WO2012002087A1 - Procédé de détection d'acariens appartenant au genre acarapis - Google Patents

Procédé de détection d'acariens appartenant au genre acarapis Download PDF

Info

Publication number
WO2012002087A1
WO2012002087A1 PCT/JP2011/062342 JP2011062342W WO2012002087A1 WO 2012002087 A1 WO2012002087 A1 WO 2012002087A1 JP 2011062342 W JP2011062342 W JP 2011062342W WO 2012002087 A1 WO2012002087 A1 WO 2012002087A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
primer
primer set
acarapis
Prior art date
Application number
PCT/JP2011/062342
Other languages
English (en)
Japanese (ja)
Inventor
辰彦 門脇
Original Assignee
国立大学法人名古屋大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人名古屋大学 filed Critical 国立大学法人名古屋大学
Publication of WO2012002087A1 publication Critical patent/WO2012002087A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms

Definitions

  • the present invention relates to a method for specifically detecting Acarapis mites and reagents, kits and the like used therefor.
  • the present invention is particularly useful as a means for detecting acarine mites (A. woodi) among Acarapis mites.
  • honey bee reduction determines whether honey bee reduction is due to mite infestation or other diseases (beebee virus, bacteria, mold, microsporidia, etc.) This is very important.
  • mite infestation or other diseases beebee virus, bacteria, mold, microsporidia, etc.
  • the typical hegiita mite has a large body length and can be easily confirmed by visual observation.
  • acarapis mites and other mites belonging to the genus Acarapis have a small body length and are difficult to confirm. In particular, it is difficult to detect red mite that parasitize the trachea.
  • Non-patent Document 1 a classic method (Non-patent Document 1) is used to detect red-spotted tick, that is, a method of detecting by a series of steps of bee dissection, section preparation, and staining. While this conventional method can make a final determination of acarinoid disease, (1) it is necessary to acquire skills, and (2) it is difficult to screen a large number of samples (about 50 bees per sample). (3) There are some disadvantages such as extremely low detection sensitivity.
  • a first object of the present invention is to provide a means for quickly and efficiently detecting Acarapis mites parasitized by bees.
  • the second object of the present invention is to provide a means for detecting quickly and efficiently a red spider mite which is particularly difficult to detect among Acarapis mites.
  • the inventor has intensively studied to solve the above problems.
  • target-specific detection was not possible, and the strategy had to be changed.
  • the partial sequence of the cytochrome oxidase subunit I (CoxI) gene encoded by the mitochondrial DNA of three species of the genus Acarapis, including red spider mites was noted on the database, We decided to target the gene.
  • the inventors succeeded in designing a primer set capable of specifically amplifying the gene, that is, a primer set specific to the Acarapis tick CoxI gene.
  • a primer set capable of specifically amplifying the gene
  • the PCR method using the primer set to the bee specimen it was confirmed that the Acarapis mite can be specifically detected.
  • a method for detecting Acarapis mites in a bee sample comprising performing a nucleic acid amplification reaction targeting a gene encoded by mitochondrial DNA of Acarapis mites, and determining the presence of Acarapis mites based on the amplification results
  • a method characterized by: [2] The method according to [1], including the following steps: (1) preparing DNA from a bee specimen containing at least the trachea; (2) performing a nucleic acid amplification reaction targeting at least a part of a gene encoded by the mitochondrial DNA of Acarapis mites using the DNA as a template; (3) A step of detecting an amplification product.
  • the primer set used in step (2) is (i) a primer set comprising the sequence of SEQ ID NO: 10 and a primer comprising the sequence of SEQ ID NO: 11, (ii) a primer set comprising the sequence of SEQ ID NO: 30 and a primer comprising the sequence of SEQ ID NO: 33; (iii) a primer set comprising the sequence of SEQ ID NO: 30 and a primer comprising the sequence of SEQ ID NO: 32; (iv) a set of primers consisting of the sequence of SEQ ID NO: 31 and a primer consisting of the sequence of SEQ ID NO: 33; and (v) a set of primers consisting of the
