WO2012018613A2 - Genetic make-up modifies cancer outcome - Google Patents

Genetic make-up modifies cancer outcome Download PDF

Info

Publication number
WO2012018613A2
WO2012018613A2 PCT/US2011/045340 US2011045340W WO2012018613A2 WO 2012018613 A2 WO2012018613 A2 WO 2012018613A2 US 2011045340 W US2011045340 W US 2011045340W WO 2012018613 A2 WO2012018613 A2 WO 2012018613A2
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
genotype
group
thyroid
tfe3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/045340
Other languages
French (fr)
Other versions
WO2012018613A3 (en
Inventor
Michael Mingzhao Xing
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Priority to US13/812,581 priority Critical patent/US8980554B2/en
Publication of WO2012018613A2 publication Critical patent/WO2012018613A2/en
Publication of WO2012018613A3 publication Critical patent/WO2012018613A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6489Metalloendopeptidases (3.4.24)
    • C12N9/6491Matrix metalloproteases [MMP's], e.g. interstitial collagenase (3.4.24.7); Stromelysins (3.4.24.17; 3.2.1.22); Matrilysin (3.4.24.23)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • Follicular epithelial cell-derived thyroid cancer is the most common endocrine malignancy with a high incidence worldwide (1, 2). This cancer is histologically classified into papillary thyroid cancer (PTC), follicular thyroid cancer (FTC), and anaplastic thyroid cancer (ATC) (3).
  • PTC papillary thyroid cancer
  • FTC follicular thyroid cancer
  • ATC anaplastic thyroid cancer
  • Thyroid cancers frequently harbor activating mutations in the MAP kinase (MAPK) and phosphatidylinositol 3-kinases (PI3K)/Akt signaling pathways (4), as represented by RAS, BRAF, and RET/PTC mutations in the former and PIK3CA and PTEN mutations in the latter.
  • MAPK MAP kinase
  • PI3K phosphatidylinositol 3-kinases
  • Akt phosphatidylinositol 3-kinases
  • MMPs matrix metalloproteinases
  • All the mutants detected in this exon were shown to be tumorigenic and the wild-type has been shown to inhibit cell growth on soft agar and tumor formation in vivo (6).
  • a point mutation in the pleckstrin homology domain (E17K) and a point mutation in the regulatory C-terminal domain (E438D) of AKT3 were recently found in melanomas (7, 8).
  • Expression of the AKT3 E17K in A375 cells has been demonstrated to increase AKT phosphorylation as compared with the wild-type AKT3 (7).
  • a recent study reported an AKT3 mutation in PTC, but FTC and ATC were not examined in this study (14).
  • PIK3R1 mutations in PIK3R1 are all shown to promote cell survival, anchorage-independent cell growth and tumorigenesis through AKT activation in a p110-dependent manner (10).
  • the mutation status in the GNAQ, MMP8, AKT3, EGFR and PIK3R1 genes had been incompletely examined or not examined in thyroid cancers.
  • SUMMARY OF THE INVENTION According to one aspect of the invention a method is provided to stratify a patient having a cancer based on a genotype affecting clinical outcome.
  • a test sample of the patient is tested and a biallelic, germline genotype of the patient for matrix metalloproteinase 8 (MMP8) gene at nucleotide position 259 of its transcribed sequence is determined.
  • An AA genotype is associated with a poor clinical outcome.
  • a GG genotype is associated with an intermediate clinical outcome.
  • An AG genotype is associated with a better clinical outcome.
  • a test sample of the patient is tested and a biallelic, germline genotype of the patient for matrix metalloproteinase 8 (MMP8) gene at nucleotide position 259 of its transcribed sequence is determined.
  • An AA genotype is associated with higher risk of becoming malignant.
  • a GG genotype is associated with an intermediate risk of becoming malignant.
  • An AG genotype is associated with a lower a higher risk of becoming malignant.
  • FIG. 1A-1D Detection of MMP8 and EGFR mutations.
  • FIG. 1A Schematic diagram of domains of MMP8 protein showing a single nucleotide polymorphism (K87E) identified in thyroid cancer. The MMP8 gene is located on chromosome 11q22.3 contains 10 exons and intervening sequences.
  • Fig. 1B The sequencing results were shown with a representative sense and antisense sequence profile of a single nucleotide polymorphisms (A259G) found in exon 2 of MMP8 gene.
  • FIG. 1C Schematic diagram of EGFR showing a mutation (G735S) and a single nucleotide polymorphism (K757K) identified in thyroid cancer.
  • the EGFR gene is located on chromosome 7p11.2 contains 28 exons and interveining sequences.
  • FIG. 1D The sequencing results were shown with sense and antisense sequence profiles of a mutation (G2203A) and a single nucleotide polymorphism (G2271A) found in exon 19 of EGFR gene. Arrow indicates mutated nucleotide. The nucleotide and amino acid alterations are indicated above the arrow.
  • Nucleotide numbers refers to the position within coding sequence, where position 1 corresponds to the first position of the initiation codon. All the samples were sequenced in two repeated examinations with independent PCR by forward and reverse primers. DETAILED DESCRIPTION OF THE INVENTION [10] Although we found no mutation in the MMP8 gene, we found a common A259G SNP (rs1940475), resulting in a K87E amino acid switch in the proteoglycan binding domain of MMP8. The more common nucleotide pattern is G259, resulting in amino acid glutamic acid at position 87 of MMP8 and seen in about 70-90% of thyroid cancer cases.
  • the less common nucleotide pattern is A259, resulting in amino acid lysine at position 87 and conversely seen in about 10-30% of the cases of thyroid cancer.
  • the type of amino acid at position 87 i.e., lysine or glutamic acid, significantly affects the function of MMP8 and its role in the invasion, metastasis, and ultimately clinicopathological outcomes of human cancers.
  • the genetic patterns were studied here and shown to be associated with specific clinicopathological outcomes of papillary thyroid cancer, they are expected to also apply to other types of thyroid tumors and can therefore be diagnostically and prognostically used in these tumors, such as follicular thyroid cancer, Hurthle cell thyroid cancer, poorly differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, and benign thyroid tumors and thyroid nodules.
  • these MMP8 markers commonly exist in the general human population. Thus these markers also predict certain clinicopatholgoical outcomes of other human cancers and can therefore be similarly used to guide their diagnosis, prognostication and appropriate management.
  • cancers which can be subjected to similar analyses and predictions based on these same markers include without limitation lung cancer, breast cancer, stomach cancer, pancreatic cancer, liver cancer, colon cancer, ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, kidney cancer, bladder cancer, testicular cancer, bone cancer, brain cancer, head and neck cancer, leukemia, lymphoma, and melanoma.
  • Other skin cancers such as squamous cell carcinoma and basal cell carcinoma, may also be used.
  • Other blood cancers including lymphomas may also be used.
  • patients who have benign tumors or precancerous lesions, such as thyroid nodules can also be the subject of the genotype determination.
  • results of the genotype may be used to indicate which tumors or lesions are most likely to progress and which are least likely to progress, for example.
  • the genotype of a patient’s germline interacts with a patient’s tumor to modify its natural history.
  • a prognosis for such patients can be similarly assigned as with cancerous tumors.
  • precancerous lesions are thyroid nodules which may develop into thyroid cancer, nevi which may develop into melanomas, breast adenoma which may develop into breast cancer, and colon polyps which may develop into colon cancer.
  • Assigning a prognosis is a positive act of sorting a patient into a group to which a particular prognosis has been associated.
