is capable of specifically binding a Ds- tagged molecule, preferably further comprising a bound a Ds-tagged molecule or molecule complex, preferably wherein said molecule or molecule complex is a protein or protein complex, preferably wherein said molecule or molecule complex is an enzyme or enzyme complex, most preferably wherein the molecule or molecule complex is a sensing element.
13. The affinity matrix or the chip of claim 12 for the use under low conditions or preferably wherein the affinity matrix or the chip is subjected to a fluid such as an aqueous solution or a body fluid, or hair over days or preferably over a couple of weeks or months.
14. A method for detecting a Ds-tagged molecule of claim 11, comprising contacting said Ds-tagged molecule with a cognate ligand of the Ds-tag as defined in any one of the preceding claims, preferably wherein said ligand is detectably labeled, preferably wherein said label is an enzyme; a heavy metal, preferably gold; a dye, preferably a fluorecent or luminescent dye or protein; or a radioactive label and/or said method is performed on a western or dot blot; or on a cell sample or tissue section.
15. A kit comprising
(i) the affinity matrix or chip of claim 12, and optionally instructions for use in a method of purifying a Ds-tagged molecule, preferably further comprising components for producing a Ds-tagged molecule; and/or
(ii) a ligand as defined in claim 14, and optionally instructions for use in a method of detecting a Ds-tagged molecule, preferably further comprising components for producing a Ds-tagged molecule.
16. A system based on donor strand complementation comprising a Ds-tag and a cognate ligand of the Ds-tag as defined in any one of the preceding claims for use in an application selected from the group consisting of high throughput screening, study of receptor-ligand interaction, identification of binding partners such as in pull-down experiments, and study of binding kinetics.
17. A method for the recombinant production of FimGt or an equivalent ligand of Ds substantially as described in the Examples and in the description.
PCT/EP2011/065148 2010-09-01 2011-09-01 Affinity purification system based on donor strand complementation WO2012028697A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP10009077.8 2010-09-01
EP10009077 2010-09-01

Publications (1)

Publication Number Publication Date
WO2012028697A1 true WO2012028697A1 (en) 2012-03-08

Family

ID=43501712

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/065148 WO2012028697A1 (en) 2010-09-01 2011-09-01 Affinity purification system based on donor strand complementation

Country Status (1)

Country Link
WO (1) WO2012028697A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017050889A1 (en) 2015-09-25 2017-03-30 F. Hoffmann-La Roche Ag Recombinant immunoglobulin heavy chains comprising a sortase conjugation loop and conjugates thereof
WO2017153336A1 (en) 2016-03-07 2017-09-14 F. Hoffmann-La Roche Ag Detection of anti-p53 antibodies
WO2018041740A1 (en) * 2016-09-01 2018-03-08 Bayer Pharma Aktiengesellschaft Non-covalent display system using fimgt/dsf
WO2018141768A1 (en) 2017-02-02 2018-08-09 Roche Diagnostics Gmbh Immunoassay using at least two pegylated analyte-specific binding agents
WO2018189214A1 (en) 2017-04-12 2018-10-18 F. Hoffmann-La Roche Ag A method for labeling of aldehyde containing target molecules
WO2019077113A1 (en) 2017-10-20 2019-04-25 F. Hoffmann-La Roche Ag Copy protection for antibodies