  • the primer set used in step (2) is (vi) a primer set comprising the sequence of SEQ ID NO: 30 and a primer comprising the sequence of SEQ ID NO: 40; (vii) a primer set comprising the sequence of SEQ ID NO: 31 and a primer comprising the sequence of SEQ ID NO: 40; (viii) a primer set consisting of the sequence of SEQ ID NO: 34 and a primer set consisting of the sequence of SEQ ID NO: 33; (ix) a primer set comprising the sequence of SEQ ID NO: 34 and a primer comprising the sequence of SEQ ID NO: 32; (x) a primer set comprising the sequence of SEQ ID NO: 37 and a primer set comprising the sequence of SEQ ID NO: 33, and (xi) a primer set comprising the sequence of SEQ ID NO: 37 and the sequence of SEQ ID NO: 32,
  • a reagent for detecting Acarapis mites comprising a primer set targeting a gene encoded by mitochondrial DNA of Acarapis mites.
  • the sequence of the region amplified by the primer set is a red tick gene, the sequence of SEQ ID NO: 2, the sequence of SEQ ID NO: 12, the sequence of SEQ ID NO: 15, the sequence of SEQ ID NO: 18, the sequence of SEQ ID NO: 21, Any one selected from the group consisting of the sequence of No. 24, the sequence of SEQ ID No. 25, the sequence of SEQ ID No.
  • the primer set is (i) a primer set comprising the sequence of SEQ ID NO: 10 and a primer comprising the sequence of SEQ ID NO: 11, (ii) a primer set comprising the sequence of SEQ ID NO: 30 and a primer comprising the sequence of SEQ ID NO: 33; (iii) a primer set comprising the sequence of SEQ ID NO: 30 and a primer comprising the sequence of SEQ ID NO: 32; (iv) a primer set comprising the sequence of SEQ ID NO: 31 and a primer comprising the sequence of SEQ ID NO: 33; (v) a set of a primer consisting of the sequence of SEQ ID NO: 31 and a primer consisting of the sequence of SEQ ID NO: 32; (vi) a primer set comprising the sequence of SEQ ID NO: 30 and a primer
  • Results of PCR using primers that amplify the ribosomal RNA-mediated sequence of A. externus The result of analyzing the presence or absence of parasitism of three species of the genus Acarapis by the PCR method for the honeybee specimen 1-4 was shown.
  • Sample 1-3 was a honey bee that was not infested with Acarapis mite
  • sample 4 was a template of total DNA extracted from a bee that was infested with acarine mite.
  • An amplification product of 290 bp was obtained regardless of the presence of red tick, which is considered to be derived from bee genomic DNA.
  • the amplification region is underlined (the amplification region of the red tick CoxI gene is the sequence of SEQ ID NO: 2, the amplification region of the A. externus CoxI gene is the sequence of SEQ ID NO: 4, and the amplification region of the A. dorsalis CoxI gene is the sequence of SEQ ID NO: 6) It was.
  • Sample 4-7 a specific amplification product of 247 bp was obtained.
  • Sample 4 was identical to the sequence of Acarinus tick (A.) woodi), and Sample 5-7 was A. externus CoxI gene.
  • the annealing temperature was set to 50 ° C. for lanes 1 and 2 and 55 ° C. for lanes 3 and 4.
  • Lane 5 as a positive control, a part of AmHsTRPA gene encoded in the bee genome was amplified. It was clarified that the Acarapis tick detection primer did not amplify the spider mite CoxI. Comparison of DNA base sequence between red-spotted tick CoxI gene region and staghorn tick CoxI gene region. The figure which shows the partial arrangement
  • the first aspect of the present invention relates to a method for detecting Acarapis mites in a bee specimen.
  • the detection method of the present invention is characterized in that it performs a nucleic acid amplification reaction targeting a gene encoded by the mitochondrial DNA of Acarapis mites. That is, in the detection method of the present invention, a nucleic acid amplification reaction targeting a gene encoded by mitochondrial DNA of Acarapis ticks is performed, and the presence or absence of Acarapis ticks is determined based on the amplification results. When a specific amplification product is recognized, the target Acarapis mite is detected.
  • the detection method of the present invention enables (1) extremely rapid detection (all steps can be completed in one day), (2) technology Is easy to learn, (3) suitable for screening a large amount of samples, and (4) extremely high detection sensitivity.
