WO2012004614A1

WO2012004614A1 - Detection of drug-resistant influenza virus

Info

Publication number: WO2012004614A1
Application number: PCT/GB2011/051294
Authority: WO
Inventors: Malcolm Guiver; Ian Vipond; Peter Muir
Original assignee: Health Protection Agency
Priority date: 2010-07-09
Filing date: 2011-07-11
Publication date: 2012-01-12
Also published as: GB201011587D0

Abstract

There are provided methods, primers, probes and kits for detecting oseltamivir resistant influenza virus. The method involves detection of influenza virus neuraminidase nucleic acid with a probe which binds to target nucleotide sequence located within the neuraminidase nucleic acid. A run control nucleic acid molecule for use in a target nucleic acid detection assay is also provided.

Description

Detection of Drug-Resistant Influenza Virus

The present invention relates to a method for detection of oseltamivir resistant influenza virus in a sample, and to reagents and kits therefor. The present invention also relates to run control nucleic acid molecules for use in target nucleic acid detection assays, such as the oseltamivir resistant influenza virus assay described herein.

Influenza is an infectious disease caused by viruses belonging to the genera of Influenzavirus A, Influenzavirus B and Influenzavirus C of the Orthomyxoviridae family. Orthomyxoviridae have a negative-sense RNA genome made up of seven or eight separate RNA molecules. Influenza A virus causes influenza in birds and some mammals, including humans. Various subtypes are recognised and classified according to their hemagglutinin (HA) and neuraminidase (N) surface glycoproteins. There are currently 16 recognised HA antigens (H1 to H16) and nine different N antigens (N1 to N9).

Influenza A (H1 N1 ) virus is a subtype of influenza A virus and the most common cause of influenza in humans. Some strains of H1 N1 are endemic in humans and cause a small fraction of all influenza-like illness and a small fraction of all seasonal influenza. Other strains of H1 N1 are endemic in pigs (swine influenza) and in birds (avian influenza). In June 2009, the World Health Organization declared a new strain of swine-origin H1 N1 as a human pandemic. The virus caused an unusual pattern of severe illness and deaths in younger people, with many deaths caused by viral pneumonia. The pandemic H1 N1 strain caused community outbreaks with person to person spread and spread with unprecedented speed, reaching 120 countries and territories in about 8 weeks. To date, more than 14 000 laboratory-confirmed deaths have been reported. Influenza virus infection can be treated with antivirals including the Adamantanes (Amanatadine and Rimantadine) which block function of the viral M2 protein and neuraminidase inhibitors such as oseltamivir (Tamiflu) and zanamavir (Relenza). Drug resistance to the Adamantanes is relatively high and there is increased reliance on neuraminidase inhibitors. In particular, oseltamivir is widely used because it can be administered orally in the form of oseltamivir phosphate. Oseltamivir phosphate is the ethyl ester prodrug which requires ester hydrolysis for conversion to the active form, oseltamivir carboxylate. Conversion into the active form is predominantly by hepatic esterases and absorption occurs in the gastrointestinal tract after oral administration.

Sialic acids found on the surface proteins of cells are the natural substrate for the viral neuraminidase protein. Oseltamivir carboxylate is an inhibitor of the influenza virus neuraminidase and thus, by blocking the activity of the viral neuraminidase enzyme, oseltamivir prevents new viral particles from being released by infected cells.

Methods for monitoring drug resistance include phenotypic and genotypic analysis of the neuraminidase gene, pyrosequencing, measurement of haemagglutination titers in presence of the drug, or flow cytometric analysis of virus-infected cells. All of the above techniques are either time consuming and require approximately 48 hours before samples are processed, or require specialized equipment that is not widely available within routine diagnostic laboratories. Rapid detection and identification of antiviral resistant strains is important for pandemic surveillance and patient management. Thus, the above mentioned methods are not useful for rapid diagnosis of oseltamivir resistance.

There is, therefore, a need to provide an alternative and/ or improved method for detecting oseltamivir resistant influenza virus in a sample.

The present invention solves one or more of the above mentioned problems.

In one aspect, the invention provides a method for detecting oseltamivir resistant influenza virus in a sample, comprising:

(i) contacting the sample with an oligonucleotide probe, wherein the probe binds to a target nucleic acid comprising nucleic acid residues 38-54 of SEQ ID NO: 4 or to a nucleic acid sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto; and

(ii) detecting for binding of said probe to said target nucleic acid;

wherein the binding of said probe to said target nucleic acid indicates the presence of oseltamivir resistant influenza virus in the sample and wherein the absence of binding of said probe to said target nucleic acid sequence indicates the absence of oseltamivir resistant influenza virus in the sample.

In another aspect, the invention provides a method for detecting oseltamivir resistant influenza virus in a sample, comprising:

(i) contacting the sample with an oligonucleotide probe, wherein the probe binds to a target nucleic acid comprising nucleic acid residues 1 -5 of SEQ ID NO: 4 or the complement thereof, and/or nucleic acid residues

100-105 of SEQ ID NO: 4 or the complement thereof; and

(ii) detecting for binding of said probe to said target nucleic acid;

wherein the binding of said probe to said target nucleic acid indicates the presence of oseltamivir resistant influenza virus in the sample and wherein the absence of binding of said probe to said target nucleic acid indicates the absence of oseltamivir resistant influenza virus in the sample.

The invention advantageously provides a highly sensitive, specific, rapid and/ or robust molecular diagnostic assay for detecting the presence of oseltamivir resistant influenza virus in a sample. Said method provides a welcome replacement for the laborious and long turnaround methods presently being used.

In one embodiment, the method detects oseltamivir resistant influenza virus in a sample in less than 6 hours, compared to an average minimum turnaround time of 48 hours for conventional DNA sequencing, biochemistry and serology-based detection methods.

The invention advantageously enables quantitative estimates of oseltamivir resistant influenza virus in a sample to be determined. Determining oseltamivir resistant influenza virus load has many useful applications, such as for clinical guidance and for determining therapy, for patient management and for assessing vaccine efficacy.

Oseltamivir resistance has been reported among seasonal influenza A H1 N1 variants and has increased in prevalence. Similarly, cases of oseltamivir resistance have been reported in pandemic H1 N1 , although these are relatively rare. Resistance may be characterized by a single nucleotide base change at position 823 of the pandemic neuraminidase gene leading to an amino acid substitution at position 275 of the neuraminidase protein from histidine to tyrosine (H275Y). A number of nucleotide sequences for the neuraminidase gene of influenza viruses are publically available. For example, NCBI accession numbers NC_004909 (SEQ ID NO: 12) and NC_007382 (SEQ ID NO: 13) encode influenza A virus neuraminidases, while NCBI accession numbers J02095 (SEQ ID NO: 14) and NC_002209 (SEQ ID NO: 15) encode influenza B virus neuraminidases.

Of the influenza A viruses, several neuraminidase subtypes sequences are present in the databases, including pandemic influenza A/H1 N1 .

In one embodiment, the influenza virus is influenza A H1 N1 .

One such influenza A H1 N1 sequence is SEQ ID NO: 3, which represents NCBI accession number GQ351316 (strain A/Hong Kong/2369/2009(H1 N1 )) segment 6, and is used herein as a reference sequence. Other representative oseltamivir sensitive reference sequences include GenBank accession numbers CY039528, GQ385302, CY056238 and CY051971 (corresponding to SEQ ID NOs 7-10, respectively) and representative oseltamivir resistant reference sequences include GQ351316 (SEQ ID NO: 3) and GQ365445 (SEQ ID NO: 1 1 ).

As described above, oseltamivir is an antiviral drug sold under the trade name Tamiflu. In one embodiment, the term oseltamivir embraces oseltamivir phosphate, oseltamivir carboxylate and all functionally equivalent derivatives thereof. In one embodiment, oseltamivir resistance is characterized by a mutation at amino acid position 275 of the viral neuraminidase protein. Said mutation may result in a histidine to tyrosine substitution at position 275 (H275Y). Thus, in one embodiment, oseltamivir resistance is characterized by H275Y mutation in the viral neuraminidase protein.

The H275Y mutation may result from a single nucleotide base change within the corresponding influenza virus neuraminidase gene; for example, by a mutation at position 823 of the pandemic neuraminidase gene represented by SEQ ID NO: 3. In one embodiment, oseltamivir resistance is characterized by mutation (e.g. by a single nucleotide substitution or deletion) at position 823 of the pandemic neuraminidase gene represented by SEQ ID NO: 3.

In one embodiment, the influenza virus neuraminidase gene has at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence SEQ ID NO: 3.

In yet another embodiment, oseltamivir resistance is characterized by H275Y mutation in the viral neuraminidase of influenza virus A H1 N1 , wherein the influenza virus neuraminidase gene has at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence SEQ ID NO: 3. For example, there may be a mutation (e.g. a single nucleotide substitution or deletion) at position 823 of the pandemic neuraminidase gene, such as is illustrated by way of SEQ ID NO: 3. A sample of the present invention may be for instance (or is derived from) a clinical, veterinary, food, water, environmental or archaeological sample or nucleic acid extract. In one embodiment, the sample is (or is derived from) a clinical or veterinary sample. Clinical samples may include respiratory tract samples, bronchoalveolar lavage, tracheal aspirate, lung tissue samples, throat/oral swabs, sputum samples, cerebrospinal fluid samples, urine samples, blood samples, faecal samples, tissue biopsies and any other samples. A sample may be from (or derived from) birds or mammals including humans.

In one embodiment, the target nucleic acid comprises nucleic acid residues 1 -5 of SEQ ID NO: 4 or the complement thereof or a nucleotide sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto, and/or nucleic acid residues 100-105 of SEQ ID NO: 4 or the complement thereof or a nucleotide sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

In one embodiment, the target nucleic acid comprises nucleic acid residues 1 -29 of SEQ ID NO: 4 or the complement thereof or a nucleotide sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto and/or nucleic acid residues 87-105 of SEQ ID NO: 4 or the complement thereof or a nucleic acid sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

In one embodiment, the target nucleic acid sequence is at least 95 (such as, at least 100, 105, 1 10, 120, 130 or 140) nucleotides long, for example at least 95 contiguous nucleotides of SEQ ID NO: 4.

In another embodiment, the probe binds to a target nucleic acid comprising nucleic acid residues 38-54 of SEQ ID NO: 4 and/or nucleic acid residues 1 -5 of SEQ ID NO: 4 or the complement thereof, and/or nucleic acid residues 100-105 of SEQ ID NO: 4 or the complement thereof, or a nucleic acid sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to.

In one embodiment, the target nucleic acid comprises or consists of a nucleic acid sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 4.

In another embodiment, the probe binds to a target nucleotide sequence located on the negative-sense strand of the influenza virus neuraminidase gene (or negative- sense copy thereof), for example a target nucleotide sequence located on SEQ ID NO: 4.

In one embodiment, the probe comprises or consists of a nucleic acid sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to a nucleic acid sequence selected from SEQ ID NO: 1 or SEQ ID NO: 2.

The invention also provides reagents such as oligonucleotide probes, forward and reverse oligonucleotide primer, and kits comprising said reagents, for use in the methods of the present invention.

Thus, in one aspect, the invention provides an oligonucleotide probe for use in detecting oseltamivir resistant influenza virus in a sample, wherein said probe binds to a target nucleic acid comprising nucleic acid residues 38-54 of SEQ ID NO: 4, or a nucleic acid sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

In one embodiment, the probe is 10-30 nucleotides long, for example at least 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long, for example up to 30, 29, 28, 27, 26, 25, 24, 23, 22 or 21 nucleotides long. In one embodiment, the probe is 13-23 nucleotides long, such as 15-21 nucleotides long. In one embodiment, the probe is about 17 nucleotides long.

In one embodiment, the target nucleotide sequence to which the probe hybridises is 5-15 nucleotides long, such as at least 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long, such as up to 30, 29, 28, 27, 26, 25, 24, 23, 22 or 21 nucleotides long. For example, the target nucleotide sequence for the probe may be 12-25 nucleotides long, such as 15-23 nucleotides long. In one embodiment, the probe binds a target nucleotide sequence that is about 17 nucleotides long.