Citations (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US637684A (en) 1898-05-10 1899-11-21 Bronistaw Turowski Car-wheel.
US3802842A (en) 1971-04-16 1974-04-09 Boehringer Mannheim Gmbh Test strips
US4061468A (en) 1974-07-30 1977-12-06 Boehringer Mannheim Gmbh Stable test strips having a water-soluble paper layer and methods for making same
US4419453A (en) 1981-09-28 1983-12-06 The Dow Chemical Company Immunological agglutination assays with dyed or colored latex and kits
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4490465A (en) 1982-03-26 1984-12-25 Merck Patent Gesellschaft Mit Beschrankter Haftung Coupled enzyme systems for determination of dissolved substances
US4554088A (en) 1983-05-12 1985-11-19 Advanced Magnetics Inc. Magnetic particles for use in separations
US4628037A (en) 1983-05-12 1986-12-09 Advanced Magnetics, Inc. Binding assays employing magnetic particles
US4695393A (en) 1983-05-12 1987-09-22 Advanced Magnetics Inc. Magnetic particles for use in separations
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US4698302A (en) 1983-05-12 1987-10-06 Advanced Magnetics, Inc. Enzymatic reactions using magnetic particles
US4780422A (en) 1986-06-27 1988-10-25 Tokuyama Soda Kabushiki Kaisha Dyed inorganic composite particles and process for production thereof
WO1988009344A1 (en) 1987-05-21 1988-12-01 Creative Biomolecules, Inc. Targeted multifunctional proteins
US4837168A (en) 1985-12-23 1989-06-06 Janssen Pharmaceutica N.V. Immunoassay using colorable latex particles
WO1989009622A1 (en) 1988-04-15 1989-10-19 Protein Design Labs, Inc. Il-2 receptor-specific chimeric antibodies
WO1990007861A1 (en) 1988-12-28 1990-07-26 Protein Design Labs, Inc. CHIMERIC IMMUNOGLOBULINS SPECIFIC FOR p55 TAC PROTEIN OF THE IL-2 RECEPTOR
US4965392A (en) 1987-03-26 1990-10-23 Neorx Corporation Chelating compounds for metal-radionuclide labeled proteins
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
WO1991010741A1 (en) 1990-01-12 1991-07-25 Cell Genesys, Inc. Generation of xenogeneic antibodies
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
WO1994002602A1 (en) 1992-07-24 1994-02-03 Cell Genesys, Inc. Generation of xenogeneic antibodies
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5543112A (en) 1993-05-14 1996-08-06 Igen, Inc. Apparatus and methods for carrying out electrochemiluminescence test measurements
WO1996034096A1 (en) 1995-04-28 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO1996033735A1 (en) 1995-04-27 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5644048A (en) 1992-01-10 1997-07-01 Isis Pharmaceuticals, Inc. Process for preparing phosphorothioate oligonucleotides
WO1997049989A2 (en) 1996-06-25 1997-12-31 Interactiva Biotechnologie Gmbh Broad specificity affinity arrays: a qualitative approach to complex sample discrimination
US5776719A (en) 1996-04-05 1998-07-07 Mercury Diagnostics, Inc. Diagnostic compositions and devices utilizing same
US5824491A (en) 1996-05-17 1998-10-20 Mercury Diagnostics, Inc. Dry reagent test strip comprising benzidine dye precursor and antipyrine compound
US5935779A (en) 1988-11-03 1999-08-10 Igen International Inc. Methods for improved particle electrochemiluminescence assay
US5962215A (en) 1996-04-05 1999-10-05 Mercury Diagnostics, Inc. Methods for testing the concentration of an analyte in a body fluid
WO2001004148A2 (en) 1999-07-13 2001-01-18 Medimmune, Inc. Donor strand complemented pilin and adhesin broad-based vaccines
WO2001040796A2 (en) 1999-11-29 2001-06-07 Thermo Hybaid Gmbh Glycoarrays on the surface of biochips
US6316607B1 (en) 1986-04-30 2001-11-13 Igen International, Inc. Electrochemiluminescent assays
WO2002059156A2 (en) 2000-12-22 2002-08-01 Medimmune, Inc. Therapeutic compounds structurally-linked to bacterial polypeptides
WO2004092214A2 (en) 2003-04-10 2004-10-28 Aristex Affinity purification system using troponin molecules as affinity ligands
EP1536232A2 (en) 2003-11-28 2005-06-01 F.Hoffmann-La Roche Ag Analytical sandwich assay for the determination of NT-proBNP
EP1642125A1 (en) 2003-06-20 2006-04-05 Roche Diagnostics GmbH Biosensor with multiple electrical functionalities
EP1642117A1 (en) 2003-06-20 2006-04-05 Roche Diagnostics GmbH Reagent stripe for test strip
EP2194381A1 (en) 2008-12-03 2010-06-09 Boehringer Mannheim Gmbh Testing element with combined control and calibration zone