  • the assignment requires recording a result, such as in a communiqué or medical record, communicating the result, e.g., to the patient or to a medical professional or family member, or acting on the prognosis., e.g., making a treatment or management decision or performing a treatment or management act based on the prognosis. Other means may be used.
  • Patients may be assigned to a group of similar patients based on the genotype determined.
  • the group may be involved in a clinical study.
  • the group may be used analytically to process the results of patients receiving similar treatments.
  • the group may be assigned different treatments based on the genotype.
  • the MMP8 genetic variant markers can be used in combination with other molecular markers to synergistically enhance the diagnostic, prognostic, and therapeutic value in the management of thyroid cancers and other human cancers.
  • molecular markers can be mutations, genetic amplifications, genetic copy gain or loss/deletion, genetic rearrangements, epigenetic alterations (e.g., hypermethylation, hypomethylation, histone acetylation, histone methylation, and other types of histone modifications, and expression changes in various microRNA markers), microsatellite instability, loss of heterozygosity, abnormal protein expression patterns, and other molecular changes.
  • genes, transcripts, and proteins which may be effected include without limitation RET-PTC (e.g., isoforms 1, 2, 3 and other forms), PPAR ⁇ /Pax8, RET, H-Ras, K-Ras, N-Ras, A-Raf, B-Raf (BRAF), C-Raf, MEK1/2, ERK1/2, PIK3CA, PIK3CB, PIK3CD, other types of PI3K, PDK, PTEN, Akt-1, Akt-2, Akt-3, mTOR, RASSF1A, RASAL1, ALK, EML4-ALK, other ALK-involving rearrangements, telomerase (and telomeres), beta-catenin, galectin 1 and 3, EGFR, PDGFR alpha and beta, VEGFR-1 and 2, c-MET, KIT, thyroxine receptor beta and alpha, TSHR, TPO, NIS, TTF-1, TTF
  • Markers known to be particularly important in thyroid cancers include miRNA markers, such as upregulation of miR-146b, miR-221, miR-222, miR-155, miR-31 and downregulation of miR-1, miR-34b, miR-130b, and miR-138 in aggressive compared with nonaggressive PTC.
  • miRNA markers such as upregulation of miR-146b, miR-221, miR-222, miR-155, miR-31 and downregulation of miR-1, miR-34b, miR-130b, and miR-138 in aggressive compared with nonaggressive PTC.
  • Another marker associated with aggressive behavior is mutated BRAF(V600E).
  • Another marker associated with aggressive behavior is IQGAP1 copy number (CN) gain 3. Combinations of any such markers may be used.
  • a genotype can be determined using any techniques known in the art. Genomic DNA, cDNA, mRNA, or protein can be analyzed to determine the genotype.
  • Any technique which provides information on the identity of the nucleotide at position 259 of the mRNA or position 87 of the protein can be used. In order to determine the biallelic genotype, one must be able to detect both versions of the SNP, if present. Techniques which may be used include without limitation, RT-PCR, PCR, nucleotide sequencing, ELISA, immunohistochemistry, immunoprecipitation, allele specific amplification, allele specific ligation, hybridization to allele specific probes, immunoelectrophoresis, etc. [18] A test sample from the patient need not be from a tumor. The SNP occurs in all cells of the body, so any sample that is convenient may be used. Blood is an obvious choice because of ease of harvesting.
  • G735S EGFR mutant was a gain-of-function mutation with increased tyrosine kinase activity associated with increased signaling activities of the STAT, MAPK and PI3K/AKT pathways, as reflected by the phosphorylation of STAT, AKT and ERK as well as increased cell proliferation, anchorage-independent colony formation and invasion (20).
  • EGFR mutations of other types have been also reported in PTC of Greek (15) and Japanese patients (9) and no mutation of this gene was found in FTC and ATC of American patients (4).
  • Akt3 may not play a significant role in the tumorigenesis of thyroid cancer (21, 22). Therefore, genetic alterations in the Akt3 gene might predictably unnecessary for thyroid cancer tumorigenesis.
  • EXAMPLE 1 Materials and Methods Cell lines, tumor samples, and DNA extraction [22]
  • the thyroid cancer cell lines K1, K5, OCUT-1, OCUT-2, FB-1, SW1736, BCPAP, HTh7, HTh74, KAT 18, FTC133 and C643
  • TRB Institutional Review Board
  • Cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), streptomycin (100 ⁇ g/mL), penicillin (100units/mL) and 2mM glutamine.
  • Genomic DNA from cell lines and tumors was isolated by standard phenol-chloroform extraction and ethanol precipitation procedures (16).
  • PCR amplification and sequencing of GNAQ, MMP8, AKT3, EGFR and PIK3R1 genes [23] The primer sequences and PCR conditions for the amplification of exon 5 of the GNAQ gene, exon 2 of the MMP8 gene, and exons 18, 19 and 21 of the EGFR gene are as described previously (5, 6, 17).
  • the primer sequences for the amplification of exon 2 and exon 12 of the AKT3 gene are as follows: (exon 2) AKT3-2F 5’- TGGAGGCCAGTGTTGTAGGAC-3’(SEQ ID NO: 1); AKT3-2R 5’- ATAGCCTAAGATATCTGACAC -3’ (SEQ ID NO: 2), (exon 12) AKT3-12F 5’- AGCGACTCAGCATTGTAGACT -3’(SEQ ID NO: 3); AKT3-12R 5’- TCACTGTGGAATTTGATCTTG -3’(SEQ ID NO: 4).
  • PCR reaction conditions were as follows, after initial denaturation, at 94oC for 2 min, amplification was performed at 94oC for 1 min, 60oC for 1 min for 35 cycles with final extension at 72oC for 7 min and the same PCR conditions were followed for the amplification of exon 12 of AKT3 except for the annealing temperature at 58oC.
  • Annealing temperature was 57oC for exon 14 and 17 and 60oC for exon 16.
  • the PCR products were directly sequenced using a Big Dye terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems). These exons were examined because they harbored most of the reported mutations in these genes.
  • Gene Bank accession numbers are NM_002072.2 (GNAQ), NM_002424.2 (MMP8), NM_ NM_005465.3 (AKT3), NM_005228.3 (EGFR) and NM_181523.1 (PIK3R1).
  • EXAMPLE 2 [24] We examined exon 5 of the GNAQ gene for mutations in the present study since all of the known GNAQ mutations have been reported in codon 209 in this exon. Exon 2 of the MMP8 gene and exons 18, 19 and 21 of the EGFR gene were selected for sequencing as they have recently been shown to carry somatic mutations in other human cancers. Exons 2 and 12 of AKT3 were similarly chosen for analysis for their carrying mutations in other cancers. Exons 14, 16 and 17 of the PIK3R1gene were selected for analysis also because they were the most mutated exons in PIK3R1.
  • the A259 pattern was found in 19.4%, 26.4%, and 11.2% of these tumors, respectively.
  • results in tables 1-3 show that the genotype AA at nucleotide position 259 in codon 87 of the MMP8 gene is most significantly associated with several poor clinicopathlogical outcomes of papillary thyroid cancer, including extrathyroidal invasion, vascular invasion, cancer recurrence/persistence, distant metastasis, advanced tumor stages. Most importantly, AA is strongly associated with disease recurrence of thyroid cancer.
  • the genotype GG is to some extent associated with some of these clinicopathological characteristics.
  • the genotype AG is least associated with these tumor characteristics. Therefore, genotype AA is associated with a poorer prognosis of thyroid cancer, genotype AG is associated with a better prognosis, and genotype GG is associated with an intermediate prognosis of thyroid cancer.
  • genotypes AA, GG, and AG termed here would be TT, CC, and TC if the complementary (non-coding) DNA strand is used for orientation.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A frequent SNP A259G (K87E) genotype switch in the MMP8 gene in has been found to modify the clinical behavior of cancers. The modification varies based on the patient's genotype for the SNP, and whether homozygous or heterozygous. One particular genotype for this SNP leads to more aggressive tumor behavior and worst clinical outcome than the others.