An alternative means for defining variant probe sequences is by defining the number of nucleotides that differ between the variant sequence and the reference probe sequence. Thus, in one embodiment, a probe of the present invention comprises (or consists of) a nucleic acid sequence that differs from SEQ ID NO: 1 or SEQ ID NO: 2 by no more than 6 nucleotides, for example by no more than 5, 4, 3, 2 or 1 nucleotides. In one embodiment, any nucleotide sequence differences are due to conservative nucleic acid substitutions.

A fragment of the above-mentioned probe sequence may also be employed, wherein the fragment comprises at least 10 consecutive nucleotides of SEQ ID NO: 1 or 2 (or sequence variants thereof as defined above).

Thus, in one embodiment, a probe of the present invention comprises (or consists of) at least 10, 1 1 , 12, 13, 14, 15, 16 consecutive nucleotides of SEQ ID NO: 1 or 2 (or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 98% or 99% nucleotide sequence identity thereto).

Conventional methods for determining nucleic acid sequence identity are discussed in more detail later in the specification.

Probes are designed to hybridise to their target sequence based on a selection of desired parameters. The binding conditions may be such that a high level of specificity is provided - i.e. hybridisation of the probe to the amplification product occurs under "stringent conditions". In general, stringent conditions may be selected to be about 5°C (preferably 10 °C) lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridises to a perfectly matched probe. In one embodiment, the T_m of probes of the present invention, at a salt concentration of about 0.02M or less at pH 7, is above 50°C, such as about 60°C.

In one embodiment, the probe hybridises to the target nucleotide sequence under stringent conditions. Probes can be screened to minimise self-complementarity and dimer formation (probe-probe binding). Probes of the present invention may be selected so as to have minimal homology with non-viral nucleic acid (e.g. mammalian or avian DNA). The selection process may involve comparing a candidate probe sequence with non- viral nucleic acid (e.g. mammalian or avian DNA) and rejecting the probe if the homology is greater than 50%. The aim of this selection process is to reduce annealing of probe to contaminating non-viral DNA sequences and hence allow improved specificity of the assay.

In one embodiment, the probe comprises a label. Thus, in one embodiment, following hybridisation of labelled probe to the target nucleic acid, the label is associated with the bound target nucleic acid. Thus, in one embodiment, the assay comprises detecting the label (eg. following separation of unbound probe from the sample) and correlating presence of label with presence of probe bound to the target nucleic acid, and hence the presence or absence of oseltamivir resistant influenza virus.

The label may comprise a detectable label such as a radiolabel, fluorescent molecule, enzymatic marker or chromogenic marker - eg. a dye that produces a visible colour change upon hybridisation of the probe. By way of example, the label may be digoxygenin, fluorescein-isothiocyanate (FITC) or R-phycoerythrin. The label may be a reporter molecule, which is detected directly, such as by exposure to photographic or X-ray film. Alternatively, the label is not directly detectable, but may be detected indirectly, for example, in a two-phase system. An example of indirect label detection is binding of an antibody to the label.

In one embodiment, the probe comprises a tag. Hence, following hybridisation of tagged probe to the target nucleic acid, the tag is associated with the bound target nucleic acid. Thus, in one embodiment, the assay comprises capturing the tag (eg. following separation of unbound probe from the sample) and correlating presence of the tag with presence of probe bound to target nucleic acid, and hence the presence or absence of oseltamivir resistant influenza virus.

As mentioned above, in one embodiment a sample of the present invention may be for instance (or is derived from) a clinical, veterinary, food, water, environmental or archaeological sample or nucleic acid extract. In one embodiment, the sample is (or is derived from) a clinical or veterinary sample. Clinical samples may include respiratory tract samples, bronchoalveolar lavage, tracheal aspirate, lung tissue samples, throat/oral swabs, sputum samples, cerebrospinal fluid samples, urine samples, blood samples, faecal samples, tissue biopsies and any other samples. A sample may be from (or derived from) birds or mammals including humans. The sample may contain RNA (e.g. influenza virus RNA). In one embodiment, RNA present in the sample is reverse transcribed thereby generating a cDNA copy of said RNA. Thus, if influenza virus neuraminidase gene RNA is present in the sample, it will be reverse transcribed into cDNA. A skilled person is able to determine suitable conditions for promoting reverse transcription. In one embodiment, the cDNA is subjected to an amplification step.

Thus, in one embodiment, the kit of the invention comprises reverse transcriptase (i.e. RNA-dependent DNA polymerase) and/ or amplification reagents such as a polymerase (e.g. a polymerase having 5'-3' exonuclease activity such as Taq polymerase) and/ or DNA precursors (e.g. dNTPs).

Amplification may be carried out using methods and platforms known in the art, for example by PCR, such as real-time PCR.

In the presence of a suitable polymerase and DNA precursors (dATP, dCTP, dGTP and dTTP), forward and reverse primers are extended in a 5' to 3' direction, thereby initiating the synthesis of new nucleic acid strands that are complementary to the individual strands of the target nucleic acid. The primers thereby drive amplification of the target nucleic acid, thereby generating an amplification product (i.e. an amplicon) comprising said target nucleic acid sequence. A skilled person would be able to determine suitable conditions for promoting amplification. In this application, the expressions "amplification product", "amplified nucleic acid sequence", "amplified portion" and "amplicon" are used interchangeably and have the same meaning.

Amplification may be carried out using various methods and platforms known in the art, for example block-based PCR, ligase chain reaction, glass capillaries, isothermal amplification methods including loop-mediated isothermal amplification, rolling circle amplification transcription mediated amplification, nucleic acid sequence-based amplification, signal mediated amplification of RNA technology, strand displacement amplification, isothermal multiple displacement amplification, helicase-dependent amplification, single primer isothermal amplification, and circular helicase-dependent amplification. A skilled person would be able to determine suitable conditions for promoting amplification.

In one embodiment, amplification can be carried using any amplification platform - as such, an advantage of this embodiment of the method is that it is platform independent and not tied to any particular instrument.

A recent development of the standard PCR assay is the emergence of real-time detection methods such as the Applied Biosystems Taqman assay, which employs a sequence-specific fluorescently labelled probe (see Figure 1 ).

During the Taqman reaction, the primers and probe bind to the target sequence, if present. As the primers are extended, the bound probe obstructs the progress of one of the extending strands. This obstruction is then circumvented by Taq polymerase, which possesses a 5' exonuclease activity and enzymatically degrades the single- stranded oligonucleotide probe. As the probe is cleaved the two fluorophores present on the probe are separated, thus altering the relative fluorescent signal. On each successive round of PCR thermal cycling the target nucleotide sequence accumulates, and for every DNA molecule synthesised a probe will be cleaved. The resulting fluorescent signal is cumulative and increases exponentially during PCR amplification.

Thus, in one embodiment, amplification is carried out using a real-time Taqman® PCR platform. Suitable probes for use in the method of the present invention using real-time PCR (such as a Taqman® PCR platform) include probes comprising a minor groove binder component. Thus, in one embodiment, the probe comprises a minor groove binder component.

In one embodiment, the probe comprises reporter and quencher fluorophores. In one embodiment, a reporter fluorophore is located at or near one end of the probe and a quencher fluorophore is located at or near the opposite end of the probe. For example, the reporter fluorophore may be located at or near the 5' end of the probe and the quencher fluorophore may be located at or near the 3' end of the probe (or vice versa).

Suitable reporter fluorophores include FAM, VIC/JOE/Yakima Yellow, N E D/TAM RA/Cy3 , ROX/TR and Cy5. Suitable quencher fluorophores include TAMRA, Black Hole quencher series, Minor Groove Binder, Deep Dark Quenchers, Qxl quenchers, Iowa Black Dark Quenchers and Eclipse Dark Quenchers.

In one embodiment, as discussed above, cleavage of the probe separates the reporter and quencher fluorophores. In one embodiment, separation of the reporter and quencher fluorophores results in a detectable fluorescent signal, or results in a detectable change in a fluorescent signal. Thus, in one embodiment, the detection step comprises (eg. after separating un-hybridised probe from the sample) cleaving the hybridised probe to separate the reporter and quencher fluorophores; and detecting a fluorescent signal or detecting a change in a fluorescent signal; wherein said fluorescent signal, or change in fluorescent signal, is indicative of the presence of the amplification product, and hence the presence or absence of oseltamivir resistant influenza virus in a sample.

By way of example, bound probe may be cleaved by an extending polymerase with 5' to 3' exonuclease activity, as may occur in a real-time PCR assay, such as a Taqman assay.

In one embodiment of the present invention, the Taqman^® system for amplifying and detecting a target nucleic acid sequence is employed. For optimal performance of the Taqman^® assay, the length of the amplicon is less than 200 nucleotides, such as less than 150, 140, 130, 120, 1 10 or 100 nucleotides. In one embodiment, the amplicon is at least 95 nucleotides and less than 200 nucleotides.

Suitable primers for use in the method of the present invention are described throughout this specification.

In one aspect, the invention provides a forward oligonucleotide primer for use in detecting oseltamivir resistant influenza virus in a sample, wherein said forward primer binds to a first target nucleotide sequence, wherein said first target nucleotide sequence comprises or consists of the complement of nucleic acid residues 1 -5 of SEQ ID NO: 4, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity thereto.

In general, a forward primer is designed to hybridise to a target nucleic acid sequence within the complementary (ie. sense) strand (or sense copy) of the target nucleic acid, and a reverse primer is designed to hybridise to a target nucleic acid sequence within the coding (anti-sense) strand (or anti-sense copy) of a target nucleic acid. In one embodiment, said forward primer binds to a first target nucleotide sequence, wherein said first target nucleotide sequence comprises or consists of the complement of nucleic acid residues 1 -29 of SEQ ID NO: 4, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity thereto. In one embodiment, the forward primer is 9-40 nucleotides long, such as at least 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long, such as up to 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22 or 21 nucleotides long. For example, the forward primer may be 27-32 nucleotides long, such as about 29 nucleotides long.

In one embodiment, the target nucleotide sequence comprises or consists of the complement of nucleic acid residues from nucleic acid residue 780 of SEQ ID NO: 3 up to nucleic acid residue 790, 795, 797, 800, 805, 808, 810, 813 or 815 of SEQ ID NO: 3; or from the complement of nucleic acid residue 797 of SEQ ID NO: 3 to the complement of nucleic acid residue 792, 787, 785, 782, 780, 775, 770, 765, 760 or 755 of SEQ ID NO: 3; or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

In one embodiment, the forward primer comprises or consists of the nucleic acid sequence of SEQ ID NO: 5 or a nucleic acid sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

Variants of SEQ ID NO: 5 may alternatively be defined by reciting the number of nucleotides that differ between the variant sequences and SEQ ID NO: 5. Thus, in one embodiment, the forward primer may comprise (or consist of) a nucleotide sequence that differs from SEQ ID NO: 5 at no more than 7 nucleotide positions, for example at no more than 6, 5, 4, 3, 2 or 1 nucleotide positions. In one embodiment, any nucleic acid sequence differences are conservative substitutions.

Fragments of the above-mentioned forward primer sequence (and sequence variants thereof as defined above) may also be employed. In one embodiment, in the context of the forward primer sequence, a fragment is at least 15 nucleotides long, such as at least 16, 17, 18 or 19, 20, 21 , 22, 23, 24, 25, 26, 27 or 28 nucleotides long.

In one embodiment, the forward primer may comprise (or consist of) at least 16, 17, 18 or 19, 20, 21 , 22, 23, 24, 25, 26, 27 or 28 consecutive nucleotides of SEQ ID NO: 5 (or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 98% or 99% nucleotide sequence identity thereto).