Patent Citations (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US637684A (en) 1898-05-10 1899-11-21 Bronistaw Turowski Car-wheel.
US3802842A (en) 1971-04-16 1974-04-09 Boehringer Mannheim Gmbh Test strips
US4061468A (en) 1974-07-30 1977-12-06 Boehringer Mannheim Gmbh Stable test strips having a water-soluble paper layer and methods for making same
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4419453A (en) 1981-09-28 1983-12-06 The Dow Chemical Company Immunological agglutination assays with dyed or colored latex and kits
US4490465A (en) 1982-03-26 1984-12-25 Merck Patent Gesellschaft Mit Beschrankter Haftung Coupled enzyme systems for determination of dissolved substances
US4554088A (en) 1983-05-12 1985-11-19 Advanced Magnetics Inc. Magnetic particles for use in separations
US4628037A (en) 1983-05-12 1986-12-09 Advanced Magnetics, Inc. Binding assays employing magnetic particles
US4695393A (en) 1983-05-12 1987-09-22 Advanced Magnetics Inc. Magnetic particles for use in separations
US4698302A (en) 1983-05-12 1987-10-06 Advanced Magnetics, Inc. Enzymatic reactions using magnetic particles
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US4837168A (en) 1985-12-23 1989-06-06 Janssen Pharmaceutica N.V. Immunoassay using colorable latex particles
EP0239400A2 (en) 1986-03-27 1987-09-30 Medical Research Council Recombinant antibodies and methods for their production
US6316607B1 (en) 1986-04-30 2001-11-13 Igen International, Inc. Electrochemiluminescent assays
US4780422A (en) 1986-06-27 1988-10-25 Tokuyama Soda Kabushiki Kaisha Dyed inorganic composite particles and process for production thereof
US4965392A (en) 1987-03-26 1990-10-23 Neorx Corporation Chelating compounds for metal-radionuclide labeled proteins
WO1988009344A1 (en) 1987-05-21 1988-12-01 Creative Biomolecules, Inc. Targeted multifunctional proteins
WO1989009622A1 (en) 1988-04-15 1989-10-19 Protein Design Labs, Inc. Il-2 receptor-specific chimeric antibodies
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5935779A (en) 1988-11-03 1999-08-10 Igen International Inc. Methods for improved particle electrochemiluminescence assay
WO1990007861A1 (en) 1988-12-28 1990-07-26 Protein Design Labs, Inc. CHIMERIC IMMUNOGLOBULINS SPECIFIC FOR p55 TAC PROTEIN OF THE IL-2 RECEPTOR
WO1991010741A1 (en) 1990-01-12 1991-07-25 Cell Genesys, Inc. Generation of xenogeneic antibodies
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5644048A (en) 1992-01-10 1997-07-01 Isis Pharmaceuticals, Inc. Process for preparing phosphorothioate oligonucleotides
WO1994002602A1 (en) 1992-07-24 1994-02-03 Cell Genesys, Inc. Generation of xenogeneic antibodies
US5543112A (en) 1993-05-14 1996-08-06 Igen, Inc. Apparatus and methods for carrying out electrochemiluminescence test measurements
WO1996033735A1 (en) 1995-04-27 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO1996034096A1 (en) 1995-04-28 1996-10-31 Abgenix, Inc. Human antibodies derived from immunized xenomice
US5776719A (en) 1996-04-05 1998-07-07 Mercury Diagnostics, Inc. Diagnostic compositions and devices utilizing same
US5962215A (en) 1996-04-05 1999-10-05 Mercury Diagnostics, Inc. Methods for testing the concentration of an analyte in a body fluid
US5824491A (en) 1996-05-17 1998-10-20 Mercury Diagnostics, Inc. Dry reagent test strip comprising benzidine dye precursor and antipyrine compound
WO1997049989A2 (en) 1996-06-25 1997-12-31 Interactiva Biotechnologie Gmbh Broad specificity affinity arrays: a qualitative approach to complex sample discrimination
WO2001004148A2 (en) 1999-07-13 2001-01-18 Medimmune, Inc. Donor strand complemented pilin and adhesin broad-based vaccines
WO2001040796A2 (en) 1999-11-29 2001-06-07 Thermo Hybaid Gmbh Glycoarrays on the surface of biochips
WO2002059156A2 (en) 2000-12-22 2002-08-01 Medimmune, Inc. Therapeutic compounds structurally-linked to bacterial polypeptides
WO2004092214A2 (en) 2003-04-10 2004-10-28 Aristex Affinity purification system using troponin molecules as affinity ligands
EP1642125A1 (en) 2003-06-20 2006-04-05 Roche Diagnostics GmbH Biosensor with multiple electrical functionalities
EP1642117A1 (en) 2003-06-20 2006-04-05 Roche Diagnostics GmbH Reagent stripe for test strip
EP1536232A2 (en) 2003-11-28 2005-06-01 F.Hoffmann-La Roche Ag Analytical sandwich assay for the determination of NT-proBNP
EP2194381A1 (en) 2008-12-03 2010-06-09 Boehringer Mannheim Gmbh Testing element with combined control and calibration zone

