WO2012013821A1 - Inhibition de la fonction dicer pour le traitement du cancer - Google Patents

Inhibition de la fonction dicer pour le traitement du cancer Download PDF

Info

Publication number
WO2012013821A1
WO2012013821A1 PCT/EP2011/063233 EP2011063233W WO2012013821A1 WO 2012013821 A1 WO2012013821 A1 WO 2012013821A1 EP 2011063233 W EP2011063233 W EP 2011063233W WO 2012013821 A1 WO2012013821 A1 WO 2012013821A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hsa
dicer
function
cells
Prior art date
Application number
PCT/EP2011/063233
Other languages
English (en)
Inventor
Jean-Christophe Marine
Irina Lambertz
Original Assignee
Vib Vzw
Katholieke Universiteit Leuven, K.U.Leuven R&D
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vib Vzw, Katholieke Universiteit Leuven, K.U.Leuven R&D filed Critical Vib Vzw
Publication of WO2012013821A1 publication Critical patent/WO2012013821A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/26—Endoribonucleases producing 5'-phosphomonoesters (3.1.26)
    • C12Y301/26003—Ribonuclease III (3.1.26.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present application relates to the field of cancer, particularly cancers wherein p53 tumour suppression function is lost or impaired. It is shown herein that Dicer is a synthetic lethal partner of p53, allowing the selective targeting and killing of cancer cells. The effects of Dicer on survival on cancer cells are, at least partly, mediated through the miR17-92 cluster and inhibition of members of this miRNA cluster is an attractive treatment strategy in cancer. Most particularly, these findings are of importance in the field of retinoblastoma.
  • Synthetic lethality has been proposed as an interesting concept in the context of anticancer therapy (30). Two genes are synthetic lethal if mutation of either alone is compatible with viability but mutation of both leads to death. ("Synthetic" is thus used in the sense of synthesis, or coming together.) So, targeting a gene that is synthetic lethal to a cancer-relevant mutation, like for instance in p53, should kill only cancer cells and spare normal cells. Synthetic lethality therefore provides a conceptual framework for the development of cancer-specific cytotoxic agents. Although it has been shown to work for cells that have lost BRCA1 or BRCA2 (31, 32), no genetic/in vivo evidence for a synthetic lethal interaction with p53 tumour suppressor has been described to date.
  • Rb retinoblastoma
  • Rb Apart from its role in eye tumours, loss of Rb has for instance been demonstrated to increase the risk of osteosarcoma development in children and teenagers.
  • human papillomavirus HPV
  • HPV human papillomavirus
  • SCLC human small-cell lung carcinomas
  • retinoblastoma affecting approximately 1 in 15,000 live births, is a rapidly developing cancer which develops in the cells of retina, the light detecting tissue of the eye. Both genetic and sporadic forms of retinoblastoma exist, and loss of Rb has been implicated in both. Moreover, it has recently been shown that, contrary to earl ier suggestions, both the Rb a nd p53 pathways are inactivated - although not necessarily mutated - in retinoblastoma (13).
  • the cell in addition to the compromised function of p53, is further characterized by activation of an oncogene or inhibition of a tumor suppressor gene (such as e.g. b).
  • a tumor suppressor gene such as e.g. b
  • the cell wherein p53 function is compromised is a tumour cell.
  • the tumour is a retinoblastoma (and the tumour cell thus is a retinoblastoma cell).
  • inhibiting the function of Dicer can be done in different ways. It is particularly envisaged that the function of Dicerl is inhibited by inhibiting one or more of the miRNAs that are upregulated in the cell where p53 function is impaired. These miRNAs are listed in the application (e.g. in the tables provided herein). According to particular embodiments, the one or more miRNAs that are inhibited (i.e. that are upregulated in the cell wherein p53 function is impaired) are selected from the miR 17-92 cluster or a paralog thereof (such as the mir-106a-363 and mir-106b-25 cluster).
  • the one or more miRNA is selected from the miR 17-92 cluster, most particularly selected from miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR- 92.
  • inhibition of miRNAs can be done in several ways.
  • inhibition of the miRNAs is with an LNA or an antagomir.
  • inhibiting the function of Dicer is done by inhibition of Dicer itself, i.e. by inhibiting the Dicerl gene, the Dicerl mRNA or the Dicer protein.
  • P53 function in the cell wherein p53 function is impaired can be impaired in different ways.
  • p53 function is impaired by functional dysregulation but not mutation.
  • p53 function is impaired by at least one mutation.
  • an inhibitor of Dicer function is provided for use in treatment of cancer.
  • the cancer is retinoblastoma.
  • the inhibitor of Dicer function is an inhibitor of one or more of the miRNAs that are upregulated in the cancer cells. More particularly, the miRNA is selected from the miR 17-92 cluster or a paralog thereof (such as the mir-106a-363 and mir-106b-25 cluster). According to further particular embodiments, the one or more miRNA is selected from the miR 17-92 cluster, most particularly selected from miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92.
  • the inhibitor is an inhibitor of the Dicerl gene, the Dicerl mRNA or the Dicer protein.
  • FIG. 1 Dicerl is required for Retinoblastoma formation.
  • A Kaplan-Meier curve showing the time to first observation of externally visible retinoblastoma. This time was markedly decreased in ChxlOCre;Rb lox/lox ;pl07 / ;p53 lox/lox (TKO, blue line at bottom of graph) mice relative to Chxl0Cre;Rb lox/lox ;pl07 / ⁇ (DKO, black line in middle of graph) littermates. ChxlOCre;Rb lm/l °' ⁇ ;pl07 / ' ; p53 i x/iox.
  • GFP-positive cells are only detected in p53 wild-type mice.
  • FIG. 3 The miRNA-17-92 cluster is overexpressed in retinoblastoma and required for survival of established retinoblastoma cell lines.
  • A Heatmap of the miRNA-17-92 and paralogue clusters in normal mouse retina (C/jxiOCre-negative mice, light green), normal human retina (dark green), 4 mouse TKO tumours (light blue) and 30 different primary human retinoblastoma (dark blue).
  • the Y axis represents the relative percentage of viable cells following transfection of the miRNA-inhibitors. The data are normalized to the percentage of viable cells following transfection of a scramble control oligonucleotide. Data represents the mean of three independent experiments ⁇ SD.
  • the term "inducing cell death” refers to a process that results in the killing of cells. Most particularly, as defined herein, the cell death is selective, i.e. cell death is induced in cells in which p53 function is compromised (thus, those cells die) and not induced in cells wherein p53 function is normal (those cells stay alive). According to particular embodiments, the term “cell death” refers to apoptotic cell death.
  • p53 function refers to the tumor suppressor function exerted by the p53 protein encoded by the TP53 gene (Gene ID: 7157 in humans).
  • the tumor suppressor function of p53 involves one or more of the following: activating DNA repair proteins when DNA has sustained damage; inducing growth arrest by holding the cell cycle at the Gl/S regulation point on DNA damage recognition (if DNA repair proteins fix the damage, the cell will typically be allowed to continue the cell cycle); and/or initiating apoptosis if DNA damage proves to be irreparable.
  • the function can be compromised because one or both copies of the TP53 gene are mutated or absent in the cells (i.e. at the DNA level), and/or because the gene is not correctly transcribed or translated (i.e. at the RNA or protein level, respectively), and/or because no or mutant (non-functional) p53 protein is expressed in the cell, and/or because lower levels of functional p53 protein are expressed in the cells.
  • “Lower levels” as used herein means lower levels than those observed in a suitable population of control cells, particularly 25% lower, 50% lower or 75% or more lower.
  • “Dicer” as used herein refers to the protein product of the DICERl gene (Gene ID: 23405 in humans). This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease (ribonuclease type III) and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. In humans, two transcript variants encoding the same protein have been identified for this gene.
  • the "function of Dicer” as used herein is the processing of microRNAs or miRNAs (35, 36), and "inhibiting the function of Dicer” consequently means inhibiting the function of correctly processed miRNAs, be it by inhibiting their processing (e.g. by directly interfering with Dicer) or by inhibiting the miRNAs themselves (e.g. via LNAs or antagomirs).
  • “inhibiting the function of Dicer in a cell where p53 function is compromised” means inhibiting the miRNAs that are upregulated in cells where p53 function is compromised, wherein upregulation should be compared to suitable control cells wherein p53 function is not compromised.
  • upregulation of miRNAs may also mean that they are expressed in cells wherein p53 function is compromised, whereas they are not expressed in control cells.
  • inhibiting the function of Dicer means “inhibiting at least one miRNA from the miR 17-92 cluster”.