In another aspect, the invention provides a reverse oligonucleotide primer for use in detecting oseltamivir resistant influenza virus in a sample, wherein said reverse primer binds to a second target nucleotide sequence, wherein said second target nucleotide sequence comprises or consists of nucleic acid residues 100-105 of SEQ ID NO: 4, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity thereto. In general, a forward primer is designed to hybridise to a target nucleic acid sequence within the complementary (ie. anti-sense) strand of the target nucleic acid, and a reverse primer is designed to hybridise to a target nucleic acid sequence within the coding (sense) strand of a target nucleic acid. In one embodiment, said second target nucleotide sequence comprises (or consists of) nucleic acid residues 87-105 of SEQ ID NO: 4, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity thereto. In one embodiment, the reverse primer is 9-40 nucleotides long, such as at least 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long, such as up to 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22 or 21 nucleotides long. For example, the reverse primer may be 16-22 nucleotides long, such as about 19 nucleotides long. In one embodiment, the target nucleotide sequence comprises or consists of a sequence of nucleic acid residues from nucleic acid residue 884 of SEQ ID NO: 3 to nucleic acid residue 879, 877, 870, 866, 860, 855, 850 or 840 of SEQ ID NO: 3; or from nucleic acid residue 866 of SEQ ID NO: 3 to nucleic acid residue 870, 875, 879, 880, 884, 889, 890, 895, 900, 905, 910 of SEQ ID NO: 3; or the complement thereof, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

In one embodiment, the reverse primer comprises or consists of the nucleic acid sequence of SEQ ID NO: 6 or a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

Variants of SEQ ID NO: 6 may alternatively be defined by reciting the number of nucleotides that differ between the variant sequences and SEQ ID NO: 6. In one embodiment, the reverse primer may comprise (or consist of) a nucleotide sequence that differs from SEQ ID NO: 6 at no more than 5 nucleotide positions, for example at no more than 4, 3, 2 or 1 nucleotide positions. In one embodiment, any nucleic acid sequence differences are conservative substitutions. Fragments of the above-mentioned reverse primer sequences (and sequence variants thereof as defined above) may also be employed. In one embodiment, in the context of the reverse primer sequence, a fragment is at least 14 nucleotides long, such as at least 15, 16, 17, or 18 nucleotides long. In one embodiment, the reverse primer may comprise (or consist of) at least 14, 15, 16, 17, or 18 consecutive nucleotides of SEQ ID NO: 6 (or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 98% or 99% nucleotide sequence identity thereto). In one embodiment, the forward primer binds to a target nucleotide sequence comprising or consisting of nucleic acid residues 1 to 29 of SEQ ID NO: 4 or the complement thereof, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity thereto; and the reverse primer binds to a target nucleotide sequence comprising or consisting of nucleic acid residues 87 to 105 of SEQ ID NO: 4 or the complement thereof, or a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity thereto.

In another aspect, the invention provides a pair of forward and reverse oligonucleotide primers comprising a forward primer and/ or a reverse primer as described above.

The forward and reverse primers of the present invention are designed to bind to the target nucleic acid sequence based on the selection of desired parameters, using conventional software, such as Primer Express (Applied Biosystems).

The term 'hybridises' is equivalent and interchangeable with the term 'binds'.

In one aspect, the invention provides a kit for detecting oseltamivir resistant influenza virus in a sample, said kit comprising forward and reverse oligonucleotide primers (such as any of the forward or reverse primers described above) and a probe (such as any of the oligonucleotide probes described above).

In one embodiment, the above-mentioned primers bind to target nucleotide sequences in the influenza virus neuraminidase gene cDNA under conditions suitable to promote amplification, thereby generating the amplicon. The amplicon can be contacted by a probe, wherein the probe binds to a target nucleotide sequence located in the amplicon. The target nucleotide sequence in the amplicon can therefore be detected by binding of the probe to the amplicon. In one embodiment, the amplicon is at least 95 nucleotides long (such as, at least 100, 105, 1 10, 120, 130 or 140) nucleotides long.

In one embodiment, the amplicon comprises or consists of a nucleotide sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) sequence identity to a nucleic acid sequence selected from SEQ ID NO: 4.

In one embodiment, the amplicon comprises nucleic acid residues 1 to 5 of SEQ ID NO: 5 and/or nucleic acid residues 87-105 of SEQ ID NO: 4.

In one embodiment, the amplicon comprises a sequence of nucleic acid residues from nucleic acid residue 780 of SEQ ID NO: 3 up to nucleic acid residue 790, 795, 797, 800, 805, 808, 810, 813 or 815 of SEQ ID NO: 3; or from nucleic acid residue 797 of SEQ ID NO: 3 to nucleic acid residue 792, 787, 785, 782, 780, 775, 770, 765, 760 or 755 of SEQ ID NO: 3.

In one embodiment, the amplicon additionally, or alternatively, comprises a sequence of nucleic acid residues from nucleic acid residue 884 of SEQ ID NO: 3 up to nucleic acid residue 879, 877, 870, 866, 860, 855, 850 or 840 of SEQ ID NO: 3; or from nucleic acid residue 866 of SEQ ID NO: 3 to nucleic acid residue 870, 875, 879, 880, 884, 889, 890, 895, 900, 905, 910 of SEQ ID NO: 3.

In one embodiment, the amplicon comprises or consists of nucleic acid residues 1 - 105 of SEQ ID NO: 4, or a nucleic acid sequence having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity thereto.

Conventional methods for determining nucleic acid sequence identity are discussed in more detail later in the specification. An alternative means for defining amplicon sequences is by defining the number of nucleotides that differ between the variant sequence and the reference amplicon sequence. Thus, in one embodiment, an amplicon of the present invention comprises or consists of a nucleic acid sequence that differs from SEQ ID NO: 4 by no more than 30 nucleotides, for example by no more than 25, 20, 15, 10, 5, 3, 2 or 1 nucleotides.

In one embodiment, the amplicon is labelled, and the amount of amplicon is measured by detecting the label and measuring the amount of label. In one embodiment, the amplicon is tagged, and the amount of amplicon is quantified by capturing the tag and measuring the amount of captured tag.

In one embodiment, the amplicon is hybridised with an oligonucleotide probe. In one embodiment, the amount of amplicon is measured by measuring the amount of probe-amplification product hybridisation complexes. In one embodiment, the probe is tagged or labelled, and the amount of probe-amplicon hybridisation complex is measured by detecting the label or capturing the tag (eg. after separating un- hybridised probe from the sample), and measuring the presence (and optionally the quantity) of label or captured tag, wherein the presence of the label or tag is indicative of the presence of the hybridisation complex.

In one embodiment, the amount of probe-amplicon hybridisation complexes is measured by detecting (and optionally quantifying) a fluorescent signal or a change in a fluorescent signal, wherein said fluorescent signal or a change in a fluorescent signal is indicative of the presence of the hybridisation complex. In one embodiment, reporter and quencher fluorophores are attached to the probe, and a fluorescent signal (or change therein) is generated by cleavage of the probe and consequent separation of reporter and quencher fluorophores. The present invention also provides run control nucleic acid molecules for use in target nucleic acid detection assays. In one embodiment, the invention provides a run control nucleic acid molecule for us in a oseltamivir resistance assay, as described above.

In one aspect, the invention provides a run control nucleic acid molecule, for use in a target nucleic acid detection assay, said run control nucleic acid molecule comprising:

(i) a first nucleic acid sequence, wherein said first nucleic acid sequence comprises at least 10 contiguous nucleotides having at least 90% nucleotide sequence identity to a first nucleic acid sequence present on the target nucleic acid molecule; and

(ii) a second nucleic acid sequence, wherein the second nucleic acid sequence comprises at least 5 contiguous nucleotides, and wherein said second nucleic acid sequence is not present on the target nucleic acid molecule.

In one embodiment, the first nucleic acid sequence comprises or consists of at least 10, such as at least 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or 25 contiguous nucleotides, such as up to 40, such as up to 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27 or 26 contiguous nucleotides having at least 90% (such as, at least 91 %, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99% or 100%) nucleotide sequence identity to a first nucleic acid sequence present on the target nucleic acid molecule.

In one embodiment, the first nucleic acid sequence comprises or consists of 10-30, 12-25 or 15-23 contiguous nucleotides having at least 90% (such as, at least 91 %, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99% or 100%) nucleotide sequence identity to a first nucleic acid sequence present on the target nucleic acid molecule. In one embodiment, the second nucleic acid sequence comprises or consists of at least 5, such as at least 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or 30 contiguous nucleotides, and wherein said second nucleic acid sequence is not present on the target nucleic acid molecule.

In one embodiment, the second nucleic acid sequence comprises or consists of 10- 30, 10-25 or 10-20 contiguous nucleotides and wherein said second nucleic acid sequence is not present on the target nucleic acid molecule. In one embodiment of the invention, said first nucleic acid sequence binds to a first oligonucleotide probe, and when bound thereto the probe allows detection of the run control nucleic acid molecule. Thus, in one embodiment, the first nucleic acid sequence enables detection of the run control nucleic acid molecule by an oligonucleotide probe.

In one embodiment of the invention, said second nucleic acid sequence binds to a second oligonucleotide probe, and when bound thereto allows detection of the run control nucleic acid molecule and/ or allows differentiation of the run control nucleic acid molecule from the target nucleic acid molecule. Thus, in one embodiment, the second nucleic acid sequence enables detection of the run control nucleic acid molecule by an oligonucleotide probe and/ or allows differentiation of the run control nucleic acid molecule from the target nucleic acid molecule.

The first and second nucleic acid sequences of the run control nucleic acid molecules can be detected using probes. In this regard, the description provided above with respect to probes and detection thereof is equally applicable to probes that hybridise to the first and second nucleic acid sequences of the run control nucleic acid molecules. A run control nucleic acid molecule may be a positive control sequence. Thus, in one embodiment, a run control nucleic acid molecule of the present invention may be used as a positive control in a target nucleic acid detection assay. For example, the run control nucleic acid molecule of the present invention may be used in a method described herein i.e. the oseltamivir resistance assay.

In one embodiment, the first nucleic acid sequence of the run control nucleic acid molecule may be used for detecting the presence of said run control nucleic acid molecule. In one embodiment, the run control nucleic acid molecule is detected by binding of a probe (eg. an oligonucleotide probe) to the first nucleic acid sequence. Detection of said run control nucleic acid molecule (via said first nucleic acid sequence) may be correlated with a positive result and proper functioning of a target nucleic acid detection assay (e.g. in a method of the present invention). Alternatively, if the run control nucleic acid molecule cannot be detected (e.g. binding of probe to said first nucleic acid sequence cannot be detected), this may indicate a negative result.

The run control nucleic acid molecules of the present invention can thus be used as positive controls to validate a target nucleic acid detection assay. In one embodiment, said target nucleic acid detection assay comprises a PCR assay, such as a real-time PCR assay.

A run control nucleic acid molecule of the present invention may also be used as a contamination control. Thus, in one embodiment, the run control nucleic acid molecule of the present invention is used as a contamination control in a target nucleic acid detection assay. In accordance with this embodiment, the run control nucleic acid molecule may be used to indicate a false-positive result. By way of example, if a 'positive control' run control nucleic acid molecule accidentally contaminates a target nucleic acid detection assay sample, the run control nucleic acid molecule would give rise to false positive results. In one embodiment, the presence of contaminating run control nucleic acid molecule in a target nucleic acid detection assay sample may be detected via detection of the second nucleic acid sequence of the run control nucleic acid molecule. In one embodiment, the run control nucleic acid molecule is detected by binding of a probe to the second nucleic acid sequence. The second nucleic acid sequence is not present in the target nucleic acid molecule and can therefore be used to distinguish the run control nucleic acid molecule from sample target nucleic acid molecule. If run control nucleic acid molecule is detected in the target nucleic acid detection assay sample (ie. if the second nucleic acid sequence is identified in the assay sample, such as via hybridisation of a probe), this may be correlated with contamination of the sample and/ or a false-positive result. Alternatively, if the run control nucleic acid molecule is not detected in the target nucleic acid detection assay sample (ie. if the second nucleic acid sequence is not identified in the assay sample, such as via an absence of probe hybridisation) this may indicate that the target nucleic acid detection assay sample is not contaminated by the 'positive control' run control nucleic acid molecule and provides confidence in the results of the target nucleic acid detection assay.