Non-Patent Citations (109)

* Cited by examiner, † Cited by third party
Title
"Carbohydrate Modifications in Antisense Research", ASC SYMPOSIUM SERIES 580
"Culture Of Animal Cells", 1987, FRESHNEY AND ALAN, LISS, INC.
"Current Protocols in Molecular Biology and Short Protocols in Molecular Biology"
"DNA Cloning", vol. I, II, 1985
"Gene Transfer Vectors for Mammalian Cells"
"Gene Transfer Vectors For Mammalian Cells", 1987, COLD SPRING HARBOR LABORATORY
"Handbook Of Experimental Immunology", vol. I-IV, 1986
"Immobilized Cells And Enzymes", 1986, IRL PRESS
"Immunochemical Methods In Cell And Molecular Biology", 1987, ACADEMIC PRESS
"Large Scale Mammalian Cell Culture", CURR. OPIN. BIOTECHNOL., vol. 2, 1991, pages 375
"Methods In Enzymology", vol. 154, 155
"Nucleic Acid Hybridization", 1984
"Oligonucleotide Synthesis", 1984
"Oxford Dictionary of Biochemistry and Molecular Biology", 1997, OXFORD UNIVERSITY PRESS
"Recombinant DNA Methodology", ACADEMIC PRESS
"Short Protocols in Molecular Biology", 1999, JOHN WILEY & SONS
"The Atlas of Protein Sequence and Structure", vol. 5, 1978, NATIONAL BIOMEDICAL RESEARCH FOUNDATION
"The Merck Manual of Diagnosis and Therapy", 2003, MERCK & CO., INC.
"Transcription And Translation", 1984
AMANN ET AL., GENE, vol. 69, no. 301, 1988, pages 315
ANGEW., CHERS. INTL. ED. ENGLISH, vol. 30, 1991, pages 423
ARGOS, EMBO J., vol. 8, 1989, pages 779 - 785
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989
BACHMANN BJ.: "Pedigrees of some mutant strains of Escherichia coli K-12", BACTERIOL REV, vol. 36, 1972, pages 525 - 557
BAKER ET AL., BIOANALYSIS, vol. 1, 2009, pages 967 - 975
BARRETT ET AL.: "Handbook of proteolytic enzymes", 1998, ACADEMIC PRESS
BEAUCAGE ET AL., TETRAHEDRON, vol. 49, no. 10, 1993, pages 1925
BEDOUELLE, DUPLAY, EUR. J. BIOCHEM., vol. 171, 1988, pages 541 - 549
BENNETT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 3127 - 3131
BERKS, TIBTECH, vol. 12, 1994, pages 352 - 364
BINGEL-ERLENMEYER R. ET AL.: "A peptide deformylase-ribosome complex reveals mechanism of nascent chain processing", NATURE, vol. 452, 2008, pages 108 - 11
BIRCH ET AL., BIOPROCESS TECHNOL., vol. 19, 1990, pages 251
BOLLAG ET AL.: "Protein Methods", 1996, JOHN WILEY & SONS
BORIJIN, NATHANS, PROC. NATL. ACAD. SCI., USA, vol. 90, 1993, pages 337 - 341
BRIU ET AL., J. AM. CHEM. SOC., vol. 111, 1989, pages 2321
CARLSSON ET AL., NATURE, vol. 380, 1996, pages 207
CHOUDHURY ET AL., SCIENCE, vol. 285, 1999, pages 1061
CHUNG CT, NIEMELA SL, MILLER RH.: "One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution", PROC NATL ACAD SCI USA, vol. 86, 1989, pages 2172 - 2175, XP002355090, DOI: doi:10.1073/pnas.86.7.2172
DENPCY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 6097
DEUTSCHER: "Methods in Enzymology Vol. 182 : Guide to Protein Purification.", 1990, ACADEMIC PRESS, INC.
DWORKOWSKI F, PHD THESIS, PHD THESIS, 2010
ECKSTEIN: "Oligonucleotides and Analogues A Practical Approach", OXFORD UNIVERSITY PRESS
EGHOLM, J. AM. CHEM. SOC., vol. 114, 1992, pages 1895
FERRARI ENRICO ET AL: "Binary polypeptide system for permanent and oriented protein immobilization", JOURNAL OF NANOBIOTECHNOLOGY, vol. 8, May 2010 (2010-05-01), XP002620397, ISSN: 1477-3155 *
FINDER VH, VODOPIVEC I, NITSCH RM, GLOCKSHUBER R: "The recombinant amyloid-beta peptide Abetal-42 aggregates faster and is more neurotoxic than synthetic Abetal-42", J MOL BIOL, vol. 396, 2010, pages 9 - 18
GASTEIGER ET AL.: "The Proteomics Protocols Handbook", 2005, HUMANA PRESS, article "Protein Identification and Analysis Tools on the ExPASy Server", XP009163232, DOI: doi:10.1385/1-59259-890-0:571
GODING: "Monoclonal Antibodies: Principles and Practice", 1986, ACADEMIC PRESS, pages: 59 - 103
HAHN ET AL., J. MOL. BIOL., vol. 323, 2002, pages 845 - 857
HARLOW, LANE: "Antibodies, A Laboratory Manual", 1988, CSH PRESS
HEY, T. ET AL., TRENDS BIOTECHNOL, vol. 23, 2005, pages 514 - 522
HILL WE, ROSSETTI GP, VAN HOLDE KE: "Physical studies of ribosomes from Escherichia coli", J MOL BIOL, vol. 44, 1969, pages 263 - 277, XP024012349, DOI: doi:10.1016/0022-2836(69)90174-0
HOPP ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1204 - 1210
HU ET AL., CURR. OPIN. BIOTECHNOL., vol. 8, 1997, pages 148
JEFFS ET AL., J. BIOMOLECULAR NMR, vol. 34, 1994, pages 17
JENKINS ET AL., CHEM. SOC. REV., 1995, pages 169 - 176
KITANO, BIOTECHNOLOGY, vol. 17, 1991, pages 73
KRAMER G, ET AL.: "L23 protein functions as a chaperone docking site on the ribosome", NATURE, vol. 419, 2002, pages 171 - 174
KRASAN ET AL., MOL. MICROBIOL., vol. 35, 2000, pages 1335 - 1347
KRASAN GRAHAM P ET AL: "Evidence for donor strand complementation in the biogenesis of Haemophilus influenzae haemagglutinating pili", MOLECULAR MICROBIOLOGY, vol. 35, no. 6, March 2000 (2000-03-01), pages 1335 - 1347, XP002620399, ISSN: 0950-382X *
KRZYSZTOF GRZYMAJO ET AL: "The high-adhesive properties of the FimH adhesin of Salmonella enterica serovar Enteritidis are determined by a single F118S substitution", MICROBIOLOGY, SOCIETY FOR GENERAL MICROBIOLOGY, READING, GB, vol. 156, no. Part 6, 1 June 2010 (2010-06-01), pages 1738 - 1748, XP002620396, ISSN: 1350-0872, DOI: 10.1099/MIC.0.039206-0 *
LETSINGER ET AL., J. AM. CHEM. SOC., vol. 110, 1988, pages 4470
LETSINGER ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 3487
LETSINGER ET AL., NUCLEOSIDE & NUCLEOTIDE, vol. 13, 1994, pages 1597
LETSINGER, J. ORG CHEM., vol. 35, 1970, pages 3800
LILIUS ET AL., EUR. J. BIOCHEM., vol. 198, 1991, pages 499 - 504
LUTZ-FREYERMUTH ET AL., PROC. NATL. ACAD. SCI., USA, vol. 87, 1990, pages 6393 - 6397
MAG ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 1437
MAINA ET AL., GENE, vol. 74, 1988, pages 365 - 373
MARTIN ET AL., CELL, vol. 63, 1990, pages 843 - 849
MARTIN ET AL., SCIENCE, vol. 255, 1992, pages 192 - 194
MEIER ET AL., CHEM. INT. ED. ENGL., vol. 31, 1992, pages 1008
MESMAEKER ET AL., BIOORGANIC & MEDICINAL CHEM. LETT., vol. 4, 1994, pages 395
MILES EW, BAUERLE R, AHMED SA: "Tryptophan synthase from Escherichia coli and Salmonella typhimurium", METHODS ENZYMOL, vol. 142, 1987, pages 398 - 414, XP002143840