  • nucleic acid amplification reactions include PCR (Polymerase chain reaction) method or its modification, LAMP (Loop-Mediated Isothermal Amplification) method (Tsugunori Notomi et al. Nucleic Acids Research, Vol.28, No.12, e63, 2000; Kentaro Nagamine, Keiko Watanabe et al.
  • genes that have been confirmed to be capable of highly specific detection that is, genes encoded by mitochondrial DNA are targeted for detection.
  • target of detection is also called “target” in accordance with the conventional practice.
  • cytochrome oxidase subunit I gene (henceforth "CoxI gene”).
  • the base sequence of the gene is shown in SEQ ID NO: 1 (red ticks sequence), SEQ ID NO: 3 (A. externus sequence) and SEQ ID NO: 5 (A. dorsalis).
  • the main Acarapis mites are A. woodi, A. externus and A. dorsalis.
  • the primer set is a partial region of the CoxI gene (SEQ ID NO: 2 for the Acarinid tick gene, SEQ ID NO: 4 for the A. externus gene, and SEQ ID NO: 6 for the A. dorsalis gene) ) Is designed to amplify.
  • Forward primer CAGTAGGGCTAGATATCGATACCCGAGCTT SEQ ID NO: 10
  • Reverse primer TGAGCTACAACATAATATCTGTCATGAAGA SEQ ID NO: 11
  • the newly published portion of the CoxI gene (FIG. 7. A. woodi sequence: SEQ ID NO: 12, A. externus sequence: SEQ ID NO: 13, A. dorsalis sequence: 14).
  • a primer set designed to be able to amplify a part or the whole is used.
  • specific examples of the primer set and the sequences of the primers constituting the primer set are shown.
  • the primer sets (ii) to (v) correspond to the primer sets (A) to (D) in Examples described later, respectively.
  • woodi forward primer (5) 5 'TCTGGTTTAGTTGGTCTATCT 3' (SEQ ID NO: 34)
  • woodi forward primer (7) 5 'TTCTTCAATTTTAATTATACGT 3' (SEQ ID NO: 37)
  • woodi reverse primer (7) 5 'TGACGTATAATTAAAATTGAA 3' (SEQ ID NO: 40)
  • sequences amplified by the primer sets (vi) to (xi) are sequence of SEQ ID NO: 24 (primer set (vi)), sequence of SEQ ID NO: 25 (primer set (vii)), SEQ ID NO: 26 Sequence (primer set (viii)), sequence number 27 (primer set (ix)), sequence number 28 (primer set (x)), sequence number 29 (primer set (xi)) .
  • the determination of the base sequence of the amplification product (steps (4) and (5) or steps (4) and (6) described later) is not necessary. Specific detection is possible. Therefore, it can be said that it is particularly preferable to employ these primer sets from the viewpoint of simplification of operation and reduction of required time.
  • the base sequence of the amplification product may be determined in order to confirm the detection result.
  • Each oligonucleotide constituting the primer set may be prepared by a conventional method. For example, it can be chemically synthesized using a general-purpose DNA synthesizer.
  • a step of preparing DNA from a bee specimen containing at least the trachea (2) A nucleic acid amplification reaction targeting at least a part of a gene encoded by mitochondrial DNA of Acarapis mite is performed using the DNA as a template Step (3) Step to detect amplification products
  • a bee sample is prepared.
  • a red spider mite parasitizing the trachea is mainly detected, and therefore, a bee sample including at least the trachea is used.
  • Preparation of a DNA sample from a bee specimen may be performed according to a conventional method. Many kits for preparing DNA samples are also commercially available, and DNA samples can be easily obtained by using such kits.
  • a nucleic acid amplification reaction is performed using the DNA prepared in step (1) as a template and targeting the gene encoded by the mitochondrial DNA of Acarapis mites.
  • the amplification region may be the entire gene or a part of the gene.
  • Specific examples of the target gene are the CoxI gene as described above, and specific examples of the amplification region in this case are the region consisting of the sequence of SEQ ID NO: 2, the region consisting of the sequence of SEQ ID NO: 12, and the sequence of SEQ ID NO: 15.
  • Each step of the nucleic acid amplification reaction may be performed by a conventional method. If PCR is employed, for example, a commercially available PCR device (for example, thermal cycler personal manufactured by Takara Bio Inc.) can be used. Numerous PCR kits that include enzymes, reagents, etc. are also commercially available. By using such a kit, each step of PCR can be carried out easily.