Positive controls and contamination controls are important in target nucleic acid detection assay, particularly in highly sensitive methodologies such as PCR. For example, there is a significant risk that samples become contaminated during handling with positive control material. The value of the above-mentioned run control nucleic acid molecules is particularly high in methods of the present invention. In more detail, when the prevalence of influenza is low, a contamination event is more likely to occur from the positive control material and use of the run control nucleic acid molecules described herein would be particularly advantageous.

In one embodiment, the first nucleic acid sequence comprises a nucleotide sequence associated with viral drug resistance or bacterial drug resistance or a diagnostic marker for disease (e.g. cancer) - i.e. in the target nucleic acid/ organism/ sample. In one embodiment, the second nucleic acid sequence of run control nucleic acid molecule of the present invention comprises or consists of a nucleotide sequence that is from a heterologous genetic source relative to the target nucleic acid molecule. In other words, said second nucleic acid sequence may comprise or consist of a nucleotide sequence from a different genetic source compared to the target nucleic acid molecule. By way of example, if the target nucleic acid molecule is of viral origin, then the second nucleic acid sequence would comprise or consist of a nucleotide sequence of non-viral origin such as a synthetic (i.e. non-naturally occurring) origin, mammalian origin, plant origin, fish origin, fungal origin or bacterial origin.

In one embodiment, said second nucleic acid sequence comprises or consists of a nucleotide sequence that is selected from: a synthetic nucleotide sequence, a mammalian nucleotide sequence, a plant nucleotide sequence, a fish nucleotide sequence, a fungal nucleotide sequence and/ or a bacterial nucleotide sequence.

In one embodiment, the first nucleic acid sequence comprises or consists of a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid residues 38-54 of SEQ ID NO: 4.

In one embodiment, the second nucleic acid sequence comprises or consists of a nucleotide sequence that is not present in the nucleic acid of SEQ ID NO: 4.

Thus, in one embodiment, the invention provides a run control nucleic acid molecule, for use in a target nucleic acid detection assay, said run control nucleic acid molecule comprising:

(i) a first nucleic acid sequence, wherein said first nucleic acid sequence comprises (or consists of) a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to nucleic acid residues 38-54 of SEQ ID NO: 4; and

(ii) a second nucleic acid sequence, wherein said second nucleic acid sequence comprises (or consists of) a nucleotide sequence that is not present in the nucleic acid of SEQ ID NO: 4.

In one embodiment, the second nucleic acid sequence comprises or consists of a nucleotide sequence that is from a heterologous genetic source relative to SEQ ID NO: 4. Suitable second nucleic acid sequence may comprise or consist of a nucleotide sequence that is not present in the influenza virus neuraminidase gene (or in the complement thereof). The second nucleic acid sequence may therefore comprise (or consists of) a nucleotide sequence that is heterologous to said influenza virus neuraminidase gene. In one embodiment, the second nucleic acid sequence comprises (or consists of) a nucleotide sequence that is not present in the influenza virus genome/ is heterologous to influenza virus. For example, the second nucleic acid may comprise or consist of a synthetic (i.e. non-naturally occurring) nucleotide sequence. Alternatively, the second nucleic acid sequence may comprise or consist of a naturally-occurring nucleotide sequence from a source other than influenza virus neuraminidase gene, or from a source other than influenza virus. Suitable sources of the second nucleic acid sequence include nucleotide sequences from plants, mammals, fish, fungi, or bacteria. Thus, in one embodiment, said second nucleic acid sequence comprises or consists of a nucleotide sequence that is selected from: a synthetic nucleotide sequence, a mammalian nucleotide sequence, a plant nucleotide sequence, a fish nucleotide sequence, a fungal nucleotide sequence and/ or a bacterial nucleotide sequence.

In one embodiment the second nucleic acid sequence comprises or consists of a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to nucleic acid residues 58-72 of SEQ ID NO: 16. In one embodiment, the run control nucleic acid molecule comprises or consists of a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

In one embodiment, the oligonucleotide probe that binds to said first nucleic acid sequence comprises or consists of a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 1 or 2.

In one embodiment of the invention, said second nucleic acid sequence binds to a second oligonucleotide probe, and when bound thereto allows detection of the run control nucleic acid molecule and/ or allows differentiation of the run control nucleic acid molecule from SEQ ID NO: 4. Thus, in one embodiment, the second nucleic acid sequence enables detection of the run control nucleic acid molecule by an oligonucleotide probe and/ or allows differentiation of the run control nucleic acid molecule from SEQ ID NO: 4. In one embodiment, the oligonucleotide probe that binds to said second nucleic acid sequence comprises or consists of a nucleic acid having at least 80% (such as, at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 18. The first and second nucleic acid sequences of the run control nucleic acid molecules described above can be detected using probes. In this regard, the description provided above with respect to probes is equally applicable to probes that hybridise to the first and second nucleic acid sequences of the run control nucleic acid molecules. Thus, in one aspect, the invention provides an oligonucleotide probe for use in a target nucleic acid detection assay, wherein said probe binds to the first nucleic acid sequence of the run control nucleic acid molecule described herein. In another aspect, the invention provides an oligonucleotide probe for use in a target nucleic acid detection assay, wherein said probe binds to the second nucleic acid sequence of the run control nucleic acid molecule described herein.

In one embodiment, the oligonucleotide probe that binds to the second nucleic acid sequence comprises or consists of a nucleic acid having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 18.

In one embodiment, the oligonucleotide probe binds to the second nucleic acid sequence, wherein said second nucleic acid sequence comprises or consists of a nucleic acid having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to to nucleic acid residues 58-72 of SEQ ID NO:16, or the complement thereof. An alternative means for defining variant probe sequences is by defining the number of nucleotides that differ between the variant sequence and the reference probe sequence. Thus, in one embodiment, the oligonucleotide probe for use in a target nucleic acid detection assay comprises (or consists of) a nucleic acid sequence that differs from SEQ ID NO: 18 by no more than 6 nucleotides, for example by no more than 5, 4, 3, 2 or 1 nucleotides. For example, any nucleotide sequence differences may be conservative substitutions.

A fragment of the above-described probe sequence may also be employed, wherein the fragment is at least 10, 1 1 , 12 or 13 nucleotides long. Thus, in one embodiment, the oligonucleotide probe for use in a target nucleic acid detection assay comprises or consists of at least 10, 1 1 , 12 or 13 consecutive nucleotides of a nucleic acid sequence having at least 80% (such as at least 85%, 90%, 95%, 96%, 98%, 99% or 100%) nucleotide sequence identity to the nucleic acid sequence selected from SEQ ID NO: 18.

In a preferred embodiment, the probe comprises a fluorophore label, such as NED.

In one aspect, the invention provides use of a run control nucleic acid molecule described herein, in a method described herein.

Thus, in one embodiment, the invention provides a run control nucleic acid molecule for use in a method for detecting oseltamivir resistant influenza virus in a sample.

In one embodiment, the invention provides a run control nucleic acid molecule as described above for use as a run control in a detection method of the invention comprising forward and reverse primer target nucleotide binding sequences suitable to promote amplification of a portion of said run control nucleic acid molecule.

In one embodiment, the primers of the present invention bind to said forward and reverse primer target binding nucleotide sequences in the run control nucleic acid molecule, and thereby promote amplification of a portion of said run control nucleic acid molecule.

In one embodiment, the run control nucleic acid molecule is a ribonucleic acid (RNA) molecule. In one embodiment, the run control nucleic acid RNA molecule is first reverse transcribed into cDNA. A skilled person would be able to determine suitable conditions for promoting reverse transcription. In one embodiment, the cDNA is subjected to an amplification step.

Amplification may be carried out using methods and platforms known in the art, as described above. Thus, the above-described methods, reagents and embodiments may apply equally to the run control nucleic acid molecule aspect of the invention. Thus, amplification may be carried out using PCR, such as a real-time Taqman® PCR platform.

In one embodiment, primers may bind to target nucleotide sequences in the run control nucleic acid molecule described herein under conditions suitable to promote amplification, thereby generating an amplicon. The amplicon can be contacted by a probe, wherein the probe binds to a target nucleotide sequence located in the amplicon. The target nucleotide sequence in the amplicon can therefore be detected by binding of the probe to the amplicon. Labelling and detection strategies of an amplicon are described above and are equally applicable to the run control nucleic acid molecule aspect of the present invention.

In one embodiment, the forward and reverse primer target nucleotide binding sequences of the run control nucleic acid molecule comprise or consist of the forward and reverse primer target nucleotide binding sequences as defined above with respect to the method of the present invention. Thus, in one embodiment, the forward and reverse primers of the present invention bind to said forward and reverse primer target nucleotide binding sequences under suitable conditions to promote amplification of a portion of said run control nucleic acid molecule.

In another aspect, the invention provides use of a run control nucleic acid molecule as described herein, in a target nucleic acid detection assay. In one embodiment, said target nucleic acid detection assay comprises a PCR assay, such as a real-time PCR assay. In one embodiment, said run control nucleic acid molecule described herein is not used as an internal amplification control (e.g. as an internal amplification control in a PCR assay). An internal amplification control (IAC) is a non-target nucleic acid molecule that is amplified simultaneously with a target nucleic acid molecule. Thus, in a PCR with an IAC, a control signal will be produced when there is no target sequence present. When neither IAC signal nor target signal is produced, the PCR has failed. Thus, an IAC is used to indicate false-negative results.

In another aspect, the invention provides a kit for detecting oseltamivir resistant influenza virus, wherein said kit comprises one or more forward and/ or reverse primers, and/ or oligonucleotide probes, and/ or run control nucleic acid molecules of the invention, as described herein.

Definitions

The term "complement of a nucleic acid sequence" refers to a nucleic acid sequence having a complementary nucleotide sequence as compared to a reference nucleotide sequence. Thus, for example, the complement of the sequence ATGC is TACG.

For the avoidance of doubt, in the context of the present invention, the definition of an oligonucleotide probe does not include the full length influenza virus neuraminidase gene (or the complement thereof).

As used herein, the terms "nucleic acid sequence", "nucleotide sequence/ molecule" and "polynucleotide" are used interchangeably and do not imply any length restriction. As used herein, the terms "nucleic acid" and "nucleotide" are used interchangeably. The terms "nucleic acid sequence" "nucleotide sequence" and "polynucleotide" embrace DNA (including cDNA) and RNA sequences.

The nucleic acid sequences of the present invention include nucleic acid sequences that have been removed from their naturally occurring environment, recombinant or cloned DNA isolates, and chemically synthesized analogues or analogues biologically synthesized by heterologous systems.

The nucleic acid sequences of the present invention may be prepared by any means known in the art. For example, nucleic acids of the present invention may be produced by chemical synthesis, eg. by the phosphoramidite method or the triester method, and may be performed on commercial automated oligonucleotide synthesizers. A double-stranded fragment may be obtained from the single stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strand together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.

In one embodiment of the present invention, the terms "H275Y mutation" and "H274Y mutation" are synonymous for the same mutation, and thus reference to H275Y may embrace or encompass H274Y (and vice versa).

Any of a variety of sequence alignment methods can be used to determine percent identity, including, without limitation, global methods, local methods and hybrid methods, such as, e.g., segment approach methods. Protocols to determine percent identity are routine procedures within the scope of one skilled in the art. Global methods align sequences from the beginning to the end of the molecule and determine the best alignment by adding up scores of individual residue pairs and by imposing gap penalties. A general global alignment technique is the Needleman- Wunsch algorithm (Needleman & Wunsch (1970). "A general method applicable to the search for similarities in the amino acid sequence of two proteins". J Mol Biol 48 (3): 443-53). An example of a local alignment technique is the Smith-Waterman algorithm (Smith & Waterman MS (1981 ) "Identification of Common Molecular Subsequences" Journal of Molecular Biology 147: 195-197). Pairwise sequence alignment methods may be used to find the best-matching piecewise (local) or global alignments of two query sequences. The three primary methods of producing pairwise alignments are dot-matrix methods, dynamic programming, and word methods. Non-limiting methods include, e.g. Basic local alignment search tool (BLAST) is a publically available algorithm commonly used for sequence alignments. It is publically available at e.g. http://blast.ncbi.nlm.nih.gov/Blast.cgi. FASTA is another commonly used sequence alignment tool and is publically available at e.g. http://www.ebi.ac.uk/Tools/fasta33/nucleotide.html. Thus, percent sequence identity can be determined by conventional methods.