MUNRO, PELHAM, CELL, vol. 46, 1986, pages 291 - 300
NALLAMSETTYA ET AL., PROT. EXPR. PURI., vol. 38, 2004, pages 108 - 115
NEUENSCHWANDER M, BUTZ M, HEINTZ C, KAST P, HILVERT D.: "A simple selection strategy for evolving highly efficient enzymes", NAT BIOTECHNOL, vol. 25, 2007, pages 1145 - 1147, XP055052276, DOI: doi:10.1038/nbt1341
NIELSEN, NATURE, vol. 365, 1993, pages 566
NISHIYAMA ET AL., SCIENCE, vol. 320, 2008, pages 3762
PAUWELS ET AL., CHEMICA SCRIPTA, vol. 26, 1986, pages 1419
PERBAL: "the treatise, Methods In Enzymology", 1984, ACADEMIC PRESS, INC., article "A Practical Guide To Molecular Cloning"
PIERCE ET AL., J. BIOL. CHEM., vol. 273, 1998, pages 23448 - 23453
PUORGER C ET AL: "Infinite Kinetic Stability against Dissociation of Supramolecular Protein Complexes through Donor Strand Complementation", STRUCTURE, CURRENT BIOLOGY LTD., PHILADELPHIA, PA, US, vol. 16, no. 4, 8 April 2008 (2008-04-08), pages 631 - 642, XP022588342, ISSN: 0969-2126, [retrieved on 20080408], DOI: DOI:10.1016/J.STR.2008.01.013 *
PUORGER ET AL., STRUCTURE, vol. 16, 2008, pages 631 - 642
PUOROGER ET AL., STRUCTURE, vol. 16, 2008, pages 631 - 642
R. SCOPES: "Protein Purification", 1982, SPRINGER-VERLAG
RAWLS, C & E NEWS, 2 June 1997 (1997-06-02), pages 35
SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, HARBOR LABORATORY PRESS
SAMBROOK J, RUSSELL D: "Molecular cloning, a laboratory manual", 2001, SPRING HARBOR LABORATORY PRESS
SAUER ET AL., SCIENCE, vol. 285, 1999, pages 1058 - 1061
SAWAI ET AL., CHEM. LETT., 1984, pages 805
SCHATZ, P. J., BIO/TECHNOLOGY, vol. 11, 1993, pages 1138 - 1143
SCHMIDT, SKERRA, PROTEIN ENGINEERING, vol. 6, 1993, pages 109 - 122
SKERRA ET AL., BIOTECHNOLOGY, vol. 9, 1991, pages 273 - 278
SKINNER ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 14163 - 14166
SMITH, JOHNSON, GENE, vol. 67, 1988, pages 31 - 40
SPEDDING G: "Ribosomes & Protein Synthesis, a practical approach", 1990, OXFORD UNIVERSITY PRESS, pages: 175 - 176
SPRINZL ET AL., EUR. J BIOCHEM., vol. 81, 1977, pages 579
STUDIER ET AL.: "Gene Expression Technology: Methods in Enzymology", 1990, ACADEMIC PRESS, pages: 185
TETRAHEDRON LETT., vol. 37, 1996, pages 743
TIJSSEN, P.: "Practice and theory of enzyme immunoassays", vol. 11, ELSEVIER SCIENCE PUBLISHERS B.V., pages: 43 - 78
VETSCH ET AL., NATURE, vol. 431, 2004, pages 329
VETSCH ET AL., NATURE, vol. 431, 2004, pages 329 - 333
VETSCH M, ET AL.: "Pilus chaperones represent a new type of protein-folding catalyst", NATURE, vol. 431, 2004, pages 329 - 333, XP002620398, DOI: doi:10.1038/nature02891
VETSCH MICHAEL ET AL: "Pilus chaperones represent a new type of protein-folding catalyst", NATURE (LONDON), vol. 431, no. 7006, 16 September 2004 (2004-09-16), pages 329 - 332, XP002620398, ISSN: 0028-0836 *
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WOEHL EU, DUNN MF: "Monovalent metal ions play an essential role in catalysis and intersubunit communication in the tryptophan synthase bienzyme complex", BIOCHEMISTRY, vol. 34, 1995, pages 9466 - 9476
ZAVIALOV ET AL., MOL. MICROBIOL., vol. 45, 2002, pages 983 - 995

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017050889A1 (en) 2015-09-25 2017-03-30 F. Hoffmann-La Roche Ag Recombinant immunoglobulin heavy chains comprising a sortase conjugation loop and conjugates thereof
WO2017153336A1 (en) 2016-03-07 2017-09-14 F. Hoffmann-La Roche Ag Detection of anti-p53 antibodies
WO2018041740A1 (en) * 2016-09-01 2018-03-08 Bayer Pharma Aktiengesellschaft Non-covalent display system using fimgt/dsf
WO2018141768A1 (en) 2017-02-02 2018-08-09 Roche Diagnostics Gmbh Immunoassay using at least two pegylated analyte-specific binding agents
WO2018189214A1 (en) 2017-04-12 2018-10-18 F. Hoffmann-La Roche Ag A method for labeling of aldehyde containing target molecules
WO2018191389A1 (en) 2017-04-12 2018-10-18 Roche Sequencing Solutions, Inc. A method for sequencing reaction with tagged nucleoside obtained via pictet spengler reaction
WO2019077113A1 (en) 2017-10-20 2019-04-25 F. Hoffmann-La Roche Ag Copy protection for antibodies

Similar Documents

Publication Publication Date Title
Gautschi et al. The yeast Nα-acetyltransferase NatA is quantitatively anchored to the ribosome and interacts with nascent polypeptides
EP0711303B1 (en) Biotinylation of proteins
Tolbert et al. Intein-mediated synthesis of proteins containing carbohydrates and other molecular probes
Wang et al. Optimized orthogonal translation of unnatural amino acids enables spontaneous protein double-labelling and FRET
Keefe et al. One-step purification of recombinant proteins using a nanomolar-affinity streptavidin-binding peptide, the SBP-Tag
US5846722A (en) System to detect small molecule/peptide interaction
Berggård et al. Methods for the detection and analysis of protein–protein interactions
US5498530A (en) Peptide library and screening method
RU2233878C2 (en) Method for selection of desirable protein and nucleic acid, agents for its realization
US5585245A (en) Ubiquitin-based split protein sensor
EP1410023B1 (en) Methods using o6-alkylguanine-dna alkyltransferases
US6156511A (en) Peptide library and screening method
US6972198B2 (en) Methods and compositions using protein binding partners
Norman et al. Genetic selection of peptide inhibitors of biological pathways
Mohammadi et al. Identification of FtsW as a transporter of lipid‐linked cell wall precursors across the membrane
Ohana et al. HaloTag7: a genetically engineered tag that enhances bacterial expression of soluble proteins and improves protein purification
US20100173384A1 (en) Methods for protein labeling based on acyl carrier protein
EP1392717B1 (en) Rapidly cleavable sumo fusion protein expression system for difficult to express proteins
US7060506B2 (en) Compositions and methods for monitoring the modification of modification dependent binding partner polypeptides
Ali et al. Deletion of a conserved, central ribosomal intersubunit RNA bridge
Phizicky et al. Protein-protein interactions: methods for detection and analysis.
AU773236B2 (en) Selection of proteins using RNA-protein fusions
US20030199088A1 (en) Minicell-based gene therapy
Lamla et al. The Nano-tag, a streptavidin-binding peptide for the purification and detection of recombinant proteins
EP2109669B1 (en) Methods for reversibly binding a biotin compound to a support

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11749448

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11749448

Country of ref document: EP

Kind code of ref document: A1