  • PCR conditions may be set in consideration of primer Tm and the like. Examples of PCR conditions are as follows. That is, heat denaturation is 90 ° C to 98 ° C, annealing is 30 ° C to 65 ° C, and extension reaction is 65 ° C to 75 ° C. The number of reaction cycle repetitions is, for example, 20-40. For example, Ex Taq (registered trademark, Takara Bio Inc.), gene taq (Nippon Gene), KOD plus (Toyobo Co., Ltd.), etc. can be used as the polymerase.
  • Ex Taq registered trademark, Takara
  • a primer set labeled with a labeling substance may be used.
  • labeling substances are fluorescent substances, chemiluminescent substances, biotin, and radioisotopes.
  • the amplification product is detected, but the detection method is not particularly limited.
  • a method using electrophoresis a method using chromatography, a method using a DNA array, and the like can be employed.
  • a specific example of the method using electrophoresis is as follows. The reaction solution after PCR is applied to a gel such as agarose and subjected to electrophoresis, followed by staining with ethidium bromide. The presence or absence of the target DNA fragment (amplified product) is determined using the position (movement distance) of the band that appears by staining as an index. In addition, the amount of the target DNA fragment may be determined based on the density of the band.
  • 2% TAE Tris acetate, EDTA
  • TBE Tris borate, EDTA
  • the following steps (4) and (5) are performed following step (3), and the species of the detected Acarapis mite is identified.
  • Step of determining the base sequence of the amplification product detected in step (3) (5) The determined base sequence is determined based on the target base sequence of acarinid mite, the target base sequence of A. externus, and the genus Acarapis of A. dorsalis. Step of judging identity by comparing with two or three base sequences selected from the group consisting of tick target base sequences
  • the base sequence of the detected amplification product is determined.
  • the base sequence can be determined by a conventional method (Sanger method, Maxa mugilbert method, cycle sequence method, method using mass spectrometry, etc.). In principle, the full-length sequence of the amplification product is determined. However, as long as the identity can be determined in step (5), a partial sequence of the amplification product may be determined.
  • the base sequence of the amplification product determined in step (4) is selected from two or three kinds of Acarapis mites (specifically, two species selected from acarinus mite, A. externus and A. dorsalis). (Or three types) of nucleotide sequences.
  • a base sequence to be compared is referred to as a target base sequence.
  • the “target base sequence” is a sequence that becomes a target in step (2). For example, if a part of the cytochrome oxidase subunit I gene is a target, the partial base sequence (for example, the sequence of SEQ ID NO: 2 (red ticks), the sequence of SEQ ID NO: 4 (A. externus), the sequence of SEQ ID NO: 6 (A. dorsalis)) is the target base sequence.
  • the identity (%) between the base sequence of the amplification product determined in step (4) and the target base sequence to be compared is determined.
  • the target base sequence having the highest identity is presumed to be the base sequence of the amplification product, and the species of the amplification product, that is, the species of the detected Acarapis mite is determined. For example, when the highest identity is found with the target base sequence of a red spider mite, it is determined that an Acarapis mite has been detected.
  • the base sequence determined in step (4) is compared with the target base sequence of red mite, and it is determined whether or not they are identical.
  • the species of the amplified product that is, the detected Acarapis mite is red. It may be determined whether or not.
  • the next step that is, (6) comparing the determined base sequence with the target base sequence of red-spotted tick and determining whether both are the same Will do.
  • detection focused on red mites is useful in that the presence or absence of red mites can be determined more easily and quickly. Whether or not both are the same is determined based on the identity of the two sequences.
  • the reference identity may vary depending on the length of the base sequence.