"R" is the standard nomenclature for a degeneracy of A or G at this position in a nucleotide sequence.

As used herein, the terms "positive-sense" and "plus-strand" are used interchangeably . As used herein, the terms "negative-sense" and "minus-strand" are used interchangeably, In addition, as used herein, the terms "sense" and "strand" are used interchangeably.

The present invention will now be described, by way of example only, with reference to the accompanying Examples and Figures, in which: Figure 1 illustrates the four main steps of a conventional real-time Taqman assay, labelled l-IV, namely (I) "Polymerisation", (II) "Strand displacement" (III) "Cleavage" and (IV) "Polymerisation completed".

Forward primer (4), reverse primer (5) and probe (6) are mixed with a buffered solution comprising sample DNA, dNTPs and a thermostable DNA polymerase enzyme (not shown), and added to the reaction vessel. The target dsDNA (1 ) (if present) is then denatured by heating to a temperature above its Tm, causing strand separation. As illustrated in Step (I) of Figure 1 , "Polymerisation", the temperature is then lowered sufficiently for hybridisation to occur between forward primer (4) and complementary, non-coding/ anti-sense strand (3); between reverse primer (5) and coding/ sense strand (2); and between probe (6) and either strand (2) or (3). In the particular embodiment illustrated in Figure 1 , step (I), probe (6) is bound to complementary, non-coding/ anti-sense strand (3). In this particular example, probe (6) is labelled at its 5' end with a reporter fluorophore (R) and at its 3' end with a quencher fluorophore (Q).

DNA synthesis then proceeds by extension of the bound forward and reverse primers by DNA polymerase, generating extending strands (7) and (8).

As illustrated in step (II) of Figure 1 "Strand displacement", bound probe (6) obstructs the progress of one of the extending strands (extending strand (7) in this particular example). This obstruction is then circumvented by the DNA Taq polymerase, which possesses 5' to 3' exonuclease activity, and hence can enzymatically degrade probe (6).

Step (III), "Cleavage" illustrates that as probe (6) is cleaved the two fluorophores (R) and (Q) present on probe (6) are separated, which alters the relative fluorescent signal.

Step (IV), "Polymerisation completed" shows complete extension of extending strands (7) and (8) along the length of coding/ sense strand (2) and complementary, non-coding/ anti-sense strand (3), and degradation of probe (6). The first round of PCR thermal cycling is hence complete.

On each successive round of PCR thermal cycling, probe (6) is cleaved and fluorophores (R) and (Q) are separated. The resulting fluorescent signal is cumulative and increases exponentially during PCR amplification. Figure 2 shows the coding sequence of Oseltamivir sensitive and resistant Influenza A viruses around the SwH275Y SNP. A potential variant resistant sequence could be encoded from strains harbouring a silent SNP encoding Tyrosine 274. Figure 3 shows typical reaction profiles of 275H wild type strains with a range of Ct values.

Figure 4 shows typical reaction profiles of oseltamivir resistant (275Y) strains. Figure 5 shows reaction profiles of oseltamivir resistant strains mixed with predominantly wild type 275H virus. Trace 1 . -100% resistant, Trace 2. -50% resistant, Trace 3. -25% resistant, Trace 4. -12% resistant, Trace 5. -6% resistant, Trace 6. -3% resistant, Trace 7. <3% resistant or 100% wild type 275H. Figure 6 shows reaction profiles of wild type 275H strains mixed with predominantly resistant virus. Trace 1 . -100% wild type, Trace 2. -50% wild type, Trace 3. -25% wild type, Trace 4. -12% wild type, Trace 5. -6% wild type, Trace 6. -3% wild type, Trace 7. <3% wild type or 100% Resistant. Figure 7 shows typical amplification profiles demonstrating detection of the contamination control sequence represented by line '1 ' and the swine resistance 275Y RNA template sequence represented by line '2'. Wild type sequence is not detected and is shown by line '3', which remains below the horizontal threshold line. Figure 8 shows typical amplification profiles demonstrating detection of the contamination control sequence represented by line '1 ' and the wild-type sequence 275H RNA template sequence represented by line '2'. Swine flu resistance sequence is not detected and is shown by line '3', which remains below the horizontal threshold line. Figure 9 shows the results of performance of the run control nucleic acid molecule "Oseltamivir-sensitive RNA control template 1 " (SEQ ID NO: 16) in Taqman PCR assays.

Figure 10 shows the results of performance of the run control nucleic acid molecule "Oseltamivir-resistant RNA control template 1 " (SEQ ID NO: 17) in Taqman PCR assays. Figure 11 shows concordance data for samples assayed using the Oseltamivir Resistance Screening Assay (SwH275Y Taqman PCR) and confirmatory pyrosequencing. Values are Ct values.

KEY TO SEQ ID NOs:

SEQ ID NO: 1 MGB Probe (Resistant)

SEQ ID NO: 2 MGB Probe (Sensitive)

SEQ ID NO: 3 GQ351316 FluA virus (A/Hong Kong/2369/2009(H1 N1 ))

segment 6 nucleotide sequence

SEQ ID NO: 4 Amplicon sequence 1

SEQ ID NO: 5 Forward primer

SEQ ID NO: 6 Reverse primer

SEQ ID NO: 7 CY039528 Influenza A virus (A Netherlands/602/2009(H1 N1 )) segment 8 nucleotide sequence

SEQ ID NO: 8 GQ385302 Influenza A virus (A/Toronto/0462/2009(H1 N1 ))

segment 6 neuraminidase (NA) nucleotide sequence

SEQ ID NO: 9 CY056238 Influenza A virus (A/San Diego/INS70/2009(H1 N1 )) segment 6 nucleotide sequence

SEQ ID NO: 10 CY051971 Influenza A virus (A/Catalonia/S1753/2009(H1 N1 )) segment 6 nucleotide sequence

SEQ ID NO: 11 GQ365445 Influenza A virus (A/Osaka/180/2009(H1 N1 )) segment 6 neuraminidase (NA) nucleotide sequence

SEQ ID NO: 12 NC_004909 Influenza A virus (A/Hong Kong/1073/99(H9N2)) segment 6 nucleotide sequence

SEQ ID NO: 13 NC_007382 Influenza A virus (A/Korea/426/68(H2N2)) segment

6 nucleotide sequence

SEQ ID NO: 14 J02095 Influenza B/lee/40, neuraminidase & nb segment 6 nucleotide sequence

SEQ ID NO: 15 NC_002209 Influenza B virus RNA 6, nucleotide sequence

SEQ ID NO: 16 Sequence of Oseltamivir-sensitive RNA control template 1

SEQ ID NO: 17 Sequence of Oseltamivir-resistant RNA control template 1

SEQ ID NO: 18 NED Probe for 'control' template sequence

SEQ ID NO: 19 Sequence of Oseltamivir-sensitive RNA control template 2 SEQ ID NO: 20 Sequence of Oseltamivir-resistant RNA control template 2

SEQUENCES:

SEQ ID NO: 1

TCCTCATAGTa RTAATT

SEQ ID NO: 2

TCCTCATAGTg RTAATT

SEQ ID NO: 3

ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATAT ACAAATTGGAAACA AATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGA AACATGCAATCAAAGCGTCATTACTTATGAAAACAACACTTGGGTAAATCAGACATATGTTAACATCAGC AACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTG TTAGTGGATGGGCTATATACAGTAAAGACAACAGTATAAGAATCGGTTCCAAGGGGGATGTGTTTGTCAT AAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTA AATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTG GTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGG CATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGC ATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTG TAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTGATGGACAGGCCTCATACAAGATCTTCAG AATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATTACTATGAGGAATGCTCC TGTTATCCTGATTCTAGTGAAATCACATGTGTATGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGG TGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACG CCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCA TTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGA TTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAA TGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCT TGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATAT CCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCAT TGACAAGTAA

SEQ ID NO: 4

gggaaagatag tcaaatcagt cgaaatgaat gcccctaatt attactatga ggaatgctcc tgttatcctg attctagtga aatcacatgt gtatgcaggg ataa

SEQ ID NO: 5

G G G AAAG ATAGTCAAATCAGTCG AAATG A SEQ ID NO: 6

TTATCCCTGCACACACATG

SEQ ID NO: 7

AGCAAAAGCAGGAGTTTAAAATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAAT TGGAATGGCTAACTTAATATTACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTT GGGAAT CAAAA C AGAT GAAAC A GCAA C AAAGCG C AT T AC T T AT GAAAAC AAC AC T T GGGTAAAT C AGACATATGTTAACATCAGCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGG CAATTCCTCTCTCTGCCCTGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTGTAAGAGTCGGTTCC AAGGGGGATGTGTTTGTCATAAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCT TGACTCAGGGGGCCTTGCTAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAAC CCTAATGAGCTGTCCTATTGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCA GCAAGTGCTTGTCATGATGGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGG CTGTGTTAAAGTACAACGGCATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACA AGAGTCTGAATGTGCATGTGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAG GCCTCATACAAGATCTTCAGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATT ATCACTATGAGGAATGCTCCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCA TGGCTCGAATCGACCGTGGGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGCTACATATGCAGTGGG ATTTTCGGAGACAATCCACGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAA ATGGAGTAAAAGGATTTTCATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTC AAGAAACGGTTTTGAGATGATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAG CAAGATATCGTAGGAATAAATGAGTGGTCAGGATATAGCGGGAGTTTTATTCAGCATCCAGAACTAACAG GGCTGGATTGTATAAGACCTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTG GACTAGCGGGAGCAGCATATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGT GCTGAGTTGCCATTTACCATTGACAAGTAATTTGTTCAAAAAACTCCTTGTTTCTACT

SEQ ID NO: 8

CAAAAGCAGGAGTTTAAAATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTG GAATGGCTAACTTAATATTACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGG GAAT CAAAAT C AGAT T GAAAC AT GCAAT C AAAGCGT CAT T AC T T AT GAAAAC AAC AC T T GGGTAAAT C AG ACATATGTTAACATCAGCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCA ATTCCTCTCTCTGCCCTGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTGTAAGAATCGGTTCCAA GGGGGATGTGTTTGTCATAAGAGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTG ACTCAAGGGGCCTTGCTAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCC TAATGAGCTGTCCTATTGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGC AAGTGCTTGTCATGATGGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCT GTGTTAAAGTACAACGGCATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAG AGTCTGAATGTGCATGTGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAGGC CTCATACAAGATCTTCAGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTAT CACTATGAGGAATGCTCCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATG GCTCGAATCGACCGTGGGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGAT TTTCGGAGACAATCCACGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAAT GGAGTAAAAGGATTTTCATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAA GAAACGGTTTTGAGATGATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCA AGACATCGTAGGAATAAATGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGG CTGGATTGTATAAGACCTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGA CTAGCGGGAGCAGCATATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGC TGAGTTGCCATTTACCATTGACAAGTAATTTGTTCAAAAAACTCCTT SEQ ID NO: 9

AAATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAAT AT T AC AAAT T GGAAAC AT AAT C T C AAT AT GGAT T AGCC AC T C AAT T C AAC T T GGGAAT CAAAAT C AGAT T GAAAC AT GC AAT C AAAGCGT CAT T AC T T AT GAAAAC AAC AC T T GGGT AAAT C AGAC AT AT GT T AAC AT C A GCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCC TGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTATAAGAATCGGTTCCAAGGGGGATGTGTTTGTC ATAAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGC TAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTAT TGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGAT GGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACG GC AT AAT AAC AGAC AC TAT CAAGAGTT GGAGAAAC AAT AT AT T GAGAAC AC AAGAGT C T GAAT GT GC AT G TGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTGATGGACAGGCCTCATACAAGATCTTC AGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTACCACTATGAGGAATGCT CCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCAAATCGACCGTG GGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCA CGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTT CATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGAT GATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATA AATGAATGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGAC CTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGTGGGAGCAGCAT ATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACC ATTGACAAGTAATTTGTTCA

SEQ ID NO: 10

AC AT GC AAT C AAAGCGT CAT T AC T T AT GAAAAC AAC AC T T GGGT AAAT C AGAC AT AT GT T AAC AT C AGC A ACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTGT TAGTGGATGGGCTATATACAGTAAAGACAACAGTATAAGAATCGGTTCCAAGGGGGATGTGTTTGTCATA AGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTAA ATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTGG TGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGGC ATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGCA TAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTGT AAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTGATGGACAGGCCTCATACAAGATCTTCAGA ATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTACCACTATGAGGAATGCTCCT GTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGGT ATCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACGC CCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCAT TCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGAT TTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAAT GAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCTT GCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATATC CTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCGGACGGTGCTGAGT

SEQ ID NO: 11

ATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATAT T AC AAAT T GGAAAC AT AAT C T C AAT AT GGAT T AGCC AC T C AAT T C AAC T T GGGAAT CAAAAT C AGAT T GA AAC AT GC AAT C AAAGCGT CAT T AC T T AT GAAAAC AAC AC T T GGGT AAAT C AGAC AT AT GT T AAC AT C AGC AACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTG TTAGTGGATGGGCTATATACAGTAAAGACAACAGTATAAGAATCGGTTCCAAGGGGGATGTGTTTGTCAT AAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTA AATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTG GTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGG CATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGC A AA AAC AGAC AC AT CAAGAGTT GGAGAAAC AAT AT AT T GAGAAC AC AAGAGT C T GAAT GT GC AT GT G TAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAGGCCTCATACAAGATCTTCAG AATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATTACTATGAGGAATGCTCC TGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGG TGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACG CCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCA TTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGA TTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAA TGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCT TGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATAT CCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCAT TGACAAGTAA

SEQ ID NO: 12

ATGAATCCAAATCAAAAGATAATAGCACTTGGCTCTGTTTCTATAACTATTGCGACAATATGTTTACTCA TGCAGATTGCCATCTTAGCAACGACTATGACACTACATTTCAATGAATGTACCAACCCATCGAACAATCA AGCAGTGCCATGTGAACCAATCATAATAGAAAGGAACATAACAGAGATAGTGCATTTGAATAATACTACC ATAGAGAAGGAAAGTTGTCCTAAAGTAGCAGAATACAAGAATTGGTCAAAACCGCAATGTCAAATTACAG GGTTCGCCCCTTTCTCCAAGGACAACTCAATTAGGCTTTCTGCAGGCGGGGATATTTGGGTGACAAGAGA ACCTTATGTATCGTGCGGTCTTGGTAAATGTTACCAATTTGCACTTGGGCAGGGAACCACTTTGAACAAC AAACACTCAAATGGCACAATACATGATAGGAGTCCCCATAGAACCCTTTTAATGAACGAGTTGGGTGTTC CATTTCATTTGGGAACCAAACAAGTGTGCATAGCATGGTCCAGCTCAAGCTGCCATGATGGGAAGGCATG GTTACATGTTTGTGTCACTGGGGATGATAGAAATGCGACTGCTAGCATCATTTATGATGGGATGCTTACC GACAGTATTGGTTCATGGTCTAAGAACATCCTCAGAACTCAGGAGTCAGAATGCGTTTGCATCAATGGAA C T T GT AC AGT AGT AAT GAC T GAT GGAAGT GC AT C AGGAAGGGC T GAT AC T AAAAT AC T AT T C AT T AGAGA AGGGAAAATTGTCCACATTGGTCCACTGTCAGGAAGTGCTCAGCATGTGGAGGAATGCTCCTGTTACCCC CGGTATCCAGAAGTTAGATGTGTTTGCAGAGACAATTGGAAGGGCTCCAATAGACCCGTGCTATATATAA ATGTGGCAGATTATAGTGTTGATTCTAGTTATGTGTGCTCAGGACTTGTTGGCGACACACCAAGAAATGA CGATAGCTCCAGCAGCAGTAACTGCAGGGATCCTAATAACGAGAGAGGGGGCCCAGGAGTGAAAGGGTGG GCCTTTGACAATGGAAATGATGTTTGGATGGGACGAACAATCAAGAAAGATTCGCGCTCTGGTTATGAGA CTTTCAGGGTCGTTGGTGGTTGGACTACGGCTAATTCCAAGTCACAAATAAATAGGCAAGTCATAGTTGA CAGTGATAACTGGTCTGGGTATTCTGGTATATTCTCTGTTGAAGGAAAAACCTGCATCAACAGGTGTTTT TATGTGGAGTTGATAAGAGGGAGACCACAGGAGACCAGAGTATGGTGGACTTCAAATAGCATCATTGTAT TTTGTGGAACTTCAGGTACCTATGGAACAGGCTCATGGCCTGATGGAGCGAATATCAATTTCATGTCTAT ATAAGCTTTCGCAATTTT

SEQ ID NO: 13

ATGAATCCAAATCAAAAGATAATAACAATTGGCTCTGTCTCTCTCACCATTGCAACAGTATGCTTCCTCA TGCAGATTGCCATCCTGGTAACTACTGTGACATTGCATTTTAAGCAACATGAGTGCGACTCCCCCGCGAG CAACCAAGTAATGCCGTGTGAACCAATAATAATAGAAAGGAACATAACAGAGATAGTGTATTTGAATAAC ACCACCATAGAGAAAGAGATCTGCCCCGAAGTAGTGGAATACAGAAATTGGTCAAAGCCGCAATGTCAAA TTACAGGATTTGCACCTTTTTCTAAGGACAATTCAATCCGGCTTTCTGCTGGTGGGGACATTTGGGTGAC GAGAGAACCTTATGTGTCATGCGATCCTGGCAAGTGTTATCAATTTGCACTCGGGCAGGGGACCACACTA GACAACAAACATTCAAATGACACAATACATGATAGAATCCCTCATCGAACCCTATTAATGAATGAGTTGG GTGTTCCATTTCATTTAGGAACCAGGCAAGTGTGTGTAGCATGGTCCAGCTCAAGTTGTCACGATGGAAA AGCATGGTTGCATGTTTGTGTCACTGGGGATGATAAAAATGCAACTGCTAGCTTCATTTATGACGGGAGG CTTATGGACAGTATTGGTTCATGGTCTCAAAATATCCTCAGGACCCAGGAGTCGGAATGCGTTTGTATCA ATGGGACTTGCACAGTAGTAATGACTGATGGAAGTGCTTCAGGAAGAGCCGATACTAGAATACTATTCAT TGAAGAGGGGAAAATTGTCCATATTAGCCCATTGTCAGGAAGTGCTCAGCATGTAGAGGAGTGTTCCTGT TATCCTCGATATCCTGACGTCAGATGTATCTGCAGAGACAACTGGAAAGGCTCTAATAGGCCCGTCATAG ACATAAATATGGAAGATTATAGCATTGATTCCAGTTATGTGTGCTCAGGGCTTGTTGGCGACACACCCAG AAACGACGACAGATCTAGCAATAGTAATTGCAGGAATCCTAACAATGAGAGAGGGAATCCAGGAGTGAAA GGCTGGGCCTTTGACAATGGAGATGACGTGTGGATGGGAAGAACGATCAGCAAGGATTTACGCTCAGGTT ATGAAACTTTCAAAGTCATTGGTGGTTGGTCCACACCTAATTCCAAATCGCAGATCAATAGACAGGTCAT AGTTGACAGCAATAATTGGTCAGGTTACTCTGGTATTTTCTCTGTTGAGGGCAAAAGATGCATCAATAGG TGCTTTTATGTGGAGTTGATAAGGGGAAGGCAACAGGAGACTAGAGTATGGTGGACCTCAAACAGTATTG TTGTGTTTTGTGGCACTTCAGGTACTTATGGAACAGGCTCATGGCCTGATGGGGCGAACATCAATTTCAT GCCTATATAA

SEQ ID NO: 14

AGC AGAAGC AGAGC A AT T C T T AGAAC T GAAGT GAAC AGGCC AAAAAT GAACAAT GC T ACC T T C AAC T GT ACAAACATTAACCCTATTACTCACATCAGGGGGAGTATTATTATCACTATATGTGTCAGCCTCATTGTCA TACTTATTGTATTCGGATGTATTGCTAAAATTTTCATCAACAAAAACAACTGCACCAACAATGTCATTAG AGTGCACAAACGCATCAAATGCCCAGACTGTGAACCATTCTGCAACAAAAGAGATGACATTTCCACCCCC AGAGCCGGAGTGGACATACCCTCGTTTATCTTGCCAGGGCTCAACCTTTCAGAAGGCACTCCTAATTAGC CCTCATAGGTTCGGAGAGATCAAAGGAAACTCAGCTCCCTTGATAATAAGAGAACCTTTTGTTGCTTGTG GACCAAAAGAATGCAGACACTTTGCTCTGACCCATTATGCAGCTCAGCCGGGGGGATACTACAATGGAAC AAGAAAGGACAGAAACAAGCTGAGGCATCTAGTATCAGTCAAATTGGGAAAAATCCCAACTGTGGAAAAC TCCATTTTCCACATGGCAGCTTGGAGCGGATCCGCATGCCATGATGGTAGAGAATGGACATATATCGGAG TTGATGGTCCT GACAAT GAT GC AT T GGT C AAAAT AAAAT AT GGAGAAGC AT AT AC T GAC AC AT AT C AT T C CTATGCACACAACATCCTAAGAACACAAGAAAGTGCCTGCAATTGCATCGGGGGAGATTGTTATCTTATG ATAACAGACGGCTCAGCTTCAGGAATTAGTAAATGCAGATTTCTTAAAATTAGAGAGGGTCGAATAATAA AAGAAATACTTCCAACAGGAAGAGTGGAGCACACTGAAGAGTGCACATGCGGGTTCGCCAGCAATAAAAC CATAGAATGTGCCTGTAGAGACAACAGTTACACAGCAAAAAGACCCTTTGTCAAATTAAATGTGGAAACT GATACAGCTGAAATAAGATTGATGTGCACAAAGACTTATCTAGACACTCCCAGACCGGATGATGGAAGCA TAGCAGGGCCTTGCGAATCTAATGGAGACAAGTGGCTTGGAGGCATCAAAGGAGGATTCGTCCATCAAAG AATGGCATCTAAGATTGGAAGATGGTACTCCCGAACGATGTCTAAAACTAACAGAATGGGGATGGAACTG TATGTAAAGTATGATGGTGACCCATGGACTGACAGTGATGCTCTTACTCTTAGTGGAGTAATGGTTTCCA TAGAAGAACCTGGTTGGTATTCTTTTGGCTTCGAAATAAAGGACAAGAAATGTGATGTCCCTTGTATTGG GATAGAGATGGTACACGATGGTGGAAAAGATACTTGGCATTCAGCTGCAACAGCCATTTACTGTTTGATG GGCTCAGGACAATTGCTATGGGACACTGTCACAGGCGTTGATATGGCTTTATAATAGAGGAATGGTTGGA TCTGTTCTAAACCCTTTGTTCCTATTTTATTTGAACAGTTGTTCTTACTAGATTTAATTGTTTCTGAAAA ATGCTCTTGTTACTACT

SEQ ID NO: 15

AGC AGAAGC AGAGC AT AT T C T T AGAAC T GAAGT GAAC AGGCC AAAAAT GAACAAT GC T ACC T T C AAC T GT ACAAACATTAACCCTATTACTCACATCAGGGGGAGTATTATTATCACTATATGTGTCAGCCTCATTGTCA TACTTATTGTATTCGGATGTATTGCTAAAATTTTCATCAACAAAAACAACTGCACCAACAATGTCATTAG AGTGCACAAACGCATCAAATGCCCAGACTGTGAACCATTCTGCAACAAAAGAGATGACATTTCCACCCCC AGAGCCGGAGTGGACATACCCTCGTTTATCTTGCCAGGGCTCAACCTTTCAGAAGGCACTCCTAATTAGC CCTCATAGGTTCGGAGAGATCAAAGGAAACTCAGCTCCCTTGATAATAAGAGAACCTTTTGTTGCTTGTG GACCAAAAGAATGCAGACACTTTGCTCTGACCCATTATGCAGCTCAGCCGGGGGGATACTACAATGGAAC AAGAAAGGACAGAAACAAGCTGAGGCATCTAGTATCAGTCAAATTGGGAAAAATCCCAACTGTGGAAAAC TCCATTTTCCACATGGCAGCTTGGAGCGGATCCGCATGCCATGATGGTAGAGAATGGACATATATCGGAG TTGATGGTCCT GACAAT GAT GC AT T GGT C AAAAT AAAAT AT GGAGAAGC AT AT AC T GAC AC AT AT C AT T C CTATGCACACAACATCCTAAGAACACAAGAAAGTGCCTGCAATTGCATCGGGGGAGATTGTTATCTTATG ATAACAGACGGCTCAGCTTCAGGAATTAGTAAATGCAGATTTCTTAAAATTAGAGAGGGTCGAATAATAA AAGAAATACTTCCAACAGGAAGAGTGGAGCACACTGAAGAGTGCACATGCGGGTTCGCCAGCAATAAAAC CATAGAATGTGCCTGTAGAGACAACAGTTACACAGCAAAAAGACCCTTTGTCAAATTAAATGTGGAAACT GATACAGCTGAAATAAGATTGATGTGCACAAAGACTTATCTAGACACTCCCAGACCGGATGATGGAAGCA TAGCAGGGCCTTGCGAATCTAATGGAGACAAGTGGCTTGGAGGCATCAAAGGAGGATTCGTCCATCAAAG AATGGCATCTAAGATTGGAAGATGGTACTCCCGAACGATGTCTAAAACTAACAGAATGGGGATGGAACTG TATGTAAAGTATGATGGTGACCCATGGACTGACAGTGATGCTCTTACTCTTAGTGGAGTAATGGTTTCCA TAGAAGAACCTGGTTGGTATTCTTTTGGCTTCGAAATAAAGGACAAGAAATGTGATGTCCCTTGTATTGG GATAGAGATGGTACACGATGGTGGAAAAGATACTTGGCATTCAGCTGCAACAGCCATTTACTGTTTGATG GGCTCAGGACAATTGCTATGGGACACTGTCACAGGCGTTGATATGGCTTTATAATAGAGGAATGGTTGGA TCTGTTCTAAACCCTTTGTTCCTATTTTATTTGAACAGTTGTTCTTACTAGATTTAATTGTTTCTGAAAA ATGCTCTTGTTACTACT

SEQ ID NO: 16

GGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATcACTATGAGGAATGcgctttggaacaatgTTC TAGTGAAATCACATGTGTGTGCAGGGATAA

SEQ ID NO: 17

GGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATtACTATGAGGAATGcgctttggaacaatgTTC TAGTGAAATCACATGTGTGTGCAGGGATAA

SEQ ID NO: 18

TCGCTGGATCAATC

SEQ ID NO: 19

GGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATcACTATGAGGAATGt cgctggatcaatcTTCTAGTGAAATCACATGTGTGTGCAGGGATAA

SEQ ID NO: 20

GGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATtACTATGAGGAATGt cgctggatcaatcTTCTAGTGAAATCACATGTGTGTGCAGGGATAA

EXAMPLES

Example 1 - Pandemic Influenza A Oseltamivir Resistance Screening Assay (SwH275Y Taqman PCR) A major determinant of Oseltamivir resistance among Influenza A viruses is encoded by a single nucleotide polymorphism (SNP) in the Neuraminidase gene, which leads to altered amino acid coding from Histidine to Tyrosine ( the so called H275Y mutation). We developed a rapid molecular allelic discrimination assay to probe the relevant single nucleotide polymorphism and so detect and discriminate the Oseltamivir sensitive and resistant genotypes in Pandemic Influenza A viruses.

Primer/Probe Design:

645 Pandemic Influenza A neuraminidase gene nucleotide sequences from GenBank were aligned to identify sequence variation in the region of the resistance encoding the SNP. Polymerase Chain Reaction (PCR) primers were selected to span the Oseltamivir resistance SNP targeting conserved regions of the Pandemic Influenza A genome. Probes were designed to include the Oseltamivir resistance SNP. Another potential sequence variant encoding a silent mutation was accommodated by degeneracy in the probe sequence. Representative Oseltamivir Sensitive sequences include GenBank accession numbers, CY039528, GQ385302, CY056238 and CY051971 (represented by SEQ ID NOs: 7-10, respectively). Figure 2 shows representative Oseltamivir Resistant sequences around the SwH275Y SNP including GenBank accession numbers GQ351316 (SEQ ID NO: 3) and GQ365445 (SEQ ID NO: 1 1 ).

SwH275Y Forward (SEQ ID NO: 5): 5' - GGG AAA GAT AGT CAA ATC AGT CGA AAT GA - 3' SwH275Y Reverse (SEQ ID NO: 6): 5' - TTA TCC CTG CAC ACA CAT G - 3'

SwH275 Probe (Wild Type) (SEQ ID NO: 2): 5' VIC - TCC TCA TAG TgR TAA TT - MGBNFQ 3' SwY275 Probe (Resistant) ((SEQ ID NO: 1 ): 5' 6FAM - TCC TCA TAG TaR TAA TT - MGBNFQ 3'

Nucleic Acid Purification:

Viral RNA was extracted from clinical specimens using QIAamp Viral RNA Mini Kit (QIAGEN) but other methods suitable for processing respiratory samples (eg nose and throat swabs, broncho-alveolar lavage and nasopharyngeal aspirates) and providing extracts of sufficient quality for downstream molecular processes (eg PCR, sequencing) may be suitable. Typically, 20ΌμΙ_ of clinical sample was extracted and eluted into 75μΙ_ of molecular grade water.

Real time PCR SNP Assay:

The SwH275Y assay can be performed as a Two step assay or a One step assay. In the Two step assay, extracted RNA was first converted to complementary DNA (cDNA) using reverse transcriptase and then amplified by real time PCR as two separate reactions. In the One step assay, extracted RNA was converted to cDNA and then amplified by real time PCR in a single reaction.

Two-step Assay - cDNA synthesis:

36μΙ_ of extracted RNA was added to 14μΙ_ of cDNA Master Mix comprising 10μΙ_ 5x MMLV Reverse Transcriptase Buffer (Promega), 2.5μΙ_ 10mM dNTP mix (Promega), 0.5μΙ_ pdN₆ primer (Roche) and 1 μΙ_ Reverse Transcriptase (2001Ι/μΙ_, Promega) in a 0.2ml_ PCR tube. The reaction mixture was incubated at 37°C for 30 minutes, followed by 10 minutes at 90°C in a thermal cycler.

Two-step Assay - Real time PCR:

5μΙ_ of cDNA was added to a PCR reaction (20μΙ_ final volume) comprising 10μΙ_ Applied Biosystems fast Universal Master Mix (2x), and 0.9μΜ SwH275Y Forward Primer, 0.9μΜ SwH275Y Reverse Primer, 0.1 μΜ SwH275 Probe and 0.1 μΜ SwY275 Probe) in a Applied Biosystems Fast PCR plate. The plate was sealed with optical film and the PCR reaction was incubated in an Applied Biosystems 7500 Fast Real time thermal cycler with the following reaction profile: 95°C 20 seconds 1 x

95°C 3 seconds

50x

60°C 60 seconds

VIC and FAM fluorescence data was acquired during the 60°C, 60 seconds step. One-step Assay - Real time Reverse Transcriptase PCR:

7.5μΙ_ extracted RNA was added to a PCR reaction (25μΙ_ final volume) containing 12.5μΙ_ Invitrogen One Step Master Mix, 0.8μΙ_ Superscript III RT/Platinum Taq mix, 0.9μΜ SwH275Y Forward Primer, 0.9μΜ SwH275Y Reverse Primer, 0.1 μΜ SwH275 Probe and 0.1 μΜ SwY275 Probe) in a Applied Biosystems Fast PCR plate. The plate was sealed with optical film and the PCR reaction was incubated in an Applied Biosystems 7500 Fast Real time thermal cycler with the following reaction profile:

50°C 15 minutes 1 x

95°C 2 minutes 1 x

95°C 15 seconds

45x

60°C 60 seconds

VIC and FAM fluorescence data was acquired during the 60°C, 60 seconds step.

Real time Fluorescence Data Analysis:

At the end of the amplification the signal baseline was set using the auto baseline function of the Applied Biosystems SDS software for each detector (SwH275-VIC and SwY275-FAM). The fluorescent threshold was set for each detector by dragging the threshold bar to a point just above fluorescence noise signal (as represented in negative controls samples with no template added). This was achieved most accurately by viewing the fluorescence data in log mode. Cycle threshold (Ct) values were generated by selecting the analyse button. Once the analysis was completed, the threshold bar indicator turned green. Results: Positive results in SwH275Y assay were indicated by an increase in fluorescent signal rising above the baseline and crossing through the threshold bar. Examples of reaction profiles are shown in Figures 3 -6.

The SwH275Y Taqman assay was validated with a blinded panel of 10 specimens comprising mixtures of Oseltamivir sensitive and resistant strains of Pandemic Influenza A virus -see the Table below. The SwH275Y Taqman assay was able to correctly detect the appropriate viruses in each sample.

Example 2 - Run control nucleic acid molecules for Pandemic Influenza A H1 N1v Oseltamivir resistance assay The Oseltamivir resistance Taqman assay described above identifies the single nucleotide polymorphism H275Y, which is a major determinant of resistance among pandemic swine H1 N1 influenza A virus. Assay controls are required to demonstrate appropriate performance of the reverse transcriptase Taqman PCR assay. As an alternative to cultured virus as control material, artificial templates such may be generated. Influenza A is an RNA virus and thus, to adequately control for both the reverse transcriptase and the PCR processes, an RNA template should be used as the starting material.

RNA transcripts which represent the RNA sequence of an oseltamivir resistant strain and one representing a sensitive strain were synthesised in vitro. An additional short 'control' sequence was introduced that could be used to distinguish this control template from the wild type strain and identify contamination of patients sample with the control material. These are specific run control nucleic acid of the present invention.

The nucleotide sequences were synthesised and cloned into a plasmid vector. RNA transcripts were then synthesised from these plasmid cloned sequences.

Synthesis of RNA transcripts:

Sequences were synthesised and cloned into the TA cloning plasmid vector p2.1 from Invitrogen. Examples of sequences synthesised are shown below (i.e. SEQ ID NOs 16 & 17 and 19 & 20). The underlined sequence represents the 'control' sequence which has been added to a section of the influenza A neuraminidase nucleic acid (non-underlined sequence).

From the TA cloning plasmid p2.1 , plasmid construct RNA transcripts were generated using the Durascribe T7 and SP6 transcription kit. The DuraScribe T7 and SP6 RNA Polymerases provided in the kits incorporate 2^'-Fluorine-CTP (2^'-F-dCTP) and 2 - Fluorine-UTP (2^'-F-dUTP), as well as ATP and GTP into full length transcripts. These 2^'-fluorine-modified RNA transcripts are completely resistant to RNase A which is practically very useful where RNA molecules are readily degraded by RNases commonly found on skin and in the general environment. The RNA transcripts generated from the plasmid constructs were then used as positive controls to validate an assay run. The 'control' sequence (ie. the second nucleic acid sequence of the run control nucleic acid molecules of the present invention) can be used to distinguish the run control nucleic acid molecules from a patient positive sample, confirming a true positive and identifying where contamination from the control template has occurred. Oseltamivir-sensitive RNA control template 1 (SEQ ID NO: 16)

Oseltamivir-resistant RNA control template 1 (SEQ ID NO: 17)

Oseltamivir-sensitive RNA control template 2 (SEQ ID NO: 19)

Oseltamivir-resistant RNA control template 2 (SEQ ID NO: 20)

Pandemic Influenza A Oseltamivir Resistance Screening Assay (SwH275Y Taqman PCR) with RNA control templates:

A Master Mix was generated using the above-described RNA run control nucleic acid molecules (SEQ ID NOs: 16 &17) as positive and contamination control and the assay was carried out as described above (see Example 1 ) with the addition of a fluorescent NED-labelled probe (shown below and represented by SEQ ID NO: 18) corresponding to the 'control' sequence shown underlined above (i.e. in SEQ ID NOs:16 & 17):

'Control' RNA template Probe: 5' NED-TCGCTGGATCAATC-MGBNFQ 3'

Primer and Probe Mix:

Stock Cone. X1 Reaction (μΙ) Final Cone. uM

Invitrogen 2x One-step mix 12.5

including ROX

Invitrogen Superscript Ill/Platinum 0.8

Tag Mix

Forward Primer 36μΜ 0.625 0.9

Reverse Primer 36μΜ 0.625 0.9

H275-BV6 VIC Probe 4μΜ 0.625 0.1

Y275-BV6 FAM Probe 4μΜ 0.625 0.1

'Control' Probe NED-labelled 4uM 0.625 0.1

Water 1 .0

Sample 7.5^*

Total Volume 25

The NED-labelled control probe was included in all PCR reactions i.e. in control as well as patient samples. The demonstration of the contamination control probe in a patient sample indicates that this result was due to contamination with one of the 2 'control' run control nucleic acid molecule RNA templates. This is of even greater value when the prevalence of swine influenza from patients is low as a contamination event is then most likely to occur from the control material. Validation of the assay using these controls was based upon the expected cycle threshold values and the results are illustrated in the amplification plots shown in Figures 7 and 8.

Example 3 - Validation of Pandemic Influenza A H1 N1v Oseltamivir resistance assay run control nucleic acid molecules The Pandemic influenza A H1 N1 H275Y (oseltamivir resistance) run control nucleic acid molecules were designed to enable standardisation of performance of the assay of the present invention. The concentration of the run control nucleic acid molecules was designed to produce a consistently positive result for both oseltamivir sensitive and resistant representative sequences, and through the use of a recombinant transcript that contain an unrelated sequence can be used to identify contamination of clinical samples with the run control nucleic acid molecules. The concentration of the reagent was designed to give a cycle threshold (Ct) value of approximately 25.

The transcripts were evaluated by real-time PCR designed to detect and distinguish oseltamivir sensitive and resistant influenza A H1 N1 2009. Cycle threshold (Ct) values were recorded, and the results are shown in Figures 9 and 10. Results from the H275 sensitive and Y275 positive control transcripts are shown. The Ct values returned for each dilution of virus have been averaged and are shown below.

The Ct mean values for the virus ranged from 24.92 and 27.22 for the H275 transcript and 24.2 to 29.30 for the Y275 transcript. Each assay showed a very good level of consistency.

The data demonstrated the utility of the influenza A H1 N1 H275Y (oseltamivir resistance) run control nucleic acid molecules and demonstrates the general principal of designing and using run control nucleic acid molecules of the present invention in target nucleic acid detection assays.

Example 4 - Stability studies on run control nucleic acid molecules Three batches of transcripts were prepared and tested for stability over a range of time and temperature. Each batch consisted of the 2 transcripts H275 sens-MG and Y275 res-MG (as described above) and for each time and temperature condition aliquots were extracted using a Qiagen MDx automated extraction system. All stocks and working reagents were stored at or below -80°C and the freezers used for storage were monitored regularly.

Stability of the transcripts was tested at room temperature, 4°C, -20°C and -80°C daily for 7 days. Stability was checked following 5 successive freeze thaw cycles of the same aliquot over 7 days. Long term stability checks at -80°C were performed over a period of 58 days.

Results

Transcripts stored at 4°C were stable for up to 3 days and were stable for at least 7 days at both -20°C and -80°C. Repeated freeze thawing showed deterioration of the transcripts only after the third freeze thaw cycle. Moreover, long term stability studies at -80°C showed no deterioration of the transcripts over a period of 58 days.

The results demonstrate the utility of the run control nucleic acid molecules of the present invention as a commercial product suitable for repeated and long-term use.

Example 5 - Pyrosequencing of Pandemic Influenza A Oseltamivir Resistance Screening Assay (SwH275Y Taqman PCR) samples.

969 patient specimens were tested for pandemic influenza using the oseltamivir resistance assay of the present invention. In 24 samples from 17 patients, the resistant genotype (SwY275) was detected. 17 specimens were detected as resistant genotype only and 7 specimens indicated a mixture of resistant and sensitive influenza viruses.

Samples were sent for confirmatory pyrosequencing - the results are summarised in Figure 1 1 . All 17 "Resistant only" samples were confirmed as 100% resistant by pyrosequencing. Of the "mixed infections", 5 were confirmed mixtures of sensitive and resistant viruses by pyrosequencing. In one specimen (Patient O), the pandemic influenza virus could not be detected, probably due to low levels in the sample and therefore the Oseltamivir resistance genotype could not be determined. However, in other samples from this patient, the Oseltamivir Resistance TaqMan assay and pyrosequencing results were concordant. In another "mixed infection" sample (Patient K), the resistance marker could not be detected by the pyrosequencing method. This sample may have contained a lower proportion of the resistant genotype not resolved by pyrosequencing.

The concordance of the results demonstrate the high sensitivity and specificity of the assay of the present invention.

Claims

1 . A method for detecting oseltamivir resistant influenza virus in a sample, comprising:

(i) contacting the sample with an oligonucleotide probe, wherein the probe binds to a target nucleic acid comprising nucleic acid residues 1 -5 of

SEQ ID NO: 4 or the complement thereof, and

(ii) detecting for binding of said probe to said target nucleic acid;

2. A method according to Claim 1 , wherein said target nucleic acid comprises nucleic acid residues 1 -29 of SEQ ID NO: 4 or the complement thereof or a nucleic acid having at least 80% nucleotide sequence identity thereto.

3. A method according to any of Claims 1 -2, wherein said target nucleic acid further comprises nucleic acid residues 100-105 of SEQ ID NO: 4 or the complement thereof.

4. A method according to any of Claims 1 -3, wherein said target nucleic acid further comprises nucleic acid residues 87-105 of SEQ ID NO: 4 or the complement thereof or a nucleic acid having at least 80% nucleotide sequence identity thereto.

5. A method according to any preceding claim, wherein said target nucleic acid is at least 95 nucleotides long.

6. A method according to any of Claims 1 -5, wherein said target nucleic acid further comprises a nucleic acid having at least 80% nucleotide sequence identity to nucleic acid residues 38-54 of SEQ ID NO: 4.

7. A method according to any of Claims 1 -6, wherein said oligonucleotide probe binds to a nucleic acid having at least 80% nucleotide sequence identity to nucleic acid residues 38-54 of SEQ ID NO: 4.

8. A method according to any of Claims 1 -7, wherein said oligonucleotide probe comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

9. A method according to Claim 1 -8, wherein said target nucleic acid comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 4.

10. An oligonucleotide probe, for use in a method according to any of Claims 1 -9, wherein said probe binds to a nucleic acid having at least 80% nucleotide sequence identity to nucleic acid residues 38-54 of SEQ ID NO: 4.

1 1 . An oligonucleotide probe according to Claim 10, wherein said probe comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

12. A forward oligonucleotide primer, for use in a method according to any of Claims 1 -9, wherein said forward primer binds to a first target nucleotide sequence, wherein said first target nucleotide sequence comprises the complement of nucleic acid residues 1 -5 of SEQ ID NO: 4, or a nucleotide sequence having at least 80% sequence identity thereto.

13. A forward primer according to Claim 12, wherein said first target nucleotide sequence comprises the complement of nucleic acid residues 1 -29 of SEQ ID NO: 4, or a nucleotide sequence having at least 80% sequence identity thereto.

14. A forward primer according to Claim 12 or Claim 13, wherein said forward primer comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 5.

15. A reverse oligonucleotide primer, for use in the method according to any of Claims 1 -9, wherein said reverse primer binds to a second target nucleotide sequence, wherein said second target nucleotide sequence comprises at least 80% sequence identity to nucleic acid residues 100-105 of SEQ ID NO: 4.

16. A reverse primer according to Claim 15, wherein said second target nucleotide sequence comprises a nucleotide sequence having at least 80% sequence identity to nucleic acid residues 87-105 of SEQ ID NO: 4.

17. A reverse primer according to Claim 15 or Claim 16, wherein said reverse primer comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 6.

18. A run control nucleic acid molecule, for use in a target nucleic acid detection assay, said run control nucleic acid molecule comprising:

19. A run control nucleic acid molecule according to Claim 18, wherein said first nucleic acid sequence binds to a first oligonucleotide probe, and when bound thereto the probe allows detection of the run control nucleic acid molecule.

20. A run control nucleic acid molecule according to Claim 19, wherein said first nucleic acid sequence comprises a nucleotide sequence associated with viral drug resistance or bacterial drug resistance or a diagnostic marker for disease.

21 . A run control nucleic acid molecule according to any of Claims 18-20, wherein said second nucleic acid sequence binds to a second oligonucleotide probe, and when bound thereto allows detection of the run control nucleic acid molecule and/ or allows differentiation of the run control nucleic acid molecule from the target nucleic acid molecule.

22. A run control nucleic acid molecule according to any of Claims 18-21 , wherein said second nucleic acid sequence comprises a nucleotide sequence that is from a heterologous genetic source relative to the target nucleic acid molecule.

23. A run control nucleic acid molecule according to any of Claims 18-22, wherein said second nucleic acid sequence comprises a nucleotide sequence that is selected from: a synthetic nucleotide sequence, a mammalian nucleotide sequence, a plant nucleotide sequence, a fish nucleotide sequence, a fungal nucleotide sequence and/ or a bacterial nucleotide sequence.

24. A run control nucleic acid molecule according to any of Claims 18-23, wherein the first nucleic acid sequence comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid residues 38-54 of SEQ ID NO: 4.

25. A run control nucleic acid molecule according to any of Claims 18-24, wherein the second nucleic acid sequence comprises a nucleotide sequence that is not present in the nucleic acid of SEQ ID NO: 4.

26. A run control nucleic acid molecule according to Claim 18-25, wherein the second nucleic acid sequence comprises a nucleic acid having at least 80% nucleotide sequence identity to nucleic acid residues 58-72 of SEQ ID NO: 16.

27. A run control nucleic acid molecule according to any of Claims 18-26, wherein the run control nucleic acid molecule comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 16 or SEQ ID NO: 17.

28. A run control nucleic acid molecule according to any of Claims 18-27, wherein the oligonucleotide probe that binds to said first nucleic acid sequence comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 1 or 2.

29. A run control nucleic acid molecule according to any of Claims 18-28, wherein the oligonucleotide probe that binds to said second nucleic acid sequence comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 18.

30. An oligonucleotide probe, for use in a target nucleic acid detection assay, wherein said probe binds to the first nucleic acid sequence of the run control nucleic acid molecule according to any of Claims 18-27.

31 . An oligonucleotide probe, for use in a target nucleic acid detection assay, wherein said probe binds to the second nucleic acid sequence of the run control nucleic acid molecule according to any of Claims 18-27.

32. An oligonucleotide probe according to Claim 31 , wherein the oligonucleotide probe comprises a nucleic acid having at least 80% nucleotide sequence identity to the nucleic acid sequence of SEQ ID NO: 18.

33. Use of a run control nucleic acid molecule according to any of Claims 18-29, in a method according to any of Claims 1 -9.

34. Use of a run control nucleic acid molecule according to any of Claims 18-29, in a target nucleic acid detection assay.

35. Use according to Claim 33 or Claim 34, wherein said run control nucleic acid molecule according to any of Claims 18-29 is not used as an internal amplification control.

36. A kit for detecting oseltamivir resistant influenza virus, said kit comprising an oligonucleotide probe according to any of Claims 10-1 1 , 30-32, and/or a forward oligonucleotide primer according to any of Claims 12-14, and/ or a reverse oligonucleotide primer according to any of Claims 15-17, and/ or a run control nucleic acid molecule according to any of Claims 18-29.

37. A method, oligonucleotide probe, forward oligonucleotide primer, reverse oligonucleotide primer, run control nucleic acid molecule or kit, substantially as described herein with reference to the Examples and/ or the Figures.