  • genes are said to be in a "synthetic lethal" relationship or “synthetic lethal partners” or interactors if a mutation in, or downregulation or knockout of, either gene alone is not lethal but mutations/downregulation/knockout in or of both cause the death of the cell.
  • genes can be synthetically lethal if e.g. a mutation in one gene is combined with e.g. downregulation of the other gene.
  • a synthetic lethal partner is a gene that, when mutated or otherwise inhibited, kills cells that harbor a specific cancer- related alteration, such as a mutated tumor-suppressor gene or an activated oncogene, but spares otherwise identical cells lacking the cancer-related alteration (30).
  • the synthetic lethal partner is synthetically lethal with mutations in, or functional dysregulation of, p53.
  • the synthetic lethal partner of p53 is Dicer or an effector of Dicer function, such as a specific miRNA, particularly one of the miR 17-92 cluster.
  • an "oncogene” as defined herein is a gene that has the potential to cause cancer. In tumor cells, they are often mutated or expressed at high levels. Typically, an oncogene is the result of changes (i.e. mutations, overexpression) of a normal gene, termed proto-oncogene. Proto-oncogenes typically code for proteins that help to regulate cell growth and differentiation. The proto-oncogene can become an oncogene by a relatively small modification of its original function, such as a mutation (e.g. leading to increase in protein or enzyme activity or loss in regulation), increase in protein concentration (e.g. by protein overexpression, increase in mRNA stability or gene duplication), or chromosomal translocation (leading to e.g.
  • oncogenes can be quantitative or qualitative.
  • oncogenes or proto-oncogenes that can become oncogenes upon activation
  • a "tumor suppressor gene”, or "anti-oncogene”, as herein defined is a gene that protects a cell from one step on the path to cancer. When this gene is mutated to cause a loss or reduction in its function, the cell can progress to cancer, usually in combination with other genetic changes.
  • Tumor-suppressor genes or more precisely, the proteins for which they code, either have a dampening or repressive effect on the regulation of the cell cycle or promote apoptosis, and sometimes do both.
  • tumor suppressors are the p53 and retinoblastoma (pRb) proteins.
  • the cell cycle may be coupled to DNA damage by tumor suppressors (i.e., as long as there is damaged DNA in the cell, it should not divide. If the damage can be repaired, the cell cycle can continue). Indeed, increased mutation rate from decreased DNA repair leads to increased inactivation of other tumor suppressors and activation of oncogenes (Markowitz, J Clin Oncol. 2000; 18(21 Suppl):75S-80S). Accordingly, in particular embodiments, DNA repair proteins are included in the definition of tumor suppressors. Non- limiting examples of such DNA repair proteins whose mutation leads to increased cancer risk include HNPCC, MENl and BRCA.
  • retinoblastoma refers to an embryonic malignant neoplasm of retinal origin (OMIM +180200).
  • the "miR 17-92 cluster” as used herein is a polycistronic cluster consisting of different miRNAs that are processed from a common precursor transcript.
  • the precursor transcript derived from the mir-17-92 gene contains six tandem stem-loop hairpin structures that ultimately yield six mature miRNAs: miR- 17, miR-18a, miR-19a, miR-20a, miR-19b-l, and miR-92-1 (18, 37, 38).
  • the six miRNAs encoded by mir- 17-92 can be categorized into three separate miRNA families according to their seed sequences: the miR-17 family (including miR-17, miR-20, and miR-18), the miR-19 family (miR-19a and miR-19b), and the miR-92 family (18). It is worth noting that miR-18 exhibits a significant sequence homology with miR-17 and
  • miR-20 despite one nucleotide difference within the seed regions.
  • Ancient gene duplications have given rise to two mir-17-92 cluster paralogs in mammals: mir-106a-363 and mir-106b-25, each of which only contains homologous miRNAs to a subset of mir-17-92 components (18, 37, 38), also referred to as paralogs or paralog clusters herein.
  • the sequences of the miRNAs (including seed regions) and organization of the different clusters can also be found in these references.
  • miRNAs are short (typically 20-24 nt) non-coding RNAs that are involved in post- transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding.
  • the primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products.
  • pre-miRNA stem-loop precursor miRNA
  • miRNA* miRNA and antisense miRNA star
  • the mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA.
  • RISC RNA-induced silencing complex
  • methods are provided for inducing cell death in a cell where p53 function is compromised. These methods involve the inhibition of the function of Dicer. Accordingly, it can be said that an inhibitor of Dicer function is provided for use in inducing cell death in a cell where p53 function is compromised.
  • the cell death that is induced is apoptotic cell death.
  • inhibiting the function of Dicer in a cell where p53 function is compromised will result in synthetic lethality. I.e., inhibiting Dicer function in cells wherein p53 function is not compromised will not kill the cells, but only when both p53 and Dicer function are compromised, the cells will die. As p53 function is most typically compromised in tumor cells, it is particularly envisaged that the method can be used to kill tumor cells. (In other words, inhibitors of Dicer function are provided for use in treatment of cancer). Moreover, the killing is selective, as cell death will not be induced in cells where p53 function is normal.
  • the cell(s) to be killed are characterized by impaired function of another tumor suppressor gene (in addition to compromised function of p53), and/or activation of one or more (proto-)oncogenes.
  • the compromised function or inhibition of the tumor suppressor gene may be through mutation of that gene (e.g. in the case of BRCA), or as a result of lower expression/stability of the gene product, or through genetic deletion.
  • the activation of one or more oncogenes (or conversion of proto-oncogenes in oncogenes) may occur through mutation, gene amplification/overexpression, or chromosomal rearrangements.
  • tumor suppressors that may also be impaired in the cells to be killed include, but are not limited to, b, APC, CD95, ST5, YPEL3, ST7, and ST14.
  • tumor suppressors may also include DNA repair proteins such as HNPCC, MEN1 and BRCA genes.
  • a non-limiting list of (proto-)oncogenes that may be activated or overexpressed in the cells to be killed includes: regulatory GTPases such as RAS; cytoplasmic Serine/threonine kinases or regulatory subunits thereof, such as Raf kinases (e.g.
  • cytoplasmic tyrosine kinases such as the Src-family, Syk-ZAP-70 family, and BTK family of tyrosine kinases, or fusion genes like Nup-Abl, Bcr-Abl
  • tumour suppressor inhibition ensures that only cells which truly undergo oncogene activation (i.e. tumour formation) are targeted for cell death.
  • the tumour or cancer to be treated is retinoblastoma.
  • inhibitors of Dicer function are provided for use in treatment of retinoblastoma.
  • the methods can be used in vitro, e.g. to induce cell death in a cell line, it is particularly envisaged that they are applied in vivo, by inhibiting Dicer function in a subject in need thereof. Most particularly, this will be done by administering an inhibitor of Dicer function to a subject in need thereof, but gene therapy is also envisaged.
  • the "subject" as used herein will be an animal, more particularly a mammal (e.g., cats, dogs, horses, cows, pigs, sheep, goats, llamas, monkeys, mice, rats, ...), most particularly a human.
  • a mammal e.g., cats, dogs, horses, cows, pigs, sheep, goats, llamas, monkeys, mice, rats, ...), most particularly a human.
  • Inhibiting Dicer function can be done in many ways. This can for instance be done by inhibiting functional expression of the Dicerl gene itself. With “functional expression” of the Dicerl gene, it is meant the transcription and/or translation of functional Dicerl gene product. “Inhibition of functional expression” can be achieved at three levels. First, at the DNA level, e.g. by removing or disrupting the Dicerl gene, or preventing transcription to take place (in both instances preventing synthesis of the Dicerl gene product). Second, at the RNA level, e.g. by preventing efficient translation to take place - this can be through destabilization of the mRNA so that it is degraded before translation occurs from the transcript, or by hybridizing to the Dicer mRNA. Third, at the protein level, e.g. by binding to the Dicer protein, inhibiting its function, and/or marking the protein for degradation.
  • a "knock-out" can be a gene knockdown or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer.
  • a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer.
  • Another way in which genes can be knocked out is by the use of zinc finger nucleases.
  • Zinc- finger nucleases are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain.
  • Zinc finger domains can be engineered to target desired DNA sequences, which enables zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms.
  • the knock-out of the Dicerl gene is limited to the tissue where the tumour is located, and most particularly, the knock-out is limited to the tumour itself, and Dicerl is not inhibited in the host subject.
  • the inhibition may also be temporary (or temporally regulated).
  • Temporally and tissue-specific gene inactivation may for instance also be achieved through the creation of transgenic organisms expressing antisense RNA, or by administering antisense RNA to the subject.
  • An antisense construct can be delivered, for example, as an expression plasmid, which, when transcribed in the cell, produces RNA that is complementary to at least a unique portion of the cellular Dicer mRNA.
  • a more rapid method for the inhibition of gene expression is based on the use of shorter antisense oligomers consisting of DNA, or other synthetic structural types such as phosphorothiates, 2'-0- alkylribonucleotide chimeras, locked nucleic acid (LNA) (see further in the application for a more detailed discussion of this technology), peptide nucleic acid (PNA), or morpholinos.
  • LNA locked nucleic acid
  • PNA peptide nucleic acid
  • morpholinos morpholinos.
  • an antisense oligomer refers to an antisense molecule or anti-gene agent that comprises an oligomer of at least about 10 nucleotides in length. In embodiments an antisense oligomer comprises at least 15, 18 20, 25, 30, 35, 40, or 50 nucleotides. Antisense approaches involve the design of oligonucleotides (either DNA or RNA, or derivatives thereof) that are complementary to an mRNA encoded by polynucleotide sequences of Dicerl.
  • Antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. This effect is therefore stoichiometric. Absolute complementarity, although preferred, is not required.
  • a sequence "complementary" to a portion of an RNA means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense polynucleotide sequences, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense polynucleotide sequence. Generally, the longer the hybridizing polynucleotide sequence, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. Oligomers that are complementary to the 5' end of the message, e.g., the 5' untranslated region (UTR) up to and including the AUG translation initiation codon, should work most efficiently at inhibiting translation.
  • UTR 5' untranslated region
  • oligomers complementary to either the 5', 3' UTRs, or non-coding regions of a Dicerl gene could be used in an antisense approach to inhibit translation of said endogenous m RNA encoded by Dicerl polynucleotides.
  • Oligomers complementary to the 5' UTR of said mRNA should include the complement of the AUG start codon.
  • Antisense oligomers complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention.
  • antisense oligomers should be at least 10 nucleotides in length, and are preferably oligomers ranging from 15 to about 50 nucleotides in length. In certain embodiments, the oligomer is at least 15 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, or at least 50 nucleotides in length.
  • a related method uses ribozymes instead of antisense RNA.
  • Ribozymes are catalytic RNA molecules with enzyme-like cleavage properties that can be designed to target specific RNA sequences. Successful target gene inactivation, including temporally and tissue-specific gene inactivation, using ribozymes has been reported in mouse, zebrafish and fruitflies.
  • RNA interference is a form of post-transcriptional gene silencing. The phenomenon of RNA interference was first observed and described in Caenorhabditis elegans where exogenous double-stranded RNA (dsRNA) was shown to specifically and potently disrupt the activity of genes containing homologous sequences through a mechanism that induces rapid degradation of the target RNA.
  • siRNAs small interfering RNAs
  • the siRNA typically comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson Crick base pairing interactions (hereinafter "base paired").
  • the sense strand comprises a nucleic acid sequence that is identical to a target sequence contained within the target mRNA.
  • the sense and antisense strands of the present siRNA can comprise two complementary, single stranded RNA molecules or can comprise a single molecule in which two complementary portions are base paired and are covalently linked by a single stranded "hairpin” area (often referred to as shRNA).
  • shRNA single stranded "hairpin” area
  • an siRNA naturally present in a living animal is not “isolated,” but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is “isolated .”
  • An isolated siRNA ca n exist in substantially purified form, or can exist in a non native environment such as, for example, a cell into which the siRNA has been delivered.
  • the siRNAs of the invention can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.
  • the siRNA of the invention can also comprise a 3' overhang.
  • a "3' overhang” refers to at least one unpaired nucleotide extending from the 3' end of an RNA strand.
  • the siRNA of the invention comprises at least one 3' overhang of from one to about six nucleotides (which includes ribonucleotides or deoxynucleotides) in length, preferably from one to about five nucleotides in length, more preferably from one to about four nucleotides in length, and particularly preferably from about one to about four nucleotides in length.
  • the length of the overhangs can be the same or different for each strand.
  • the 3' overhang is present on both strands of the siRNA, and is two nucleotides in length.
  • the 3' overhangs can also be stabil ized against degradation.
  • the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.
  • substitution of pyrimidine nucleotides by modified analogues e.g., substitution of uridine nucleotides in the 3' overhangs with 2' deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation.
  • the absence of a 2' hydroxyl in the 2' deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium.
  • the siRNAs of the invention can be targeted to any stretch of approximately 19 to 25 contiguous nucleotides in any of the target Dicerl mRNA sequences (the "target sequence"), of which examples are given in the application. Techniques for selecting target sequences for siRNA are well known in the art.
  • the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.
  • siRNAs of the invention can be obtained using a number of techniques known to those of skill in the art.
  • the siRNAs can be chemically synthesized or recombinantly produced using methods known in the art.
  • the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • the siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
  • Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA),
  • siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter.
  • suitable promoters for expressing siRNA of the invention from a plasmid include, for exam ple, the U6 or H I RNA pol I I I promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art.
  • the recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment.
  • the siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellular ⁇ , e.g. in breast tissue or in neurons.
  • the siRNAs of the invention can also be expressed intracellular ⁇ from recombinant viral vectors.
  • the recombinant viral vectors comprise sequences encoding the siRNAs of the invention and any suitable promoter for expressing the siRNA sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art.
  • the recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in the tissue where the tumour is localized.
  • an "effective amount" of the siRNA is an amount sufficient to cause RNAi mediated degradation of the target mRNA, or an amount sufficient to inhibit the progression of metastasis in a subject.
  • RNAi mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described above.
  • an effective amount of the siRNA of the invention to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of the disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of the siRNA of the invention comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered.
  • morpholino antisense oligonucleotides in zebrafish and frogs overcome the limitations of RNase H-competent antisense oligonucleotides, which include numerous non-specific effects due to the non target-specific cleavage of other mRNA molecules caused by the low stringency requirements of RNase H. Morpholino oligomers therefore represent an important new class of antisense molecule. Oligomers of the invention may be synthesized by standard methods known in the art. As examples, phosphorothioate oligomers may be synthesized by the method of Stein et al. (1988) Nucleic Acids Res.
  • methylphosphonate oligomers can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 7448-7451). Morpholino oligomers may be synthesized by the method of Summerton and Weller U.S. Patent Nos. 5,217,866 and 5,185,444.
  • the Dicer gene product inhibitor may also be an inhibitor of Dicer protein.
  • a typical example thereof is an anti-Dicer antibody.
  • the term 'antibody' or 'antibodies' relates to an antibody characterized as being specifically directed against Dicer or any functional derivative thereof, with said antibodies being preferably monoclonal antibodies; or an antigen-binding fragment thereof, of the F(ab') 2 , F(ab) or single chain Fv type, or any type of recombinant antibody derived thereof.
  • These antibodies of the invention including specific polyclonal antisera prepared against Dicer or any functional derivative thereof, have no cross- reactivity to other proteins.
  • the monoclonal antibodies of the invention can for instance be produced by any hybridoma liable to be formed according to classical methods from splenic cells of an animal, particularly of a mouse or rat immunized against Dicer or any functional derivative thereof, and of cells of a myeloma cell line, and to be selected by the ability of the hybridoma to produce the monoclonal antibodies recognizing Dicer or any functional derivative thereof which have been initially used for the im munization of the animals.
  • the monoclonal antibodies according to this em bodiment of the invention may be humanized versions of the mouse monoclonal antibodies made by m eans of recombinant DNA technology, departing from the mouse and/or human genomic DNA sequences coding for H and L chains or from cDNA clones coding for H and L chains.
  • the monoclonal antibodies according to this embodiment of the invention may be human monoclonal antibodies.
  • Such human monoclonal antibodies are prepared, for instance, by means of human peripheral blood lymphocytes (PBL) repopulation of severe combined immune deficiency (SCI D) mice as described in PCT/EP 99/03605 or by using transgenic non-human animals capable of producing human antibodies as described in US patent 5,545,806.
  • PBL peripheral blood lymphocytes
  • SCI D severe combined immune deficiency
  • fragments derived from these monoclonal antibodies such as Fab, F(ab)' 2 and scFv ("single chain variable fragment"), providing they have retained the original binding properties, form part of the present invention.
  • Such fragments are commonly generated by, for instance, enzymatic digestion of the antibodies with papain, pepsin, or other proteases.
  • monoclonal antibodies, or fragments thereof can be modified for various uses.
  • the antibodies involved in the invention can be labeled by an appropriate label of the enzymatic, fluorescent, or radioactive type.
  • said antibodies against Dicer or a functional fragment thereof are derived from camels.
  • Camel antibodies are fully described in W094/25591, WO94/04678 and in WO97/49805. Processes are described in the art which make it possible that antibodies can be used to hit intracellular targets. Since Dicer is an intracellular target, the antibodies or fragments thereof with a specificity for Dicer must be delivered into the cel ls. One such technology uses lipidation of the antibodies. The latter method is fully described in WO94/01131 and these methods are herein incorporated by reference. Another method is by fusing the antibody to cell-penetrating peptides (Chen and Harrison, Biochem Soc Trans. 2007). Antibodies binding to Dicer are commercially available, e.g. from Abeam, Santa Cruz biotechnology, Sigma-Aldrich and the like. If the tumour is located in the brain, the inhibitor should be able to pass the blood-brain barrier. Technologies of modifying antibodies to pass the blood-brain barrier are well known to the skilled person.
  • inhibitors of Dicer include, but are not limited to, peptide inhibitors of Dicer, peptide-aptamer (Tomai et al., J Biol Chem. 2006) inhibitors of Dicer, and protein interferors as described in WO2007/071789, incorporated herein by reference.
  • Small molecule inhibitors e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries.
  • Dicer function is inhibited downstream of Dicer, by inhibiting one or more miRNAs that are upregulated by Dicer in cells where p53 function is impaired.
  • miRNAs that fall under this category are the members of the polycistronic miR 17-92 cluster.
  • upregulation of these miRNAs means that they are present in p53 deficient cells, whereas they are not expressed in control cells (e.g. retinoblasts).
  • inhibition of these miRNAs can be done in tissues where they are not normally expressed, thereby reducing the risk of side effects.
  • Inhibition of one or more of the miRNAs upregulated by Dicer in cells where p53 is compromised can be done at the DNA or RNA level, as described for Dicer above. (Inhibition at the protein level is not feasible since miRNAs are non-protein coding RNAs). Particularly suited for inhibition of miRNAs are locked nucleic acids (LNAs) or antagomirs.
  • LNAs locked nucleic acids
  • a locked nucleic acid is a modified RNA nucleotide.
  • the ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form of DNA or RNA.
  • LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleotide whenever desired. Such oligomers are commercially available (e.g. from Exiqon).
  • the locked ribose conformation enhances base stacking and backbone pre-organization.
  • LNA incorporation generally improves mismatch discrimination compared to unmodified reference oligonucleotide, and LNA mediates high- affinity hybridization by using the Watson-Crick rules without compromising base pairing selectivity.
  • LNA oligonucleotides are readily transfected into cells using standard techniques: they are sequence- specific and non-toxic, and show improved nuclease resistance, which make them highly useful for powerful and selective antisense-based silencing. Hence, LNA oligonucleotides are uniquely suited for mimicking RNA structures and for miRNA targeting both in vivo and in vitro. Such LNA-based RNA antagonists have unusually high potency, biostability, and duration of action. See Nature Methods - 4, (2007) for more background on miRNA knockdown using LNA probes. Antagomirs are another example of chemically engineered oligonucleotides that can be used to silence endogenous microRNA.
  • An antagomir is a small synthetic RNA that is perfectly complementary to the specific miRNA target with either mispairing at the cleavage site of Ago2 or some sort of base modification to inhibit Ago2 cleavage. Usually, antagomirs have some sort of modification to make it more resistant to degradation. It is unclear how antagomirization (the process by which an antagomir inhibits miRNA activity) operates, but it is believed to inhibit by irreversibly binding the m iRNA. Antagomirs are now used as a method to constitutively inhibit the activity of specific miRNAs (39). One clear advantage with respect to siRNA technology is that antagomirs did not induce an immune response.
  • inhibition of Dicer function means inhibition of one or more of the following miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-l, and miR-92-1.
  • miRNAs miR-17, miR-18a, miR-19a, miR-20a, miR-19b-l, and miR-92-1.
  • inhibition of one of these miRNAs in cells in which p53 function is impaired already results in killing of these cells, it is envisaged that more than one of these miRNAs is inhibited, e.g. all members of the same miRNA family (see above), or also members of a paralog gene cluster, other family members of this gene cluster, and so on, may be inhibited as well.
  • Inhibitors of these miRNAs may be used in treatment of cancer, particularly in retinoblastoma.
  • Dicer function (and miRNA control) is important, inhibition of Dicer function is particularly envisaged to be temporally and/or spatially regulated, rather than just systemic inhibition. According to particular embodiments, inhibition will not be done during prenatal development. According to further particular embodiments, inhibition of Dicer function will be restricted in time: after the cells in which p53 function is compromised have died, Dicer function will no longer be inhibited.
  • inhibition of Dicer function will only be done in the tissue where cells with compromised p53 function are located (in practice: the tumour itself or the tissue where a tumour is located).
  • a non-limiting example hereof is in the case of retinoblastoma, where inhibitors of Dicer function can be administered directly into the eye.
  • a further benefit hereof is that th is direct adm inistration approach facil itates in hibition at the NA level - indeed, i n the case of systemic inhibition, stability of RNA inhibitors is often an issue, but if time and location of inhibition can be restricted, this allows more efficient inhibition.
  • p53 fu nction As m entio ned, the m ethods provided herei n i nd uce cel l death in cel l s wherein p53 fu nction is compromised.
  • the way in which p53 function is compromised is in fact not essential to the invention. In many tumours, for instance, p53 function is compromised as a result of one or more mutations. However, it is particularly envisaged herein that p53 function may also be compromised by functional dysregulation that is not the result of m utation in p53. "Functiona l dysregulation" as used herein typically means that p53 function is impaired as the result of downregulation of levels of functionally active p53 protein.
  • p53 function is compromised in retinoblastoma as a result of amplification of the M DMX gene, and not due to mutations in p53 itself (13).
  • Example 1 Dicerl is a synthetic lethal partner of p53
  • conditional inactivation of p53 on this sensitized background (ChxlOCre; Rb lox/lox ; plOJ 1' ; p53 lox/lox , referred to as the TKO m ice) leads to rapid formation of visible retinoblastoma in virtually al l m ice analyzed (122 out of 129). On average it takes 100 days for these mice to develop visible tumours ( Figure 1A). Moreover, while DKO mice only ever develop unilateral tumours more than 80% of TKO mice (97 out of 122) develop bilateral retinoblastoma with clear evidence of anterior chamber invasion.
  • GFP green fluorescent protein
  • AP alkaline phosphatase
  • Dicer is dispensable for the expansion, cell fate specification and differentiation of retinal progenitor cells since GFP-positive cells were identified in the I N L of ChxlOCre; Dicerl lox/lox retinae; moreover, these retinae were indistinguishable from those of wild-type littermates (Figure 4). Consistent with a previous study (16) focal and progressive retinal degeneration was observed in a few older mice suggesting that Dicer might be required for the survival of some terminally differentiated neuronal cell populations. However, the penetrance of this phenotype was extremely low (1 out of 11 mice examined).
  • GFP-positive cells could also be identified in retinae of ChxlOCre; Rb lox/lox ; plOT' ' ; Dicerl lox/lox ( Figure 2A) indicating that Dicer deficiency does not compromise the viability of the retinal progenitors on either wild-type or b/pl07-deficient backgrounds.
  • Dicer-deficient cells in ChxlOCre; Dicerl lox/lox and ChxlOCre; Rb lox/lox ; plOJ 1' ; Dicerl lox/lox retinae we determined mature miRNAs expression levels in FACS- sorted GFP-positive cells from three retinae of each genotype. Consistent with the loss of Dicer function we observed a dramatic global shut-down/down-regulation in steady-state miRNA levels in all samples analyzed compared to the levels in ChxlOCre; Dicerl +/+ and ChxlOCre; Rb lox/lox ; plOJ 1' ; Dicerl +/+ retinae (data not shown). This analysis supports the presence of Dicer-deficient cells in these retinae.
  • PCR-based genotyping confirmed Cre-mediated recombination of the conditional Dicerl allele in ChxlOCre; Rb'° x/lox ; plOT' ' Dicerl'° x/lox but not in QKO adult retinae (P20) (Figure 2C). Consistent with the mosaicism exhibited in the ChxlOCre transgenic line the non- recombined Dicerl allele remained detectable in all Dicerl lox/lox samples analyzed.
  • the miR17-92 cluster is also expressed at very high levels in the human retinoblastoma cell lines Rbl5, WERI-Rbl and Y-79 in which both the Rb and p53 tumour suppressor pathways are inactivated and/or compromised (12).
  • Data for miR-17 are shown in figure 3B.
  • each miRNA of the cluster was inhibited by transient transfection of miRNA-inhibitors. Inhibition of all individual miRNAs induced a significant decrease in cell viability as measured by MTT ( Figure 3C) and caspase-glow (data not shown) assays. The apoptotic effects of miR17-92 knockdown were evident in the two cell lines tested, Y79 and WERI-RB1 ( Figure 3C and data not shown).
  • Dicer inactivation-induced tumour suppression results lead us to propose the following working model for the role of Dicer inactivation- induced tumour suppression (Figure 3D).
  • inactivation of members of the miR-17-92 cluster is sufficient to kill human retinoblastoma cells and, im portantly, we show that it does so in a selective manner. Indeed, inactivation of Dicer, and consequently processing of the pre-miRs, in normal retinoblasts does not affect their survival and function.
  • the miR-17-92 cluster is in fact not normally expressed in these cells.
  • Therapeutic silencing of another pro-oncogenic miR, miRlOb was recently shown to successfully suppress metastasis in a mouse mammary tumour model (23). Our results call for the development and optimization of miR17-92 inhibitors for the treatment of Retinoblastoma patients.
  • Retinoblastomas could be simply treated by sub-conjuctival injection of the miRNA-inhibitory molecules.
  • Dissected retinae were fixed for lh in 4% paraformaldehyde/PBS on ice, heated to 65°C for 30min and embedded in 4% agarose/PBS. 40 ⁇ sections were rinsed once in AP detection buffer (lOOmM Tris pH9.5, 50mM MgCI 2 , 100 mM NaCI) before developing in Nitro blue tetrazolium chloride/5-Bromo-4- chloro-3-indolyl phosphate (NBT/BCIP Ready-to-use tablets, Roche) for 4h.
  • AP detection buffer lOOmM Tris pH9.5, 50mM MgCI 2 , 100 mM NaCI
  • DNA was isolated from dissected retinae and isolated tumours using DNeasy Blood&Tissue Kit (Qjagen). Dicerl reco m b i n at io n wa s a n a l yzed by PC R u s i ng t h e fo l l owi ng p ri m e rs : a 5'- ATTGTTACCAGCGCTTAGAATTCC; c 5'-TCGGAAT AGGAACTTCGTTTAAAC and the reverse b primer 5'- GGGAGGTGTACGTCTA CAATT.
  • P53 recombination was analyzed by PCR using the following primers: d 5'-CACAAAAACAGGTTAAACCCAG and the reverse primers f 5'-AGCACATAGGAGGCAGAGAC and e 5'- GAAGACAGAAAAGGGGAGGG.
  • PCR conditions were as fol low: lx precycle at 94°C for 3m in a nd 30cycles of 94°C, 30sec; 60°C, 30sec; 72°C, 45sec.
  • tumour samples were removed from the mouse eyes under the binocular using forceps. The specimens were placed on ice and immediately processed for RNA or DNA isolation. Before tumour samples were collected from human
  • retinoblastoma samples serial cryosections where obtained from all tumours. The first and last cryosection of each series were H&E stained for tumour cell content verification. 3-5mm 3 samples were placed on ice and immediately processed for RNA and DNA isolation. Total RNA and genomic DNA were isolated using the miRNeasy kit (Qjagen) and the QJAmp mini kit (Qjagen), respectively, according to manufacturer's instructions. Written informed consent was obtained from patients and/or their parents. All procedures have been approved by the institutional review board of the Children's University Hospital of Essen. microRNA Expression analyses
  • miRNA expression profiling was performed as described previously (24). For murine samples, 60 ng of total RNA was reverse transcribed using the murine stem-loop megaplex pool A and B followed by limited cycle pre-amplification (Applied Biosystems). Expression of 430 human and 509 murine miRNAs was profiled using Taqman miRNA assays on a 7900HT detection system (Applied Biosystems). Data were normalized using the global mean (25). miRNA expression data are available as RDML-files upon request (26). Differentially expressed miRNAs were identified using the Mann- Whitney test followed by multiple testing correction according to the Benjamini-Hochberg algorithm. Hierarchical clustering was performed using method Ward and distance Manhattan. All statistical analyses were performed using R Bioconductor software.
  • Samples were profiled on a custom designed 44K/60K array (Agilent Technologies) enriched for miRNA and T-UCR regions and regions around cancer gene census genes. Utilizing random prime labelling (BioPrime ArrayCGH Genomic Labeling System, Invitrogen), 150 ng of test and control DNA (DNA from an EBV cell line if cell lines were tested or male control DNA, Promega if tumour samples were tested) was labeled with Cy3 and Cy5 dyes (GE healthcare). Slides were scanned using an Agilent scanner (Agilent Technologies) an in-house developed visual isation software program arrayCG H base (http://medgen.ugent.be/arrayCGHbase) (27). Array CGH profiles were evaluated by using the circulary binary segmentation (CBS) algorithm.
  • CBS circulary binary segmentation
  • Retinoblastoma cell lines Weri and Y79 were authenticated by DNA fingerprinting (DMSZ, Braunschweig, Germany). Cells were cultured in suspension in Dulbecco's Modified Eagles's Medium (DMEM) (Invitrogen), containing 15% FCS, Penicillin/Streptomycin, 4mM L-G l utam in, 50 ⁇ ⁇ - Mercaptoethanol and 0.1% Insulin (all from Invitrogen).
  • DMEM Dulbecco's Modified Eagles's Medium
  • lxlO 4 Weri and Y79 cells / well were seeded on 24-well plates and transfected with specific antagomirs or scrambled Cy3-labelled control oligos (all from Ambion) at a final concentration of ⁇ using NeoFx transfection agent (Ambion) according to the manufacturers recommendations.
  • antisense inhibitors were designed against all members of the miR-17/92 cluster using the locked nucleic acid (LNA) technology. The inhibitors were synthesized as fully phosphorothiolated DNA/LNA mixmers and purified by preparative H PLC before use. The number and position of LNA nucleotides was chosen in each case in order to maximize affinity and selectivity towards the specific miRNA target.
  • MTT assays were performed as previously described (28). Briefly, after the addition of 200 ⁇ MTT solution (6 mg/mL in PBS, Roche, Germany), cells were incubated for lh and then solubilized by the addition of 1 mL stop solution (10% SDS, 5% acetic acid in dimethyl sulfoxide). Absorbance at 570 nm was measured using a GloMax ® -Multi Microplate Multimode Reader (Promega).
  • arrayCGHbase an analysis platform for comparative genomic hybridization microarrays. BMC Bioinformatics 6, 124 (2005).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne le domaine du cancer, en particulier des cancers dans lesquels la fonction de suppression de la tumeur p53 est perdue ou déficiente. Il est montré ici que Dicer est un partenaire létal synthétique de p53, permettant le ciblage sélectif et l'élimination sélective de cellules cancéreuses. Les effets de Dicer sur la survie des cellules cancéreuses sont médiés par le groupe miR17-92 et l'inhibition des éléments de ce groupe de miARN est une stratégie de traitement prometteuse pour le cancer. Plus particulièrement, ces découvertes ont une importance dans le domaine du rétinoblastome.
PCT/EP2011/063233 2010-07-30 2011-08-01 Inhibition de la fonction dicer pour le traitement du cancer WO2012013821A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1012845.2 2010-07-30
GBGB1012845.2A GB201012845D0 (en) 2010-07-30 2010-07-30 Inhibition of dicer function for treatment of cancer

Publications (1)

Publication Number Publication Date
WO2012013821A1 true WO2012013821A1 (fr) 2012-02-02

Family

ID=42799372

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/063233 WO2012013821A1 (fr) 2010-07-30 2011-08-01 Inhibition de la fonction dicer pour le traitement du cancer

Country Status (2)

Country Link
GB (1) GB201012845D0 (fr)
WO (1) WO2012013821A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013167744A1 (fr) * 2012-05-10 2013-11-14 Ifom Fondazione Istituto Firc Di Oncologia Molecolare Produits d'arn et leurs utilisations
WO2015025940A1 (fr) * 2013-08-23 2015-02-26 国立大学法人大阪大学 Nouvel adénovirus et procédé pour favoriser la croissance de celui-ci
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
CN106676196A (zh) * 2017-03-10 2017-05-17 南京九寿堂医药科技有限公司 一种用于诊断重度吸烟人群中肺鳞癌患者的非侵入性标记物及试剂盒
US10450575B2 (en) * 2013-08-08 2019-10-22 Danisco Us Inc Increasing the expression of a transgene in eukaryotic cells by reducing RNA interference

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5217866A (en) 1985-03-15 1993-06-08 Anti-Gene Development Group Polynucleotide assay reagent and method
WO1994001131A1 (fr) 1992-07-13 1994-01-20 Eukarion, Inc. Apport transvasculaire et intracellulaire de proteines lipidisees
WO1994004678A1 (fr) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulines exemptes de chaines legeres
WO1994025591A1 (fr) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION D'ANTICORPS OU DE FRAGMENTS FONCTIONNALISES D'ANTICORPS, DERIVES DES IMMUNOGLOBULINES A CHAINE LOURDE DE $i(CAMELIDAE)
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
WO1997049805A2 (fr) 1996-06-27 1997-12-31 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Molecules de reconnaissance ayant une interaction specifique avec le site actif ou la fissure d'une molecule cible
WO2007071789A1 (fr) 2005-12-22 2007-06-28 Vib Vzw Moyens et méthodes d'induction d’une interférence protéinique
WO2009102225A2 (fr) * 2008-02-14 2009-08-20 Instytut Chemii Bioorganicznej Pan Procédé pour inhiber la ribonucléase dicer, inhibiteur de la ribonucléase dicer et utilisation d’aptamères d’arn en tant qu’inhibiteurs de la ribonucléase dicer

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5217866A (en) 1985-03-15 1993-06-08 Anti-Gene Development Group Polynucleotide assay reagent and method
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
WO1994001131A1 (fr) 1992-07-13 1994-01-20 Eukarion, Inc. Apport transvasculaire et intracellulaire de proteines lipidisees
WO1994004678A1 (fr) 1992-08-21 1994-03-03 Casterman Cecile Immunoglobulines exemptes de chaines legeres
WO1994025591A1 (fr) 1993-04-29 1994-11-10 Unilever N.V. PRODUCTION D'ANTICORPS OU DE FRAGMENTS FONCTIONNALISES D'ANTICORPS, DERIVES DES IMMUNOGLOBULINES A CHAINE LOURDE DE $i(CAMELIDAE)
WO1997049805A2 (fr) 1996-06-27 1997-12-31 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Molecules de reconnaissance ayant une interaction specifique avec le site actif ou la fissure d'une molecule cible
WO2007071789A1 (fr) 2005-12-22 2007-06-28 Vib Vzw Moyens et méthodes d'induction d’une interférence protéinique
WO2009102225A2 (fr) * 2008-02-14 2009-08-20 Instytut Chemii Bioorganicznej Pan Procédé pour inhiber la ribonucléase dicer, inhibiteur de la ribonucléase dicer et utilisation d’aptamères d’arn en tant qu’inhibiteurs de la ribonucléase dicer