  • both are the same when the identity is 98% or more, preferably 99% or more, more preferably 99.5% or more, and most preferably 100%. And the conclusion that red mite was detected was obtained. It should be noted that both steps (5) and (6) may be performed, and the final determination may be made by combining the determination results.
  • the reagent of the present invention comprises a primer set that targets a gene encoded by the mitochondrial DNA of Acarapis mites in order to enable specific detection of Acarapis mites.
  • Each primer constituting the primer set is not particularly limited as long as it can specifically amplify the target.
  • the length of the primer is not limited as long as it functions as a primer (for example, a PCR primer) in the nucleic acid amplification reaction to be employed, and is, for example, 15 to 40 bp, preferably 20 to 40 bp, more preferably 20 to 35 bp. There may be 1 to several, preferably 1 to 5, more preferably about 1 to 3 mismatches between the primer and the region of the target gene to which it hybridizes.
  • the cytochrome oxidase subunit I gene is targeted.
  • the primer set is designed so as to amplify a partial region (sequence of SEQ ID NO: 2) of the red tick gene.
  • a specific example of the primer set corresponding to this example is a set of a forward primer consisting of the sequence of SEQ ID NO: 10 and a reverse primer consisting of the sequence of SEQ ID NO: 11.
  • the present invention further provides a kit for detecting Acarapis mites.
  • the kit of the present invention contains the reagent of the present invention as an essential element.
  • a kit that combines a reagent consisting of a primer set designed for detecting a specific Acarapis mite (eg, Acarinus tick) and a reagent consisting of a primer set designed for detecting another Acarapis mite (eg, A. externus) Good.
  • Reagents necessary for each step of nucleic acid amplification reaction typically PCR (DNA polymerase, buffer solution, etc.), reagents required for detection (reagents for gel preparation, stain solution, etc.), containers, instruments, etc.
  • PCR DNA polymerase, buffer solution, etc.
  • reagents required for detection reagents for gel preparation, stain solution, etc.
  • containers instruments, etc.
  • an instruction manual is attached to the kit of the present invention.
  • Cytochrome oxidase subunit I encoded in the mitochondrial DNA of three Acarapis mites (A. woodi, A. externus, and A. dorsalis), including red spider mite, in October last year A partial sequence of the gene has been published on the database. Comparing the nucleotide sequences of these three mite CoxI genes, they have a homology of 95% or more, and therefore it was expected that it was difficult to design a primer that specifically amplifies only the red tick CoxI. However, although A. externus and A. dorsalis are not as deadly as red mites, they are obviously mites that parasitize honeybees, so it is clear that they adversely affect the health of honeybees. Therefore, it is extremely important to know the infiltration status of these three species of Acarapis ticks in the bee population in Japan, and it has the benefit of helping to grasp and prevent the spread of bee diseases. We aimed to establish a method that can detect it automatically.
  • FIG. 2 shows a DNA region amplified by a primer set (forward primer CAGTAGGGCTAGATATCGATACCCGAGCTT (SEQ ID NO: 10); reverse primer TGAGCTACAACATAATATCTGTCATGAAGA (SEQ ID NO: 11)) designed with reference to the primers listed as candidates.
  • the underlined regions in FIG. 2 (the corresponding region of the red tick CoxI gene is shown in SEQ ID NO: 2, the corresponding region of the A. externus CoxI gene is shown in SEQ ID NO: 4, and the corresponding region of the A. dorsalis CoxI gene is shown in SEQ ID NO: 6).
  • FIG. 3 shows the PCR results obtained using the above primer sets (SEQ ID NOs: 10 and 11).
  • An amplification product was detected in Sample 4-7, but not detected in Sample 1-3.
  • As a result of determining the base sequence of the PCR amplification product of specimen 4-7 it was found to be CoxI of red mite (A. woodi) and A. externus (FIG. 4). That is, it became possible to detect Acarapis mites parasitizing bees by the PCR method using the above primers.
  • Acarapis ticks detection method As mites that parasitize honeybees, there are the Acarapis ticks, Varroa destructor. The lobster mite is about 1mm in length and can be detected by visual inspection because it parasitizes on the body surface of bees.