Description

GENETIC MAKE-UP MODIFIES CANCER OUTCOME
[01] This invention was made using funds from the U.S. government. The U.S. retains certain rights in the invention under the terms of National Institutes of Health grant CA134225. TECHNICAL FIELD OF THE INVENTION [02] This invention is related to the area of cancer. In particular, it relates to genetic factors that modify outcome. BACKGROUND OF THE INVENTION [03] Follicular epithelial cell-derived thyroid cancer is the most common endocrine malignancy with a high incidence worldwide (1, 2). This cancer is histologically classified into papillary thyroid cancer (PTC), follicular thyroid cancer (FTC), and anaplastic thyroid cancer (ATC) (3). Thyroid cancers frequently harbor activating mutations in the MAP kinase (MAPK) and phosphatidylinositol 3-kinases (PI3K)/Akt signaling pathways (4), as represented by RAS, BRAF, and RET/PTC mutations in the former and PIK3CA and PTEN mutations in the latter. As an important mechanism for the tumorigenesis of thyroid cancer and many other human cancers, aberrant activation of the two signaling pathways by such mutations can cause uncontrolled cell division, proliferation and survival. [04] Somatic mutations of GNAQ, MMP8, Akt3, EGFR and PIK3R1 genes have been recently reported in some human cancers with various prevalences and they can activate the MAPK and PI3K/Akt signaling pathways (5-10). A particularly frequent somatic mutation of the GNAQ gene at codon 209, resulting in mutant GNAQQ209L, has been reported in uveal melanoma and blue nevi (5). The GNAQ gene encodes a G-protein Dsubunit that mediates signals from G-protein-coupled receptors (GPCRs) to the MAPK pathway. The normal amino acid, glutamine, encoded by codon 209 of the GNAQ gene lies within the RAS-like domain of GNAQ (corresponding to residue 61 of Ras) and is essential for GTP hydrolysis. Recent studies found no mutation in GNAQ in PTC, MTC and FTC, but it has not been analyzed in the more aggressive type of thyroid cancer, ATC (11-13). Matrix metalloproteinases (MMPs) are proteolytic enzymes that degrade components of extra cellular matrix and basement membranes. Abnormalities of MMPs have been associated with cancer metastasis. Frequent mutations of the MMP8 gene have been observed in melanoma (6). Most of the mutations in this gene have been observed in exon 2. All the mutants detected in this exon, including S50F, P78S, K87N and G104R, were shown to be tumorigenic and the wild-type has been shown to inhibit cell growth on soft agar and tumor formation in vivo (6). A point mutation in the pleckstrin homology domain (E17K) and a point mutation in the regulatory C-terminal domain (E438D) of AKT3 were recently found in melanomas (7, 8). Expression of the AKT3 E17K in A375 cells has been demonstrated to increase AKT phosphorylation as compared with the wild-type AKT3 (7). A recent study reported an AKT3 mutation in PTC, but FTC and ATC were not examined in this study (14). Varying frequencies of EGFR mutation in PTC had been reported in two studies (9, 15). The status of somatic EGFR mutation is not known in this cancer in the American patients, while other types of cancers such as FTC and ATC have been reported (4). The class IA PI3K lipid kinase has a catalytic subunit (p110Į) and a regulatory subunit (p85Į), which is encoded by PIK3CA and PIK3R1 genes, respectively. Somatic mutations of PIK3CA gene are common in human cancers. Recently, mutations have also been found in the PIK3R1 gene in human cancers (10). These mutations in PIK3R1 are all shown to promote cell survival, anchorage-independent cell growth and tumorigenesis through AKT activation in a p110-dependent manner (10). The mutation status in the GNAQ, MMP8, AKT3, EGFR and PIK3R1 genes had been incompletely examined or not examined in thyroid cancers. [05] There is a continuing need in the art to develop a fuller understanding of the genetic factors that affect human cancers so that they can be better identified, treated, and managed. SUMMARY OF THE INVENTION [06] According to one aspect of the invention a method is provided to stratify a patient having a cancer based on a genotype affecting clinical outcome. A test sample of the patient is tested and a biallelic, germline genotype of the patient for matrix metalloproteinase 8 (MMP8) gene at nucleotide position 259 of its transcribed sequence is determined. An AA genotype is associated with a poor clinical outcome. A GG genotype is associated with an intermediate clinical outcome. An AG genotype is associated with a better clinical outcome. These genotypes refer to the coding strand of genomic nucleic acid. [07] According to another aspect of the invention a method is provided to stratify a patient having a benign tumor or precancerous lesion based on a genotype affecting clinical outcome. A test sample of the patient is tested and a biallelic, germline genotype of the patient for matrix metalloproteinase 8 (MMP8) gene at nucleotide position 259 of its transcribed sequence is determined. An AA genotype is associated with higher risk of becoming malignant. A GG genotype is associated with an intermediate risk of becoming malignant. An AG genotype is associated with a lower a higher risk of becoming malignant. These genotypes refer to the coding strand of genomic nucleic acid. [08] These and other embodiments which will be apparent to those of skill in the art upon reading the specification provide the art with methods of categorizing, assessing, predicting, and testing patients with precancerous lesions, benign tumors, or cancers. BRIEF DESCRIPTION OF THE DRAWINGS [09] Fig. 1A-1D. Detection of MMP8 and EGFR mutations. (Fig. 1A) Schematic diagram of domains of MMP8 protein showing a single nucleotide polymorphism (K87E) identified in thyroid cancer. The MMP8 gene is located on chromosome 11q22.3 contains 10 exons and intervening sequences. (Fig. 1B) The sequencing results were shown with a representative sense and antisense sequence profile of a single nucleotide polymorphisms (A259G) found in exon 2 of MMP8 gene. (Fig. 1C) Schematic diagram of EGFR showing a mutation (G735S) and a single nucleotide polymorphism (K757K) identified in thyroid cancer. The EGFR gene is located on chromosome 7p11.2 contains 28 exons and interveining sequences. (Fig. 1D) The sequencing results were shown with sense and antisense sequence profiles of a mutation (G2203A) and a single nucleotide polymorphism (G2271A) found in exon 19 of EGFR gene. Arrow indicates mutated nucleotide. The nucleotide and amino acid alterations are indicated above the arrow. Nucleotide numbers refers to the position within coding sequence, where position 1 corresponds to the first position of the initiation codon. All the samples were sequenced in two repeated examinations with independent PCR by forward and reverse primers. DETAILED DESCRIPTION OF THE INVENTION [10] Although we found no mutation in the MMP8 gene, we found a common A259G SNP (rs1940475), resulting in a K87E amino acid switch in the proteoglycan binding domain of MMP8. The more common nucleotide pattern is G259, resulting in amino acid glutamic acid at position 87 of MMP8 and seen in about 70-90% of thyroid cancer cases. The less common nucleotide pattern is A259, resulting in amino acid lysine at position 87 and conversely seen in about 10-30% of the cases of thyroid cancer. We further investigated the biological and pathological relevance of this missense genetic change resulting in the K87E amino acid switch in MMP8 and its particular role in tumorigenesis. The type of amino acid at position 87, i.e., lysine or glutamic acid, significantly affects the function of MMP8 and its role in the invasion, metastasis, and ultimately clinicopathological outcomes of human cancers. [11] Although the genetic patterns were studied here and shown to be associated with specific clinicopathological outcomes of papillary thyroid cancer, they are expected to also apply to other types of thyroid tumors and can therefore be diagnostically and prognostically used in these tumors, such as follicular thyroid cancer, Hurthle cell thyroid cancer, poorly differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, and benign thyroid tumors and thyroid nodules. Moreover, as these genetic patterns reflect germline genetic variants, these MMP8 markers commonly exist in the general human population. Thus these markers also predict certain clinicopatholgoical outcomes of other human cancers and can therefore be similarly used to guide their diagnosis, prognostication and appropriate management. [12] Examples of cancers which can be subjected to similar analyses and predictions based on these same markers include without limitation lung cancer, breast cancer, stomach cancer, pancreatic cancer, liver cancer, colon cancer, ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, kidney cancer, bladder cancer, testicular cancer, bone cancer, brain cancer, head and neck cancer, leukemia, lymphoma, and melanoma. Other skin cancers, such as squamous cell carcinoma and basal cell carcinoma, may also be used. Other blood cancers including lymphomas may also be used. [13] Additionally, patients who have benign tumors or precancerous lesions, such as thyroid nodules can also be the subject of the genotype determination. The results of the genotype, similar to the case of cancers in patients, may be used to indicate which tumors or lesions are most likely to progress and which are least likely to progress, for example. Thus the genotype of a patient’s germline interacts with a patient’s tumor to modify its natural history. A prognosis for such patients can be similarly assigned as with cancerous tumors. Non-limiting examples of precancerous lesions are thyroid nodules which may develop into thyroid cancer, nevi which may develop into melanomas, breast adenoma which may develop into breast cancer, and colon polyps which may develop into colon cancer. [14] Assigning a prognosis is a positive act of sorting a patient into a group to which a particular prognosis has been associated. The assignment requires recording a result, such as in a communiqué or medical record, communicating the result, e.g., to the patient or to a medical professional or family member, or acting on the prognosis., e.g., making a treatment or management decision or performing a treatment or management act based on the prognosis. Other means may be used. [15] Patients may be assigned to a group of similar patients based on the genotype determined.
The group may be involved in a clinical study. The group may be used analytically to process the results of patients receiving similar treatments. The group may be assigned different treatments based on the genotype. [16] The MMP8 genetic variant markers can be used in combination with other molecular markers to synergistically enhance the diagnostic, prognostic, and therapeutic value in the management of thyroid cancers and other human cancers. These other molecular markers can be mutations, genetic amplifications, genetic copy gain or loss/deletion, genetic rearrangements, epigenetic alterations (e.g., hypermethylation, hypomethylation, histone acetylation, histone methylation, and other types of histone modifications, and expression changes in various microRNA markers), microsatellite instability, loss of heterozygosity, abnormal protein expression patterns, and other molecular changes. Examples of genes, transcripts, and proteins which may be effected include without limitation RET-PTC (e.g., isoforms 1, 2, 3 and other forms), PPARȖ/Pax8, RET, H-Ras, K-Ras, N-Ras, A-Raf, B-Raf (BRAF), C-Raf, MEK1/2, ERK1/2, PIK3CA, PIK3CB, PIK3CD, other types of PI3K, PDK, PTEN, Akt-1, Akt-2, Akt-3, mTOR, RASSF1A, RASAL1, ALK, EML4-ALK, other ALK-involving rearrangements, telomerase (and telomeres), beta-catenin, galectin 1 and 3, EGFR, PDGFR alpha and beta, VEGFR-1 and 2, c-MET, KIT, thyroxine receptor beta and alpha, TSHR, TPO, NIS, TTF-1, TTF-2, PAX8, SLC26A4 (pendrin), thyroglobulin, MLH1, MLH3, MSH2, MSH6, PMS1, PMS2, the family of matrix metalloproteinases (including MMP1-23 other than MMP8), PSA, CA-125, CA-19, CEA, calcitonin, NF-kappaB, retinoic acid receptors (e.g., RARbeta2 ), TIMP3, SLC5A8, DAPK, estrogen receptors, STAT3, HMGI, JNK, DUSP26, APC, MSH2, MSH6, TP53, LKB1, STK11, SMAD4, DPC4, ERBB2 (HER2/neu), ETV6, NTRK3, BRCA1, BRCA2, CDKN2, CDK4, TMPRSS2-EGR, Tp16 (p16/INK4/CDKN2), PRCC/TFE3, PSF/TFE3, ASPL/TFE3, CLTC/TFE3, NONO/TFE3, ALPHA/TFEB, FKHR, menin, TGFBR1, E-cadherin, TGF-beta, hypoxia-inducible factor-1alpha, chemokines CXCL1 and CXCL10, MST1, FoxO3, Mst1, urokinase plasminogen activator receptor, thrombospondin-1, neurotrophic tyrosine kinase receptor 1 (NTRK1), GDNF-family receptor-alpha, hepatocyte growth factor, CDH1, and other genes. Markers known to be particularly important in thyroid cancers include miRNA markers, such as upregulation of miR-146b, miR-221, miR-222, miR-155, miR-31 and downregulation of miR-1, miR-34b, miR-130b, and miR-138 in aggressive compared with nonaggressive PTC. Another marker associated with aggressive behavior is mutated BRAF(V600E). Another marker associated with aggressive behavior is IQGAP1 copy number (CN) gain 3. Combinations of any such markers may be used. [17] A genotype can be determined using any techniques known in the art. Genomic DNA, cDNA, mRNA, or protein can be analyzed to determine the genotype. Any technique which provides information on the identity of the nucleotide at position 259 of the mRNA or position 87 of the protein can be used. In order to determine the biallelic genotype, one must be able to detect both versions of the SNP, if present. Techniques which may be used include without limitation, RT-PCR, PCR, nucleotide sequencing, ELISA, immunohistochemistry, immunoprecipitation, allele specific amplification, allele specific ligation, hybridization to allele specific probes, immunoelectrophoresis, etc. [18] A test sample from the patient need not be from a tumor. The SNP occurs in all cells of the body, so any sample that is convenient may be used. Blood is an obvious choice because of ease of harvesting. [19] We examined the MMP8, AKT3 and PIK3R1 genes for their mutation status in various thyroid cancers and GNAQ in anaplastic thyroid cancer and found no mutation in them. A positive finding in the present study is the discovery for the first time a G735S EGFR mutation in thyroid cancer although it is an infrequent event. This mutation was first identified in lung cancer and subsequently in prostate cancer (18, 19). The G735 residue is located on the beta-strand of the N-terminal lobe. Three-D rendering of the tyrosine kinase domain has suggested that a possible mechanism for EGFR deregulation by the G735S mutation is a conformational change of the kinase domain, leading to its activation (19). Functional analyses demonstrated that the G735S EGFR mutant was a gain-of-function mutation with increased tyrosine kinase activity associated with increased signaling activities of the STAT, MAPK and PI3K/AKT pathways, as reflected by the phosphorylation of STAT, AKT and ERK as well as increased cell proliferation, anchorage-independent colony formation and invasion (20). EGFR mutations of other types have been also reported in PTC of Greek (15) and Japanese patients (9) and no mutation of this gene was found in FTC and ATC of American patients (4). The prevalence of the EGFR mutation in the PTC patients in the present study was 5% (1/21), same to the prevalence (5%, 2/43) of EGFR mutations in Greek PTC patients (15), but lower than that (30%, 7/23) in Japanese PTC patients (9). Different ethnic backgrounds may explain this variation in prevalence. It is likely that PTC patients harboring mutations in the EGFR gene may respond to therapeutic targeting using specific EGFR inhibitors or dually targeting the PI3K/AKT and MAPK pathways using MEK and AKT inhibitors. [20] Somatic mutations in MMP8 and PIK3R1 have not been investigated previously in thyroid cancer. Akt3 has not been analyzed in follicular and anaplastic thyroid cancer and GNAQ has not been analyzed in anaplastic thyroid cancer. Our mutational analyses in the present study showed absence of somatic mutations in these genes in thyroid cancer. These findings suggest that genetic alterations in these genes may not play a significant role in the tumorigenesis of this cancer. It is probably not surprising that GNAQ, MMP8, Akt3 and PIK3R1 gene mutations are not common in thyroid cancer since many of the upstream effectors such as EGFR, RET/PTC, RAS, BRAF, PTEN, PIK3CA, PIK3CB and PDK1 are commonly activated via mutations or genetic amplifications that can independently activate the MAPK or the PI3K/AKT pathway in thyroid cancers (4). For example the BRAF V600E mutation is very common in thyroid cancers such as papillary thyroid cancers. Moreover, unlike Akt1 and Akt2, Akt3 may not play a significant role in the tumorigenesis of thyroid cancer (21, 22). Therefore, genetic alterations in the Akt3 gene might predictably unnecessary for thyroid cancer tumorigenesis. [21] The above disclosure generally describes the present invention. All references disclosed herein are expressly incorporated by reference. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention. EXAMPLE 1 Materials and Methods Cell lines, tumor samples, and DNA extraction [22] The thyroid cancer cell lines (K1, K5, OCUT-1, OCUT-2, FB-1, SW1736, BCPAP, HTh7, HTh74, KAT 18, FTC133 and C643) and thyroid tumor, melanoma and colon cancer samples used were as described previously with local Institutional Review Board (IRB) approval (16). Cell lines were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), streptomycin (100μg/mL), penicillin (100units/mL) and 2mM glutamine. Genomic DNA from cell lines and tumors was isolated by standard phenol-chloroform extraction and ethanol precipitation procedures (16).
PCR amplification and sequencing of GNAQ, MMP8, AKT3, EGFR and PIK3R1 genes [23] The primer sequences and PCR conditions for the amplification of exon 5 of the GNAQ gene, exon 2 of the MMP8 gene, and exons 18, 19 and 21 of the EGFR gene are as described previously (5, 6, 17). The primer sequences for the amplification of exon 2 and exon 12 of the AKT3 gene are as follows: (exon 2) AKT3-2F 5’- TGGAGGCCAGTGTTGTAGGAC-3’(SEQ ID NO: 1); AKT3-2R 5’- ATAGCCTAAGATATCTGACAC -3’ (SEQ ID NO: 2), (exon 12) AKT3-12F 5’- AGCGACTCAGCATTGTAGACT -3’(SEQ ID NO: 3); AKT3-12R 5’- TCACTGTGGAATTTGATCTTG -3’(SEQ ID NO: 4). PCR reaction conditions were as follows, after initial denaturation, at 94ºC for 2 min, amplification was performed at 94ºC for 1 min, 60ºC for 1 min for 35 cycles with final extension at 72ºC for 7 min and the same PCR conditions were followed for the amplification of exon 12 of AKT3 except for the annealing temperature at 58ºC. The primers sequences PIK3R1-14F 5’- AAACTGCTGGGAAACCATAGT- 3’(SEQ ID NO: 5), PIK3R1-14R 5’- TAACTCATCCTGAATTGTAGC -3’(SEQ ID NO: 6), PIK3R1-16F 5’- AAGACAGCAAGGCAGGCTGAT -3’(SEQ ID NO: 7), PIK3R1-16R 5’- CTATGTCAAATCTTTGCCCCC -3’(SEQ ID NO: 8), PIK3R1-17F 5’- TGAGACTGCACAATAATGCTT -3’ (SEQ ID NO: 9) and PIK3R1-17R 5’- CTCAATTCACAGATCAGACTG - 3’ (SEQ ID NO: 10) were used for the PCR amplification of exon 14, 16 and 17 respectively. Annealing temperature was 57ºC for exon 14 and 17 and 60ºC for exon 16. The PCR products were directly sequenced using a Big Dye terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems). These exons were examined because they harbored most of the reported mutations in these genes. Gene Bank accession numbers are NM_002072.2 (GNAQ), NM_002424.2 (MMP8), NM_ NM_005465.3 (AKT3), NM_005228.3 (EGFR) and NM_181523.1 (PIK3R1).
EXAMPLE 2 [24] We examined exon 5 of the GNAQ gene for mutations in the present study since all of the known GNAQ mutations have been reported in codon 209 in this exon. Exon 2 of the MMP8 gene and exons 18, 19 and 21 of the EGFR gene were selected for sequencing as they have recently been shown to carry somatic mutations in other human cancers. Exons 2 and 12 of AKT3 were similarly chosen for analysis for their carrying mutations in other cancers. Exons 14, 16 and 17 of the PIK3R1gene were selected for analysis also because they were the most mutated exons in PIK3R1. [25] Our sequencing results showed no mutation in and around the hot spot codon 209 in the GNAQ gene in 12 thyroid cancer cell lines and 40 thyroid cancer samples (including 20 FTC and 20 ATC). We did not examine PTC as this cancer was found to harbor no GNAQ mutation previously (11). The normal amino acid, glutamine, encoded by codon 209 of the GNAQ gene lies within the RAS-like domain of GNAQ (corresponding to residue 61 of Ras) and is essential for GTP hydrolysis. In members of RAS family, mutations at this site and at codon 12 cause loss of GTPase activity with constitutive activation of Ras. Given this similarity of GNAQQ209L mutation with Ras mutations and the fact that melanoma and colon cancer are similar to thyroid cancer in terms of their high prevalence of Ras mutations, we additionally analyzed 20 cutaneous melanoma and 20 colon cancer samples for the GNAQ mutation and found that none of them harbored this mutation. [26] We did not find any novel MMP8 mutation in 12 thyroid cancer cell lines and 31 PTC, 20 FTC and 20 ATC tumor samples. As illustrated in Fig 1, we observed a frequent homozygous/heterozygous A>G transition at nucleotide position 259, resulting in codon 87 switch between AAA and GAA and amino acid 87 switch between lysine and glutamic acid (K87E) in exon 2 of MMP8. This represents a single nucleotide polymorphism (SNP) (rs1940475) reported in the SNP data base (http://www.ncbi.nlm.nih.gov/projects/SNP/). [27] We found the G259 pattern in 25 of 31 (80.6%) PTC, 14 of 19 (73.6%) FTC and 8 of 9 (88.8%) ATC. Conversely, the A259 pattern was found in 19.4%, 26.4%, and 11.2% of these tumors, respectively. [28] We did not find any AKT3 mutation in 12 thyroid cancer cell lines and 20 PTC, 20 FTC and 20 ATC tumor samples. We also did not find any PIK3R1 mutation in 12 thyroid cancer cell lines and 20 PTC, 32 FTC and 32 ATC samples. [29] However, we found an EGFR mutation in 1 of 21 (5%) PTC tumor samples. This mutation was not found in 12 thyroid cancer cell lines. As illustrated in Fig 1, this mutation is a homozygous missense mutation resulting in G>A transition at nucleotide position 2203 of the EGFR gene. This mutation caused codon 735 to change from GGT>AGT, resulting in the amino acid change G735S in the EGFR protein. We also found a rare and novel silent mutation resulting in G>A transition at the nucleotide position 2271 and it has not been reported in the SNP data base (Fig 1). Fig 1 shows the mutations and SNP identified and their related protein domain. EXAMPLE 3 [30] We performed 3-way and 2-way analyses to determine if there was an association between gat nucleotide 259 in codon 87 of the MMP8 gene with poor clinicopathological outcomes in cancer. Results in tables 1-3 show that the genotype AA at nucleotide position 259 in codon 87 of the MMP8 gene is most significantly associated with several poor clinicopathlogical outcomes of papillary thyroid cancer, including extrathyroidal invasion, vascular invasion, cancer recurrence/persistence, distant metastasis, advanced tumor stages. Most importantly, AA is strongly associated with disease recurrence of thyroid cancer. The genotype GG is to some extent associated with some of these clinicopathological characteristics. The genotype AG is least associated with these tumor characteristics. Therefore, genotype AA is associated with a poorer prognosis of thyroid cancer, genotype AG is associated with a better prognosis, and genotype GG is associated with an intermediate prognosis of thyroid cancer. This genotypic information is expected to be useful in guiding the prognostication and in selecting an appropriate treatment of thyroid and other cancers. It should be noted that the genotypes AA, GG, and AG termed here would be TT, CC, and TC if the complementary (non-coding) DNA strand is used for orientation.
Figure imgf000014_0001
Figure imgf000015_0001
Figure imgf000016_0001
References The disclosure of each reference cited is expressly incorporated herein. 1. Leenhardt L, Grosclaude P & Cherie-Challine L. Increased incidence of thyroid carcinoma in France: a true epdemic or thyroid nodule management effects? Report from the French Thyroid Cancer Committee. Thyroid 14:1056-1060, 2004.
2. Sprague BL, Warren Andersen S & Trentham-Dietz A. Thyroid cancer incidence and socioeconomic indicators of health care access. Cancer Causes and Control 19:585– 593, 2008.
3. Hundahl, I.D. Fleming, A.M. Fremgen and H.R. Menck, A national cancer data base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer 83:2638–2648, 1998.
4. Liu Z, Hou P, Ji M, Guan H, Studeman K, Jensen K, et al. Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogen-activated protein kinase pathways in anaplastic and follicular thyroid cancers. J Clin Endocrinol Metab 93:3106–3116, 2008.
5. Van Raamsdonk CD, Bezrookove V, Green G, Bauer J, Gaugler L, O'Brien JM, et al. Frequent somatic mutations of GNAQ in uveal melanoma and bluenaevi. Nature 457:599-602, 2009.
6. Palavalli LH, Prickett TD, Wunderlich JR, Wei X, Burrell AS, Porter-Gill P, et al. Analysis of the matrix metalloproteinase family reveals that MMP8 is often mutated in melanoma. Nat Genet 41:518-520, 2009.
7. Davies MA, Stemke-Hale K, Tellez C, Calderone TL, Deng W, Prieto VG, et al. A novel AKT3 mutation in melanoma tumors and cell lines. Br J Cancer 99:1265-1268, 2008.
8. Dutt A, Salvesen HB, Greulich H, Sellers WR, Beroukhim R & Meyerson M. Somatic mutations are present in all members of the AKT family in endometrial carcinoma. Br J Cancer 101:1218-1219, 2009. 9. Masago K, Asato R, Fujita S, Hirano S, Tamura Y, Kanda T, et al., Epidermal growth factor receptor mutations in papillary thyroid carcinoma. Int J Cancer 124:2744- 2749, 2009.
10. Jaiswal BS, Janakiraman V, Kljavin NM, Chaudhuri S, Stern HM, Wang W, et al. Somatic mutations in p85Į promote tumorigenesis through class 1A PI3K activation. Cancer Cell 16:463-474, 2009.
11. Matsuse M, Mitsutake N, Nishihara E, Rogounovitch T, Saenko V, Rumyantsev P, et al. Lack of GNAQ hotspot mutation in papillary thyroid carcinomas. Thyroid 19: 921-922, 2009.
12. Lamba S, Felicioni L, Buttitta F, Bleeker FE, Malatesta S, Corbo V, et al.
Mutational profile of GNAQQ209 in human tumors. PLoS One 4:e6833, 2009.
13. Cassol CA, Guo M, Ezzat S, Asa SL. GNAq mutations are not identified in papillary thyroid carcinomas and hyperfunctioning thyroid nodules. Endocr Pathol 21:250-2, 2010.
14. Sozopoulos E, Litsiou H, Voutsinas G, Mitsiades N, Anagnostakis N, Tseva T, et al. Mutational and immunohistochemical study of the PI3K/Akt pathway in papillary thyroid carcinoma in Greece. Endocr Pathol 21:90-100, 2010.
15. Mitsiades CS, Kotoula V, Poulaki V, Sozopoulos E, Negri J, Charalambous E, et al. Epidermal growth factor receptor as a therapeutic target in human thyroid carcinoma: mutational and functional analysis. J Clin Endocrinol Metab 91:3662-3666, 2006.
16. Murugan AK, Dong J, Xie J & Xing M. MEK1 mutations, but not ERK2 mutations, occur in melanomas and colon carcinomas, but none in thyroid carcinomas. Cell Cycle 8:2122-2124, 2009.
17. Nagai Y, Miyazawa H, Huqun, Tanaka T, Udagawa K, Kato M, et al. Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system, the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res 65:7276-7282, 2005.
18. Tsao MA, Sakurada A, Cutz JC, Zhu CQ, Kamel-Reid S, Squire J, et al. Erlotinib in lung cancer - molecular and clinical predictors of outcome. N Engl J Med 353:133- 144, 2005. 19. Douglas DA, Zhong H, Ro JY, Oddoux C, Berger AD, Pincus MR, et al. Novel mutations of epidermal growth factor receptor in localized prostate cancer. Front Biosci 11:2518-2525, 2006.
20. Cai CQ, Peng Y, Buckley MT, Wei J, Chen F, Liebes L, et al. Epidermal growth factor receptor activation in prostate cancer by three novel missense mutations. Oncogene 27:3201-3210, 2008.
21. Ringel MD, Hayre N, Saito J, Saunier B, Schuppert F, Burch H, et al.
Overexpression and overactivation of Akt in thyroid carcinoma. Cancer Res 6:6105- 6111, 2001.
22. Ricarte-Filho JC, Ryder M, Chitale DA, Rivera M, Heguy A, Ladanyi M, et al. Mutational profile of advanced primary and metastatic radioactive iodine-refractory thyroid cancers reveals distinct pathogenetic roles for BRAF, PIK3CA, and AKT1.
Cancer Res 69:4885-93, 2009.

Claims

CLAIMS 1. A method to stratify a patient having a cancer based on a genotype affecting clinical outcome, comprising:
testing and determining in a test sample of the patient a biallelic, germline genotype of the patient for matrix metalloproteinase 8 (MMP8) gene at nucleotide position 259 of its transcribed sequence, wherein an AA genotype is associated with a poor clinical outcome, a GG genotype is associated with an intermediate clinical outcome, and an AG genotype is associated with a better clinical outcome; wherein said genotypes refer to the coding strand of genomic nucleic acid.
2. The method of claim 1 wherein the biallelic, germline genotype is determined by testing genomic DNA in the test sample.
3. The method of claim 1 wherein the biallelic, germline genotype is determined by testing mRNA in the test sample.
4. The method of claim 1 wherein the biallelic, germline genotype is determined by testing protein in the test sample, and determining a lysine and/or a glutamate at residue 87 of the MMP8 protein, wherein lysine/lysine is the result of an AA genotype,
glutamate/glutamate is the result of an GG genotype, and lysine/glutamate is the result of an AG genotype.
5. The method of claim 1 wherein the clinical outcome is selected from the group consisting of tumor progression, vascular invasion, tumor metastasis, tumor recurrence, mortality, and extra-organ invasion.
6. The method of claim 1 wherein the cancer is selected from the group consisting of
papillary thyroid cancer, follicular thyroid cancer, Hurthle cell thyroid cancer, poorly differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, and benign thyroid tumors.
7. The method of claim 1 wherein the cancer is selected from the group consisting of lung cancer, breast cancer, stomach cancer, pancreatic cancer, liver cancer, colon cancer, ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, kidney cancer, bladder cancer, testicular cancer, bone cancer, brain cancer, head and neck cancer, leukemia, lymphoma, and melanoma.
8. The method of claim 1 further comprising the step of assigning a prognosis based on the biallelic, germline genotype.
9. The method of claim 8 wherein the prognosis relates to a clinical outcome selected from the group consisting of tumor progression, vascular invasion, tumor metastasis, tumor recurrence, mortality, extra-organ invasion.
10. The method of claim 1 further comprising the step of assigning a prognosis based on the biallelic, germline genotype and one or more additional molecular markers.
11. The method of claim 10 wherein the one or more additional molecular markers comprise a somatic mutation in the cancer of the patient.
12. The method of claim 10 wherein the one or more additional molecular markers comprise a change in expression of a protein.
13. The method of claim 1 further comprising the step of assigning the patient to a group based on the biallelic, germline genotype.
14. The method of claim 13 wherein the group is subjected to clinical study.
15. The method of claim 14 wherein the group is assigned a test therapeutic regimen.
16. The method of claim 13 wherein the group is identified as sensitive to a therapeutic
regimen.
17. The method of claim 13 wherein the group is identified as resistant to a therapeutic
regimen.
18. The method of claim 13 wherein the group is assigned a therapeutic regimen.
19. The method of claim 11 wherein the somatic mutation is in a gene selected from the
group consisting of for RET-PTC, PPARȖ/Pax8, RET, H-Ras, K-Ras, N-Ras, A-Raf, B- Raf (BRAF), C-Raf, MEK1/2, ERK1/2, PIK3CA, PIK3CB, PIK3CD, PDK, PTEN, Akt- 1, Akt-2, Akt-3, mTOR, RASSF1A, RASAL1, ALK, EML4-ALK, telomerase, telomeres, beta-catenin, galectin 1 and 3, EGFR, PDGFR alpha and beta, VEGFR, c-MET, KIT, thyroxine receptor ȕ and Į, TSHR, TPO, NIS, TTF-1, TTF-2, PAX8, SLC26A4
(pendrin), thyroglobulin, MLH1, MLH3, MSH2, MSH6, PMS1, PMS2, IDH1, IDH2, MMP1-7, and 9-23, PSA, CA-125, CA-19, CEA, hepatic alpha-protein, calcitonin, NF- kappaB, retinoic acid receptors, TIMP3, SLC5A8, DAPK, estrogen receptors, STAT3, HMGI, JNK, DUSP26, APC, MSH2, MSH6, TP53, LKB1, STK11, SMAD4, DPC4, ERBB2 (HER2/neu), ETV6, NTRK3, BRCA1, BRCA2, CDKN2, CDK4, TMPRSS2- EGR, Tp16 (p16/INK4/CDKN2), PRCC/TFE3, PSF/TFE3, ASPL/TFE3, CLTC/TFE3, NONO/TFE3, ALPHA/TFEB, FKHR, menin, TGFBR1, E-cadherin, TGFȕ, hypoxia- inducible factor-1Į, chemokines CXCL1 and CXCL10, MST1, FoxO3, Mst1, urokinase plasminogen activator receptor, thrombospondin-1, neurotrophic tyrosine kinase receptor 1 (NTRK1), GDNF-family receptor-Į, hepatocyte growth factor, prohibitin, vimentin, microRNAs, and CDH1.
20. The method of claim 12 wherein the change in expression of a protein is in a protein
selected from the group consisting of for RET-PTC, PPARȖ/Pax8, RET, H-Ras, K-Ras, N-Ras, A-Raf, B-Raf (BRAF), C-Raf, MEK1/2, ERK1/2, PIK3CA, PIK3CB, PIK3CD, PDK, PTEN, Akt-1, Akt-2, Akt-3, mTOR, RASSF1A, RASAL1, ALK, EML4-ALK, telomerase, telomeres, beta-catenin, galectin 1 and 3, EGFR, PDGFR alpha and beta, VEGFR, c-MET, KIT, thyroxine receptor ȕ and Į, TSHR, TPO, NIS, TTF-1, TTF-2, PAX8, SLC26A4 (pendrin), thyroglobulin, MLH1, MLH3, MSH2, MSH6, PMS1, PMS2, IDH1, IDH2, MMP1-7, and 9-23, PSA, CA-125, CA-19, CEA, hepatic alpha-protein, calcitonin, NF-kappaB, retinoic acid receptors, TIMP3, SLC5A8, DAPK, estrogen receptors, STAT3, HMGI, JNK, DUSP26, APC, MSH2, MSH6, TP53, LKB1, STK11, SMAD4, DPC4, ERBB2 (HER2/neu), ETV6, NTRK3, BRCA1, BRCA2, CDKN2, CDK4, TMPRSS2-EGR, Tp16 (p16/INK4/CDKN2), PRCC/TFE3, PSF/TFE3,
ASPL/TFE3, CLTC/TFE3, NONO/TFE3, ALPHA/TFEB, FKHR, menin, TGFBR1, E- cadherin, TGFȕ, hypoxia-inducible factor-1Į, chemokines CXCL1 and CXCL10, MST1, FoxO3, Mst1, urokinase plasminogen activator receptor, thrombospondin-1 , neurotrophic tyrosine kinase receptor 1 (NTRK1), GDNF-family receptor-Į, hepatocyte growth factor, prohibitin, vimentin, microRNAs, and CDH1.
21. The method of claim 10 wherein the one or more additional molecular markers is
selected from the group consisting of mutations, amplifications, deletions,
rearrangements, hypermethylation, hypomethylation, histone acetylation, histone methylation, microsatellite instability, loss of heterozygosity, microRNAs, and abnormal protein expression.
22. A method to stratify a patient having a benign tumor or precancerous lesion based on a genotype affecting clinical outcome, comprising:
testing and determining in a test sample of the patient a biallelic, germline genotype of the patient for matrix metalloproteinase 8 (MMP8) gene at nucleotide position 259 of its transcribed sequence, wherein an AA genotype is associated with a higher risk of becoming malignant, a GG genotype is associated with an intermediate risk of becoming malignant, and an AG genotype is associated with a lower risk of becoming malignant; wherein said genotypes refer to the coding strand of genomic nucleic acid.
23. The method of claim 22 further comprising the step of assigning a prognosis based on the biallelic, germline genotype.
24. The method of claim 22 wherein the precancerous lesion is a thyroid nodule.
25. The method of claim 22 wherein the precancerous lesion is a nevus.
26. The method of claim 22 wherein the precancerous lesion is a breast adenoma.
27. The method of claim 22 wherein the precancerous lesion is a colon polyp.
PCT/US2011/045340 2010-07-26 2011-07-26 Genetic make-up modifies cancer outcome Ceased WO2012018613A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/812,581 US8980554B2 (en) 2010-07-26 2011-07-26 Genetic make-up modifies cancer outcome

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US36768410P 2010-07-26 2010-07-26
US61/367,684 2010-07-26
US201161432780P 2011-01-14 2011-01-14
US61/432,780 2011-01-14

Publications (2)

Publication Number Publication Date
WO2012018613A2 true WO2012018613A2 (en) 2012-02-09
WO2012018613A3 WO2012018613A3 (en) 2012-05-24

Family

ID=45559988

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/045340 Ceased WO2012018613A2 (en) 2010-07-26 2011-07-26 Genetic make-up modifies cancer outcome

Country Status (2)

Country Link
US (1) US8980554B2 (en)
WO (1) WO2012018613A2 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016094692A1 (en) * 2014-12-11 2016-06-16 Wisconsin Alumni Research Foundation Methods for detection and treatment of colorectal cancer
CN106811517A (en) * 2016-03-22 2017-06-09 凯杰(苏州)转化医学研究有限公司 It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation
CN107299134A (en) * 2017-06-16 2017-10-27 中国人民解放军南京军区南京总医院 PCR primer combination for diagnosing PRCC-TFE3 translocation tumor and application thereof
CN108315425A (en) * 2018-04-10 2018-07-24 广东省人民医院(广东省医学科学院) PCR specific primers, kit and its application method of metastasis of thyroid carcinoma related gene detection
CN108699553A (en) * 2015-12-31 2018-10-23 奎斯特诊断投资有限责任公司 Compositions and methods for screening for mutations in thyroid cancer
CN108866190A (en) * 2018-07-12 2018-11-23 吉林大学 A kind of malignant tumor of ovary neurological susceptibility prediction kit and system
CN109136377A (en) * 2018-09-25 2019-01-04 浙江师范大学 The therapeutic agent and diagnostic kit of adult T-cell leukemia
CN109234362A (en) * 2018-10-15 2019-01-18 北京艾迪康医学检验实验室有限公司 Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample
CN109321640A (en) * 2018-10-15 2019-02-12 南京艾迪康医学检验所有限公司 Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample
CN109355382A (en) * 2018-10-15 2019-02-19 福州艾迪康医学检验所有限公司 Detect oligonucleotides, method and the kit of PRCC-TFE3 fusion in sample
CN112941162A (en) * 2020-12-30 2021-06-11 昆明理工大学 Method for detecting correlation between DNA telomere length and gene methylation degree
CN120102906A (en) * 2025-05-07 2025-06-06 中南大学湘雅二医院 Application of DUSP26 as a biomarker in the preparation of a product to predict the transformation of acute kidney injury to chronic kidney disease

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107267608B (en) * 2017-06-16 2018-03-09 中国人民解放军南京军区南京总医院 A kind of MATR3 TFE3 fusions and its detection primer and application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DECOCK, J. ET AL.: 'Association of matrix metalloproteinase-8 gene variati on with breast cancer prognosis' CANCER RESEARCH vol. 67, 01 November 2007, pages 10214 - 10221 *
GONZALEZ-ARRIAGA, P. ET AL.: 'Polymorphism +17 C/G in matrix metalloprotea se MMP8 decreases lung cancer risk' BMC CANCER vol. 8, 19 December 2008, page 378 *
NAN, H. ET AL.: 'Missense polymorphisms in matrix metalloproteinase genes and skin cancer risk' CANCER EPIDEMIOL BIOMARKERS PREV. vol. 17, 08 December 2008, pages 3551 - 3 557 *
WANG, H. ET AL.: 'Functionally significant SNP MMP8 promoter haplotypes an d preterm premature rupture of membranes (PPROM)' HUMAN MOLECULAR GENETICS vol. 13, no. 21, 14 September 2004, pages 2659 - 2669 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016094692A1 (en) * 2014-12-11 2016-06-16 Wisconsin Alumni Research Foundation Methods for detection and treatment of colorectal cancer
US11513123B2 (en) 2014-12-11 2022-11-29 Wisconsin Alumni Research Foundation Methods for detection and treatment of colorectal cancer
EP3397766A4 (en) * 2015-12-31 2019-10-02 Quest Diagnostics Investments LLC COMPOSITIONS AND METHODS FOR SEARCHING FOR MUTATIONS IN THYROID CANCER
US11053542B2 (en) 2015-12-31 2021-07-06 Quest Diagnostics Investments Llc Compositions and methods for screening mutations in thyroid cancer
CN108699553A (en) * 2015-12-31 2018-10-23 奎斯特诊断投资有限责任公司 Compositions and methods for screening for mutations in thyroid cancer
US12516372B2 (en) 2015-12-31 2026-01-06 Quest Diagnostics Investments Llc Compositions and methods for screening mutations in thyroid cancer
EP4246144A3 (en) * 2015-12-31 2023-12-20 Quest Diagnostics Investments LLC Compositions and methods for screening mutations in thyroid cancer
CN108699553B (en) * 2015-12-31 2023-08-04 奎斯特诊断投资有限责任公司 Compositions and methods for screening for mutations in thyroid cancer
CN106811517A (en) * 2016-03-22 2017-06-09 凯杰(苏州)转化医学研究有限公司 It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation
CN107299134B (en) * 2017-06-16 2019-10-11 中国人民解放军南京军区南京总医院 A PCR primer combination and its application for diagnosing PRCC-TFE3 translocation tumors
CN107299134A (en) * 2017-06-16 2017-10-27 中国人民解放军南京军区南京总医院 PCR primer combination for diagnosing PRCC-TFE3 translocation tumor and application thereof
CN108315425A (en) * 2018-04-10 2018-07-24 广东省人民医院(广东省医学科学院) PCR specific primers, kit and its application method of metastasis of thyroid carcinoma related gene detection
CN108866190B (en) * 2018-07-12 2022-01-28 吉林大学 Ovarian malignant tumor susceptibility prediction kit and system
CN108866190A (en) * 2018-07-12 2018-11-23 吉林大学 A kind of malignant tumor of ovary neurological susceptibility prediction kit and system
CN109136377A (en) * 2018-09-25 2019-01-04 浙江师范大学 The therapeutic agent and diagnostic kit of adult T-cell leukemia
CN109355382A (en) * 2018-10-15 2019-02-19 福州艾迪康医学检验所有限公司 Detect oligonucleotides, method and the kit of PRCC-TFE3 fusion in sample
CN109321640A (en) * 2018-10-15 2019-02-12 南京艾迪康医学检验所有限公司 Detect oligonucleotides, method and the kit of PSF-TFE3 fusion in sample
CN109234362A (en) * 2018-10-15 2019-01-18 北京艾迪康医学检验实验室有限公司 Detect oligonucleotides, method and the kit of CLTC-TFE3 fusion in sample
CN112941162A (en) * 2020-12-30 2021-06-11 昆明理工大学 Method for detecting correlation between DNA telomere length and gene methylation degree
CN120102906A (en) * 2025-05-07 2025-06-06 中南大学湘雅二医院 Application of DUSP26 as a biomarker in the preparation of a product to predict the transformation of acute kidney injury to chronic kidney disease

Also Published As

Publication number Publication date
WO2012018613A3 (en) 2012-05-24
US20130171645A1 (en) 2013-07-04
US8980554B2 (en) 2015-03-17

Similar Documents

Publication Publication Date Title
US8980554B2 (en) Genetic make-up modifies cancer outcome
Pstrąg et al. Thyroid cancers of follicular origin in a genomic light: in-depth overview of common and unique molecular marker candidates
Dunbar et al. 250K single nucleotide polymorphism array karyotyping identifies acquired uniparental disomy and homozygous mutations, including novel missense substitutions of c-Cbl, in myeloid malignancies
CA2957396C (en) Method of determining pik3ca mutational status in a sample
Mijnes et al. Promoter methylation of DNA damage repair (DDR) genes in human tumor entities: RBBP8/CtIP is almost exclusively methylated in bladder cancer
US20210108256A1 (en) Genomic alterations in the tumor and circulation of pancreatic cancer patients
Böttcher et al. Novel long non-coding RNAs are specific diagnostic and prognostic markers for prostate cancer
AU2013281355B2 (en) Targeted RNA-seq methods and materials for the diagnosis of prostate cancer
Frankel et al. Genome‐wide analysis of esophageal adenocarcinoma yields specific copy number aberrations that correlate with prognosis
Arriaga-Canon et al. The use of long non-coding RNAs as prognostic biomarkers and therapeutic targets in prostate cancer
EP2147123A2 (en) Use of methylated or unmethylated line-i dna as a cancer marker
Hessels et al. Recurrent gene fusions in prostate cancer: their clinical implications and uses
Sabaliauskaite et al. Combined analysis of TMPRSS2–ERG and TERT for improved prognosis of biochemical recurrence in prostate cancer
Jehan et al. In-situ hybridization as a molecular tool in cancer diagnosis and treatment
Waseem et al. MicroRNA-183-5p: a new potential marker for prostate cancer
WO2014152950A1 (en) Methods and compositions for correlating genetic markers with risk of aggressive prostate cancer
Bandoh et al. Targeted next‑generation sequencing of cancer‑related genes in thyroid carcinoma: A single institution's experience
Ribeiro et al. Cysteine-rich secretory protein-3 (CRISP3) is strongly up-regulated in prostate carcinomas with the TMPRSS2-ERG fusion gene
KR20180108820A (en) Genetic profiling of cancer
Cao et al. Genetic alterations in cfDNA of benign and malignant thyroid nodules based on amplicon-based next-generation sequencing
Murugan et al. Uncommon GNAQ, MMP8, AKT3, EGFR, and PIK3R1 mutations in thyroid cancers
CN106337058B (en) CRYL1-IFT88 fusion gene and application thereof in diagnosis and treatment of primary hepatocellular carcinoma
JP5865241B2 (en) Prognostic molecular signature of sarcoma and its use
EP2309002A1 (en) Signature for the diagnosis of colorectal cancer aggressiveness
Brand et al. Association of polymorphisms in TGFB1 and prostate cancer prognosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11815065

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13812581

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 11815065

Country of ref document: EP

Kind code of ref document: A2