Non-Patent Citations (53)

* Cited by examiner, † Cited by third party
Title
AGUDA, B.D., KIM, Y., PIPER-HUNTER, M.G., FRIEDMAN, A., MARSH, C.B.: "MicroRNA regulation of a cancer network: consequences of the feedback loops involving miR-17-92, E2F, and Myc", PROC NATL ACAD SCI U S A, vol. 105, no. 50, 2008, pages 19678 - 19683
ARRATE, M.P. ET AL.: "MicroRNA Biogenesis Is Required for Myc-Induced B-Cell Lymphoma Development and Survival", CANCER RES.
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1999, JOHN WILEY & SONS
BARTEL B: "MicroRNAs directing siRNA biogenesis", NAT STRUCT MOL BIOL, vol. 12, no. 7, 2005, pages 569 - 71, XP002416567, DOI: doi:10.1038/nsmb0705-569
BURKHART DL ET AL.: "Cellular mechanisms of tumour suppression by the retinoblastoma gene", NAT REV CANCER, vol. 8, no. 9, 2008, pages 671 - 82
CHEN, HARRISON, BIOCHEM SOC TRANS., 2007
CROCE, C.M.: "Causes and consequences of microRNA dysregulation in cancer", NAT REV GENET, vol. 10, no. 10, 2009, pages 704 - 714, XP055032479, DOI: doi:10.1038/nrg2634
DAMIANI, D. ET AL.: "Dicer inactivation leads to progressive functional and structural degeneration of the mouse retina", J NEUROSCI, vol. 28, no. 19, 2008, pages 4878 - 4887
DONOVAN, S.L., DYER, M.A.: "Developmental defects in Rb-deficient retinae", VISION RES, vol. 44, no. 28, 2004, pages 3323 - 3333, XP004632790, DOI: doi:10.1016/j.visres.2004.08.007
DONOVAN, S.L., SCHWEERS, B., MARTINS, R., JOHNSON, D., DYER, M.A.: "Compensation by tumour suppressor genes during retinal development in mice and humans", BMC BIOL, vol. 4, 2006, pages 14, XP021019019, DOI: doi:10.1186/1741-7007-4-14
ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498
FARMER H ET AL.: "Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy", NATURE, vol. 434, 2005, pages 917 - 921, XP002516395, DOI: doi:10.1038/nature03445
FONG PC ET AL.: "Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers", N ENGL J MED, vol. 361, 2009, pages 123 - 134, XP003030947, DOI: doi:10.1056/NEJMoa0900212
HILL, D.A. ET AL.: "DICER1 mutations in familial pleuropulmonary blastoma", SCIENCE, vol. 325, no. 5943, 2009, pages 965, XP002577340
KAELIN WG JR.: "The concept of synthetic lethality in the context of anticancer therapy", NAT REV CANCER, vol. 5, no. 9, 2005, pages 689 - 98, XP055204234, DOI: doi:10.1038/nrc1691
KARUBE, Y. ET AL.: "Reduced expression of Dicer associated with poor prognosis in lung cancer patients", CANCER SCI, vol. 96, no. 2, 2005, pages 111 - 115, XP002491291, DOI: doi:10.1111/j.1349-7006.2005.00015.x
KRÜTZFELDT J ET AL.: "Silencing of microRNAs in vivo with 'antagomirs", NATURE, vol. 438, no. 7068, 1 December 2004 (2004-12-01), pages 685 - 9
KUMAR, M.S. ET AL.: "Dicerl functions as a haploinsufficient tumour suppressor", GENES DEV, 2009
KUMAR, M.S., LU, J., MERCER, K.L., GOLUB, T.R., JACKS, T.: "Impaired microRNA processing enhances cellular transformation and tumourigenesis", NAT GENET, vol. 39, no. 5, 2007, pages 673 - 677, XP002525879, DOI: doi:10.1038/NG2003
LAMBERTZ I. ET AL.: "Monoallelic but not biallelic loss of Dicer1 promotes tumorigenesis in vivo", CELL DEATH AND DIFFERENTIATION, vol. 17, no. 4, 1 April 2010 (2010-04-01), pages 633 - 641, XP055008885, ISSN: 1350-9047, DOI: 10.1038/cdd.2009.202 *
LAMBERTZ, I. ET AL.: "Monoallelic but not biallelic loss of Dicerl promotes tumourigenesis in vivo", CELL DEATH DIFFER, vol. 17, no. 4, pages 633 - 641
LAURIE, N.A. ET AL.: "Inactivation of the p53 pathway in retinoblastoma", NATURE, vol. 444, no. 7115, 2006, pages 61 - 66
LEFEVER, S. ET AL.: "RDML: structured language and reporting guidelines for real-time quantitative PCR data", NUCLEIC ACIDS RES, vol. 37, no. 7, 2009, pages 2065 - 2069
LEVINE, A.J.: "p53, the cellular gatekeeper for growth and division", CELL, vol. 88, no. 3, 1997, pages 323 - 331, XP000783627, DOI: doi:10.1016/S0092-8674(00)81871-1
MA, L. ET AL.: "Therapeutic silencing of miR-10b inhibits metastasis in a mouse mammary tumour model", NAT BIOTECHNOL, vol. 28, no. 4, pages 341 - 347
MARINE, J.C.: "Journal club. A cancer geneticist looks at the link between small RNA molecules and cancer", NATURE, vol. 464, no. 7293, pages 1249
MARKOWITZ, J CLIN ONCOL., vol. 18, no. 21, 2000, pages 75S - 80S
MELO, S.A. ET AL.: "A TARBP2 mutation in human cancer impairs microRNA processing and DICER1 function", NAT GENET, vol. 41, no. 3, 2009, pages 365 - 370
MENTEN, B. ET AL.: "arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays", BMC BIOINFORMATICS, vol. 6, 2005, pages 124, XP021000715, DOI: doi:10.1186/1471-2105-6-124
MESTDAGH, P. ET AL.: "A novel and universal method for microRNA RT-qPCR data normalization", GENOME BIOL, vol. 10, no. 6, 2009, pages R64, XP021061426, DOI: doi:10.1186/gb-2009-10-6-r64
MESTDAGH, P. ET AL.: "High-throughput stem-loop RT-qPCR miRNA expression profiling using minute amounts of input RNA", NUCLEIC ACIDS RES, vol. 36, no. 21, 2008, pages E143
MOSMANN, T.: "Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays", J IMMUNOL METHODS, vol. 65, no. 1-2, 1983, pages 55 - 63, XP023973702, DOI: doi:10.1016/0022-1759(83)90303-4
NATURE METHODS, vol. 4, 2007
NEVINS JR: "The Rb/E2F pathway and cancer", HUM MOL GENET, vol. 10, no. 7, 2001, pages 699 - 703
NITTNER D. ET AL.: "Dicer1 is a synthetic lethal partner of tumour suppressor p53", EJC SUPPLEMENTS, vol. 8, no. 5, June 2010 (2010-06-01), & 21ST MEETING OF THE EUROPEAN-ASSOCIATION-FOR-CANCER-RESEARCH; OSLO, NORWAY; JUNE 26 -29, 2010, pages 98, XP002661054, ISSN: 1359-6349 *
OLIVE, V., JIANG, I., HE, L.: "mir-17-92, a cluster of miRNAs in the midst of the cancer network", INTJ BIOCHEM CELL BIOL.
PAMPALAKIS, G., DIAMANDIS, E.P., KATSAROS, D., SOTIROPOULOU, G.: "Down-regulation of dicer expression in ovarian cancer tissues", CLIN BIOCHEM, 2009
ROWAN, S., CEPKO, C.L.: "Genetic analysis of the homeodomain transcription factor ChxlO in the retina using a novel multifunctional BAC transgenic mouse reporter", DEV BIOL, vol. 271, no. 2, 2004, pages 388 - 402
RYAN BM ET AL.: "Genetic variation in microRNA networks: the implications for cancer research", NAT REV CANCER, vol. 10, no. 6, 2010, pages 389 - 402
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS
SARIN ET AL., PROC. NATL. ACAD. SCI. USA., vol. 85, 1988, pages 7448 - 7451
SHIELDS, C.L., SHIELDS, J.A.: "Basic understanding of current classification and management of retinoblastoma", CURR OPIN OPHTHALMOL, vol. 17, no. 3, 2006, pages 228 - 234
STEIN ET AL., NUCLEIC ACIDS RES., vol. 16, 1988, pages 3209 - 3021
TANZER A ET AL.: "Molecular evolution of a microRNA cluster", J MOL BIOL, vol. 339, 2004, pages 327 - 35, XP004506520, DOI: doi:10.1016/j.jmb.2004.03.065
TOMAI ET AL., J BIOL CHEM., 2006
VAN HAAFTEN, G., AGAMI, R.: "Tumourigenicity of the miR-17-92 cluster distilled", GENES DEV, vol. 24, no. 1, pages 1 - 4
VENTURA A ET AL.: "Targeted Deletion Reveals Essential and Overlapping Functions of the miR-17-92 Family of miRNA Clusters", CELL, vol. 132, 2008, pages 875 - 886
WAGNER, R., NATURE, vol. 372, 1994, pages 333 - 335
YAN LI ET AL: "Supporting Information: Targeted deletion of Dicer disrupts lens morphogenesis, corneal epithelium stratification, and whole eye development", vol. 238, no. 9, September 2009 (2009-09-01), XP002661055, Retrieved from the Internet <URL:http://onlinelibrary.wiley.com/doi/10.1002/dvdy.22056/suppinfo> [retrieved on 20111006] *
YAN LI ET AL: "Targeted deletion of Dicer disrupts lens morphogenesis, corneal epithelium stratification, and whole eye development", DEVELOPMENTAL DYNAMICS, vol. 238, no. 9, 1 September 2009 (2009-09-01), pages 2388 - 2400, XP055008881, ISSN: 1058-8388, DOI: 10.1002/dvdy.22056 *
YAN, H.L. ET AL.: "Repression of the miR-17-92 cluster by p53 has an important function in hypoxia-induced apoptosis", EMBOJ, vol. 28, no. 18, 2009, pages 2719 - 2732
ZHANG, J. ET AL.: "Rb regulates proliferation and rod photoreceptor development in the mouse retina", NAT GENET, vol. 36, no. 4, 2004, pages 351 - 360, XP003008082, DOI: doi:10.1038/ng1318
ZHANG, J., SCHWEERS, B., DYER, M.A.: "The first knockout mouse model of retinoblastoma", CELL CYCLE, vol. 3, no. 7, 2004, pages 952 - 959

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013167744A1 (fr) * 2012-05-10 2013-11-14 Ifom Fondazione Istituto Firc Di Oncologia Molecolare Produits d'arn et leurs utilisations
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
US9708606B2 (en) 2012-05-10 2017-07-18 IFOM Fondazione Istituto FIRC di Oncologie Molecolare RNA products and uses thereof
US10240154B2 (en) 2012-05-10 2019-03-26 Ifom Fondazione Istituto Firc Di Oncologia Molecolare RNA products and uses thereof
US10450575B2 (en) * 2013-08-08 2019-10-22 Danisco Us Inc Increasing the expression of a transgene in eukaryotic cells by reducing RNA interference
WO2015025940A1 (fr) * 2013-08-23 2015-02-26 国立大学法人大阪大学 Nouvel adénovirus et procédé pour favoriser la croissance de celui-ci
JPWO2015025940A1 (ja) * 2013-08-23 2017-03-02 国立大学法人大阪大学 新規アデノウイルス及びその増殖促進方法
CN106676196A (zh) * 2017-03-10 2017-05-17 南京九寿堂医药科技有限公司 一种用于诊断重度吸烟人群中肺鳞癌患者的非侵入性标记物及试剂盒

Also Published As

Publication number Publication date
GB201012845D0 (en) 2010-09-15

Similar Documents

Publication Publication Date Title
Lizarbe et al. Colorectal cancer: from the genetic model to posttranscriptional regulation by noncoding RNAs
ES2419129T3 (es) Expresión de miARN en microvesículas de sangre periférica humana y usos del mismo
Garofalo et al. microRNAs: Master regulators as potential therapeutics in cancer
ES2420973T3 (es) Micro-ARN asociado a exosoma como marcador de diagnóstico
Mueller et al. miRNA expression profiling in melanocytes and melanoma cell lines reveals miRNAs associated with formation and progression of malignant melanoma
US20180208997A1 (en) METHODS, COMPOSITIONS, AND DEVICES UTILIZING MicroRNA TO DETERMINE PHYSIOLOGICAL CONDITIONS
Wouters et al. MicroRNAs, the DNA damage response and cancer
US20140171484A1 (en) Tissue-specific micrornas and compositions and uses thereof
AU2008256886B2 (en) Micro-RNA scaffolds and non-naturally occurring micro-RNAs
US8768630B2 (en) miRNA target prediction
EP2208499A1 (fr) Acide nucléique capable de réguler la prolifération d&#39;une cellule
US20110107440A1 (en) Skin cancer associated micrornas
US20100202973A1 (en) Microrna molecules associated with inflammatory skin disorders
Wahid et al. MicroRNA and diseases: therapeutic potential as new generation of drugs
US20100286044A1 (en) Detection of tissue origin of cancer
Sandhu et al. Micro-RNA expression and function in lymphomas
US9200275B2 (en) Methods and compositions for regulating cell cycle progression
WO2011069100A2 (fr) Microarn et utilisation de celui-ci dans l&#39;identification de malignités à lymphocytes b
Leonardi et al. microRNAs and thyroid cancer: Biological and clinical significance
WO2011094335A2 (fr) Signatures de microarn prédictives de la réponse à une thérapie anti-her2
Aghanoori et al. MiRNA molecular profiles in human medical conditions: connecting lung cancer and lung development phenomena
WO2012013821A1 (fr) Inhibition de la fonction dicer pour le traitement du cancer
Öner Two different mechanisms of two different non-coding RNAs—MicroRNAs and PIWI-interacting RNAs: From origin to cancer
Prajzlerová et al. Is there a potential of circulating miRNAs as biomarkers in rheumatic diseases?
Iorio et al. Current and future developments in cancer therapy research: miRNAs as new promising targets or tools

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11738722

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11738722

Country of ref document: EP

Kind code of ref document: A1