  • Acarapis mite CoxI total DNA was extracted from one individual honey bee with a single phoenix mite, and a PCR reaction was performed as described above. As shown in FIG.
  • FIG. 6 shows a comparison of the DNA base sequences of the red mite CoxI gene region and the red mite CoxI gene region amplified by PCR. There is a mismatch between the PCR primer sequence and the base sequence of the CoxI gene, which matches the results of the PCR reaction.
  • primers (1) to (4) capable of amplifying a specific region of the sequence were designed (FIG. 7).
  • PCR was performed using total DNA extracted from bees as a template. Sample preparation methods, PCR methods and conditions, etc. were in accordance with the above examples.
  • sequences of the primers (1) to (4) and the configurations of the primer sets (A) to (D) are shown.
  • Forward primer (1) 5 'AAGATATTGGAACATTATATTTTATTTT 3' (SEQ ID NO: 30)
  • Forward primer (2) 5 'ATTATTCGAATAGAATTATCAATTCCATCCTCAGTT 3' (SEQ ID NO: 31)
  • Reverse primer (3) 5 'AGTAATATTGTAATAGCACCTGCTAATACTGGTAAA 3' (SEQ ID NO: 32)
  • Reverse primer (4) 5 'CAAAAATCAGAATAAATGTTGAAATA 3' (SEQ ID NO: 33)
  • sequences amplified by the plumer sets (A) to (D) are as follows. Sequence of A. woodi CoxI gene amplified by primer set (A): Sequence of SEQ ID NO: 12 Sequence of A. externus CoxI gene amplified by primer set (A): Sequence of SEQ ID NO: 13 By primer set (A) A. dorsalis CoxI gene sequence to be amplified: SEQ ID NO: 14 sequence A. woodi CoxI gene sequence amplified by primer set (B): SEQ ID NO: 15 sequence A. externus amplified by primer set (B) Sequence of CoxI gene: Sequence of SEQ ID NO: 16 Sequence of A.
  • the sequence of the amplification product can be determined without determining the sequence of the amplified product. It was possible to detect red mite specifically in the steps (FIG. 9. As a typical result, a detection result in the case of using a primer set consisting of a forward primer (1) and a reverse primer (7) was shown).
  • woodi reverse primer (7) (SEQ ID NO: 40) Primer set (G): A. woodi forward primer (5) (SEQ ID NO: 34) and reverse primer (4) (SEQ ID NO: 33) Primer set (H): A. woodi forward primer (5) (SEQ ID NO: 34) and reverse primer (3) (SEQ ID NO: 32) Primer set (I): A. woodi forward primer (7) (SEQ ID NO: 37) and reverse primer (4) (SEQ ID NO: 33) Primer set (J): A. woodi forward primer (7) (SEQ ID NO: 37) and reverse primer (3) (SEQ ID NO: 32)
  • sequences amplified by the plummer sets (E) to (J) are as follows. Sequence of A. woodi CoxI gene amplified by primer set (E): Sequence of SEQ ID NO: 24 Sequence of A. woodi CoxI gene amplified by primer set (F): Sequence of SEQ ID NO: 25 In primer set (G) A. woodi CoxI gene sequence to be amplified: sequence of SEQ ID NO: 26 A. woodi CoxI gene sequence to be amplified by primer set (H): sequence of SEQ ID NO: 27 A. woodi amplified by primer set (I) CoxI gene sequence: SEQ ID NO: 28 sequence A. woodi CoxI gene sequence amplified by primer set (J): SEQ ID NO: 29 sequence
  • Acarapis mites can be detected quickly and efficiently with high specificity.
  • the present invention is expected to greatly contribute to the prevention and prevention of bee disease caused by mite infestation.
  • the present invention may be used for preliminary or screening detection that is performed prior to final determination by a conventional method.
  • the method of the present invention and the conventional method are used in combination, the total time and the amount of work required for the final determination can be significantly reduced.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un moyen de détection rapide et très efficace d'acariens appartenant au genre Acarapis qui parasitent les abeilles. Une réaction d'amplification d'acides nucléiques ciblant un gène codé par l'ADN mitochondrial d'un acarien appartenant au genre Acarapis est mise en œuvre, et la présence ou l'absence d'acariens appartenant au genre Acarapis est déterminée en se basant sur les résultats de l'amplification. De préférence, un gène de la sous-unité I de la cytochrome oxydase est ciblé.
PCT/JP2011/062342 2010-06-30 2011-05-30 Procédé de détection d'acariens appartenant au genre acarapis WO2012002087A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2010148480 2010-06-30
JP2010-148480 2010-06-30

