WO2012012708A1 - Induced pluripotent stem cells - Google Patents

Induced pluripotent stem cells Download PDF

Info

Publication number
WO2012012708A1
WO2012012708A1 PCT/US2011/044995 US2011044995W WO2012012708A1 WO 2012012708 A1 WO2012012708 A1 WO 2012012708A1 US 2011044995 W US2011044995 W US 2011044995W WO 2012012708 A1 WO2012012708 A1 WO 2012012708A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
oct4
ipscs
mefs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/044995
Other languages
French (fr)
Inventor
Nobuaki Kikyo
Hiroyuki Hirai
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Minnesota Twin Cities
University of Minnesota System
Original Assignee
University of Minnesota Twin Cities
University of Minnesota System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Minnesota Twin Cities, University of Minnesota System filed Critical University of Minnesota Twin Cities
Priority to US13/811,572 priority Critical patent/US9580689B2/en
Publication of WO2012012708A1 publication Critical patent/WO2012012708A1/en
Anticipated expiration legal-status Critical
Priority to US15/403,653 priority patent/US20170267978A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0696Artificially induced pluripotent stem cells, e.g. iPS
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/12Animals modified by administration of exogenous cells
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/602Sox-2
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/603Oct-3/4
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/604Klf-4
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/60Transcription factors
    • C12N2501/606Transcription factors c-Myc
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1307Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector

Definitions

  • Nuclear reprogramming the process of converting one cell type into another by resetting the pattern of gene expression, can be achieved through forced expression of defined transcription factors.
  • iPSCs induced pluripotent stem cells
  • iPSCs induced pluripotent stem cells
  • OSKM c-Myc
  • iPSCs are a type of pluripotent stem cell artificially derived by reprogramming a somatic cell.
  • iPSCs are morphologically similar to embryonic stem cells and are capable of differentiating into a variety of different somatic cell types. This technology allows researchers to obtain pluripotent stem cells for use in a research setting. iPSCs also have therapeutic uses for the treatment of disease without the need for stem cells derived from an embryonic source.
  • transduced cells generally less than 1% are reprogrammed to form iPSCs, and the entire process of establishing iPSC clones is long (over a month).
  • Described herein is a novel approach to nuclear reprogramming using a fusion protein
  • TAD transcription activation domain
  • Oct4 such a fusion protein is designated herein as M 3 0
  • the pluripotency of iPSCs was confirmed by genome- wide gene expression analysis, teratoma formation, and chimera formation, including germline transmission.
  • Transduction of M 3 0 and SKM increased chromatin accessibility at the Oct4 promoter, facilitated recruitment of the Oct4- binding Paf 1 complex, and remodeled many histone modifications at pluripotency genes to an embryonic stem cell (ESC)-like state more efficiently than transduction of OSKM.
  • ESC embryonic stem cell
  • One embodiment provides iPSCs derived by nuclear reprogramming of a somatic cell with a fusion protein.
  • the somatic cell can be a mammalian cell, for example a mouse cell or a human cell.
  • One embodiment provides a fusion protein for induction of pluripotent stem cells.
  • Another embodiment provides such a pluripotent stem cell, wherein the reprogramming comprises contacting the somatic cell with a fusion protein or DNA encoding the fusion protein.
  • the disclosed methods and fusion proteins can be used to conveniently and reproducibly establish iPSCs having pluripotency and growth ability similar to that of ES cells (ESCs).
  • ESCs ES cells
  • One embodiment provides a method for preparing an induced pluripotent stem cell by nuclear reprogramming of a somatic cell, which comprises introducing a nucleic acid sequence, by methods available to one of skill in the art, coding for a fusion protein of an unrelated/heterologous transactivation domain and a transcription factor into the somatic cell.
  • One embodiment provides an induced pluripotent stem cell obtained by such a method.
  • the fusion protein can be the fusion of an unrelated/heterologous transactivation domain and a transcription factor (e.g., the TAD is not normally associated with the transcription factor), such as the transactivation domain of MyoD (sequence information for MyoD is provided, for example, at NM_002478.4; NM_010866.2; NP_002469.2; NP_034996.2) or VP16 fused with Oct4 (full length or a bioactive fragment thereof; octamer-binding transcription factor 4 also known as POU5F1 (POU domain, class 5, transcription factor 1); sequence includes, for example, NM_002701; NM_013633.2; NP_002692; NP .038661.2; NM_001009178; NP_001009178; NM_131112; NP_571187).
  • Additional trans-activating domains can include, for example, but are not limited to, those found in p53,
  • Additional factors to be introduced into the cell, and/or used to generate a fusion protein with a transactivation domain can include, but is not limited to, a gene from the Sox family (e.g., SOX genes encode a family of transcription factors that bind to the minor groove in DNA, and belong to a super-family of genes characterized by a homologous sequence called the HMG (high mobility group) box and include, but are not limited to, SoxA, SRY (e.g., NM_003140.1; NM_011564; NP_003131.1; NP_035694), SoxBl, Soxl (e.g., NM_005986), Sox2 (e.g., NM_003106; NM_011443; NP_003097; NP_035573), Sox3 (e.g., NM_005634; XM_988206; NP_005625; XP_993300), SoxB2, Soxl
  • KLF1 e.g., NM_006563
  • KLF2 e.g., NM_016270; XM_982078; NP_057354; XP_987172
  • KLF3 e.g., NM .016531; XM_994052; NP_057615; XP_999146
  • KLF4 e.g.
  • One embodiment provides a somatic cell derived by inducing differentiation of an induced pluripotent stem cell as disclosed herein.
  • One embodiment also provides a method for stem cell therapy comprising: (1) isolating and collecting a somatic cell from a subject; (2) inducing said somatic cell from the subject into an iPSC (3) inducing differentiation of said iPSCs, and (4) transplanting the differentiated cell from (3) into the subject (e.g., a mammal, such as a human).
  • FIG. 1 Establishment of mouse iPSCs with M 3 O-SKM.
  • A Schematic drawing of MyoD-Oct4 chimeric constructs. Numbers indicate amino acid positions delimiting MyoD fragments. The basic helix-loop-helix (bHLH) domain of MyoD corresponds to amino acids 108-167, which was not used in these chimeric constructs.
  • EO indicates a polypeptide consisting of one methionine and a chain of 20 glutamic acids fused to Oct4 (E for glutamic acid).
  • Right column shows percentage of GFP-positive colonies derived from mouse embryonic fibroblasts (MEFs) transduced with each MyoD-Oct4 chimeric construct along with SKM and cultured on feeder cells (Fig.
  • Protocol A Data represent the mean + SEM from three independent experiments.
  • B Schematic drawings of two protocols for iPSC creation. Whereas transduced MEFs were transferred onto feeder cells on day 4 in Protocol A, MEFs were maintained feeder- free until the end of experiments in Protocol B.
  • C C
  • Sox2 mutants were transduced with OKM or M 3 0-KM.
  • the Klf4 mutant was transduced with OSM or M 3 0-SM.
  • H Drawings of fusion constructs between Oct4 and TADs taken from other transactivators. Constructs were transduced with SKM.
  • FIG. 1 Characterization of mouse iPSCs prepared with M 3 0-SKM (M 3 0-iPSCs).
  • A Comparison of GFP-positivity between colonies obtained with M 0-SKM and OSKM using Protocol B. Representative images of the GFP expression patterns used to categorize colonies are shown (top). Percentages of colonies with different GFP expression patterns were calculated from 300 colonies for M 3 O-SKM and OSKM (bottom). Bar, 200 ⁇ .
  • B qRT-PCR analysis of expression levels of three pluripotency genes in MEFs and GFP- positive colonies obtained with M 3 O-SKM and OSKM. PCR primers specific to endogenous Oct4 and Sox2 were used for these two genes. Although GFP-positive colonies were
  • FIG. 3 Verification of pluripotency of mouse M 3 0-iPSCs.
  • A Expression level of transcripts in M 3 O-1PSCS and ESCs relative to MEFs. Log2 ratios are plotted for transcripts in ESCs/MEFs and iPSCs/MEFs. Red lines indicate a 4-fold difference in transcript levels. Transcripts in M 3 0-iPSCs were assayed 60 days after transduction.
  • B Hematoxylin and 15 eosin staining of teratoma sections derived from M 3 0-iPSCs. Neural tube and epidermis (ectoderm), striated muscle and bone (mesoderm), and mucous gland and respiratory epithelium (endoderm) are shown.
  • C X gal staining for cells expressing the lacZ gene in a chimeric embryo prepared with M 3 O-1PSCS and a control embryo at 13.5 dpc.
  • D Chimeric mice prepared with M 3 O-1PSCS. The agouti coat color indicates a high (right) 20 and low (left) contribution of iPSCs to the skin. The host embryos used to generate mice were derived from the albino mouse strain ICR.
  • E Germline contribution of M 3 0-iPSCs as shown by GFP expression in the gonad of a 13.5 dpc chimeric embryo.
  • F Pups obtained from crossing a wild-type ICR female (bottom) with an M 3 O-1PSC chimeric male (left mouse in panel D).
  • NANOG-positive colonies was divided by the number of seeded dermal fibroblasts at each time point.
  • C Immunofluorescence staining of pluripotency markers in cloned human iPSCs obtained with M 3 O-SKM on day 28 after four passages.
  • D Quantitative RT-PCR analysis of pluripotency genes expressed in cloned human iPSCs prepared with M 3 O-SKM. Ten colonies were harvested on day 30 and the mean + SEM was obtained. The expression level of each gene in human ESCs H9 was defined as 1.0. Endogenous genes were amplified for OCT4, SOX2, KLF4 and c-MYC.
  • E Karyotype analysis of a human iPSC established with M 3 0- SKM.
  • F Hematoxylin and eosin staining of teratoma sections derived from human iPSCs prepared with M 3 0-SKM. Bar, 100 ⁇ .
  • ESCs and MEFs were mixed at a 13:87 ratio in the sample labeled as ESCs+MEFs (blue). The difference of the values between the two samples indicated by an asterisk was statistically significant (p ⁇ 0.01).
  • D Analyses of the accessibility of the restriction enzyme Nsil to chromatin at the distal enhancer of the Oct4 gene by Southern blotting. Locations of the enzyme recognition site and probe are shown in relation to the distal enhancer of the Oct4 gene (top). The transcription initiation site was defined as position 1. Appearance of new DNA fragments following digestion with Nsil are shown (bottom).
  • Percentage of digested chromatin was obtained by dividing the combined signal intensity of the bands at 752 and 652 bp by the combined signal intensity of the two bands and the band at 1404 bp. Cloned O-iPSCs and M 3 0-iPSCs were used for day 30 lanes. GFP-negative population was collected by a FACS and analyzed for the day 9 GFP (-) lane of M 0-MEFs (far right). (E) ChIP analyses of the levels of three histone
  • FIG. 6 Effects of M 3 0-SKM and OSKM on expression of pluripotency markers and cell proliferation.
  • A Temporal profiles of expression patterns of alkaline phosphatase. Bar, 100 ⁇ .
  • B Temporal profiles of expression patterns of SSEAl . Bar, 100 ⁇ .
  • C Flow cytometry comparing the expression level of SSEAl between MEFs transduced with OSKM and those transduced with M 3 O-SKM.
  • D Cell proliferation patterns of MEFs transduced with M 3 O or Oct4. Means + SEM of three independent experiments are shown.
  • E Cell proliferation patterns of MEFs transduced with M 3 O-SKM or OSKM.
  • FIG. 7 Chromatin analyses of day 9 at the Oct4 gene comparing transduction of MEFs with different gene combinations.
  • A Flow cytometry of MEFs transduced with M 3 O- SK and OSK.
  • B DNA methylation analysis by bisulfite sequencing. MEFs were transduced with one (IF), two (2F), or three (3F) transcription factor genes.
  • C ChIP studies on transcription factor binding at the distal enhancer.
  • D ChIP analyses on histone
  • FIG. 8 Immunoblotting of MyoD-Oct4 fusion proteins. Expression of transduced MyoD-Oct4 fusion genes was evaluated with an antibody against Oct4 (top). Expression of histone H2A was examined as a loading control (bottom). Bands correspond to the predicted molecular mass of each protein. Identities of extra bands marked with asterisks are unknown.
  • FIG. 1 ChIP analyses of the Sox2 gene.
  • A Binding of Oct4 and Sox2 at the enhancer.
  • B Binding of parafibromin and the levels of histone modifications associated with active genes on day 9.
  • C Levels of histone modifications associated with suppressive genes on day 9.
  • IF two (2F), three (3F) and four (4F) transcription factor genes.
  • A Transcription factor binding.
  • B Histone modifications associated with gene activation.
  • iPSC technology is the process of converting an adult specialized cell, such as a skin cell, into a stem cell, a process known as dedifferentiation.
  • iPSCs can be very useful in clinical as well as preclinical settings.
  • iPSCs can be created from human patients and differentiated into many tissues to provide new materials for autologous transplantation, which can avoid immune rejection of the transplanted tissues.
  • pancreatic beta cells differentiated from a patient's iPSCs can be transplanted into the original patient to treat diabetes.
  • iPSCs derived from a patient can be differentiated into the ailing tissue to be used in an in vitro disease model.
  • iPSCs iPSCs
  • iPSCs provide a new opportunity to understand the mechanisms underlying the plasticity of cell differentiation.
  • the potential of iPSCs for many fields of life science is tremendous.
  • iPSCs are slow and inefficient.
  • MEFs are transduced with OSKM on day 1 and the cells are transferred onto feeder cells composed of irradiated fibroblasts, which provide a poorly characterized, but optimal environment for the generation of iPSCs, on day 5.
  • iPSC colonies emerge around day 10, which are then picked up and expanded over the next two to three weeks on feeder cells to establish purified iPSC lines.
  • a fusion protein combining, for example, the stem cell factor Oct4 (a homeodomain transcription factor associated with undifferentiated cells) with a portion of another protein factor, for example, a transactivation domain, such as that of MyoD, can accelerate the process of making iPSCs. It is also shown herein that heterologous transactivation domains, including the MyoD TAD, promote global chromatin remodeling of stem cell genes. Thus, the process disclosed herein improves the efficiency and quality of iPSCs.
  • the stem cell factor Oct4 a homeodomain transcription factor associated with undifferentiated cells
  • a transactivation domain such as that of MyoD
  • iPSCs are a type of pluripotent stem cell obtained from a non-pluripotent cell, typically an adult somatic cell (a cell of the body, rather than gametes or an embryo), by inducing a "forced" expression of certain genes.
  • iPSCs are believed to be similar to natural pluripotent stem cells, such as ESCs in many respects, such as the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, and potency and differentiability.
  • iPSCs are not adult stem cells, but rather reprogrammed cells (e.g., epithelial cells) given pluripotent capabilities.
  • pluripotent stem cells equivalent to embryonic stem cells have been derived from human adult skin tissue.
  • Shinya Yamanaka and his colleagues at Kyoto University used the transcription factors Oct3/4, Sox2, c-Myc, and Klf4 in their experiments on cells from humans.
  • Junying Yu, James Thomson, and their colleagues at the University of Wisconsin- Madison used a different set of factors, Oct4, Sox2, Nanog and Lin28, and carried out their experiments using cells from human foreskin to generate iPS cells.
  • isolated refers to a factor(s), cell or cells which are not associated with one or more factors, cells or one or more cellular components that are associated with the factor(s), cell or cells in vivo.
  • Cells include cells from, or the "subject” is, a vertebrate, such as a mammal, including a human. Mammals include, but are not limited to, humans, farm animals, sport animals and companion animals. Included in the term “animal” is dog, cat, fish, gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey (e.g., ape, gorilla, chimpanzee, orangutan), rat, sheep, goat, cow and bird.
  • animal is dog, cat, fish, gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey (e.g., ape, gorilla, chimpanzee, orangutan), rat, sheep, goat, cow and bird.
  • an “effective amount” generally means an amount which provides the desired local or systemic effect and/or performance.
  • Pluripotency refers to a stem cell that has the potential to differentiate into one, two or three of the three germ layers: endoderm (e.g., interior stomach lining, gastrointestinal tract, the lungs), mesoderm (e.g., muscle, bone, blood, urogenital), or ectoderm (e.g., epidermal tissues and nervous system).
  • endoderm e.g., interior stomach lining, gastrointestinal tract, the lungs
  • mesoderm e.g., muscle, bone, blood, urogenital
  • ectoderm e.g., epidermal tissues and nervous system.
  • Pluripotent stem cells can give rise to any fetal or adult cell type.
  • Transdifferentiation is when a non-stem cell transforms into a different type of cell, or when an already differentiated stem cell creates cells outside its already established differentiation path.
  • a "transcription factor” (sometimes called a sequence- specific DNA-binding factor) is a protein that binds to specific DNA sequences, thereby controlling the transfer (or transcription) of genetic information from DNA to mRNA. Transcription factors perform this function alone or with other proteins or factors in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase (the enzyme that performs the transcription of genetic information from DNA to RNA) to specific genes.
  • RNA polymerase the enzyme that performs the transcription of genetic information from DNA to RNA
  • a defining feature of transcription factors is that they contain one or more DNA-binding domains (DBDs), which attach to specific sequences of DNA adjacent to the genes that they regulate.
  • a “transcription activation domain,” “transactivation domain” or “trans-activating domain” is generally that portion of a transcription factor that is responsible for recruitment of the transcription machinery needed to transcribe RNA. Transactivation is an increased rate of gene expression triggered either by biological processes or by artificial means.
  • Transactivation can be triggered either by endogenous cellular or viral proteins - transactivators. These protein factors act in trans (i.e., intermolecularly).
  • An "unrelated" or “heterologous transactivation domain” refers to a transactivation domain that is not normally associated with the gene/protein (e.g., transcription factor) of interest (not wild-type).
  • iPSC populations can comprise mixed populations of cells.
  • FACS fluorescence activated cell sorting
  • Preferable ranges of purity in populations comprising iPSCs are about 1 to about 5%, about 5 to about 10%, about 10 to about 15%, about 15 to about 20%, about 20 to about 25%, about 25 to about 30%, about 30 to about 35%, about 35 to about 40%, about 40 to about 45%, about 45 to about 50%, about 50 to about 55%, about 55 to about 60%, about 60 to about 65%, about 65 to about 70%, about 70 to about 75%, about 75 to about 80%, about 80 to about 85%, about 85 to about 90%, about 90% to about 95% or about 95 to about 100%.
  • Purity of the cells can be determined for example according to the cell surface marker profile within a population.
  • iPSC colonies emerge as early as about five days (day 5) after transduction of a transactivator domain (or a portion thereof) fused to a transcription factor (or a portion thereof), e.g., M 3 0 (short transactivation domain of MyoD (about 50 to 60 amino acids) fused to the amino terminus of the full-length Oct4), Sox2, Klf4, and c-Myc without feeder cells.
  • a transcription factor or a portion thereof
  • M 3 0 short transactivation domain of MyoD (about 50 to 60 amino acids) fused to the amino terminus of the full-length Oct4), Sox2, Klf4, and c-Myc without feeder cells.
  • the preparation of the nucleic acid molecule coding for the fusion protein(s) as well as the construct(s) of Sox, Klf, c-Myc etc. can be carried out by methods available to an art worker as well as the transduction thereof into cells (see, for example, Sambrook, Molecular Cloning:
  • iPSCs established with the standard OSKM protocol frequently contain partially reprogrammed cells and even established iPSCs occasionally lose pluripotency during prolonged cultures. In contrast, the iPSCs disclosed herein retain pluripotency more tightly and heterogeneity among different colonies is much less apparent than that with the OSKM iPSCs.
  • iPSC colonies can be obtained without c-Myc (use only M 3 0, Sox2 and Klf4) at the efficiency of 0.44% around day 7.
  • iPSCs have been prepared without c-Myc (use OSK) before, but the efficiency was low ( ⁇ 0.01 ) and it generally took 30 to 40 days for iPSCs to emerge 2 ' 3.
  • this transactivation domain-based strategy can be applied to amplify the effects of other transcription factors to facilitate their reprogramming capability of cell differentiation.
  • TAD such as the M 3 domain
  • the fusion technology such as the M 3 0, technology disclosed herein has significant advantages over wild-type Oct4 (or other transcription factors) in generating iPSCs.
  • the fusion technology is faster. While iPSC colonies appear at about day 10 with the standard OSKM protocol (see, Cell Stem Cell 2008, 3, 595 for a general protocol for making iPSCs), iPSC colonies emerge on day 5 with the fusion technology (e.g., M 3 0-SKM).
  • efficiency of making iPSCs is more than 50-fold higher with the fusions technology (e.g., M 3 0-SKM) than that with OSKM.
  • purer iPSCs populations can be obtained with the fusions technology described herein (e.g., M 0- SKM) compared with OSKM.
  • the fusion technology described herein e.g., M 0-
  • SKM does not require feeder cells unlike OSKM. This is noted especially for making iPSCs for transplantation purposes because one would generally need to use patient-derived fibroblasts as feeder cells to avoid immune rejection. Also, the use of feeder cells adds an extra step to make iPSCs. Feeder-free iPSCs have been reported, but they are derived from already undifferentiated cells, such as adipose stem cells. Fibroblasts generally require feeder cells to become iPSCs. Finally, iPSCs can be prepared using only M 3 0, Sox2 and Klf4 (without c-Myc).
  • genes which can be used to create induced pluripotent stem cells include, but are not limited to, one or more of the following: Oct4 (Oct3/4, Pou5fl), Sox (e.g., Soxl, Sox2, Sox3, Soxl8, or Soxl5), Klf (e.g., Klf4, Klfl, Klf3, Klf2 or Klf5), Myc (e.g., c-myc, N-myc or L-myc), nanog, or LIN28.
  • Oct4 Oct3/4, Pou5fl
  • Sox e.g., Soxl, Sox2, Sox3, Soxl8, or Soxl5
  • Klf e.g., Klf4, Klfl, Klf3, Klf2 or Klf5
  • Myc e.g., c-myc, N-myc or L-myc
  • nanog or LIN28.
  • accession numbers are provided: Mouse MyoD
  • NM_004235 Human c-Myc: NM_002467; Human Nanog: NM_024865; and/or Human Lin28: NM_024674, for portions or fragments thereof and/or any related sequence available to an art worker (these sequences are incorporated by referenced herein).
  • sequences for use in the invention have at least about 50% or about 60% or about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, or about 79%, or at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, or about 89%, or at least about 90%, about 91%, about 92%, about 93%, or about 94%, or at least about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity compared to the sequences and/or accession numbers provided herein and/or any other such sequence available to an art worker, using one of alignment programs available in the art using standard parameters or hybridization techniques.
  • the differences in sequence are due to conservative amino acid changes.
  • the protein sequence or DNA sequence has at least 80% sequence identity with the sequences disclosed herein and is bioactive (e.g., retains activity).
  • the cells can be cultured in culture medium that is established in the art and commercially available from the American Type Culture Collection (ATCC), Invitrogen and other companies.
  • culture medium include, but are not limited to, Dulbecco's Modified Eagle's Medium (DMEM), DMEM F12 medium, Eagle's Minimum Essential Medium, F-12K medium, Iscove's Modified Dulbecco's Medium, Knockout D- MEM, or RPMI-1640 medium. It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as needed for the cells used. It will also be apparent that many media are available as low-glucose formulations, with or without sodium pyruvate.
  • Sera often contain cellular factors and components that are needed for viability and expansion.
  • sera include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), human serum, chicken serum, porcine serum, sheep serum, rabbit serum, rat serum (RS), serum replacements (including, but not limited to, KnockOut Serum Replacement (KSR,
  • the cells are cultured in the presence of FBS /or serum specific for the species cell type.
  • FBS total serum
  • serum replacement concentrations of about 0.5% to about 5% or greater including about 5% to about 15% or greater, such as about 20%, about 25% or about 30%. Concentrations of serum can be determined
  • Additional supplements can also be used to supply the cells with trace elements for optimal growth and expansion.
  • Such supplements include insulin, transferrin, sodium selenium, and combinations thereof.
  • These components can be included in a salt solution such as, but not limited to, Hanks' Balanced Salt SolutionTM (HBSS), Earle's Salt SolutionTM, antioxidant supplements, MCDB-201TM supplements, phosphate buffered saline (PBS), N-2- hydroxyethylpiperazine-N' -ethanesulfonic acid (HEPES), nicotinamide, ascorbic acid and/or ascorbic acid-2-phosphate, as well as additional amino acids.
  • HBSS Hanks' Balanced Salt Solution
  • EHEPES N-2- hydroxyethylpiperazine-N' -ethanesulfonic acid
  • nicotinamide ascorbic acid and/or ascorbic acid-2-phosphate, as well as additional amino acids.
  • Many cell culture media already contain amino acids; however some require
  • Such amino acids include, but are not limited to, L-alanine, L-arginine, L-aspartic acid, L- asparagine, L-cysteine, L-cystine, L-glutamic acid, L-glutamine, L-glycine, L-histidine, L- inositol, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L- serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine.
  • Antibiotics are also typically used in cell culture to mitigate bacterial, mycoplasmal, and fungal contamination.
  • antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to, amphotericin (FungizoneTM), ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin.
  • amphotericin FungizoneTM
  • ampicillin ampicillin
  • gentamicin gentamicin
  • bleomycin bleomycin
  • hygromycin kanamycin
  • mitomycin mycophenolic acid
  • nalidixic acid neomycin
  • Hormones can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, ⁇ -estradiol,
  • DES diethylstilbestrol
  • dexamethasone dexamethasone
  • ⁇ -estradiol ⁇ -estradiol
  • hydrocortisone insulin, prolactin, progesterone, somatostatin/human growth hormone (HGH), thyrotropin, thyroxine, and L-thyronine.
  • ⁇ -mercaptoethanol can also be supplemented in cell culture media.
  • Lipids and lipid carriers can also be used to supplement cell culture media, depending on the type of cell and the fate of the differentiated cell.
  • Such lipids and carriers can include, but are not limited to cyclodextrin ( ⁇ , ⁇ , ⁇ ), cholesterol, linoleic acid conjugated to albumin, linoleic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic-oleic- arachidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others.
  • Albumin can similarly be used in fatty-acid free formulation.
  • Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components and synthetic or biopolymers.
  • a solid support such as extracellular matrix components and synthetic or biopolymers.
  • Cells often require additional factors that encourage their attachment to a solid support (e.g., attachment factors) such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, "superfibronectin” and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L- lysine, MatrigelTM, thrombospondin, and/or vitronectin.
  • attachment factors such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, "superfibronectin” and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L- lysine, MatrigelTM,
  • Cells can be cultured at different densities, e.g., cells can be seeded or maintained in the culture dish at different densities.
  • the cells can be seeded or maintained at low or high cell densities.
  • densities including, but not limited to, densities of less than about 2000 cells/well of a 12-well plate (for example, 12-well flat-bottom growth area: 3.8cm well volume: 6.0 ml or well ID x depth (mm) 22.1x17.5; well capacity (ml) 6.5, growth area (cm ) 3.8), including less than about 1500 cells/well of a 12-well plate, less than about 1,000 cells/well of a 12-well plate, less than about 500 cells/well of a 12-well plate, or less than about 200 cells/well of a 12-well plate.
  • densities including, but not limited to, densities of less than about 2000 cells/well of a 12-well plate (for example, 12-well flat-bottom growth area: 3.8cm well volume: 6.0 ml or well ID x depth (mm) 22.1x17.5; well capacity (ml) 6.5, growth area (cm ) 3.8), including less than about 1500 cells/well of a 12-well plate, less than about 1,000 cells/well of
  • the cells can also be seeded or maintained at higher densities, for example, great than about 2,000 cells/well of a 12-well plate, greater than about 2,500 cells/well of a 12-well plate, greater than about 3,000 cells/well of a 12-well plate, greater than about 3,500 cells/well of a 12-well plate, greater than about 4,000 cells/well of a 12-well plate, greater than about 4,500 cells/well of a 12-well plate, greater than about 5,000 cells/well of a 12-well plate, greater than about 5,500 cells/well of a 12-well plate, greater than about 6,000 cells/well of a 12-well plate, greater than about 6,500 cells/well of a 12-well plate, greater than about 7,000 cells/well of a 12-well plate, greater than about 7,500 cells/well of a 12-well plate or greater than about 8,000 cells/well of a 12-well plate.
  • the maintenance conditions of cells cultures can also contain cellular factors that allow cells, such as the iPSCs of the invention, to remain in an undifferentiated form. It may be advantageous under conditions where the cell must remain in an undifferentiated state of self -renewal for the medium to contain epidermal growth factor (EGF), platelet derived growth factor (PDGF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF) and combinations thereof.
  • EGF epidermal growth factor
  • PDGF platelet derived growth factor
  • LIF leukemia inhibitory factor
  • bFGF basic fibroblast growth factor
  • Example 1 is provided in order to demonstrate and further illustrate certain embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
  • Example 1 is provided in order to demonstrate and further illustrate certain embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
  • MEFs were prepared from Oct4-GFP mice which harbour an IRES-green fluorescence protein (GFP) fusion cassette downstream of the stop codon of the Oct4 gene (Jackson Laboratory #008214) . All animal experiments were conducted in accordance with the animal experiment guidelines of University of Minnesota. For chimera experiments, MEFs were prepared from mice that harbour the Oct4-GFP allele and ROSA26-/acZ allele. MEFs were seeded at 3xl0 5 cells/6cm dish on day -2 in DMEM with 10% fetal bovine serum (FBS). Fresh virus supernatant was added to MEFs on day -1 and day 0 with 10 g/ml polybrene.
  • FBS fetal bovine serum
  • iPSC medium (DMEM, 15% fetal bovine serum, 100 ⁇ MEM non-essential amino acids, 55 ⁇ 2-mercaptoethanol, 2 mM L-glutamine and 1000 u/ml leukemia inhibitory factor) on day 1.
  • Transduced MEFs were subcultured onto irradiated SNL feeder cells at 2xl0 5 cells/6 cm dish on day 4 and maintained on the feeder cells in Protocol A. The maximum number of GFP-positive colonies obtained around day 18 was divided by 2xl0 5 to obtain the efficiency of making iPSCs.
  • Protocol B transduced MEFs were maintained without feeder cells. GFP-positive colonies were picked up around day 10 to clone without feeder cells for pluripotency analyses.
  • Retrovirus titer was measured using NIH3T3 cells as described . All recombinant DNA research was conducted following the NIH guidelines.
  • pMXs-IP vectors encoding human M 3 0, OCT4, SOX2, KLF4 and c-MYC (Addgene) were transfected into Plat-A cells (Cell Biolabs) with Lipofectamin 2000 (Invitrogen). Virus supernatant was harvested 48 and 72 hrs later (day -1 and 0, respectively below), filtered through a 0.45 ⁇ syringe filter and transduced into dermal fibroblasts obtained from a 34-year-old Caucasian female (Cell Applications).
  • fibroblasts were plated in each well of a 12-well plate in DMEM with 10% fetal bovine serum. Fresh virus supernatant was added to the fibroblasts on day -1 and day 0 with 10 ⁇ g/ml polybrene. On day 3 cells were harvested with trypsin and subcultured at 1.7xl0 4 cells per well in 12-well plates coated with BD Matrigel hESC- qualified Matrix (BD Biosciences) in human iPSC medium (KnockOut DMEM F-12
  • MEFs were transduced with MyoD-Oct4 fusion genes and analyzed with
  • iPSCs were fixed with 4% formaldehyde for 10 min and permeabilized with 0.5% Triton X-100 for 3 min. Cells were then incubated with primary antibody and secondary antibody for 1 hr each at 25°C. DNA was counterstained with Hoechst 33342. Used antibodies are listed in Table 1. Fluorescence signal was captured with a lOx A-Plan Phi Varl objective (numerical aperture 0.25) and an AxioCam charge coupled device camera attached to an Axiovert 200M fluorescence microscope (all from Zeiss). Photoshop 7.0 (Adobe Systems) was used for image processing.
  • Alkaline phosphatase was detected with an Alkaline Phosphatase Detection Kit (Millipore SCR004).
  • the percentage of GFP-positive or SSEA1 -positive cells at each time point was determined with a FACSCalibur flow cytometer and analyzed using CellQuest Pro software
  • cDNA for mPvNA was prepared from iPSC colonies using a Cells-to-cDNA II kit
  • qRT-PCR was performed with GoTaq qPCR Master mix (Promega) on a Realplex 2S system (Eppendorf). PCR primer sequences are listed in Table 2. Expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize the expression levels of mRNAs.
  • the feeder-free ESC line CGR8.8 was used as a positive control.
  • Col6a2 CCACCACTGAAAGGAACAACAA TCCAACACGAAATACACGTTGAC
  • RNA was prepared from CGR8.8 cells, MEFs, and a mouse iPSC clone prepared with the fusion gene between the M 3 domain of MyoD and Oct4 (M 3 0-iPSC) on day 60 with the PureLink RNA total RNA purification system (Invitrogen). RNA was amplified and labeled using the Agilent Quick AmpLabeling Kit (Agilent Technologies) following the
  • DNA microarray data have been deposited in the NCBI GEO database under the accession number GSE22327.
  • Adherent cells were arrested with colcemid, harvested, treated with 75mM KC1 hypotonic solution, and fixed with methanol and acetic acid at 3: 1. The cells were spread onto glass slides and stained with Wright-Giemsa stain. G-banded metaphases were evaluated using an Olympus BX61 microscope outfitted with lOx and lOOx objectives. Metaphase cells were imaged and karyotyped using Applied Spectral Imaging (ASI) software.
  • ASI Applied Spectral Imaging
  • teratomas To prepare teratomas, one million cloned mouse or human M 3 0-iPSCs were injected into the limb muscle of NOD/SCID mice. Teratomas were fixed with 10% formalin and embedded with paraffin after three weeks for mouse iPSCs and eight weeks for human iPSCs. Five- ⁇ thick sections were stained with haematoxylin and eosin for histological analysis.
  • Chromatin immunoprecipitation (ChIP)
  • ChIP was performed as described in the instruction of the EZ Magna ChIP G kit
  • PCR amplification levels were first normalized against the value obtained with control IgG.
  • the normalized values with ESCs or MEFs were then defined as 1.0 depending on antibodies to obtain relative expression levels in other cells.
  • Genomic DNA from mouse iPSCs was treated with bisulfite with an EZ DNA
  • Fig. 1A Full-length mouse Oct4 was fused with various fragments of mouse MyoD (Fig. 1A).
  • Each chimeric gene was co-transduced with a polycistronic retroviral vector encoding mouse Sox2, Klf4, and c-Myc (SKM) 5 into MEFs derived from Oct4-GFP mice, which contain the GFP gene knocked into the Oct4 locus .
  • formation of GFP-positive colonies indicates that individual MEFs develop into Oct4-expressing cells capable of clonal growth.
  • MEFs were then transduced with each chimeric gene along with SKM and followed the protocol described above (Protocol A).
  • M 3 0 with SKM M 3 0-SKM
  • M 3 0-SKM increased the percentage of GFP-positive colonies most drastically, with 5.10+0.85% of MEFs (M 3 0- MEFs) being transformed into GFP-positive cells by day 15.
  • the M 3 region encompasses the acidic transactivation domain (TAD) of MyoD (amino acids 3-56) 11 .
  • TAD acidic transactivation domain
  • M 3 0 still required Sox2 and Klf4, c-Myc was dispensable.
  • iPSCs can be established without c-Myc 2 ' 3 ; however, the uniqueness of M 0-SK lies in the speed and efficiency with which GFP-positive colonies form. While it requires three to four weeks and the presence of feeder cells for OSK to induce GFP-positive colonies at an efficiency of around 0.01% 2 ' 3 , M 3 0-SK could generate GFP-positive colonies without feeder cells by day 7 after transduction at an efficiency of 0.44%, over 40-fold more efficient than OSK.
  • HIV- 1 immunodeficiency virus type 1 14 ' 15 , Gata4 16,17 and Mef2c 11 .
  • the GFP-positive colonies that emerged on day 5 following transduction with M 3 0- SKM using Protocol B contained 31-143 cells in 12 colonies, with a median of 43 cells/colony. This number of cells would be produced after less than seven cell divisions assuming even division for each cell, which is strikingly small compared to the median of 70
  • M 3 O-1PSCS The pluripotency of iPSC clones prepared with M 3 O-SKM following Protocol B (M 3 O-1PSCS) was verified using three standard approaches.
  • genome-wide transcript analysis demonstrated highly similar gene expression in M 3 O-1PSCS and ESCs. Out of 41,160 probes, 3,293 were greater than 4-fold differentially expressed (up- or down-regulated) in both ESCs and cloned iPSCs compared to MEFs (Fig. 3A).
  • the commonly up-regulated genes included eight ECS-enriched genes, such as Oct4, Sox2 and Nanog.
  • Thyl, Col6a2 and Fgf7 were down-regulated more than 16-fold in both ESCs and iPSCs.
  • M 3 0-iPSCs intramuscular injection of M 3 0-iPSCs into an NOD/SCID mouse resulted in teratoma formation as shown by the presence of various tissues derived from the three germ layers (Fig. 3B).
  • M 3 0- iPSCs contributed to germ cells in some chimeric mice (Fig. 3E). When one of the chimeric males (Fig. 3D left) was crossed with a wild-type female ICR mouse (Fig. 3F, white adult at bottom), all 11 pups showed agouti or black coat color (Fig. 3F).
  • M 3 0 could also facilitate generation of human iPSCs in comparison to OSKM.
  • Human M 3 O-SKM and OSKM were transduced into human dermal fibroblasts prepared from a 34-year-old female. Because these cells did not harbor a transgene that could be used as a convenient marker for reprogramming, expression of the pluripotency protein NANOG was monitored by immunofluorescence staining as an iPSC indicator. NANOG-positive human ESC-like colonies emerged around day 8 with M 3 O-SKM, with the number increasing by around day 15 when 0.30+0.033% of the original fibroblasts were converted to iPSC colonies (Fig. 4A, 4B). In contrast, when OSKM was transduced, NANOG-positive colonies did not emerge until around day 12 and eventually only
  • iPSCs prepared with M 3 O-SKM expressed twelve pluripotency genes as demonstrated by quantitative RT-PCR (Fig. 4D). All twenty mitotic spreads prepared from a cloned M 3 O-SKM iPSCs demonstrated normal karyotypes (Fig. 4E). Finally, they formed teratomas when injected into an NOD/SCID mouse (Fig. 4F), proving pluripotency of the cells.
  • Chromatin from M 0- MEFs and O-MEFs was digested with the restriction enzyme Nsil and analyzed DNA fragments using Southern blotting. Indeed, chromatin accessibility was consistently higher in M 3 0-MEFs compared to O-MEFs between day 5 and day 9 (Fig. 5D). Additionally, GFP- negative M 0-MEFs were selected with a FACS on day 9 followed by Nsil digestion analysis. This GFP-negative population also demonstrated increased sensitivity to Nsil (Fig. 5D, far right), indicating that the minor GFP-positive population did not significantly influence the overall result of chromatin accessibility
  • Paf 1 complex is recruited to the distal enhancer of the Oct4 gene through binding to the Oct4 protein 24 ' 25 and then generally moves to the coding region of the gene 26 .
  • Three Pafl complex subunits - parafibromin, Leol and Pafl - displayed a gradual increase of binding to the distal enhancer and coding region of the Oct4 gene in M 3 O-MEFS, but not in O-MEFs, between days 3 and 9 following transduction (Fig. 5C).
  • the Pafl complex recruits the histone methyltransferase complex COMPASS, which catalyzes trimethylation of lysine 4 on histone H3 (H3K4me3) 26 .
  • This histone modification was also increased specifically in M 3 O-MEFS in the coding region of the Oct4 gene (Fig. 5E).
  • Two other markers for active genes acetylation of lysines 9 and 14 on histone H3 (H3K9ac and H3K14ac) 27 , were also increased in M 3 0-MEFs (Fig. 5E).
  • two markers for suppressed genes trimethylation of H3K9 (H3K9me3) and H3K27 (H3K27me3) 27 , were more decreased in M 3 0-MEFs than those in O-MEFs (Fig. 5F). Similar results were observed at the Sox2 locus (Fig. 9).
  • M 3 0-SKM In addition to global chromatin remodeling, M 3 0-SKM also elicited wider expression of two pluripotency markers than OSKM: alkaline phosphatase and SSEA1.
  • Alkaline phosphatase was almost ubiquitously expressed by day 9 in M 0-MEFs, unlike the weak and heterogeneous expression observed in O-MEFs (Fig. 6A).
  • SSEA1 was also more widely expressed in M 3 0-MEFs than in O-MEFs by day 9 as shown by immunofluorescence microscopy and flow cytometory (Fig. 6B, 6C).
  • M 0 facilitated binding of Oct4, Sox2, and parafibromin in combination with Sox2 or Sox2 and Klf4 (Fig. 7C, red), with some of these binding levels comparable to levels achieved with M 3 0-SKM.
  • Leol and Pafl were not recruited to the enhancer without c-Myc (Fig. 7C). The binding of
  • H3K4me3 was effectively decreased by M 0-S and M 0-SK, H3K27me3 was more resistant to
  • the present study advances the field of iPSC biology by showing that one of the rate- limiting steps in iPSC formation with OSKM is poor chromatin accessibility at pluripotency genes and that a strong transactivating domain can overcome this problem. Because iPSC formation was dramatically improved with M 0-SKM, the factors required to increase chromatin accessibility most likely already exist within MEFs but are not effectively recruited to pluripotency genes when using OSKM. Our current working model is that the MyoD TAD overcomes the barrier of closed chromatin by effectively attracting chromatin modifying proteins and thereby facilitating the binding of Oct4 and other regulatory proteins as well as epigenetic modifications at pluripotency genes (Fig. 7F).
  • Myc family proteins have been proposed to globally relax chromatin in part through activation of the histone acetyltransferase GCN5 and in part through direct binding to thousands of genomic loci 28 ' 29. The results also support c-Myc's potential roles in chromatin remodeling.
  • the MyoD TAD eliminated the requirement for feeder cells and achieved significant levels of epigenetic remodeling even in those MEFs that eventually fell short of activating GFP with Protocol B.
  • the MyoD TAD is expected to facilitate the dissection of epigenetic processes during the early phase of iPSC formation.
  • TAD-fusion to potentiate transactivators will further advance the study of nuclear reprogramming.
  • the effect of each TAD may be on dependent on cell types, host transcription factors, and target genes.
  • Other TADs have been used to amplify the activity of transcription factors.
  • the TAD of VP 16 was fused to the transcription factor Pdxl to facilitate conversion of hepatocytes to pancreatic cells 36 ' 37 .
  • the MyoD TAD has not been used in nuclear reprogramming.
  • the TAD-fusion approach is applicable to combinations of many other transcription factors and TADs to amplify the activity of the host transcription factor and control cell fate decisions.
  • the M 3 domain of the mouse MyoD cDNA was fused to the amino terminus of the full-length mouse Oct4 cDNA using PCR and inserted into the EcoRI site of the pMXs-IP vector.
  • the cDNA encoding the M 3 domain of mouse MyoD (amino acids 1-62) was amplified with two primer sets, MyoDOct4F4
  • MyoDOct4F4 GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC (SEQ ID NO:6) ⁇ 63- 109R 1 : CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG (SEQ ID NO:7) ⁇ 63- 109F 1 : CTGAAACCGGAGGAGCACATGGCTGGACACCTG (SEQ ID NO:8) MyoDOct4R5 : CGGAATTCTCTCAGTTTGAATGC ATGGGAGAG (SEQ ID NO:9)
  • the M 3 domain of the mouse MyoD cDNA was fused to the carboxy terminus of the mouse full length Oct4 cDNA.
  • the M3 domain was prepared with PCR using the primer pair M 3 FI and M 3 RI and inserted into the EcoRI and the Xhol sites of the pMXs-IP vector to create the pMXs-IP M 3 vector.
  • Oct4 was then PCR amplified with the primer pair Oct4Fl and Oct4Rl, and inserted into the EcoRI site of pMXs-IP M 3 vector.
  • Oct4Fl CGAGAATTCATGGCTGGACACCTG (SEQ ID NO:H)
  • Oct4Rl CGAGAATTCGTTTGAATGCATGGGAGAG (SEQ ID NO:12)
  • OM 3 converts 3.2% of MEFs to iPSCs.
  • Mouse M 3 was fused to both the amino and carboxy termini of mouse Oct4.
  • Mouse M 3 domain was prepared from the mouse MyoD cDNA with PCR using the primer pair M 3 OFI and M 3 ORI .
  • Mouse full length Oct4 was prepared with PCR using the primer set M 3 OF2 and Oct4Rl .
  • M 3 O the above two PCR products were used as templates for PCR with the primer pair M 3 OFl and Oct4Rl .
  • M 3 0 was inserted into the EcoRI site of the pMXs-IP M 3 vector prepared in the OM 3 construct above.
  • Oct4Rl CGAGAATTCGTTTGAATGCATGGGAGAG (SEQ ID NO:19)
  • the M 3 domain of the human MyoD cDNA was fused to the amino terminus of the full-length human Oct4 cDNA using PCR and inserted into the EcoRI site of the pMXs-IP vector.
  • the M3 domain of human MyoD was PCR amplified with the primer pair of hM 3 OFl (see below for sequence) and hM 3 ORl.
  • Human full length Oct4 was PCR amplified with the primer pair of hM 3 OF2 and hM 3 OR2. These two PCR products were used as templates for the third PCR with the primers hM 3 OFl and hM 3 OR2.
  • hM 3 OFl CGAGAATTCGCCATGGAGCTACTGTCGCCAC (SEQ ID NO:21)
  • hM 3 ORl CAGGTGTCCCGCCATGTGCTCTTCGGGTTTCAG ( SEQ ID NO : 22 )
  • hM OF2 CTG A A ACCCG A AG AGC AC ATGGCGGG AC ACCTG (SEQ ID NO:23)
  • hM 3 OR2 CGTGAATTCCTCGAGTCTCAGTTTGAATGCATGGGAGAG (SEQ ID NO: 24)
  • VP 16 is a protein expressed by the herpes simplex virus type 1 and its transactivation domain is highly powerful.
  • the cDNA encoding the transactivation domain of VP 16 (amino acids 411-490) was amplified by PCR and inserted into the BamHI and Xhol sites of the pMXs-IP vector to create the pMXs VP16-IP vector. Then the full-length mouse Oct4 cDNA was inserted into the EcoRI and Xhol sites of the pMXs VP16-IP vector. PCR primers for VP 16
  • VP 16F 1 CG AGG ATCCGCC ATGTCG ACGGCCCCCCCG ACCG ATGTC (SEQ ID NO:25)
  • VP 16R 1 CG ACTCG AGG A ATTCCCC ACCGTACTCGTC (SEQ ID NO:26)
  • VP16LO-SKM converts around 0.5% of mouse embryonic fibroblasts to iPSCs, which is lower than M 3 0-SKM (5.3%) but still higher than OSKM (0.08%).
  • VP16LO- SKM does not require feeder cells, unlike OSKM, to make iPSCs.
  • V 16F4 CG AG A ATTCGCC ATGTTGGGGG ACGGGG ATTC (SEQ ID NO:32)
  • V160R CAGGTGTCCAGCCATCCCACCGTACTCGTC (SEQ ID NO:33)
  • VP 160F GACGAGTACGGTGGGATGGCTGGACACCTG (SEQ ID NO:34)
  • Oct4Rl GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG ( SEQ ID NO : 35 )
  • MEFs transduced with M 3 0-SKM were seeded onto feeder cells at the density of 2000 cells/well of a 12-well plate. This cell density is around 15-fold lower than the density used in protocol described above.
  • 10% fetal bovine serum was replaced with 15% KnockOut Serum Replacement (KSR, Invitrogen) in the culture medium.
  • KSR KnockOut Serum Replacement
  • the herpes simplex virus type 1 protein VP 16 is a powerful transactivator. To test if the VP 16 TAD could also raise the efficiency of making iPSCs, two fusion genes were prepared between mouse Oct4 and the VP 16 TAD.
  • the first fusion gene called VP16LO is composed of the full-length VP 16 TAD (amino acids 411-490) fused to the amino terminus of Oct4.
  • the second fusion gene called VP16SO comprises the second half of the VP 16 TAD (amino acids 446-490) fused to the amino terminus of Oct4.
  • mice iPSCs The efficiency of making mouse iPSCs was around 5% with VP16LO-SKM and around 14% with VP16SO-SKM on day 12 under the above-mentioned culture conditions (with decreased cell density and KSR). The efficiency with these two combinations was higher than the efficiency with OSKM.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Transplantation (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Described herein is a major breakthrough in nuclear reprogramming and induced pluripotent stem cell (iPSC) technology. Fusion of the powerful transcription activation domain (TAD) of MyoD to the Oct4 protein makes iPSCs generation faster, more efficient, purer, safer and feeder-free. Also, disclosed herein is the first report of the use of a TAD fused to a transcription factor as a method for making iPSCs. By combining transcription factors and TADs, this approach to nuclear reprogramming can have a range of applications from inducing pluriopotency to inducing transdifferentiation without transitioning through iPSCs.

Description

INDUCED PLURIPOTENT STEM CELLS
Related Applications
This application claims priority from U.S. Provisional Application Serial Nos.
61/366,821 filed July 22, 2010 and 61/390,454 filed October 6, 2010, which applications are herein incorporated by reference.
Statement of Government Rights
This invention was made with government support under United States Grant No. ROl DK082430-01 from National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health. The government has rights in the invention.
Background of the Invention
Nuclear reprogramming, the process of converting one cell type into another by resetting the pattern of gene expression, can be achieved through forced expression of defined transcription factors. One example is the induced pluripotent stem cells (iPSCs) prepared by transducing four genes (e.g., Oct4, Sox2, Klf4 and c-Myc, called OSKM hereafter) into a cell type to be dedifferentiated. iPSCs are a type of pluripotent stem cell artificially derived by reprogramming a somatic cell. iPSCs are morphologically similar to embryonic stem cells and are capable of differentiating into a variety of different somatic cell types. This technology allows researchers to obtain pluripotent stem cells for use in a research setting. iPSCs also have therapeutic uses for the treatment of disease without the need for stem cells derived from an embryonic source.
However, generally less than 1% of transduced cells are reprogrammed to form iPSCs, and the entire process of establishing iPSC clones is long (over a month).
Summary of the Invention
Described herein is a novel approach to nuclear reprogramming using a fusion protein
(a protein created through the joining of two or more genes or portions thereof in any orientation or copy number (e.g., from about 1 to about 2, about 3, about 4, about 5 or more copies of genes for example) which originally coded for separate proteins or portions thereof) of a transcription activation domain (TAD) of a gene, for example, MyoD and a transcription factor, for example, Oct4 (such a fusion protein is designated herein as M30) that greatly improves the efficiency of reprogramming and accelerates iPSC production. iPSC colonies emerged five days after transduction of Sox2, Klf4 and c-Myc (SKM) and M 0 into fibroblasts, with colonies rapidly enlarging in the absence of feeder cells. The pluripotency of iPSCs was confirmed by genome- wide gene expression analysis, teratoma formation, and chimera formation, including germline transmission. Transduction of M30 and SKM increased chromatin accessibility at the Oct4 promoter, facilitated recruitment of the Oct4- binding Paf 1 complex, and remodeled many histone modifications at pluripotency genes to an embryonic stem cell (ESC)-like state more efficiently than transduction of OSKM. Thus, discussed herein is a novel approach to nuclear reprogramming in which a wide variety of TADs can be combined with related or unrelated transcription factors to reprogram the pattern of gene expression, with applications ranging from induction of pluripotency to direct transdifferentiation.
One embodiment provides iPSCs derived by nuclear reprogramming of a somatic cell with a fusion protein. The somatic cell can be a mammalian cell, for example a mouse cell or a human cell. One embodiment provides a fusion protein for induction of pluripotent stem cells. Another embodiment provides such a pluripotent stem cell, wherein the reprogramming comprises contacting the somatic cell with a fusion protein or DNA encoding the fusion protein. The disclosed methods and fusion proteins can be used to conveniently and reproducibly establish iPSCs having pluripotency and growth ability similar to that of ES cells (ESCs).
One embodiment provides a method for preparing an induced pluripotent stem cell by nuclear reprogramming of a somatic cell, which comprises introducing a nucleic acid sequence, by methods available to one of skill in the art, coding for a fusion protein of an unrelated/heterologous transactivation domain and a transcription factor into the somatic cell. One embodiment provides an induced pluripotent stem cell obtained by such a method.
The fusion protein can be the fusion of an unrelated/heterologous transactivation domain and a transcription factor (e.g., the TAD is not normally associated with the transcription factor), such as the transactivation domain of MyoD (sequence information for MyoD is provided, for example, at NM_002478.4; NM_010866.2; NP_002469.2; NP_034996.2) or VP16 fused with Oct4 (full length or a bioactive fragment thereof; octamer-binding transcription factor 4 also known as POU5F1 (POU domain, class 5, transcription factor 1); sequence includes, for example, NM_002701; NM_013633.2; NP_002692; NP .038661.2; NM_001009178; NP_001009178; NM_131112; NP_571187). Additional trans-activating domains can include, for example, but are not limited to, those found in p53, VP16, MLL, E2A, HSF1, NF-IL6, NFAT1 and NF-KB.
Additional factors to be introduced into the cell, and/or used to generate a fusion protein with a transactivation domain, can include, but is not limited to, a gene from the Sox family (e.g., SOX genes encode a family of transcription factors that bind to the minor groove in DNA, and belong to a super-family of genes characterized by a homologous sequence called the HMG (high mobility group) box and include, but are not limited to, SoxA, SRY (e.g., NM_003140.1; NM_011564; NP_003131.1; NP_035694), SoxBl, Soxl (e.g., NM_005986), Sox2 (e.g., NM_003106; NM_011443; NP_003097; NP_035573), Sox3 (e.g., NM_005634; XM_988206; NP_005625; XP_993300), SoxB2, Soxl4 (e.g., NM_004189; XM_284529; NP_004180; XP_284529), Sox21 (e.g., NM_007084; XM_979432; NP_009015; XP_984526), SoxC, Sox4 (e.g., NM_003107; NM_009238; NP_003098; NP_033264), Soxll (e.g., XM_001128542; NM_009234; XP_001128542; NP_033260), Soxl2 (e.g., NM_006943; XM_973626; NP_008874; XP_978720), SoxD, Sox5 (e.g., NM_006940; NM_011444; NP .008871; NP_035574), Sox6 (e.g., NM_017508; NM_001025560; NP_059978; NP_001020731), Soxl3 (e.g., NM_005686; NM_011439; NP_005677; NP_035569), SoxE, Sox8 (e.g., NM_014587; NM_011447; NP_055402; NP_035577), Sox9 (e.g., NM_000346; NM_011448; NP_000337; NP_035578), SoxlO (e.g., NM .006941; XM_001001494; NP_008872; XP_001001494), SoxF, Sox7, Soxl7, Soxl8 (e.g., NM_018419; NM_009236; NP_060889; NP_033262), SoxG, Soxl5 (e.g., NM_006942; NM_009235; NP_008873; NP_033261), SoxH, Sox30), the Klf (Krueppel-like factor) family (e.g., KLF1 (e.g., NM_006563), KLF2 (e.g., NM_016270; XM_982078; NP_057354; XP_987172), KLF3 (e.g., NM .016531; XM_994052; NP_057615; XP_999146), KLF4 (e.g., NM_004235; NM_010637; NP_004226; NP_034767), KLF5 (e.g., NM_001730; NM_009769; NP .001721; NP_033899), KLF6 (e.g., NM_001008490; NM_011803; NP_001008490; NP_035933), KLF7 (e.g., NM_003709; XM_992457; NP_003700; XP_997551), KLF8 (e.g., NM_007250; NM_173780; NP_009181; NP_776141), KLF9 (e.g., NM_001206; XM_988516; NP_001197; XP_993610), KLF 10 (e.g., NM_001032282; NM_013692; NP_001027453; NP_038720), KLF 11 (e.g., XM_001129527; NM_178357; XP_001129527; NP_848134), KLF 12 (e.g., NM_016285; NM_010636; NP_057369; NP_034766), KLF 13 (e.g., NM_015995; NM_021366; NP_057079; NP_067341), KLF 14 (e.g., NM_138693; NM_001135093; NP_619638; NP_001128565), KLF 15 (e.g., NM_014079; NM_023184; NP_054798; NP_075673), KLF16, KLF 17 (e.g., NM_173484.3; NM_029416.2; NP_775755.3; NP_083692.2)), the Myc family (e.g., c-Myc (e.g., NM_002467.4; NM_010849; NP_002458.2; NP_034979)), nanog (e.g., NM_024865.2; NM_028016.2; NP_079141.2; NP_082292.1), Lin28 (e.g., NM_024674; NM_145833; NP_078950; NP_665832) or a combination thereof. Additionally, the cell can also be contacted with a cytokine, such as basic fibroblast growth factor (bFGF) and/or stem cell factor (SCF). In one embodiment, the somatic cell is further contacted with a DNA demethylation reagent.
One embodiment provides a somatic cell derived by inducing differentiation of an induced pluripotent stem cell as disclosed herein. One embodiment also provides a method for stem cell therapy comprising: (1) isolating and collecting a somatic cell from a subject; (2) inducing said somatic cell from the subject into an iPSC (3) inducing differentiation of said iPSCs, and (4) transplanting the differentiated cell from (3) into the subject (e.g., a mammal, such as a human).
Brief Description of the Drawings
Figure 1. Establishment of mouse iPSCs with M3O-SKM. (A) Schematic drawing of MyoD-Oct4 chimeric constructs. Numbers indicate amino acid positions delimiting MyoD fragments. The basic helix-loop-helix (bHLH) domain of MyoD corresponds to amino acids 108-167, which was not used in these chimeric constructs. EO indicates a polypeptide consisting of one methionine and a chain of 20 glutamic acids fused to Oct4 (E for glutamic acid). Right column shows percentage of GFP-positive colonies derived from mouse embryonic fibroblasts (MEFs) transduced with each MyoD-Oct4 chimeric construct along with SKM and cultured on feeder cells (Fig. IB, Protocol A). Data represent the mean + SEM from three independent experiments. (B) Schematic drawings of two protocols for iPSC creation. Whereas transduced MEFs were transferred onto feeder cells on day 4 in Protocol A, MEFs were maintained feeder- free until the end of experiments in Protocol B. (C)
Emergence of GFP-positive colonies obtained with M3O-SKM with Protocol B. Bar, 200 μιη. (D) Summary of the efficiency of making GFP-positive colonies with various combinations of the M3O, Sox2, Klf4, and c-Myc genes with Protocol B. Number of GFP-positive colonies peaked by day 14. (E) Drawings of various combinations of the M3 domain and Oct4. The efficiency of making GFP-positive colonies with Protocol B in the presence of SKM is shown on the right. (F) Drawings of TAD replacement constructs in which TADs of Oct4 were replaced with the M3 domain. Constructs were transduced with SKM. (G) Drawings of fusion constructs between the M domain and Sox2 or Klf4. Sox2 mutants were transduced with OKM or M30-KM. The Klf4 mutant was transduced with OSM or M30-SM. (H) Drawings of fusion constructs between Oct4 and TADs taken from other transactivators. Constructs were transduced with SKM.
Figure 2. Characterization of mouse iPSCs prepared with M30-SKM (M30-iPSCs). (A) Comparison of GFP-positivity between colonies obtained with M 0-SKM and OSKM using Protocol B. Representative images of the GFP expression patterns used to categorize colonies are shown (top). Percentages of colonies with different GFP expression patterns were calculated from 300 colonies for M3O-SKM and OSKM (bottom). Bar, 200 μιη. (B) qRT-PCR analysis of expression levels of three pluripotency genes in MEFs and GFP- positive colonies obtained with M3O-SKM and OSKM. PCR primers specific to endogenous Oct4 and Sox2 were used for these two genes. Although GFP-positive colonies were
5 harvested on different days based on the time when the GFP signal first emerged for M3O- SKM (day 5) and OSKM (day 10), the intervals between time points is equivalent (bottom of graphs). Expression level of each gene in ESCs (CGR8.8 cells) was defined as 1.0. Five colonies were examined for each condition. Results represent the mean + SEM of three independent experiments. (C) qRT-PCR analysis of expression levels of three fibroblastic) enriched genes in MEFs and GFP-positive colonies obtained with M3O-SKM and OSKM.
Figure 3. Verification of pluripotency of mouse M30-iPSCs. (A) Expression level of transcripts in M3O-1PSCS and ESCs relative to MEFs. Log2 ratios are plotted for transcripts in ESCs/MEFs and iPSCs/MEFs. Red lines indicate a 4-fold difference in transcript levels. Transcripts in M30-iPSCs were assayed 60 days after transduction. (B) Hematoxylin and 15 eosin staining of teratoma sections derived from M30-iPSCs. Neural tube and epidermis (ectoderm), striated muscle and bone (mesoderm), and mucous gland and respiratory epithelium (endoderm) are shown. Bar, 50 μιη. (C) X gal staining for cells expressing the lacZ gene in a chimeric embryo prepared with M3O-1PSCS and a control embryo at 13.5 dpc. (D) Chimeric mice prepared with M3O-1PSCS. The agouti coat color indicates a high (right) 20 and low (left) contribution of iPSCs to the skin. The host embryos used to generate mice were derived from the albino mouse strain ICR. (E) Germline contribution of M30-iPSCs as shown by GFP expression in the gonad of a 13.5 dpc chimeric embryo. (F) Pups obtained from crossing a wild-type ICR female (bottom) with an M3O-1PSC chimeric male (left mouse in panel D).
25 Figure 4. Characterization of human iPSCs established with M3O-SKM. (A)
Immunofluorescence staining of NANOG and SSEA4 in human iPSC colonies on day 8 and 15 obtained with M3O-SKM without subculture after day 3 when transferred onto Matrigel. Bar, 100 μιη for (A) and (B). Note that day 15 colonies are substantially larger than day 8 colonies as indicated by the different magnifications. (B) Comparison of the efficiency of
30 making NANOG-positive colonies between M3O-SKM and OSKM. The number of
NANOG-positive colonies was divided by the number of seeded dermal fibroblasts at each time point. (C) Immunofluorescence staining of pluripotency markers in cloned human iPSCs obtained with M3O-SKM on day 28 after four passages. (D) Quantitative RT-PCR analysis of pluripotency genes expressed in cloned human iPSCs prepared with M3O-SKM. Ten colonies were harvested on day 30 and the mean + SEM was obtained. The expression level of each gene in human ESCs H9 was defined as 1.0. Endogenous genes were amplified for OCT4, SOX2, KLF4 and c-MYC. (E) Karyotype analysis of a human iPSC established with M30- SKM. (F) Hematoxylin and eosin staining of teratoma sections derived from human iPSCs prepared with M30-SKM. Bar, 100 μιη.
Figure 5. Chromatin analyses of the Oct4 gene in MEFs transduced with M 0-SKM (M30-MEFs) and those with OSKM (O-MEFs). (A) DNA methylation patterns at the proximal promoter of the Oct4 gene analyzed with bisulfite sequencing. Black circles indicate methylated CpG and open circles, unmethylated CpG. The proportion of
unmethylated CpG sites was calculated by dividing the number of unmethylated CpG sites by the total number of CpG sites in each cell type. (B) Flow cytometry of O-MEFs and M30- MEFs prepared with Protocol B and harvested on day 9. (C) ChIP analyses of the binding levels of Oct4, Sox2, and the Pafl complex subunits at the distal enhancer (Region 1) and initiation site (Region 2) of the Oct4 gene in M 0-MEFs and O-MEFs. Data represent the mean + SEM of three independent experiments. All y axes indicate relative enrichment (fold). Relative enrichment in ESCs was defined as 1.0. ESCs and MEFs were mixed at a 13:87 ratio in the sample labeled as ESCs+MEFs (blue). The difference of the values between the two samples indicated by an asterisk was statistically significant (p<0.01). (D) Analyses of the accessibility of the restriction enzyme Nsil to chromatin at the distal enhancer of the Oct4 gene by Southern blotting. Locations of the enzyme recognition site and probe are shown in relation to the distal enhancer of the Oct4 gene (top). The transcription initiation site was defined as position 1. Appearance of new DNA fragments following digestion with Nsil are shown (bottom). Percentage of digested chromatin was obtained by dividing the combined signal intensity of the bands at 752 and 652 bp by the combined signal intensity of the two bands and the band at 1404 bp. Cloned O-iPSCs and M30-iPSCs were used for day 30 lanes. GFP-negative population was collected by a FACS and analyzed for the day 9 GFP (-) lane of M 0-MEFs (far right). (E) ChIP analyses of the levels of three histone
modifications associated with active genes at the initiation site (Region 2) and a coding region (Region 3) of the Oct4 gene. (F) ChIP analyses of the levels of two histone
modifications associated with inactive genes at a coding region of the Oct4 gene (Region 3). Relative enrichment in MEFs was defined as 1.0.
Figure 6. Effects of M30-SKM and OSKM on expression of pluripotency markers and cell proliferation. (A) Temporal profiles of expression patterns of alkaline phosphatase. Bar, 100 μιη. (B) Temporal profiles of expression patterns of SSEAl . Bar, 100 μιη. (C) Flow cytometry comparing the expression level of SSEAl between MEFs transduced with OSKM and those transduced with M3O-SKM. (D) Cell proliferation patterns of MEFs transduced with M3O or Oct4. Means + SEM of three independent experiments are shown. (E) Cell proliferation patterns of MEFs transduced with M3O-SKM or OSKM.
Figure 7. Chromatin analyses of day 9 at the Oct4 gene comparing transduction of MEFs with different gene combinations. (A) Flow cytometry of MEFs transduced with M3O- SK and OSK. (B) DNA methylation analysis by bisulfite sequencing. MEFs were transduced with one (IF), two (2F), or three (3F) transcription factor genes. (C) ChIP studies on transcription factor binding at the distal enhancer. (D) ChIP analyses on histone
modifications associated with active genes. (E) ChIP studies on histone modifications associated with suppressed genes. (F) Hypothetical summary of epigenetic remodeling induced by M3O-SKM (right) in comparison to the lack of remodeling with OSKM (left). Binding sites for Oct4 and Sox2 are located adjacent to each other at the distal enhancer of Oct4 \ Transduced Oct4 and Sox2 cannot bind to their respective binding sites (blue box and gray box, respectively) in the majority of O-MEFs due to condensed chromatin. In contrast, M3O and Sox2 can effectively bind to each binding site in M3 O-MEFs through the effects of the unidentified binding proteins to the MyoD TAD domain. Recruitment of these proteins eventually contributes to DNA demethylation at the proximal promoter and a histone modification pattern typical of active genes at the coding region.
Figure 8. Immunoblotting of MyoD-Oct4 fusion proteins. Expression of transduced MyoD-Oct4 fusion genes was evaluated with an antibody against Oct4 (top). Expression of histone H2A was examined as a loading control (bottom). Bands correspond to the predicted molecular mass of each protein. Identities of extra bands marked with asterisks are unknown.
Figure 9. ChIP analyses of the Sox2 gene. (A) Binding of Oct4 and Sox2 at the enhancer. (B) Binding of parafibromin and the levels of histone modifications associated with active genes on day 9. (C) Levels of histone modifications associated with suppressive genes on day 9.
Figure 10. ChIP analyses on day 9 of the Oct4 gene comparing transduction of one
(IF), two (2F), three (3F) and four (4F) transcription factor genes. (A) Transcription factor binding. (B) Histone modifications associated with gene activation.
Figure 11. ChIP analyses on day 9 of the Sox2 gene comparing transduction of one (IF), two (2F), three (3F) and four (4F) transcription factor genes. (A) Transcription factor binding at the enhancer. (B) Histone modifications associated with gene activation and suppression.
Detailed Description of the Invention
iPSC technology is the process of converting an adult specialized cell, such as a skin cell, into a stem cell, a process known as dedifferentiation. iPSCs can be very useful in clinical as well as preclinical settings. For example, iPSCs can be created from human patients and differentiated into many tissues to provide new materials for autologous transplantation, which can avoid immune rejection of the transplanted tissues. For example, pancreatic beta cells differentiated from a patient's iPSCs can be transplanted into the original patient to treat diabetes. Also, iPSCs derived from a patient can be differentiated into the ailing tissue to be used in an in vitro disease model. For example, study of dopaninergic neurons differentiated from a Parkinson's disease patient can provide unprecedented clues for the pathogenesis of the disease. In vi/ra-differentiated cells derived from iPSCs can be used for drug screening. For instance, many drugs are metabolized in the liver, but there have been no ideal liver cells that can be cultured for a long term for in vitro screening of drug toxicity. Also, iPSCs provide a new opportunity to understand the mechanisms underlying the plasticity of cell differentiation. Thus, the potential of iPSCs for many fields of life science is tremendous.
However, the process of generating iPSCs is slow and inefficient. With the standard protocol, MEFs are transduced with OSKM on day 1 and the cells are transferred onto feeder cells composed of irradiated fibroblasts, which provide a poorly characterized, but optimal environment for the generation of iPSCs, on day 5. iPSC colonies emerge around day 10, which are then picked up and expanded over the next two to three weeks on feeder cells to establish purified iPSC lines. Eventually, only 0.1 % of the transduced fibroblasts turn into iPSCs. This slow process and extremely low efficiency make production of iPSCs costly.
It is disclosed herein that a fusion protein combining, for example, the stem cell factor Oct4 (a homeodomain transcription factor associated with undifferentiated cells) with a portion of another protein factor, for example, a transactivation domain, such as that of MyoD, can accelerate the process of making iPSCs. It is also shown herein that heterologous transactivation domains, including the MyoD TAD, promote global chromatin remodeling of stem cell genes. Thus, the process disclosed herein improves the efficiency and quality of iPSCs.
Definitions
As used herein, the terms below are defined by the following meanings:
Induced pluripotent stem cells, commonly abbreviated as iPSCs, are a type of pluripotent stem cell obtained from a non-pluripotent cell, typically an adult somatic cell (a cell of the body, rather than gametes or an embryo), by inducing a "forced" expression of certain genes. iPSCs are believed to be similar to natural pluripotent stem cells, such as ESCs in many respects, such as the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, and potency and differentiability.
iPSCs are not adult stem cells, but rather reprogrammed cells (e.g., epithelial cells) given pluripotent capabilities. Using genetic reprogramming with protein transcription factors, pluripotent stem cells equivalent to embryonic stem cells have been derived from human adult skin tissue. Shinya Yamanaka and his colleagues at Kyoto University used the transcription factors Oct3/4, Sox2, c-Myc, and Klf4 in their experiments on cells from humans. Junying Yu, James Thomson, and their colleagues at the University of Wisconsin- Madison used a different set of factors, Oct4, Sox2, Nanog and Lin28, and carried out their experiments using cells from human foreskin to generate iPS cells.
The term "isolated" refers to a factor(s), cell or cells which are not associated with one or more factors, cells or one or more cellular components that are associated with the factor(s), cell or cells in vivo.
"Cells" include cells from, or the "subject" is, a vertebrate, such as a mammal, including a human. Mammals include, but are not limited to, humans, farm animals, sport animals and companion animals. Included in the term "animal" is dog, cat, fish, gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey (e.g., ape, gorilla, chimpanzee, orangutan), rat, sheep, goat, cow and bird.
An "effective amount" generally means an amount which provides the desired local or systemic effect and/or performance.
"Pluripotency" refers to a stem cell that has the potential to differentiate into one, two or three of the three germ layers: endoderm (e.g., interior stomach lining, gastrointestinal tract, the lungs), mesoderm (e.g., muscle, bone, blood, urogenital), or ectoderm (e.g., epidermal tissues and nervous system). Pluripotent stem cells can give rise to any fetal or adult cell type.
"Transdifferentiation" is when a non-stem cell transforms into a different type of cell, or when an already differentiated stem cell creates cells outside its already established differentiation path.
A "transcription factor" (sometimes called a sequence- specific DNA-binding factor) is a protein that binds to specific DNA sequences, thereby controlling the transfer (or transcription) of genetic information from DNA to mRNA. Transcription factors perform this function alone or with other proteins or factors in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase (the enzyme that performs the transcription of genetic information from DNA to RNA) to specific genes. Generally, a defining feature of transcription factors is that they contain one or more DNA-binding domains (DBDs), which attach to specific sequences of DNA adjacent to the genes that they regulate.
A "transcription activation domain," "transactivation domain" or "trans-activating domain" is generally that portion of a transcription factor that is responsible for recruitment of the transcription machinery needed to transcribe RNA. Transactivation is an increased rate of gene expression triggered either by biological processes or by artificial means.
Transactivation can be triggered either by endogenous cellular or viral proteins - transactivators. These protein factors act in trans (i.e., intermolecularly). An "unrelated" or "heterologous transactivation domain" refers to a transactivation domain that is not normally associated with the gene/protein (e.g., transcription factor) of interest (not wild-type).
By "pure" it is meant that the population of cells has the desired purity. For example, iPSC populations can comprise mixed populations of cells. Those skilled in the art can readily determine the percentage of iPSCs in a population using various well-known methods, such as fluorescence activated cell sorting (FACS). Preferable ranges of purity in populations comprising iPSCs are about 1 to about 5%, about 5 to about 10%, about 10 to about 15%, about 15 to about 20%, about 20 to about 25%, about 25 to about 30%, about 30 to about 35%, about 35 to about 40%, about 40 to about 45%, about 45 to about 50%, about 50 to about 55%, about 55 to about 60%, about 60 to about 65%, about 65 to about 70%, about 70 to about 75%, about 75 to about 80%, about 80 to about 85%, about 85 to about 90%, about 90% to about 95% or about 95 to about 100%. Purity of the cells can be determined for example according to the cell surface marker profile within a population.
The terms "comprises," "comprising," and the like can have the meaning ascribed to them in U.S. Patent Law and can mean "includes," "including" and the like. As used herein, "including" or "includes" or the like means including, without limitation.
Rapid and Efficient Production of iPSCs Through the processes disclosed herein, iPSC colonies emerge as early as about five days (day 5) after transduction of a transactivator domain (or a portion thereof) fused to a transcription factor (or a portion thereof), e.g., M30 (short transactivation domain of MyoD (about 50 to 60 amino acids) fused to the amino terminus of the full-length Oct4), Sox2, Klf4, and c-Myc without feeder cells. The preparation of the nucleic acid molecule coding for the fusion protein(s) as well as the construct(s) of Sox, Klf, c-Myc etc. (either singly or on a polycistronic RNA) can be carried out by methods available to an art worker as well as the transduction thereof into cells (see, for example, Sambrook, Molecular Cloning: A Laboratory Manual).
iPSCs established with the standard OSKM protocol frequently contain partially reprogrammed cells and even established iPSCs occasionally lose pluripotency during prolonged cultures. In contrast, the iPSCs disclosed herein retain pluripotency more tightly and heterogeneity among different colonies is much less apparent than that with the OSKM iPSCs. In addition, iPSC colonies can be obtained without c-Myc (use only M30, Sox2 and Klf4) at the efficiency of 0.44% around day 7. iPSCs have been prepared without c-Myc (use OSK) before, but the efficiency was low (<0.01 ) and it generally took 30 to 40 days for iPSCs to emerge 2 ' 3. Additionally, this transactivation domain-based strategy can be applied to amplify the effects of other transcription factors to facilitate their reprogramming capability of cell differentiation. In summary, the use of a TAD, such as the M3 domain, has made iPSC production faster, easier, feeder-free and more efficient than the standard OSKM or other protocols.
Thus, as discussed above, the fusion technology, such as the M30, technology disclosed herein has significant advantages over wild-type Oct4 (or other transcription factors) in generating iPSCs. First, the fusion technology is faster. While iPSC colonies appear at about day 10 with the standard OSKM protocol (see, Cell Stem Cell 2008, 3, 595 for a general protocol for making iPSCs), iPSC colonies emerge on day 5 with the fusion technology (e.g., M30-SKM). Second, efficiency of making iPSCs is more than 50-fold higher with the fusions technology (e.g., M30-SKM) than that with OSKM. Third, purer iPSCs populations can be obtained with the fusions technology described herein (e.g., M 0- SKM) compared with OSKM. Fourth, the fusion technology described herein (e.g., M 0-
SKM) does not require feeder cells unlike OSKM. This is noted especially for making iPSCs for transplantation purposes because one would generally need to use patient-derived fibroblasts as feeder cells to avoid immune rejection. Also, the use of feeder cells adds an extra step to make iPSCs. Feeder-free iPSCs have been reported, but they are derived from already undifferentiated cells, such as adipose stem cells. Fibroblasts generally require feeder cells to become iPSCs. Finally, iPSCs can be prepared using only M30, Sox2 and Klf4 (without c-Myc).
Generally, genes which can be used to create induced pluripotent stem cells, either singly, in combination or as fusions with transactivation domains, include, but are not limited to, one or more of the following: Oct4 (Oct3/4, Pou5fl), Sox (e.g., Soxl, Sox2, Sox3, Soxl8, or Soxl5), Klf (e.g., Klf4, Klfl, Klf3, Klf2 or Klf5), Myc (e.g., c-myc, N-myc or L-myc), nanog, or LIN28. As examples of sequences for these genes and proteins, the following accession numbers are provided: Mouse MyoD: M84918, NM_010866; Mouse Oct4
(POU5F1): NM_013633; Mouse Sox2: NM_011443; Mouse Klf4: NM_010637; Mouse c- Myc: NM_001177352, NM_001177353, NM_001177354; Mouse Nanog: NM_028016;
Mouse Lin28: NM_145833; Human MyoD: NM_002478; Human Oct4 (POU5F1):
NM_002701, NM_203289, NM_001173531; Human Sox2: NM_003106; Human Klf4:
NM_004235; Human c-Myc: NM_002467; Human Nanog: NM_024865; and/or Human Lin28: NM_024674, for portions or fragments thereof and/or any related sequence available to an art worker (these sequences are incorporated by referenced herein). For example, sequences for use in the invention have at least about 50% or about 60% or about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, or about 79%, or at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, or about 89%, or at least about 90%, about 91%, about 92%, about 93%, or about 94%, or at least about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity compared to the sequences and/or accession numbers provided herein and/or any other such sequence available to an art worker, using one of alignment programs available in the art using standard parameters or hybridization techniques. In one embodiment, the differences in sequence are due to conservative amino acid changes. In another embodiment, the protein sequence or DNA sequence has at least 80% sequence identity with the sequences disclosed herein and is bioactive (e.g., retains activity).
Methods of alignment of sequences for comparison are available in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.
During and after preparation of iPSCs, the cells can be cultured in culture medium that is established in the art and commercially available from the American Type Culture Collection (ATCC), Invitrogen and other companies. Such media include, but are not limited to, Dulbecco's Modified Eagle's Medium (DMEM), DMEM F12 medium, Eagle's Minimum Essential Medium, F-12K medium, Iscove's Modified Dulbecco's Medium, Knockout D- MEM, or RPMI-1640 medium. It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as needed for the cells used. It will also be apparent that many media are available as low-glucose formulations, with or without sodium pyruvate.
Also contemplated is supplementation of cell culture medium with mammalian sera.
Sera often contain cellular factors and components that are needed for viability and expansion. Examples of sera include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), human serum, chicken serum, porcine serum, sheep serum, rabbit serum, rat serum (RS), serum replacements (including, but not limited to, KnockOut Serum Replacement (KSR,
Invitrogen)), and bovine embryonic fluid. It is understood that sera can be heat-inactivated at 55-65°C if deemed needed to inactivate components of the complement cascade. Modulation of serum concentrations, or withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. In one embodiment, the cells are cultured in the presence of FBS /or serum specific for the species cell type. For example, cells can be isolated and/or expanded with total serum (e.g., FBS) or serum replacement concentrations of about 0.5% to about 5% or greater including about 5% to about 15% or greater, such as about 20%, about 25% or about 30%. Concentrations of serum can be determined
empirically.
Additional supplements can also be used to supply the cells with trace elements for optimal growth and expansion. Such supplements include insulin, transferrin, sodium selenium, and combinations thereof. These components can be included in a salt solution such as, but not limited to, Hanks' Balanced Salt Solution™ (HBSS), Earle's Salt Solution™, antioxidant supplements, MCDB-201™ supplements, phosphate buffered saline (PBS), N-2- hydroxyethylpiperazine-N' -ethanesulfonic acid (HEPES), nicotinamide, ascorbic acid and/or ascorbic acid-2-phosphate, as well as additional amino acids. Many cell culture media already contain amino acids; however some require supplementation prior to culturing cells. Such amino acids include, but are not limited to, L-alanine, L-arginine, L-aspartic acid, L- asparagine, L-cysteine, L-cystine, L-glutamic acid, L-glutamine, L-glycine, L-histidine, L- inositol, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L- serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine.
Antibiotics are also typically used in cell culture to mitigate bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to, amphotericin (Fungizone™), ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin.
Hormones can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, β-estradiol,
hydrocortisone, insulin, prolactin, progesterone, somatostatin/human growth hormone (HGH), thyrotropin, thyroxine, and L-thyronine. β-mercaptoethanol can also be supplemented in cell culture media. Lipids and lipid carriers can also be used to supplement cell culture media, depending on the type of cell and the fate of the differentiated cell. Such lipids and carriers can include, but are not limited to cyclodextrin (α, β, γ), cholesterol, linoleic acid conjugated to albumin, linoleic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic-oleic- arachidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others. Albumin can similarly be used in fatty-acid free formulation.
Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components and synthetic or biopolymers. Cells often require additional factors that encourage their attachment to a solid support (e.g., attachment factors) such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, "superfibronectin" and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L- lysine, Matrigel™, thrombospondin, and/or vitronectin.
Cells can be cultured at different densities, e.g., cells can be seeded or maintained in the culture dish at different densities. For example, for cells to be dedifferentiated or iPSCs, the cells can be seeded or maintained at low or high cell densities. For example, at densities, including, but not limited to, densities of less than about 2000 cells/well of a 12-well plate (for example, 12-well flat-bottom growth area: 3.8cm well volume: 6.0 ml or well ID x depth (mm) 22.1x17.5; well capacity (ml) 6.5, growth area (cm ) 3.8), including less than about 1500 cells/well of a 12-well plate, less than about 1,000 cells/well of a 12-well plate, less than about 500 cells/well of a 12-well plate, or less than about 200 cells/well of a 12-well plate. The cells can also be seeded or maintained at higher densities, for example, great than about 2,000 cells/well of a 12-well plate, greater than about 2,500 cells/well of a 12-well plate, greater than about 3,000 cells/well of a 12-well plate, greater than about 3,500 cells/well of a 12-well plate, greater than about 4,000 cells/well of a 12-well plate, greater than about 4,500 cells/well of a 12-well plate, greater than about 5,000 cells/well of a 12-well plate, greater than about 5,500 cells/well of a 12-well plate, greater than about 6,000 cells/well of a 12-well plate, greater than about 6,500 cells/well of a 12-well plate, greater than about 7,000 cells/well of a 12-well plate, greater than about 7,500 cells/well of a 12-well plate or greater than about 8,000 cells/well of a 12-well plate.
The maintenance conditions of cells cultures can also contain cellular factors that allow cells, such as the iPSCs of the invention, to remain in an undifferentiated form. It may be advantageous under conditions where the cell must remain in an undifferentiated state of self -renewal for the medium to contain epidermal growth factor (EGF), platelet derived growth factor (PDGF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF) and combinations thereof. It is apparent to those skilled in the art that supplements that allow the cell to self-renew (e.g., to produce replicate daughter cells having differentiation potential that is identical to those from which they arose; a similar term used in this context is "proliferation"), but not differentiate should be removed from the culture medium prior to differentiation. It is also apparent that not all cells will require these factors.
Examples
The following examples are provided in order to demonstrate and further illustrate certain embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof. Example 1
MATERIALS AND METHODS
Preparation of mouse iPSCs
Full-length and deletion mutants of mouse Oct4 cDNA were fused with various TADs and inserted into the pMXs-IP vector 4. Polycistronic cDNAs encoding Sox2, Klf4 and c-Myc were transferred from the 4F2A lentiviral vector 5 to the pMXs-IP vector. pMXs-IP vectors encoding OSKM separately (Addgene) were also used in some experiments. These pMXs-IP vectors were transfected into Plat-E cells 6 with Fugene 6 (Roche). Virus supernatant was harvested 48 and 72 hr later and filtered through a 0.45 μιη syringe filter. MEFs were prepared from Oct4-GFP mice which harbour an IRES-green fluorescence protein (GFP) fusion cassette downstream of the stop codon of the Oct4 gene (Jackson Laboratory #008214) . All animal experiments were conducted in accordance with the animal experiment guidelines of University of Minnesota. For chimera experiments, MEFs were prepared from mice that harbour the Oct4-GFP allele and ROSA26-/acZ allele. MEFs were seeded at 3xl05 cells/6cm dish on day -2 in DMEM with 10% fetal bovine serum (FBS). Fresh virus supernatant was added to MEFs on day -1 and day 0 with 10 g/ml polybrene. Culture medium was then changed to iPSC medium (DMEM, 15% fetal bovine serum, 100 μΜ MEM non-essential amino acids, 55 μΜ 2-mercaptoethanol, 2 mM L-glutamine and 1000 u/ml leukemia inhibitory factor) on day 1. Transduced MEFs were subcultured onto irradiated SNL feeder cells at 2xl05cells/6 cm dish on day 4 and maintained on the feeder cells in Protocol A. The maximum number of GFP-positive colonies obtained around day 18 was divided by 2xl05 to obtain the efficiency of making iPSCs. In Protocol B, transduced MEFs were maintained without feeder cells. GFP-positive colonies were picked up around day 10 to clone without feeder cells for pluripotency analyses. Retrovirus titer was measured using NIH3T3 cells as described . All recombinant DNA research was conducted following the NIH guidelines.
Preparation of human iPSCs
Full-length human OCT4 cDNA fused with the M3 domain of human MYOD at the amino terminus was inserted into the pMXs-IP vector. pMXs-IP vectors encoding human M30, OCT4, SOX2, KLF4 and c-MYC (Addgene) were transfected into Plat-A cells (Cell Biolabs) with Lipofectamin 2000 (Invitrogen). Virus supernatant was harvested 48 and 72 hrs later (day -1 and 0, respectively below), filtered through a 0.45 μιη syringe filter and transduced into dermal fibroblasts obtained from a 34-year-old Caucasian female (Cell Applications). On day -2, 2.7xl04 fibroblasts were plated in each well of a 12-well plate in DMEM with 10% fetal bovine serum. Fresh virus supernatant was added to the fibroblasts on day -1 and day 0 with 10 μg/ml polybrene. On day 3 cells were harvested with trypsin and subcultured at 1.7xl04 cells per well in 12-well plates coated with BD Matrigel hESC- qualified Matrix (BD Biosciences) in human iPSC medium (KnockOut DMEM F-12
(Invitrogen), 20% Knockout Serum Replacement (Invitrogen), ΙΟΟμΜ MEM non-essential amino acids, 1% insulin-transferrin-selenium (Invitrogen), O.lmM 2-mercaptoethanol, 2 mM L-glutamine and 4 ng/ml basic FGF). The medium was changed every other day.
Chromatin accessibility to Nsil
One million cells were resuspended in ice-cold lysis buffer containing 0.1% NP40 and incubated on ice for 5 min as previously described 9. Nuclei were isolated with centrifugation at 4,000x g for 5 min and digested with 200u/ml Nsil for 2 hr at 37°C. DNA was purified and double-digested with Mspl and BamHI, followed by Southern blotting using the radioactive probe shown in Fig. 5D.
Immunoblotting
MEFs were transduced with MyoD-Oct4 fusion genes and analyzed with
immunoblotting five days after transduction. All antibodies are listed in supplemental Table 1. SuperSignal West Dura (Thermo Scientific) was used to detect chemiluminescence signal.
Table 1
Antibodies used in immunoblotting, immunofluorescence staining and ChIP
Immunoblotting (primary antibodies)
Figure imgf000020_0001
Immunoblotting (secondary antibodies)
Figure imgf000020_0002
Immunofluorescence staining (primary antibodies)
Figure imgf000020_0003
Immunofluorescence staining (secondary antibodies)
Figure imgf000020_0004
Antigen Manufacturer Catalog # Oct4 Santa Cruz Biotechnology sc-9081
Sox2 Santa Cruz Biotechnology sc- 17320
Parafibromin Bethyl Laboratories A300-170A
Pafl Abeam ab-20662
Leol Abeam ab-70630
H3K4me3 Abeam ab-1012
H3K9ac Abeam ab-4441
H3K14ac Millipore 07-353
H3K9me3 Millipore 07-523
H3K27me3 Millipore 07-449
Control IgG Santa Cruz Biotechnology sc-2027
Fluorescence microscopy
iPSCs were fixed with 4% formaldehyde for 10 min and permeabilized with 0.5% Triton X-100 for 3 min. Cells were then incubated with primary antibody and secondary antibody for 1 hr each at 25°C. DNA was counterstained with Hoechst 33342. Used antibodies are listed in Table 1. Fluorescence signal was captured with a lOx A-Plan Phi Varl objective (numerical aperture 0.25) and an AxioCam charge coupled device camera attached to an Axiovert 200M fluorescence microscope (all from Zeiss). Photoshop 7.0 (Adobe Systems) was used for image processing.
Alkaline phosphatase staining
Alkaline phosphatase was detected with an Alkaline Phosphatase Detection Kit (Millipore SCR004).
Flow cytometry
The percentage of GFP-positive or SSEA1 -positive cells at each time point was determined with a FACSCalibur flow cytometer and analyzed using CellQuest Pro software
(both BD Biosciences).
Quantitative RT-PCR (qRT-PCR)
cDNA for mPvNA was prepared from iPSC colonies using a Cells-to-cDNA II kit
(Ambion). qRT-PCR was performed with GoTaq qPCR Master mix (Promega) on a Realplex 2S system (Eppendorf). PCR primer sequences are listed in Table 2. Expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize the expression levels of mRNAs. The feeder-free ESC line CGR8.8 was used as a positive control.
Table 2
Primers used for quantitative RT-PCR, bisulfite sequencing and ChIP
Quantitative RT-PCR (mouse) Gene Forward Reverse
Oct4 endogenous TCTTTCCACCAGGCCCCCGGCTC TGCGGGCGGACATGGGGAGATCC
(SEQ ID NO: 36) (SEQ ID NO:37)
Sox2 endogenous AAAGGAGAGAAGTTTGGAGCCCGA GGGCGAAGTGCAATTGGGATGAAA
(SEQ ID NO:38) (SEQ ID NO:39)
Nanog AGCAGAAGATGCGGACTGTGTTCT CCGCTTGCACTTCATCCTTTGGTT
(SEQ ID NO:40) (SEQ ID NO:41)
Thyl GCCTGACCCGAGAGAAGAAGAAG TGGTGGTGAAGTTCGCTAGAGTAAG
(SEQ ID NO:42) (SEQ ID NO:43)
Col6a2 CCACCACTGAAAGGAACAACAA TCCAACACGAAATACACGTTGAC
(SEQ ID NO:44) (SEQ ID NO:45)
Fgf7 CCATGAACAAGGAAGGGAAA (SEQ TCCGCTGTGTGTCCATTTAG (SEQ ID
ID NO:46) NO:47)
GAPDH TGCACCACCAACTGCTTAG (SEQ ID GATGCAGGGATGATGTTC (SEQ ID
NO:48) NO:49)
Quantitative RT-PCR (human)
Figure imgf000022_0001
Bisulfite sequencing
Figure imgf000022_0002
ChIP
Figure imgf000023_0001
DNA microarray analysis
RNA was prepared from CGR8.8 cells, MEFs, and a mouse iPSC clone prepared with the fusion gene between the M3 domain of MyoD and Oct4 (M30-iPSC) on day 60 with the PureLink RNA total RNA purification system (Invitrogen). RNA was amplified and labeled using the Agilent Quick AmpLabeling Kit (Agilent Technologies) following the
manufacturer's protocol. cRNA was hybridized overnight to Agilent Whole Murine Genome Oligo Microarray using the Agilent Gene Expression Hybridization Kit. The fluorescence signals of the hybridized microarrays were detected using Agilent's DNA Microarray Scanner. The Agilent Feature Extraction Software was used to read out and process the image files. Data were processed and visualized with Spotfire DecisionSite for Functional Genomics software. DNA microarray data have been deposited in the NCBI GEO database under the accession number GSE22327.
Karyotyping of human iPSCs
Adherent cells were arrested with colcemid, harvested, treated with 75mM KC1 hypotonic solution, and fixed with methanol and acetic acid at 3: 1. The cells were spread onto glass slides and stained with Wright-Giemsa stain. G-banded metaphases were evaluated using an Olympus BX61 microscope outfitted with lOx and lOOx objectives. Metaphase cells were imaged and karyotyped using Applied Spectral Imaging (ASI) software.
Aggregation chimera and teratoma formation
Ten M30-iPSCs of a cloned line were transferred into a microdrop of KSOMaa solution (Millipore) with a zona-free 8-cell stage mouse embryo of the ICR strain (albino) after brief exposure to acidic Tyrode' s solution (Millipore). Aggregated morula stage embryos at 2.5 days post coitum (dpc) that contained GFP-positive iPSCs were transferred into the uteri of 2.5 dpc pseudopregnant recipient mice. Embryos at 13.5 dpc were analyzed for chimera formation with X gal stain or for germline transmission with a fluorescence microscope. To prepare teratomas, one million cloned mouse or human M30-iPSCs were injected into the limb muscle of NOD/SCID mice. Teratomas were fixed with 10% formalin and embedded with paraffin after three weeks for mouse iPSCs and eight weeks for human iPSCs. Five-μιη thick sections were stained with haematoxylin and eosin for histological analysis.
Chromatin immunoprecipitation (ChIP)
ChIP was performed as described in the instruction of the EZ Magna ChIP G kit
(Millipore). All antibodies are listed in Table 1. PCR primer sequences are listed in Table 2.
PCR amplification levels were first normalized against the value obtained with control IgG.
The normalized values with ESCs or MEFs were then defined as 1.0 depending on antibodies to obtain relative expression levels in other cells.
DNA methylation analysis
Genomic DNA from mouse iPSCs was treated with bisulfite with an EZ DNA
Methylation-Gold kit (Zymo Research). The DNA sequence at the Oct4 proximal promoter region was amplified with PCR using the primers listed in Table 2 and cloned into the pCR2.1-TOPO vector (Invitrogen) for sequencing.
RESULTS
Generation of mouse iPSCs with heterologous transactivation domains
Full-length mouse Oct4 was fused with various fragments of mouse MyoD (Fig. 1A). The basic helix-loop-helix (bHLH) domain of MyoD, used for dimerization and DNA binding, was not included in these constructs to avoid activation of MyoD-target genes. Each chimeric gene was co-transduced with a polycistronic retroviral vector encoding mouse Sox2, Klf4, and c-Myc (SKM) 5 into MEFs derived from Oct4-GFP mice, which contain the GFP gene knocked into the Oct4 locus . In this model, formation of GFP-positive colonies indicates that individual MEFs develop into Oct4-expressing cells capable of clonal growth. Expression of chimeric proteins was confirmed through immunoblotting with antibodies against Oct4 (Fig. 8). As a control, MEFs were transduced with OSKM (O-MEFs) on day -1 and 0 and transferred these cells onto SNL feeder cells on day 4 following a standard protocol (Fig. IB, Protocol A). GFP-positive colonies emerged around day 10, gradually increasing in number until reaching a peak by day 18. To calculate the percentage of MEFs that were reprogrammed into iPSCs, the number of GFP-positive colonies were divided by the total number of MEFs seeded in a culture dish. It was estimated that 0.08+0.09% of O-MEFs were converted into GFP-positive cells, which is similar to previous reports 8 ' 10 (Fig. 1A, right column). MEFs were then transduced with each chimeric gene along with SKM and followed the protocol described above (Protocol A). M30 with SKM (M30-SKM) increased the percentage of GFP-positive colonies most drastically, with 5.10+0.85% of MEFs (M30- MEFs) being transformed into GFP-positive cells by day 15. The M3 region encompasses the acidic transactivation domain (TAD) of MyoD (amino acids 3-56) 11. However, the simple presence of acidity was insufficient to facilitate iPSC formation, as evidenced by a lack of increase in GFP-positive colonies in MEFs transduced with M60, which also contains the main acidic amino acid cluster, or a chain of 20 glutamic acids attached to Oct4 (EO) (Fig. 1A). The high efficiency with which M 0 created iPSCs as compared to Oct4 was not simply due to a difference in the retrovirus titer for the two virus suspensions. The titer for the M 0 virus and Oct4 virus was 1.8+0.2x10 7 and 2.1+0.4x107 colony forming units/ml, respectively.
While conducting the above experiments, it was noticed that GFP-positive colonies emerged from M 0-MEFs on about day 5 without transfer onto feeder cells (Fig. IB, Protocol B), and these colonies steadily increased in size and number (Fig. 1C). By around day 12, 3.6+0.5% of M30-MEFs formed GFP-positive colonies in the absence of feeder cells, perhaps supported by the surrounding MEFs serving as "autologous" feeder cells (Fig. ID). In contrast, GFP-positive colonies emerged from O-MEFs between day 16 and 18 at an extremely low efficiency (0.0035+0.0006%) with the same protocol. It was next tested if GFP-positive colonies could be obtained without Sox2, Klf4, or c-Myc in the presence of M30 with Protocol B (Fig. ID). Although M30 still required Sox2 and Klf4, c-Myc was dispensable. Previous studies have reported that iPSCs can be established without c-Myc 2 ' 3 ; however, the uniqueness of M 0-SK lies in the speed and efficiency with which GFP-positive colonies form. While it requires three to four weeks and the presence of feeder cells for OSK to induce GFP-positive colonies at an efficiency of around 0.01% 2 ' 3 , M30-SK could generate GFP-positive colonies without feeder cells by day 7 after transduction at an efficiency of 0.44%, over 40-fold more efficient than OSK.
These striking differences between M30 and Oct4 prompted the evaluation of the specificity of the M30 configuration in relation to other host factors and TADs taken from other transcription factors using Protocol B. First, the location and number of the M domains in the fusion protein with Oct4 were changed (Fig. IE). Second, the two TADs in Oct4 12 were replaced with the M3 domain in various combinations (Fig. IF). Third, the M3 domain was fused to Sox2 or Klf4 and tested in combination with other members of OSKM and M 0 (Fig. 1G). OM3 was as effective as M30 in iPSC creation. In a fourth experiment, TADs taken from other powerful transactivators were fused to Oct4 (Fig. 1H), including the TADs
13
from Tax of human T-lymphotropic virus type 1 (HTLV- 1) , Tat of human
immunodeficiency virus type 1 (HIV- 1) 14'15, Gata4 16,17 and Mef2c 11.
Characterization of M3O-1PSCS
The GFP-positive colonies that emerged on day 5 following transduction with M30- SKM using Protocol B contained 31-143 cells in 12 colonies, with a median of 43 cells/colony. This number of cells would be produced after less than seven cell divisions assuming even division for each cell, which is strikingly small compared to the median of 70
18
cell divisions needed before GFP-positive cells appear with OSKM . The colonies that emerged with M 0-SKM were usually homogenously GFP-positive from the beginning. On day 7 over 97% of these colonies were homogeneously GFP-positive with Protocol B compared to around 5% of colonies derived with OSKM obtained on day 12 with Protocol A (Fig. 2A). Protocol A was used for OSKM. As a result, GFP-positive colonies were harvested at different time points corresponding to two days after the onset of GFP activation.
The quality of GFP-positive colonies obtained with M 0-SKM and OSKM were compared by quantitative RT-PCR (qRT-PCR) analysis of three pluripotency genes
(endogenous Oct4, endogenous Sox2, and Nanog) and three fibroblast-enriched genes (Thyl, Col6a2, and Fgf 19-21. Homogeneously GFP-positive colonies obtained with M 0-SKM using Protocol B and those with OSKM using Protocol A were selected to represent the colonies for each group. Although cells were harvested at different time points corresponding to the onset of GFP activation, the interval between time points is the same. For OSKM, expression of the three pluripotency genes gradually increased during the initial week after emergence of GFP-positive colonies, indicating a slow maturation process toward
pluripotency (Fig. 2B). For M30-SKM, in contrast, levels of these transcripts reached or exceeded those seen in ESCs at the time of the emergence of GFP-positive colonies and remained at similar levels until day 30. This differential efficiency of transcriptional reprogramming was also evident with suppression of the three fibroblast-enriched genes. For M30-SKM, expression levels of these genes on day 5 when the GFP signal was apparent were comparable to those seen in ESCs, but it took around one week after the activation of GFP for OSKM to accomplish the same level of gene suppression (Fig. 2C). Together, these results indicate that M 0-SKM can reprogram MEFs to an iPSC state more efficiently than OSKM.
The pluripotency of iPSC clones prepared with M3O-SKM following Protocol B (M3O-1PSCS) was verified using three standard approaches. First, genome-wide transcript analysis demonstrated highly similar gene expression in M3O-1PSCS and ESCs. Out of 41,160 probes, 3,293 were greater than 4-fold differentially expressed (up- or down-regulated) in both ESCs and cloned iPSCs compared to MEFs (Fig. 3A). The commonly up-regulated genes included eight ECS-enriched genes, such as Oct4, Sox2 and Nanog. In addition, Thyl, Col6a2 and Fgf7 were down-regulated more than 16-fold in both ESCs and iPSCs. Second, intramuscular injection of M30-iPSCs into an NOD/SCID mouse resulted in teratoma formation as shown by the presence of various tissues derived from the three germ layers (Fig. 3B). Third, aggregation of 8-cell stage embryos of the ICR strain with M3O-1PSCS containing the Oct4-GFP allele and ROSA26-/acZ allele formed chimeric mice (Fig. 3C, 3D). M30- iPSCs contributed to germ cells in some chimeric mice (Fig. 3E). When one of the chimeric males (Fig. 3D left) was crossed with a wild-type female ICR mouse (Fig. 3F, white adult at bottom), all 11 pups showed agouti or black coat color (Fig. 3F).
Establishment of human iPSCs with M3O-SKM
Next it was evaluated if M30 could also facilitate generation of human iPSCs in comparison to OSKM. Human M3O-SKM and OSKM were transduced into human dermal fibroblasts prepared from a 34-year-old female. Because these cells did not harbor a transgene that could be used as a convenient marker for reprogramming, expression of the pluripotency protein NANOG was monitored by immunofluorescence staining as an iPSC indicator. NANOG-positive human ESC-like colonies emerged around day 8 with M3O-SKM, with the number increasing by around day 15 when 0.30+0.033% of the original fibroblasts were converted to iPSC colonies (Fig. 4A, 4B). In contrast, when OSKM was transduced, NANOG-positive colonies did not emerge until around day 12 and eventually only
0.0052+0.0018% of the fibroblasts were turned into iPSC colonies. This indicates 58-fold increased efficiency with M3O-SKM in comparison to OSKM. Furthermore, while less than 10% of the colonies that appeared with OSKM were NANOG positive, more than 90% of the colonies produced with M3O-SKM were NANOG-positive, consistent with the results for mouse iPSCs. Cloned iPSCs prepared with M3O-SKM also expressed endogenous OCT4 and surface markers SSEA4, TRA-1-60 and TRA-1-81 on day 28 (Fig. 4C). Transduced M30 was suppressed by this day (not shown). In addition, iPSCs prepared with M3O-SKM expressed twelve pluripotency genes as demonstrated by quantitative RT-PCR (Fig. 4D). All twenty mitotic spreads prepared from a cloned M3O-SKM iPSCs demonstrated normal karyotypes (Fig. 4E). Finally, they formed teratomas when injected into an NOD/SCID mouse (Fig. 4F), proving pluripotency of the cells.
Chromatin analyses of pluripotency genes in M3O-MEFS
To understand how M3O-SKM facilitated nuclear reprogramming at the molecular level, several chromatin changes at the Oct4 gene were examined during the early phase of iPSC generation. All analyses were performed with Protocol B on all MEFs in a culture dish including GFP-positive and -negative cells without subculture for 9 days. First, changes in DNA methylation at the promoter of the Oct4 gene were studied. CpG dinucleotides at the proximal promoter of the Oct4 gene are heavily methylated in MEFs, unlike in ESCs and iPSCs 22 (Fig. 5A), and this serves as a major inhibitory mechanism for Oct4 transcription. While the number of unmethylated CpG sites remained essentially the same on day 9 in O- MEFs, the number increased approximately twofold in M30-MEFs on the same day (Fig. 5A, 25.5% vs 55.5%). The more advanced demethylation in M30-MEFs than in O-MEFs is consistent with the higher percentage of GFP-positive cells in M 0-MEFs than in O-MEFs on day 9 (12.77% vs 0.52%) as shown by flow cytometry (Fig. 5B).
Next, the binding of Oct4 and Sox2 to the distal enhancer of the Oct4 gene 1 using chromatin immunoprecipitation (ChIP) was studied. The binding of Oct4 and Sox2 to the distal enhancer remained low with O-MEFs (Fig. 5C). However, Oct4, which was identical to M30 in this case, was already highly bound to the Oct4 distal enhancer in M30-MEFs as early as day 3 when no GFP-positive colonies had yet appeared (Fig. 5C, the red column in the Oct4 panel). The Oct4-binding level gradually increased subsequently, eventually reaching the level comparable to that seen in ESCs on day 9. The chromatin binding of Sox2 displayed a similar tendency. The binding levels of these two proteins in the mixture of ESCs and MEFs at a 13:87 ratio was studied. This study showed substantially lower binding of Oct4 and Sox2 in comparison to the day 9 levels in M30-MEFs (Fig. 5C, ESCs+MEFs in blue). This observation indicates that Oct4 and Sox2 were bound to the Oct4 enhancer in the majority of M30-MEFs including GFP-negative cells on day 9. The increased binding of these two proteins to chromatin in M30-MEFs prompted us to investigate if chromatin accessibility at the distal enhancer was also increased in M 0-MEFs. Increased chromatin accessibility is generally indicated by higher sensitivity to DNAses 23. Chromatin from M 0- MEFs and O-MEFs was digested with the restriction enzyme Nsil and analyzed DNA fragments using Southern blotting. Indeed, chromatin accessibility was consistently higher in M30-MEFs compared to O-MEFs between day 5 and day 9 (Fig. 5D). Additionally, GFP- negative M 0-MEFs were selected with a FACS on day 9 followed by Nsil digestion analysis. This GFP-negative population also demonstrated increased sensitivity to Nsil (Fig. 5D, far right), indicating that the minor GFP-positive population did not significantly influence the overall result of chromatin accessibility
Previous reports have shown that the Paf 1 complex is recruited to the distal enhancer of the Oct4 gene through binding to the Oct4 protein 24 ' 25 and then generally moves to the coding region of the gene 26. Three Pafl complex subunits - parafibromin, Leol and Pafl - displayed a gradual increase of binding to the distal enhancer and coding region of the Oct4 gene in M3O-MEFS, but not in O-MEFs, between days 3 and 9 following transduction (Fig. 5C). The Pafl complex recruits the histone methyltransferase complex COMPASS, which catalyzes trimethylation of lysine 4 on histone H3 (H3K4me3) 26. This histone modification, a marker for active genes, was also increased specifically in M3O-MEFS in the coding region of the Oct4 gene (Fig. 5E). Two other markers for active genes, acetylation of lysines 9 and 14 on histone H3 (H3K9ac and H3K14ac) 27 , were also increased in M30-MEFs (Fig. 5E). In addition, two markers for suppressed genes, trimethylation of H3K9 (H3K9me3) and H3K27 (H3K27me3) 27 , were more decreased in M30-MEFs than those in O-MEFs (Fig. 5F). Similar results were observed at the Sox2 locus (Fig. 9). Among these chromatin changes, the levels of H3K9me3 and H3K27me3 in M 0-MEFs most quickly reached the levels observed in ESCs (Fig. 5F), suggesting that the loss of these suppressive histone markers precedes other chromatin modifications. Taken together, these results demonstrate that chromatin at Oct4 and Sox2 loci was generally remodeled in majority of M30-MEFs, including the GFP- negative population, toward an ESC pattern during the first ten days after transduction, while chromatin in the majority of O-MEFs was not significantly altered.
In addition to global chromatin remodeling, M30-SKM also elicited wider expression of two pluripotency markers than OSKM: alkaline phosphatase and SSEA1. Alkaline phosphatase was almost ubiquitously expressed by day 9 in M 0-MEFs, unlike the weak and heterogeneous expression observed in O-MEFs (Fig. 6A). SSEA1 was also more widely expressed in M30-MEFs than in O-MEFs by day 9 as shown by immunofluorescence microscopy and flow cytometory (Fig. 6B, 6C). While alkaline phosphatase and SSEA1 are not exclusively expressed in pluripotent cells, these findings support the interpretation that M 0-SKM remodeled the chromatin in much more wider population of the cells to a certain degree unlike OSKM. Rapid cell proliferation is known to facilitate iPSC generation as shown using p53-null MEFs 18 ; however, neither M30-SKM nor M30 alone facilitated MEF proliferation during the initial 9 days after transduction (Fig. 6D, 6E).
Chromatin analyses of pluripotency genes without c-Myc M3O-SK induced GFP-positive colonies over 100-fold more efficiently than OSKM with Protocol B (0.44% with M3O-SK in Fig. ID vs 0.0035% with OSKM in Fig. IF). This observation suggests that the M3 domain could compensate for the lack of c-Myc when Oct4 activation was used as an indicator. Although several roles of c-Myc have been proposed, its precise function in iPSC formation remains elusive 28. To further understand the roles of c- Myc in the activation of pluripotency genes, chromatin analyses at the Oct4 and Sox2 loci were repeated comparing MEFs transduced with three genes (M30-SK or OSK) and four genes (M30-SKM of OSKM) on day 9 when the effects of M30-SKM were readily detectable. One gene (M 0 or Oct4) and two genes (M 0+Sox2 or Oct4+Sox2) were transduced for comparison. At this time point, 3.16% of MEFs were GFP-positive with M 0- SK (Fig. 7A), and no GFP-positive cells were observed with other combinations of one, two, or three genes. However, M30-SK did not significantly decrease the overall level of DNA methylation compared with other gene combinations (Fig. 7B).
As for transcription factor binding to the enhancer, M 0 facilitated binding of Oct4, Sox2, and parafibromin in combination with Sox2 or Sox2 and Klf4 (Fig. 7C, red), with some of these binding levels comparable to levels achieved with M30-SKM. However, Leol and Pafl were not recruited to the enhancer without c-Myc (Fig. 7C). The binding of
parafibromin, Leol, and Pafl to the initiation site of Oct4 was also weak without c-Myc (Fig. 10A). Consistent with this partial assembly of the Pafl complex at the Oct4 gene, the level of H3K4me3 remained low without c-Myc (Fig. 7D, 10B). Another active gene marker, H3K9ac, also remained low without c-Myc (Fig. 7D, 10B). Whereas H3K9me3 was effectively decreased by M 0-S and M 0-SK, H3K27me3 was more resistant to
demethylation by any of the gene combinations without c-Myc (Fig. 7E). At the Sox2 gene, compared to the Oct4 gene, M30 did not substantially increase the binding of Oct4 or Sox2 to the enhancer alone or in combination with Sox2 or Sox2 and Klf4 (Fig. 11 A). The changes in the levels of H3K4me3, H3K9ac, H3K9me3 and H3K27me3 were all weak in the absence of c-Myc (Fig. 11B). Together, these chromatin studies indicate that while M30 could facilitate formation of GFP-positive colonies without c-Myc, the overall level of chromatin remodeling in GFP-negative MEFs was low in the absence of c-Myc.
DISCUSSION
The present study advances the field of iPSC biology by showing that one of the rate- limiting steps in iPSC formation with OSKM is poor chromatin accessibility at pluripotency genes and that a strong transactivating domain can overcome this problem. Because iPSC formation was dramatically improved with M 0-SKM, the factors required to increase chromatin accessibility most likely already exist within MEFs but are not effectively recruited to pluripotency genes when using OSKM. Our current working model is that the MyoD TAD overcomes the barrier of closed chromatin by effectively attracting chromatin modifying proteins and thereby facilitating the binding of Oct4 and other regulatory proteins as well as epigenetic modifications at pluripotency genes (Fig. 7F). Myc family proteins have been proposed to globally relax chromatin in part through activation of the histone acetyltransferase GCN5 and in part through direct binding to thousands of genomic loci 28 ' 29. The results also support c-Myc's potential roles in chromatin remodeling.
One of the central questions related to the molecular mechanisms of iPSC formation is how closed chromatin at the loci of Oct4, Sox2, and Nanog are opened by OSKM. Little is known about this mechanism. One potential mechanism is that chromatin disruption occurs during repeated DNA replication as suggested by a report that 92% of B lymphocytes derived from inducible OSKM transgenic mice become iPSCs after 18 weeks of culture 18.
Additionally, knockdown of p53 in B cells shortened both cell doubling time and the time required to form iPSCs by twofold. However, this does not seem to be the case for M3O- SKM since it did not facilitate cell proliferation. Additionally, emerging GFP-positive colonies contained far less cells than their counterparts obtained from B cells. It has been difficult to perform biochemical analysis of the early process of iPSC formation, such as epigenetic remodeling at pluripotency genes, because of the presence of feeder cells and non- responsive MEFs that comprise more than 90% of transduced cells. However, the MyoD
TAD eliminated the requirement for feeder cells and achieved significant levels of epigenetic remodeling even in those MEFs that eventually fell short of activating GFP with Protocol B. Thus, the MyoD TAD is expected to facilitate the dissection of epigenetic processes during the early phase of iPSC formation.
By combining transcription factors with TADs, this approach to nuclear
reprogramming is expected to have a range of applications from inducing pluripotency, as shown in this study, to inducing direct conversion from one differentiated cell type to another without transitioning through iPSCs 17 ' 33 ' 34. The strategy of TAD-fusion to potentiate transactivators will further advance the study of nuclear reprogramming. The effect of each TAD may be on dependent on cell types, host transcription factors, and target genes. Other TADs have been used to amplify the activity of transcription factors. For instance, the TAD of VP 16 was fused to the transcription factor Pdxl to facilitate conversion of hepatocytes to pancreatic cells 36'37. However, the MyoD TAD has not been used in nuclear reprogramming. The TAD-fusion approach is applicable to combinations of many other transcription factors and TADs to amplify the activity of the host transcription factor and control cell fate decisions.
Sequence information of the plasmid constructs
Following is a list of plasmid constructs used in the above work as well as two constructs based on the VP 16 gene and data therefor.
1) Mouse M30
The M3 domain of the mouse MyoD cDNA was fused to the amino terminus of the full-length mouse Oct4 cDNA using PCR and inserted into the EcoRI site of the pMXs-IP vector.
PCR for mouse M^O
The cDNA encoding the M3 domain of mouse MyoD (amino acids 1-62) was amplified with two primer sets, MyoDOct4F4
(GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC; SEQ ID NO: l) and MOA63-109R1 (CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG; SEQ ID NO:2). Full length Oct4 cDNA was amplified with two primer sets, MOA63-109F1
(CTGAAACCGGAGGAGCACATGGCTGGACACCTG; SEQ ID NO:3) and MyoDOct4R5 (CGGAATTCTCTCAGTTTGAATGCATGGGAGAG; SEQ ID NO:4). The two PCR products of each first PCR were used as a template for the secondary PCR with the primer set MyoDOct4F4 and MyoDOct4R5. M30 was directly subcloned into EcoRI site of pMXs-IP. PCR parameters
Denature 94°C 2min
Denature 94°C 15 sec*
Anneal 57°C 30sec*
Extend 68°C lmin* *Repeat 25 cycles
Final extension 68°C 7min
The DNA sequence of mouse M3Q taken from mouse MyoD
atggagcttctatcgccgccactccgggacatagacttgacaggccccgacggctctctctgctcctttgagaca gcagacgacttctatgatgatccgtgtttcgactcaccagacctgcgcttttttgaggacctggacccgcgcctg gtgcacgtgggagccctcctgaaaccggaggagcacatggctggacacctggcttcagacttcgccttctcaccc ccaccaggtgggggtgatgggtcagcagggctggagccgggctgggtggatcctcgaacctggctaagcttccaa gggcctccaggtgggcctggaatcggaccaggctcagaggtattggggatctccccatgtccgcccgcatacgag ttctgcggagggatggcatactgtggacctcaggttggactgggcctagtcccccaagttggcgtggagactttg cagcctgagggccaggcaggagcacgagtggaaagcaactcagagggaacctcctctgagccctgtgccgaccgc cccaatgccgtgaagttggagaaggtggaaccaactcccgaggagtcccaggacatgaaagccctgcagaaggag ctagaacagtttgccaagctgctgaagcagaagaggatcaccttggggtacacccaggccgacgtggggctcacc ctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgcttcgaggccttgcagctcagccttaag aacatgtgtaagctgcggcccctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcaggagata tgcaaatcggagaccctggtgcaggcccggaagagaaagcgaactagcattgagaaccgtgtgaggtggagtctg gagaccatgtttctgaagtgcccgaagccctccctacagcagatcactcacatcgccaatcagcttgggctagag aaggatgtggttcgagtatggttctgtaaccggcgccagaagggcaaaagatcaagtattgagtattcccaacga gaagagtatgaggctacagggacacctttcccagggggggctgtatcctttcctctgcccccaggtccccacttt ggcaccccaggctatggaagcccccacttcaccacactctactcagtcccttttcctgagggcgaggcctttccc tctgttcccgtcactgctctgggctctcccatgcattcaaactga (SEQ ID NO: 5)
Mouse M30 primer sequences
MyoDOct4F4: GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC (SEQ ID NO:6) ΜΟΔ63- 109R 1 : CAGGTGTCCAGCCATGTGCTCCTCCGGTTTCAG (SEQ ID NO:7) ΜΟΔ63- 109F 1 : CTGAAACCGGAGGAGCACATGGCTGGACACCTG (SEQ ID NO:8) MyoDOct4R5 : CGGAATTCTCTCAGTTTGAATGC ATGGGAGAG (SEQ ID NO:9)
Accession numbers
Mouse MyoD: M84918, NM_010866
Mouse Oct4 (POU5F1): NM_013633
2) Mouse OM3
The M3 domain of the mouse MyoD cDNA was fused to the carboxy terminus of the mouse full length Oct4 cDNA.
PCR for mouse OM3
The M3 domain was prepared with PCR using the primer pair M3FI and M3RI and inserted into the EcoRI and the Xhol sites of the pMXs-IP vector to create the pMXs-IP M3 vector. Oct4 was then PCR amplified with the primer pair Oct4Fl and Oct4Rl, and inserted into the EcoRI site of pMXs-IP M3 vector.
Mouse OM^sequence
atggctggacacctggcttcagacttcgccttctcacccccaccaggtgggggtgatgggtcagcagggctggag ccgggctgggtggatcctcgaacctggctaagcttccaagggcctccaggtgggcctggaatcggaccaggctca gaggtattggggatctccccatgtccgcccgcatacgagttctgcggagggatggcatactgtggacctcaggtt ggactgggcctagtcccccaagttggcgtggagactttgcagcctgagggccaggcaggagcacgagtggaaagc aactcagagggaacctcctctgagccctgtgccgaccgccccaatgccgtgaagttggagaaggtggaaccaact cccgaggagtcccaggacatgaaagccctgcagaaggagctagaacagtttgccaagctgctgaagcagaagagg atcaccttggggtacacccaggccgacgtggggctcaccctgggcgttctctttggaaaggtgttcagccagacc accatctgtcgcttcgaggccttgcagctcagccttaagaacatgtgtaagctgcggcccctgctggagaagtgg gtggaggaagccgacaacaatgagaaccttcaggagatatgcaaatcggagaccctggtgcaggcccggaagaga aagcgaactagcattgagaaccgtgtgaggtggagtctggagaccatgtttctgaagtgcccgaagccctcccta cagcagatcactcacatcgccaatcagcttgggctagagaaggatgtggttcgagtatggttctgtaaccggcgc cagaagggcaaaagatcaagtattgagtattcccaacgagaagagtatgaggctacagggacacctttcccaggg ggggctgtatcctttcctctgcccccaggtccccactttggcaccccaggctatggaagcccccacttcaccaca ctctactcagtcccttttcctgagggcgaggcctttccctctgttcccgtcactgctctgggctctcccatgcat tcaaacgaattcatggagcttctatcgccgccactccgggacatagacttgacaggccccgacggctctctctgc tcctttgagacagcagacgacttctatgatgatccgtgtttcgactcaccagacctgcgcttttttgaggacctg gacccgcgcctggtgcacgtgggagccctcctgaaaccggaggagcactga (SEQ ID NO: 10)
Mouse OM- jrimer sequences
Oct4Fl : CGAGAATTCATGGCTGGACACCTG (SEQ ID NO:H)
Oct4Rl : CGAGAATTCGTTTGAATGCATGGGAGAG (SEQ ID NO:12)
M3F1 : CGAGAATTCATGGAGCTTCTATCGCCGCCAC (SEQ ID NO:13)
M3RI : CGACTCGAGTCAGTGCTCCTCCGGTTTCAG (SEQ ID NO:14)
PCR parameters
Denature 94°C 2min
Denature 94°C 15 sec*
Anneal 57°C 30sec*
Extend 68°C lmin* *Repeat 25 cycles
Final extension 68°C 7min
Accession number for mouse OM3
Mouse MyoD: M84918, NM_010866
Mouse Oct4 (POU5F1): NM_013633
Activity test of making iPSCs
OM3 converts 3.2% of MEFs to iPSCs.
3) Mouse M3OM3
Mouse M3 was fused to both the amino and carboxy termini of mouse Oct4.
PCR for mouse M3OM3
Mouse M3 domain was prepared from the mouse MyoD cDNA with PCR using the primer pair M3OFI and M3ORI . Mouse full length Oct4 was prepared with PCR using the primer set M3OF2 and Oct4Rl . To make M3O, the above two PCR products were used as templates for PCR with the primer pair M3OFl and Oct4Rl . Finally, to make M3OM3, M30 was inserted into the EcoRI site of the pMXs-IP M3 vector prepared in the OM3 construct above.
Mouse M 0M _sequence
atggagcttctatcgccgccactccgggacatagacttgacaggccccgacggctctctctgctcctttgagaca gcagacgacttctatgatgatccgtgtttcgactcaccagacctgcgcttttttgaggacctggacccgcgcctg gtgcacgtgggagccctcctgaaaccggaggagcacatggctggacacctggcttcagacttcgccttctcaccc ccaccaggtgggggtgatgggtcagcagggctggagccgggctgggtggatcctcgaacctggctaagcttccaa gggcctccaggtgggcctggaatcggaccaggctcagaggtattggggatctccccatgtccgcccgcatacgag ttctgcggagggatggcatactgtggacctcaggttggactgggcctagtcccccaagttggcgtggagactttg cagcctgagggccaggcaggagcacgagtggaaagcaactcagagggaacctcctctgagccctgtgccgaccgc cccaatgccgtgaagttggagaaggtggaaccaactcccgaggagtcccaggacatgaaagccctgcagaaggag ctagaacagtttgccaagctgctgaagcagaagaggatcaccttggggtacacccaggccgacgtggggctcacc ctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgcttcgaggccttgcagctcagccttaag aacatgtgtaagctgcggcccctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcaggagata tgcaaatcggagaccctggtgcaggcccggaagagaaagcgaactagcattgagaaccgtgtgaggtggagtctg gagaccatgtttctgaagtgcccgaagccctccctacagcagatcactcacatcgccaatcagcttgggctagag aaggatgtggttcgagtatggttctgtaaccggcgccagaagggcaaaagatcaagtattgagtattcccaacga gaagagtatgaggctacagggacacctttcccagggggggctgtatcctttcctctgcccccaggtccccacttt ggcaccccaggctatggaagcccccacttcaccacactctactcagtcccttttcctgagggcgaggcctttccc tctgttcccgtcactgctctgggctctcccatgcattcaaacgaattcatggagcttctatcgccgccactccgg gacatagacttgacaggccccgacggctctctctgctcctttgagacagcagacgacttctatgatgatccgtgt ttcgactcaccagacctgcgcttttttgaggacctggacccgcgcctggtgcacgtgggagccctcctgaaaccg gaggagcactga (SEQ ID NO: 15)
Figure imgf000035_0001
M30F1 : GAGAATTCGCCATGGAGCTTCTATCGCCGCCAC (SEQ ID NO:16)
M3ORI : CAGGTGTCCAGCCATATCAGCGTTGGTGGTC (SEQ ID NO:17)
M3 OF2 : G ACC ACC A ACGCTG ATATGGCTGG AC ACCTG (SEQ ID NO:18)
Oct4Rl: CGAGAATTCGTTTGAATGCATGGGAGAG (SEQ ID NO:19)
PCR parameters: the same as that for OM3
Denature 94°C 2min
Denature 94°C 15 sec*
Anneal 57°C 30sec*
Extend 68°C lmin* *Repeat 25 cycles
Final extension 68°C 7min
Accession number for mouse M3OM3
Mouse MyoD: M84918, NM_010866
Mouse Oct4 (POU5F1): NM_013633
4) Human M3O DNA
The M3 domain of the human MyoD cDNA was fused to the amino terminus of the full-length human Oct4 cDNA using PCR and inserted into the EcoRI site of the pMXs-IP vector.
PCR for human M3O
The M3 domain of human MyoD was PCR amplified with the primer pair of hM3OFl (see below for sequence) and hM3ORl. Human full length Oct4 was PCR amplified with the primer pair of hM3OF2 and hM3OR2. These two PCR products were used as templates for the third PCR with the primers hM3OFl and hM3OR2.
PCR parameters
Denature 94°C 2min
Denature 94°C 15sec*
Anneal 57°C 30sec*
Extend 68°C lmin* *Repeat 25 cycles
Final extension 68°C 7min The DNA sequence of human M3Q taken from human MyoD
atggagctactgtcgccaccgctccgcgacgtagacctgacggcccccgacggctctctctgctcctttgccaca acggacgacttctatgacgacccgtgtttcgactccccggacctgcgcttcttcgaagacctggacccgcgcctg atgcacgtgggcgcgctcctgaaacccgaagagcacatggcgggacacctggcttcggatttcgccttctcgccc cctccaggtggtggaggtgatgggccaggggggccggagccgggctgggttgatcctcggacctggctaagcttc caaggccctcctggagggccaggaatcgggccgggggttgggccaggctctgaggtgtgggggattcccccatgc cccccgccgtatgagttctgtggggggatggcgtactgtgggccccaggttggagtggggctagtgccccaaggc ggcttggagacctctcagcctgagggcgaagcaggagtcggggtggagagcaactccgatggggcctccccggag ccctgcaccgtcacccctggtgccgtgaagctggagaaggagaagctggagcaaaacccggaggagtcccaggac atcaaagctctgcagaaagaactcgagcaatttgccaagctcctgaagcagaagaggatcaccctgggatataca caggccgatgtggggctcaccctgggggttctatttgggaaggtattcagccaaacgaccatctgccgctttgag gctctgcagcttagcttcaagaacatgtgtaagctgcggcccttgctgcagaagtgggtggaggaagctgacaac aatgaaaatcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagagaaagcgaaccagtatcgag aaccgagtgagaggcaacctggagaatttgttcctgcagtgcccgaaacccacactgcagcagatcagccacatc gcccagcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccggcgccagaagggcaagcgatca agcagcgactatgcacaacgagaggattttgaggctgctgggtctcctttctcagggggaccagtgtcctttcct ctggccccagggccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccct ttccctgagggggaagcctttccccctgtctccgtcaccactctgggctctcccatgcattcaaactga ( SEQ ID NO:20)
Human M3Q primer sequences
hM3OFl : CGAGAATTCGCCATGGAGCTACTGTCGCCAC (SEQ ID NO:21)
hM3ORl : CAGGTGTCCCGCCATGTGCTCTTCGGGTTTCAG ( SEQ ID NO : 22 ) hM OF2 : CTG A A ACCCG A AG AGC AC ATGGCGGG AC ACCTG (SEQ ID NO:23) hM3OR2: CGTGAATTCCTCGAGTCTCAGTTTGAATGCATGGGAGAG (SEQ ID NO: 24)
Accession numbers
Human MyoD: NM_002478
Human Oct4 (POU5F1): NM_002701
5) VP16LO
The full length of the TAD (amino acids 411-490) of VP 16 was fused to the amino terminus of the mouse full-length Oct4 cDNA. VP 16 is a protein expressed by the herpes simplex virus type 1 and its transactivation domain is highly powerful.
PCR for VP16LO
The cDNA encoding the transactivation domain of VP 16 (amino acids 411-490) was amplified by PCR and inserted into the BamHI and Xhol sites of the pMXs-IP vector to create the pMXs VP16-IP vector. Then the full-length mouse Oct4 cDNA was inserted into the EcoRI and Xhol sites of the pMXs VP16-IP vector. PCR primers for VP 16
VP 16F 1 : CG AGG ATCCGCC ATGTCG ACGGCCCCCCCG ACCG ATGTC (SEQ ID NO:25) VP 16R 1 : CG ACTCG AGG A ATTCCCC ACCGTACTCGTC (SEQ ID NO:26)
PCR parameters
Denature 94°C 2min
Denature 94°C 15 sec*
Anneal 57°C 30sec*
Extend 68°C lmin* *Repeat 25 cycles
Final extension 68°C 7min
VP16LO DNA sequence
atgtcgacgcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgc atgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccgggatttacccccc acgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaa ttgacgagtacggtggggaattcatggctggacacctggcttcagacttcgccttctcacccccaccaggtgggg gtgatgggtcagcagggctggagccgggctgggtggatcctcgaacctggctaagcttccaagggcctccaggtg ggcctggaatcggaccaggctcagaggtattggggatctccccatgtccgcccgcatacgagttctgcggaggga tggcatactgtggacctcaggttggactgggcctagtcccccaagttggcgtggagactttgcagcctgagggcc aggcaggagcacgagtggaaagcaactcagagggaacctcctctgagccctgtgccgaccgccccaatgccgtga agttggagaaggtggaaccaactcccgaggagtcccaggacatgaaagccctgcagaaggagctagaacagtttg ccaagctgctgaagcagaagaggatcaccttggggtacacccaggccgacgtggggctcaccctgggcgttctct ttggaaaggtgttcagccagaccaccatctgtcgcttcgaggccttgcagctcagccttaagaacatgtgtaagc tgcggcccctgctggagaagtgggtggaggaagccgacaacaatgagaaccttcaggagatatgcaaatcggaga ccctggtgcaggcccggaagagaaagcgaactagcattgagaaccgtgtgaggtggagtctggagaccatgtttc tgaagtgcccgaagccctccctacagcagatcactcacatcgccaatcagcttgggctagagaaggatgtggttc gagtatggttctgtaaccggcgccagaagggcaaaagatcaagtattgagtattcccaacgagaagagtatgagg ctacagggacacctttcccagggggggctgtatcctttcctctgcccccaggtccccactttggcaccccaggct atggaagcccccacttcaccacactctactcagtcccttttcctgagggcgaggcctttccctctgttcccgtca ctgctctgggctctcccatgcattcaaactga (SEQ ID NO: 27)
Accession number for VP 16 Human herpesvirus 1 complete genome: X14112.1
Tegument protein VP 16 from human herpes simplex virus type 1 : NP_044650
Activity test of making iPSCs
VP16LO-SKM converts around 0.5% of mouse embryonic fibroblasts to iPSCs, which is lower than M30-SKM (5.3%) but still higher than OSKM (0.08%). In addition, VP16LO- SKM does not require feeder cells, unlike OSKM, to make iPSCs.
6) VP16SO
A part of the TAD (amino acids 446-490) of VP 16 was fused to the amino terminus of the mouse full-length Oct4 cDNA.
PCR for VP16SO
The cDNA encoding a part of the transactivation domain of VP 16 (amino acids 446- 490) was amplified with two primer sets, V16F4
(CGAGAATTCGCCATGTTGGGGGACGGGGATTC; SEQ ID NO: 28) and V160R
(CAGGTGTCCAGCCATCCCACCGTACTCGTC; SEQ ID NO:29). Full length Oct4 cDNA was amplified with two primer sets, VP160F
(GACGAGTACGGTGGGATGGCTGGACACCTG; SEQ ID NO:30) and Oct4Rl
(GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG;SEQ ID NO:31). The two PCR products of each first PCR were used as a template for the secondary PCR with the primer set V16F4 and Oct4Rl. VP160S was directly subcloned into EcoRI and Xhol site of pMXs-IP. PCR primers for VP16SO
V 16F4 : CG AG A ATTCGCC ATGTTGGGGG ACGGGG ATTC (SEQ ID NO:32)
V160R: CAGGTGTCCAGCCATCCCACCGTACTCGTC (SEQ ID NO:33)
VP 160F: GACGAGTACGGTGGGATGGCTGGACACCTG (SEQ ID NO:34)
Oct4Rl : GCGCTCGAGTCTCAGTTTGAATGCATGGGAGAG ( SEQ ID NO : 35 )
PCR parameters
Denature 94°C 2min
Denature 94°C 15 sec*
Anneal 57°C 30sec*
Extend 68°C lmin* *Repeat 25 cycles
Final extension 68°C 7min
VP16SO DNA sequence
atgttgggggacggggattccccgggtccgggatttaccccccacgactccgccccctacggcgctctggatatg gccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtgggatggctggacacctg gcttcagacttcgccttctcacccccaccaggtgggggtgatgggtcagcagggctggagccgggctgggtggat cctcgaacctggctaagcttccaagggcctccaggtgggcctggaatcggaccaggctcagaggtattggggatc tccccatgtccgcccgcatacgagttctgcggagggatggcatactgtggacctcaggttggactgggcctagtc ccccaagttggcgtggagactttgcagcctgagggccaggcaggagcacgagtggaaagcaactcagagggaacc tcctctgagccctgtgccgaccgccccaatgccgtgaagttggagaaggtggaaccaactcccgaggagtcccag gacatgaaagccctgcagaaggagctagaacagtttgccaagctgctgaagcagaagaggatcaccttggggtac acccaggccgacgtggggctcaccctgggcgttctctttggaaaggtgttcagccagaccaccatctgtcgcttc gaggccttgcagctcagccttaagaacatgtgtaagctgcggcccctgctggagaagtgggtggaggaagccgac aacaatgagaaccttcaggagatatgcaaatcggagaccctggtgcaggcccggaagagaaagcgaactagcatt gagaaccgtgtgaggtggagtctggagaccatgtttctgaagtgcccgaagccctccctacagcagatcactcac atcgccaatcagcttgggctagagaaggatgtggttcgagtatggttctgtaaccggcgccagaagggcaaaaga tcaagtattgagtattcccaacgagaagagtatgaggctacagggacacctttcccagggggggctgtatccttt cctctgcccccaggtccccactttggcaccccaggctatggaagcccccacttcaccacactctactcagtccct tttcctgagggcgaggcctttccctctgttcccgtcactgctctgggctctcccatgcattcaaactga ( SEQ ID NO:36)
Accession number for VP 16
Human herpesvirus 1 complete genome: X14112.1
Tegument protein VP 16 from human herpes simplex virus type 1 : NP_044650
The combination of VP16SO and SKM induced mouse iPSCs at a frequency of around 1 %. Example 2
MEFs transduced with M30-SKM were seeded onto feeder cells at the density of 2000 cells/well of a 12-well plate. This cell density is around 15-fold lower than the density used in protocol described above. In addition, 10% fetal bovine serum was replaced with 15% KnockOut Serum Replacement (KSR, Invitrogen) in the culture medium. Combination of the decreased cell density and KSR increased the efficiency of making iPSCs to around 27% by day 12. In contrast, the efficiency with OSKM was around 1% under the same condition.
The herpes simplex virus type 1 protein VP 16 is a powerful transactivator. To test if the VP 16 TAD could also raise the efficiency of making iPSCs, two fusion genes were prepared between mouse Oct4 and the VP 16 TAD. The first fusion gene called VP16LO is composed of the full-length VP 16 TAD (amino acids 411-490) fused to the amino terminus of Oct4. The second fusion gene called VP16SO comprises the second half of the VP 16 TAD (amino acids 446-490) fused to the amino terminus of Oct4. The efficiency of making mouse iPSCs was around 5% with VP16LO-SKM and around 14% with VP16SO-SKM on day 12 under the above-mentioned culture conditions (with decreased cell density and KSR). The efficiency with these two combinations was higher than the efficiency with OSKM.
Bibliography
1. Chew, J.L. et al. Mol Cell Biol 25, 6031-46 (2005).
2. Nakagawa, M. et al. Nat Biotechnol 26, 101-6 (2008).
3. Wernig, M., Meissner, A., Cassady, J.P & Jaenisch, R. Cell Stem Cell 2, 10-2 (2008). 4. Kitamura, T. et al. Exp Hematol 31, 1007- 14 (2003).
5. Carey, B.W. et al. Proc Natl Acad Sci U SA 106, 157-62 (2009).
6. Morita, S., Kojima, T. & Kitamura, T. Gene Ther 7, 1063-6 (2000).
7. Lengner, C.J. et al. Cell Stem Cell 1, 403-15 (2007).
8. Takahashi, K. & Yamanaka, Cell 126, 663-76 (2006). 9. Gerber, A.N et al. Genes Dev 11, 436-50 (1997).
10. Huangfu, D. et al. Nat Biotechnol 26, 795-7 (2008).
11. Weintraub, H. et al. Genes Dev 5, 1377-86 (1991).
12. Niwa, H. et al. Cell 123, 917-29 (2005).
13. Boxus, M. et al. Retrovirology 5, 76 (2008).
14. Romani, B., Engelbrecht, S. & Glashoff, R.H. J Gen Virol 91, 1-12 (2010).
15. Pumfery, A. et al. Curr HIV Res 1, 343-62 (2003).
16. Cirillo, L.A. et al. Mol Cell 9, 279-89 (2002).
17. Ieda, M. et al. Cell 142, 375-386 (2010).
18. Hanna, J. et al. Nature 462, 595-601 (2009).
19. Stadtfeld, M. et al. Cell Stem Cell 2, 230-40 (2008).
20. Gonzalez, F. et al. Proc Natl Acad Sci U SA 106, 8918-22 (2009).
21. Maherali, N. et al. Cell Stem Cell 1, 55-70 (2007).
22. Okita, K., Ichisaka, T. & Yamanaka, S. Nature 448, 313-7 (2007).
23. Carey, M.F., Peterson, C.L. & Smale, S.T. In vivo analysis of an endogenous control region, in Transcriptional regulation in eukaryotes (eds. Carey, M.F., Peterson, C.L. & Smale, S.T.) 261-322 (Cold Spring Harbor Laboratory Press, 2009).
24. Ding, L. et al. Cell Stem Cell 4, 403-15 (2009).
25. Ponnusamy, M.P et al. Stem Cells 27, 3001-11 (2009).
26. Gerber, M. & Shilatifard, / Biol Chem 278, 26303-6 (2003).
27. Kouzarides, T. Cell 128, 693-705 (2007).
28. Knoepfler, PS. Cell Stem Cell 2, 18-21 (2008).
29. Knoepfler, PS. et al. EMBO J 25, 2723-34 (2006).
33. Zhou, Q. et al. Nature 455, 627-32 (2008).
34. Vierbuchen, T. et al. Nature 463, 1035-41 (2010).
35. Yamanaka, S. & Blau, H.M. Nature 465, 704-12 (2010).
36. Horb, M.E., Shen, C.N., Tosh, D. & Slack, J.M. Curr Biol 13, 105-15 (2003).
37. Kaneto, H. et al. Diabetes 54, 1009-22 (2005).
All publications, patents and patent applications are incorporated herein by reference.
While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

Claims

WHAT IS CLAIMED IS:
1. A method for preparing an induced pluripotent stem cell comprising introducing a nucleic acid sequence which is a fusion of a heterologous transactivation domain and a transcription factor into a somatic cell.
2. The method of claim 1, wherein the transcription factor is Oct-4.
3. The method of claim 1, wherein the transactivation domain is obtained from MyoD or VP16.
4. The method of claim 3, wherein the transactivation domain of MyoD comprises an N- terminus region of MyoD.
5. The method of claim 4, wherein the transactivation domain comprising amino acids 1- 62 of MyoD or is at least 80% identical thereto.
6. The method of claim 1, wherein a transcription factor is further introduced into the cell.
7. The method of any one of claim 6, wherein the transcription factor is Klf4.
8. The method of any one of claim 6 or 7, wherein transcription factor is Sox2, c-Myc or a combination thereof.
9. The method of claim 1, wherein the cell is mammalian.
10. The method of claim 9, wherein the mammalian cell is human.
11. A fusion nucleic acid or protein comprising a heterologous transactivation domain and a transcription factor.
12. The fusion of claim 11, wherein the transcription factor is Oct4.
12. The fusion of claim 11 or 12, wherein the transactivation domain (TAD) is obtained from MyoD or VP 16.
13. The fusion of claim 11, wherein the transactivation domain (TAD) of MyoD comprises amino acids 1-62 of MyoD or is at least 80% identical thereto.
14. The method of claim 1, wherein the somatic cells are seeded at a low density.
15. The method of claim 1 or 14, wherein the somatic cells are placed in cell culture medium comprising a serum replacement.
16. A method for stem cell therapy comprising: (1) isolating and collecting a somatic cell from a patient; (2) inducing said somatic cell from the patient into an iPS cell according to the method of claim 1 and (3) administering the cell to the patient.
17. The method of claim 16, wherein the iPS cell is induced to differentiate prior to administering the cell to said patient.
18. The method of claim 16, wherein the patient is a mammal.
PCT/US2011/044995 2010-07-22 2011-07-22 Induced pluripotent stem cells Ceased WO2012012708A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US13/811,572 US9580689B2 (en) 2010-07-22 2011-07-22 Induced pluripotent stem cells
US15/403,653 US20170267978A1 (en) 2010-07-22 2017-01-11 Induced pluripotent stem cells

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US36682110P 2010-07-22 2010-07-22
US61/366,821 2010-07-22
US39045410P 2010-10-06 2010-10-06
US61/390,454 2010-10-06

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/811,572 A-371-Of-International US9580689B2 (en) 2010-07-22 2011-07-22 Induced pluripotent stem cells
US15/403,653 Continuation US20170267978A1 (en) 2010-07-22 2017-01-11 Induced pluripotent stem cells

Publications (1)

Publication Number Publication Date
WO2012012708A1 true WO2012012708A1 (en) 2012-01-26

Family

ID=45497190

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/044995 Ceased WO2012012708A1 (en) 2010-07-22 2011-07-22 Induced pluripotent stem cells

Country Status (2)

Country Link
US (2) US9580689B2 (en)
WO (1) WO2012012708A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013155109A1 (en) 2012-04-09 2013-10-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for generation of pluripotent and multipotent cells
WO2013173248A3 (en) * 2012-05-13 2014-12-18 Allele Biotechnology And Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
WO2014190361A3 (en) * 2013-05-13 2015-07-30 Allele Biotechnology And Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
US9580689B2 (en) 2010-07-22 2017-02-28 Regents Of The University Of Minnesota Induced pluripotent stem cells
KR20170023014A (en) * 2014-05-30 2017-03-02 알렐 바이오테크놀로지 앤 파마슈티칼스, 인크. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
CN107286232A (en) * 2017-05-23 2017-10-24 中国科学院广州生物医药与健康研究院 Efficient induction of the POU domains engineered protein to multipotential stem cell
US10119150B2 (en) 2012-05-13 2018-11-06 Allele Biotechnology & Pharmaceuticals, Inc. Feeder-free Derivation of human-induced pluripotent stem cells with synthetic messenger RNA
EP3384038A4 (en) * 2015-11-23 2019-12-04 The Regents of The University of Colorado, A Body Corporate METHODS AND COMPOSITIONS FOR CELL REPROGRAMMING

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9410128B2 (en) * 2011-02-22 2016-08-09 Sanford-Burnham Medical Research Institute Method and compounds for generation of iPSCs
WO2017120089A1 (en) * 2016-01-08 2017-07-13 Luigi Warren Cellular reprogramming utilizing mrna
EP3856260A1 (en) 2018-09-28 2021-08-04 President and Fellows of Harvard College Mutant reverse tetracycline transactivators for expression of genes
EP3856226B1 (en) 2018-09-28 2026-02-18 President and Fellows of Harvard College Cellular reprogramming to reverse aging and promote organ and tissue regeneration
US12274733B2 (en) 2018-09-28 2025-04-15 President And Fellows Of Harvard College Cellular reprogramming to reverse aging and promote organ and tissue regeneration
JPWO2021149824A1 (en) * 2020-01-24 2021-07-29
JP2022104813A (en) 2020-12-29 2022-07-11 アイ ピース,インコーポレイテッド Culture method of cell into which reprogramming factor is introduced
US12252518B2 (en) 2023-01-06 2025-03-18 Life Biosciences, Inc. Methods of treating non-arteritic anterior ischemic optic neuropathy
US20250332260A1 (en) 2024-04-10 2025-10-30 Garuda Therapeutics, Inc. Immune compatible cells for allogeneic cell therapies to cover global, ethnic, or disease-specific populations

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090191159A1 (en) * 2007-06-15 2009-07-30 Kazuhiro Sakurada Multipotent/pluripotent cells and methods

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2369893A1 (en) * 2001-02-12 2002-08-12 Warner-Lambert Company Vegf responsive cell-based assay for determining vegf bioactivity
US8129187B2 (en) * 2005-12-13 2012-03-06 Kyoto University Somatic cell reprogramming by retroviral vectors encoding Oct3/4. Klf4, c-Myc and Sox2
EP2344676A1 (en) * 2008-09-25 2011-07-20 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Combinatorial synthesis and use of libraries of short expressed nucleic acid sequences for the analysis of cellular events
WO2012012708A1 (en) 2010-07-22 2012-01-26 Regents Of The University Of Minnesota Induced pluripotent stem cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090191159A1 (en) * 2007-06-15 2009-07-30 Kazuhiro Sakurada Multipotent/pluripotent cells and methods

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SARTORELLI ET AL.: "Molecular mechanisms of myogenic coactivation by p300: direct interaction with the activation domain of MyoD and with the MADS box of MEF2C", MOL CELL BIOL., vol. 17, no. 2, February 1997 (1997-02-01), pages 1010 - 1026 *
WEINTRAUB, H. ET AL.: "Muscle-specific transcriptional activation by MyoD", GENES DEV., vol. 5, 1991, pages 1377 - 1386 *

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9580689B2 (en) 2010-07-22 2017-02-28 Regents Of The University Of Minnesota Induced pluripotent stem cells
WO2013155109A1 (en) 2012-04-09 2013-10-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for generation of pluripotent and multipotent cells
AU2013263101B2 (en) * 2012-05-13 2019-02-14 Allele Biotechnology And Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger RNA
US10119150B2 (en) 2012-05-13 2018-11-06 Allele Biotechnology & Pharmaceuticals, Inc. Feeder-free Derivation of human-induced pluripotent stem cells with synthetic messenger RNA
CN110241087B (en) * 2012-05-13 2023-02-03 美国绿阳生物技术及医药公司 Feeder-free derivation of human induced pluripotent stem cells using synthetic messenger RNA
AU2019203335B2 (en) * 2012-05-13 2021-10-21 Allele Biotechnology And Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger RNA
CN104520424A (en) * 2012-05-13 2015-04-15 美国绿阳生物技术及医药公司 Feeder-free derivation of human induced pluripotent stem cells using synthetic messenger RNA
US10435711B2 (en) 2012-05-13 2019-10-08 Allele Biotechnology & Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger RNA
JP2017184766A (en) * 2012-05-13 2017-10-12 アリール バイオテクノロジー アンド ファーマシューティカルズ, インコーポレイテッド Feeder-free derivation of human induced pluripotent stem cells using synthetic messenger rna
CN110241087A (en) * 2012-05-13 2019-09-17 美国绿阳生物技术及医药公司 Derive mankind's inductive pluripotent stem cells without feeder cells using the mRNA of synthesis
CN104520424B (en) * 2012-05-13 2019-06-28 美国绿阳生物技术及医药公司 Feeder-free derivation of human induced pluripotent stem cells using synthetic messenger RNA
US10155929B2 (en) 2012-05-13 2018-12-18 Allele Biotechnology & Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger RNA
JP2015517311A (en) * 2012-05-13 2015-06-22 アリール バイオテクノロジー アンド ファーマシューティカルズ, インコーポレイテッド Feeder-free induction of human induced pluripotent stem cells using synthetic messenger RNA
WO2013173248A3 (en) * 2012-05-13 2014-12-18 Allele Biotechnology And Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
JP2016521541A (en) * 2013-05-13 2016-07-25 アリール バイオテクノロジー アンド ファーマシューティカルズ, インコーポレイテッド Feeder-free induction of human induced pluripotent stem cells by synthetic messenger RNA
WO2014190361A3 (en) * 2013-05-13 2015-07-30 Allele Biotechnology And Pharmaceuticals, Inc. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
KR20170023014A (en) * 2014-05-30 2017-03-02 알렐 바이오테크놀로지 앤 파마슈티칼스, 인크. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
TWI698526B (en) * 2014-05-30 2020-07-11 美商綠陽生物科技及製藥公司 Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
KR102361849B1 (en) * 2014-05-30 2022-02-11 알렐 바이오테크놀로지 앤 파마슈티칼스, 인크. Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna
EP3384038A4 (en) * 2015-11-23 2019-12-04 The Regents of The University of Colorado, A Body Corporate METHODS AND COMPOSITIONS FOR CELL REPROGRAMMING
US11459560B2 (en) 2015-11-23 2022-10-04 The Regents Of The University Of Colorado Methods and compositions for reprogramming cells
US11566242B2 (en) 2015-11-23 2023-01-31 The Regents Of The University Of Colorado, A Body Corporate Methods and compositions for reprogramming cells
EP4470544A3 (en) * 2015-11-23 2025-06-18 The Regents of the University of Colorado, a body corporate Methods and compositions for reprogramming cells
US12600968B2 (en) 2015-11-23 2026-04-14 The Regents Of The University Of Colorado, A Body Corporate Methods and compositions for reprogramming cells
CN107286232A (en) * 2017-05-23 2017-10-24 中国科学院广州生物医药与健康研究院 Efficient induction of the POU domains engineered protein to multipotential stem cell

Also Published As

Publication number Publication date
US9580689B2 (en) 2017-02-28
US20130195812A1 (en) 2013-08-01
US20170267978A1 (en) 2017-09-21

Similar Documents

Publication Publication Date Title
US9580689B2 (en) Induced pluripotent stem cells
KR101564044B1 (en) Nucleus initialization method
EP2423302B1 (en) New serum-free medium for inducing pluripotent stem cells quickly with high efficiency and method using thereof
CN104630136B (en) Composition and its application used in a kind of method and this method preparing inducing pluripotent stem cells
KR101685209B1 (en) Method of efficiently establishing induced pluripotent stem cells
CA2823265C (en) Method of generating induced pluripotent stem cells and differentiated cells
US20110250692A1 (en) Method for producing induced pluripotent stem cells
Nomura et al. Human periodontal ligament fibroblasts are the optimal cell source for induced pluripotent stem cells
CN102190731B (en) Multipotential stem cell is produced with manual transcription factor induction
US20130059386A1 (en) Induced pluripotent stem cells produced with oct3/4, klf and sox
US20100330677A1 (en) Improved Reprogramming of Mammalian Cells, and Cells Obtained
JP5944315B2 (en) Cells and methods for obtaining them
WO2010013359A1 (en) Efficient method for establishing induced pluripotent stem cells
JP2009165478A (en) Method for producing induced pluripotent stem cells
US10077429B2 (en) Method of efficiently establishing induced pluripotent stem cells
JP2010158171A (en) Efficient method for nuclear reprogramming
US8709805B2 (en) Canine iPS cells and method of producing same
KR20200139799A (en) Reprogramming vector
Di Stefano et al. A microRNA-based system for selecting and maintaining the pluripotent state in human induced pluripotent stem cells
WO2011111588A1 (en) Method of inducing the differentiation of germline stem cells, method of expanding the cells, and culture media therefor
Chan et al. Yinxiang Wang, Ming-Hoi Wu, May Pui Lai Cheung, 2, 4 Mai Har Sham, Haruhiko Akiyama, 3

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11810456

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13811572

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 11810456

Country of ref document: EP

Kind code of ref document: A1