Publications (1)

Publication Number Publication Date
WO2012002087A1 true WO2012002087A1 (fr) 2012-01-05

Family

ID=45401818

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2011/062342 WO2012002087A1 (fr) 2010-06-30 2011-05-30 Procédé de détection d'acariens appartenant au genre acarapis

Country Status (1)

Country Link
WO (1) WO2012002087A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019062745A (ja) * 2017-09-28 2019-04-25 株式会社Ｄｎａチップ研究所 蜂病の原因菌を検出する方法及びその検出キット

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI [online] 19 October 2009 (2009-10-19), "Acarapis woodi isolate B2-D9 cytochrome oxidase subunit I gene, partial cds; mitochondrial.", retrieved from http://www.ncbi.nlm.nih.gov/ nucleotide/261286618?report=genbank&log$= nuclalign&blast rank=1&RID=2CZ698TR01R Database accession no. GQ916565 (GI:261286618) *
MIKIO YOSHIYAMA ET AL.: "Nippon Kokunai ni Okeru Mitsubachi Nosema Bihoshichu no Shinjun Chosa", JAPANESE SOCIETY OF APPLIED ENTOMOLOGY AND ZOOLOGY TAIKAI KOEN YOSHI, vol. 54, 2010 *
PENG Y.-S. ET AL.: "Detection of honeybee tracheal mites (Acarapis woodi) by simple staining techniques.", J. INVERTEBR. PATHOL., vol. 46, no. 3, 1985, pages 325 - 331 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019062745A (ja) * 2017-09-28 2019-04-25 株式会社Ｄｎａチップ研究所 蜂病の原因菌を検出する方法及びその検出キット

Similar Documents

Publication Publication Date Title
Liu et al. Rapid detection of tobacco mosaic virus using the reverse transcription loop-mediated isothermal amplification method
US8785130B2 (en) Use of markers including nucleotide sequence based codes to monitor methods of detection and identification of genetic material
Malewski et al. Identification of forensically important blowfly species (Diptera: Calliphoridae) by high-resolution melting PCR analysis
Noh et al. A high-throughput marker-assisted selection system combining rapid DNA extraction high-resolution melting and simple sequence repeat analysis: Strawberry as a model for fruit crops
Cheng et al. Development and characterization of expressed sequence tag-derived microsatellite markers for the wheat stripe rust fungus Puccinia striiformis f. sp. tritici
Filloux et al. Metagenomics approaches based on virion-associated nucleic acids (VANA): an innovative tool for assessing without a priori viral diversity of plants
Shi et al. A novel plant DNA extraction method using filter paper-based 96-well spin plate
CN108728581B (zh) 同时检测5种甘蔗病毒的多重rt-pcr方法及其引物和试剂盒
Korpelainen et al. Microsatellite marker identification using genome screening and restriction-ligation
Bedarida et al. Identification of viral DNA (Anelloviridae) in a 200-year-old dental pulp sample (Napoleon's Great Army, Kaliningrad, 1812)
Waliullah et al. Rapid detection of pecan root-knot nematode, Meloidogyne partityla, in laboratory and field conditions using loop-mediated isothermal amplification
Dong et al. Loop-mediated isothermal amplification assay for sensitive and rapid detection of Phytophthora capsici
Casa et al. MITE display
US11414714B2 (en) Methods and kits for the detection of powdery mildew
WO2012002087A1 (fr) Procédé de détection d'acariens appartenant au genre acarapis
Maya-Soriano et al. Biobanked amphibian samples confirmed to species level using 16S rRNA DNA barcodes
CN116064905A (zh) 用于检测大丽轮枝菌的引物组合、试剂盒及应用
JP2016524906A (ja) アレルギーを引き起こすダニのｐｃｒによる分子同定
Chou et al. Validation of Spilornis cheela hoya TaqMan probes for potential gender identification of many Accipitridae species
Dhir et al. A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study
Mackie et al. Experimental parameters affecting quantitative PCR of Artemia franciscana: a model for a marine zooplanktonic target in natural plankton samples
Silva et al. Homing in on endogenous badnaviral elements: Development of multiplex PCR-DGGE for detection and rapid identification of badnavirus sequences in yam germplasm
Tran-Nguyen et al. Optimizing phytoplasma DNA purification for genome analysis
Bae et al. Molecular genetic analysis of wetland soils
Phui et al. Development and polymorphism of simple sequence repeats (SSRs) in Kelampayan (Neolamarckia cadamba–Rubiaceae) using ISSR suppression method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11800555

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11800555

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP