WO2011162612A1 - Procédé permettant de moduler le niveau de phosphorylation de l'amidon dans une lignée végétale, procédé permettant de sélectionner une plante ou une partie de celle-ci, incluant une graine et un tubercule, et son utilisation - Google Patents

Procédé permettant de moduler le niveau de phosphorylation de l'amidon dans une lignée végétale, procédé permettant de sélectionner une plante ou une partie de celle-ci, incluant une graine et un tubercule, et son utilisation Download PDF

Info

Publication number
WO2011162612A1
WO2011162612A1 PCT/NL2011/050460 NL2011050460W WO2011162612A1 WO 2011162612 A1 WO2011162612 A1 WO 2011162612A1 NL 2011050460 W NL2011050460 W NL 2011050460W WO 2011162612 A1 WO2011162612 A1 WO 2011162612A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
gwd
allele
starch
alleles
Prior art date
Application number
PCT/NL2011/050460
Other languages
English (en)
Inventor
Anna Maria Agnes Wolters
Johannes Gerardus Anna Maria Ludovicus Uitdewilligen
Herman Johannes Van Eck
Nicolaas Clemens Maria Henricus De Vetten
Richard Gerardus Franciscus Visser
Original Assignee
Wageningen Universiteit
Stichting Voor De Technische Wetenschappen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wageningen Universiteit, Stichting Voor De Technische Wetenschappen filed Critical Wageningen Universiteit
Publication of WO2011162612A1 publication Critical patent/WO2011162612A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
    • C08B31/00—Preparation of derivatives of starch
    • C08B31/08—Ethers
    • C08B31/12—Ethers having alkyl or cycloalkyl radicals substituted by heteroatoms, e.g. hydroxyalkyl or carboxyalkyl starch
    • C08B31/125—Ethers having alkyl or cycloalkyl radicals substituted by heteroatoms, e.g. hydroxyalkyl or carboxyalkyl starch having a substituent containing at least one nitrogen atom, e.g. cationic starch
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
    • C08L3/00—Compositions of starch, amylose or amylopectin or of their derivatives or degradation products
    • C08L3/04—Starch derivatives, e.g. crosslinked derivatives
    • C08L3/06—Esters
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
    • C08L3/00—Compositions of starch, amylose or amylopectin or of their derivatives or degradation products
    • C08L3/04—Starch derivatives, e.g. crosslinked derivatives
    • C08L3/08—Ethers
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09D—COATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
    • C09D103/00—Coating compositions based on starch, amylose or amylopectin or on their derivatives or degradation products
    • C09D103/04—Starch derivatives
    • C09D103/06—Esters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1294—Phosphotransferases with paired acceptors (2.7.9)

Definitions

  • step c) selecting progeny from crossing step b) for a genotype wherein allele A of GWD is absent, d) selfing and /or further crossing said progeny selected in step c),
  • the term "nulliplex”, “simplex”, “duplex”, “triplex” and “quadruplex” is defined as a genetic condition existing when a specific allele at a corresponding locus on corresponding homologous chromosomes is present 0, 1 , 2, 3 or 4 times, respectively.
  • the phenotypic effect associated with a recessive allele is only observed when the allele is present in quadruplex condition, whereas the phenotypic effect associated with a dominant allele is already observed when the allele is present in a simplex or higher condition.
  • haplotype means a combination of alleles at multiple loci that are transmitted together on the same chromosome. This includes haplotypes referring to as few as two loci, and haplotypes referring to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci. It also includes a set of polymorphisms on a single chromatid that are statistically associated with each other.
  • primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization.
  • the exact lengths of the primers will depend on many factors, including temperature and source of primer.
  • a "pair of bi-directional primers" as used herein refers to one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
  • stringency or “stringent hybridization conditions” refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence.
  • the terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background).
  • Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher temperatures.
  • stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer.
  • the present invention now enables a method for increasing the degree of phosphorylation of starch in a plant comprising:
  • the invention provides a method for increasing the degree of phosphorylation in starch in a plant, comprising enriching a plant for the presence of the alleles C or H of GWD by
  • step b) selecting progeny from crossing step b) for a genotype wherein at least one of alleles C or H of GWD is present,
  • step d) selecting progeny resulting from step d) for a genotype wherein at least one of alleles C or H of GWD is present, and
  • StPho2 starch phosphorylase 2
  • allele 2 of StPho2 was correlated with a high amount of starch phosphate
  • allele 1 was correlated with a low amount of starch phosphate.
  • StPho2 allele 2 can be distinguished from other StPho2 alleles by sequencing the PCR product obtained with primers Pho2-lF (5 ' -GAAGATGGAAAGGGTTCTC A-3 ') and Pho2-lR (5'- TTAGCCATATGCACAACAGG-3 ' ) .
  • step c) selfing and/or further crossing said progeny selected in step c),
  • phosphorylase 2 (StPho2) may be obtained.
  • a simultaneous enrichment for allele 2 of starch phosphorylase 2 (StPho2) and for any of alleles C or H of the GWD gene may be used for obtaining an additional enrichment effect.
  • a positive selection for allele 2 of starch phosphorylase 2 (StPho2) may be combined with a negative selection for allele A of GWD.
  • the application provides for a method of producing the plants, by involving them in a breeding programme, either the programme for enriching for the C and/or H alleles, and/or the programme for decreasing the amount of A alleles, as mentioned above, select the plants of interest and grow these plants.
  • Selected plants that are used for crossing purposes in the methods according to the invention may have any type of ploidy.
  • selected plants may be haploid, diploid or tetraploid.
  • crossing diploid plants will only provide diploid offspring.
  • Crossing a diploid plant with a tetraploid plant will result in triploid offspring that is sterile.
  • selected plants are crossed with each other using classical in vivo crossing methods that comprise one or more crossing steps including selfing.
  • classical crossing steps characteristics of both the parents can be combined in the progeny.
  • a plant that provides a high yield can be crossed with a plant that contains large amounts of a certain nutrient.
  • Such a crossing would provide progeny comprising both characteristics, i.e. plants that not only comprise large amounts of the nutrient but also provide high yields.
  • the inventors now have identified two regions in the genomic sequence of the glucan water dikinase (GWD) gene containing SNPs that enable discrimination between 10 different alleles for the gene. These regions are a large part (627 basepairs) of the region exon 8 to exon 9 of the gene (hereinafter identified as GWDex7) and a region (606 basepairs) covering exon 15 to exon 17 (hereinafter identified as GWD56).
  • GWDex7 region exon 8 to exon 9 of the gene
  • GWD56 region (606 basepairs) covering exon 15 to exon 17
  • Allele B as compared to allele Al differs in many places in the GWDex7 area: positions 139 (A ⁇ T), 237 (T ⁇ C), 261 (C ⁇ T), 268 (G ⁇ C), 271 (T ⁇ C), 283 (T ⁇ G), 292 (T ⁇ G), 448 (C ⁇ T), 459
  • allele B the GWDex7 area is unique with respect to all other alleles by the T460A mutation. Further, as can be seen, allele B differs from allele Al in 8 positions in the GWD56 area. In the present application, the alleles will be indicated by their letter as used in the below Table.
  • Table 1 Single nucleotide polymorphisms in the areas GWDex7 and GWD56:
  • Methods for detecting a nucleotide change can utilize one or more oligonucleotide probes or primers that selectively hybridize to a target polynucleotide which contains one or more SNP positions or other markers.
  • probes or primers include, for example, an amplification primer pair.
  • Probes useful in practicing a method of the invention can include, for example, an oligonucleotide that is complementary to and spans a portion of the target polynucleotide, including the position of the marker, wherein the presence or absence of a specific nucleotide at the position (e.g, an SNP, an indel or a transposon insertion) is detected by the presence or absence of selective hybridization of the probe.
  • a specific nucleotide at the position e.g, an SNP, an indel or a transposon insertion
  • Such a method can further include contacting the target polynucleotide and hybridized oligonucleotide with an endonuclease, and detecting the presence or absence of a cleavage product of the probe, depending on whether the nucleotide occurrence at the marker site is complementary to the corresponding nucleotide of the probe.
  • a pair of probes that specifically hybridize upstream and adjacent and downstream and adjacent to the site of the marker, wherein one of the probes includes a nucleotide complementary to a nucleotide occurrence of the marker also can be used in an oligonucleotide ligation assay, wherein the presence or absence of a ligation product is indicative of a specific nucleotide occurrence at the marker site.
  • An oligonucleotide also can be useful as a primer, for example, for a primer extension reaction, wherein the product (or absence of a product) of the extension reaction is indicative of the nucleotide occurrence.
  • polynucleotide including the marker site can be useful, wherein the amplification product is examined to determine the nucleotide occurrence at the marker site.
  • nucleotide occurrence of a marker is such that the nucleotide occurrence results in an amino acid change in an encoded polypeptide
  • nucleotide occurrence can be identified indirectly by detecting the particular amino acid in the polypeptide.
  • the method for determining the amino acid will depend, for example, on the structure of the polypeptide or on the position of the amino acid in the polypeptide.
  • the polypeptide contains only a single occurrence of an amino acid encoded by the particular polymorphism, the polypeptide can be examined for the presence or absence of the amino acid.
  • the amino acid is at or near the amino terminus or the carboxy terminus of the polypeptide
  • simple sequencing of the terminal amino acids can be performed.
  • the polypeptide can be treated with one or more enzymes and a peptide fragment containing the amino acid position of interest can be examined, for example, by sequencing the peptide, or by detecting a particular migration of the peptide following electrophoresis.
  • the particular amino acid comprises an epitope of the polypeptide
  • the specific binding, or absence thereof, of an antibody specific for the epitope can be detected.
  • Other methods for detecting a particular amino acid in a polypeptide or peptide fragment thereof are well known and can be selected based, for example, on convenience or availability of equipment such as a mass-spectrometer, capillary
  • electrophoresis system magnetic resonance imaging equipment, and the like.
  • the marker-assisted selection steps in the methods of the invention can in principle be performed by applying any nucleic acid amplification method, such as the Polymerase Chain Reaction (PCR; Mullis 1987, U.S. Pat. No. 4,683,195, 4,683,202, en 4,800,159) or by using amplification reactions such as Ligase Chain Reaction (LCR; Barany 1991, Proc. Natl. Acad. Sci. USA 88: 189-193; EP Appl. No., 320,308), Self- Sustained Sequence Replication (3SR; Guatelli et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), Strand Displacement Amplification (SDA; U.S. Pat. Nos.
  • PCR Polymerase Chain Reaction
  • LCR Ligase Chain Reaction
  • LCR Ligase Chain Reaction
  • SDA Strand Displacement Amplification
  • an amplification reaction may be performed under conditions of reduced stringency (e.g. a PCR amplification using an annealing temperature of 38°C, or the presence of 3.5 mM MgCl 2 ).
  • conditions of reduced stringency e.g. a PCR amplification using an annealing temperature of 38°C, or the presence of 3.5 mM MgCl 2 .
  • the person skilled in the art will be able to select conditions of suitable stringency.
  • the detection of the amplification products can in principle be accomplished by any suitable method known in the art.
  • the detection fragments may be directly stained or labeled with radioactive labels, antibodies, luminescent dyes, fluorescent dyes, or enzyme reagents.
  • Direct DNA stains include for example intercalating dyes such as acridine orange, ethidium bromide, ethidium monoazide or Hoechst dyes.
  • the DNA fragments may be detected by incorporation of labeled dNTP bases into the synthesized DNA fragments.
  • Detection labels which may be associated with nucleotide bases include e.g. fluorescein, cyanine dye or BrdU.
  • a suitable detection procedure for use in the present invention may for example comprise an enzyme immunoassay (EIA) format.
  • EIA enzyme immunoassay
  • Probes useful for the detection of the target DNA as disclosed herein preferably bind only to at least a part of the DNA sequence region as amplified by the DNA amplification procedure. Those of skill in the art can prepare suitable probes for detection based on the nucleotide sequence of the target DNA without undue experimentation. Also the
  • complementary sequences of the target DNA may suitably be used as detection probes in a method of the invention, provided that such a complementary strand is amplified in the amplification reaction employed.
  • Any suitable method for screening the nucleic acids of a plant or part thereof for the presence or absence of polymorphisms is considered to be part of the methods according to the invention.
  • Such screening methods include, but are not limited to: DNA sequencing, restriction fragment length polymorphism (RFLP) analysis, amplified fragment length polymorphism (AFLP) analysis; heteroduplex analysis, single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), real time PCR analysis (e.g.
  • nucleic acid amplification techniques allow the amplification of fragments of nucleic acids, which may be present in very low amounts.
  • the SNP-specific sequences must be determined for which primers or probes may then be developed.
  • the nucleic acid may be isolated from any raw sample material, optionally reverse transcribed into cDNA and directly cloned and/or sequenced.
  • DNA and RNA isolation kits are commercially available from for instance QIAGEN GmbH, Hilden, Germany, or Roche Diagnostics, a division of F. Hoffmann-La Roche Ltd, Basel, Switzerland. Nucleic acid-based detection of insertions or deletions can be accomplished accordingly.
  • a sample useful for practicing a method of the invention can be any biological sample from a plant or a part thereof that contains nucleic acid molecules, including portions of the allele sequences to be examined, or corresponding encoded polypeptides, depending on the particular method.
  • the sample can be a cell or tissue sample.
  • the nucleic acid sample generally is a deoxyribonucleic acid (DNA) sample, particularly genomic DNA or an amplification product thereof.
  • DNA deoxyribonucleic acid
  • RNA hetero-nuclear ribonucleic acid
  • the nucleic acid sample can thus be DNA or RNA, or products derived therefrom such as, for example, amplification products.
  • nucleic acid hybridization probes and/or nucleic acid amplification primers may be designed an used in a detection assay for detecting the above identified SNPs in a sample as defined herein.
  • the DNA, or alternatively, the cDNA may be PCR amplified by using for instance Pfu and Taq DNA polymerases and amplification primers specific for the SNP DNA sequences. Also complete commercially available systems may be used for PCR (e.g. available form various suppliers such as Roche Diagnostics).
  • a suitable method may for instance include mixing into a suitable aqueous buffering system (e.g. a commercially available PCR buffer) a suitable amount of total DNA as a template (e.g. 1 to 5 ⁇ g), a suitable amount (e.g.
  • hybridization signal refers to the amount of amplification product produced upon a certain number of cycles and thus to the amount of target DNA available as template in the reaction.
  • the DNA or RNA fragments may be detected by incorporation of labeled dNTP bases into the synthesized fragments.
  • Detection labels which may be associated with nucleotide bases include e.g. fluorescein, cyanine dye, digoxigenin (DIG) or
  • RNA extension assay a primer extension assay
  • Taqman® PCR a differential hybridization assay
  • an assay which detects allele- specific enzyme cleavage an assay which detects allele-specific enzyme cleavage
  • allele-specific PCR an assay which detects allele-specific enzyme cleavage
  • Probes useful for the detection of the target nucleic acid sequences preferably bind only to at least a part of the nucleic acid sequence region as amplified by the nucleic acid amplification procedure.
  • Those of skill in the art can prepare suitable probes for detection based on the nucleotide sequence of the target nucleic acid without undue experimentation as set out herein.
  • the specific amplicon detection probes may comprise a label moiety such as a fluorophore, a chromophore, an enzyme or a radio-label, so as to facilitate monitoring of binding of the probes to the reaction product of the amplification reaction.
  • labels are well known to those skilled in the art and include, for example, fluorescein isothiocyanate (FITC), ⁇ -galactosidase, horseradish peroxidase, streptavidin,
  • biotin biotin, digoxigenin, S, C, P or I. Other examples will be apparent to those skilled in the art.
  • Detection may also be performed by a so-called reverse line blot (RLB) assay, such as for instance described by Van den Brule et al. (2002).
  • RLB probes are preferably synthesized with a 5' amino group for subsequent immobilization on e.g. carboxyl coated nylon membranes.
  • the advantage of an RLB format is the ease of the system and its speed, thus allowing for high throughput sample processing.
  • nucleic acid probes for the detection of RNA or DNA fragments is well known in the art. Usually these procedures comprise the hybridization of the target nucleic acid with the probe followed by post-hybridization washings. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
  • Tm 81.5 °C + 16.6 (log M) + 0.41 (% GQ-0.61 ( form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the nucleic acid, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
  • Tm is reduced by about 1 °C for each 1 % of mismatching; thus, the hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with > 90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5 °C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH.
  • a modulation in the degree of phosphorylation may also achieved by transgenic methods. Again in such a case, for an increase of the degree of phosphorylation in starch an enrichment for the GWD portions C and H and a decrease in the GWD allele A should be sought. Also enrichment for allele 1 of StPho2 is an alternative or additional approach to reach the intended goal.
  • Transgenic approaches can consist of introducing the above-mentioned alleles in a plant, which is a common procedure and which is well known to the skilled person. More appropriate, however, is site directed mutagenesis, in which one or more of the above- mentioned alleles is used to replace the corresponding endogenously present alleles.
  • Methods for site directed mutagenesis of plants are known such as, for instance, using homologous recombination as been described in WO 02/052026 and in a reviw of May, G.D. and Kmiec, E.B., 2000, AgBiotechNet, 2: 1-3.
  • an allele C or H is introduced by exchange with an allele A of GWD by homologous recombination.
  • also introduction of allele 2 of StPho2 by exchange with allele 1 of StPho2 is performed.
  • H7322 H7322, or AM79.7322 originally from G. Wenzel, Institut fur Genetik, Griinbach,
  • AWGWD1 1 GAAGAAATTATACGTGCTGGAT 3033 F exon 22
  • haplotype G was found only in ancient cultivar accessions, introduced between 1804 to 1872, and that haplotype H is relatively new in the analyzed pool (figure 3).
  • haplotype H All analyzed accessions harboring haplotype H have a lineage descending from the USDA 96-56 accession, which has been used for the introgression of the Phytophthora resistance gene Rl from S. demissum (Leonards-Schippers et al. 1992; Ballvora et al. 2002). Also the rare haplotype A (1) is relatively new in the cultivated potato genepool. The first cultivar in our dataset harbouring this haplotype is Maris Piper, introduced in 1963. This is also the first cultivar harbouring the nematode resistance allele HI, providing resistance to Grol (Ellenby 1952; Toxopeus and Huijsman 1953; Ross 1979). The HI resistance was introduced by introgression from S. tuberosum ssp. andigena clone CPC 1673. All accessions in which we could identify haplotype A (1) had this CPC clone as parent in their pedigree and are, according to the European potato database, resistant to Grol .
  • QTL analysis showed three major additive QTLs regions on chromosome 2, 5 and 9 respectively (figure 7).
  • the QTL on chromosome 2 with a LOD score of 6.41, explained 33.8% of the observed variance.
  • the chromosome 5 QTL (LOD 6.06) explained 28.5% of the variance and the chromosome 9 QTL (LOD4.47) explained 23.7% of the variance.
  • StPho2 allele 2 can be distinguished from other StPho2 alleles by sequencing the PCR product obtained with primers Pho2-lF (5 ' -GAAGATGGAAAGGGTTCTCA-3 ' ) and Pho2- 1R (5 ' -TTAGCC ATATGC AC AAC AGG-3 ' ) .
  • the nucleotide at position 278 (counting from the first nucleotide of primer Pho2-lF) is A for allele 2, while it is G for all other alleles (SNP G278A).
  • Starch of the genotypes with the GWD alllele in different dosages is analysed for starch phosphate content. It shows that with decreasing dosage of allele A and with increasing dosage of allele C starch phosphate content increases.
  • the GBSS mutation in potato is similar to the so-called waxy (wx) mutation in maize and prevents the production of amylose, when expression or specific function of the GBSS protein is absent. Therefore, this mutation has been designated as amylose-free (amf) mutant of potato.
  • amf-gene mutation (allele a) stands for a modification of the GBSS-gene that leads to a complete functional loss of GBSS-activity, notwithstanding that GBSS-like gene products, without the specific activity, may still be expressed from the gene's transcripts in question, whereby the Amf-gene (allele A) stands for a gene from which gene products with GBSS-activity can still be obtained.
  • amf-gene character is determined by a monogenic mendelian recessive gene, the phenotype of which can be detected in various plant parts such as columella cells of root tips, tubers, plastids in the stomatal guard cells and in microspores (Jacobsen et al., 1989, Euphytica 44:43-48). When these parts are stained with a potassium iodine solution (Lugol), starch is stained red in mutants and dark blue in the wild type.
  • a potassium iodine solution Ligol
  • tetraploid clones with nulliplex, simplex, duplex, triplex and quadriplex genotypes at the GWD or StPho2 locus were selected in the nulliplex, simplex, duplex, triplex and quadriplex genotypes at the Am -locus.
  • amylose and starch-bound phosphate content in various parts of the mutant potato plant were investigated.
  • triplex/quadruplex for GWD allele C, or H were selectedThis selection was based on High Resolution Melting analysis using the LightScanner (Idaho Technologies, US).
  • Cationic regular potato starch used was Amylofax PW from AVEBE.
  • test pulp consisted of 80 % birch sulphate cellulose fibres (as in Example 1) and of 20 % Hydrocarb 90.
  • the specific conductivity and the water hardness is artificially increased to a level of 3000 ⁇ 8 : ⁇ (sodium sulphate) and 40°GH (calcium chloride)
  • the cationic starch dosage is 0.8 %, with and without 0.3 % as is Paper Pac N (PPN).
  • the zeta-potential is measured and the starch content of the filtrate is determined.
  • the hand sheet tests are performed with the dynamic hand sheet former (FRET).
  • FRET dynamic hand sheet former
  • the machine settings are:
  • the pulp is diluted to 0.25% with water with a similar specific conductivity and water hardness as the test pulp

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • Materials Engineering (AREA)
  • Microbiology (AREA)
  • Nutrition Science (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Botany (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

La présente invention a trait à un procédé permettant de moduler le niveau de phosphorylation de l'amidon chez les plantes en changeant la composition d'allèle du gène alpha-glucane water dikinase (GWD). Une réduction de la quantité (dosage) de l'allèle A et/ou une augmentation de la quantité (dosage) de l'allèle C et/ou H infèrent une augmentation de la teneur en phosphate de l'amidon. Les décalages de la composition d'allèle peuvent être établis au moyen d'une amélioration génétique, telle que l'introgression, ou grâce à un moyen transgénique, tel que la recombinaison homologue.
PCT/NL2011/050460 2010-06-25 2011-06-24 Procédé permettant de moduler le niveau de phosphorylation de l'amidon dans une lignée végétale, procédé permettant de sélectionner une plante ou une partie de celle-ci, incluant une graine et un tubercule, et son utilisation WO2011162612A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP10167424 2010-06-25
EP10167424.0 2010-06-25

Publications (1)

Publication Number Publication Date
WO2011162612A1 true WO2011162612A1 (fr) 2011-12-29

Family

ID=42734668

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2011/050460 WO2011162612A1 (fr) 2010-06-25 2011-06-24 Procédé permettant de moduler le niveau de phosphorylation de l'amidon dans une lignée végétale, procédé permettant de sélectionner une plante ou une partie de celle-ci, incluant une graine et un tubercule, et son utilisation

Country Status (1)

Country Link
WO (1) WO2011162612A1 (fr)

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
EP0320308A2 (fr) 1987-12-11 1989-06-14 Abbott Laboratories Procédé pour détecter une séquence cible d'acide nucléique
US5270184A (en) 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
US5455166A (en) 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
US5719028A (en) 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5871921A (en) 1994-02-16 1999-02-16 Landegren; Ulf Circularizing nucleic acid probe able to interlock with a target sequence through catenation
US5942391A (en) 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
WO2002034923A2 (fr) 2000-10-23 2002-05-02 Bayer Cropscience Gmbh Cellules vegetales et plantes de monocotyledone permettant de synthetiser de l'amidon modifie
WO2002052026A2 (fr) 2000-12-22 2002-07-04 Universiteit Leiden Integration d'acides nucleiques dans les eucaryotes
WO2005002359A2 (fr) 2003-05-22 2005-01-13 Syngenta Participations Ag Amidon modifie, ses utilisations, ses procedes de production
WO2009000557A1 (fr) * 2007-06-25 2008-12-31 Bayer Cropscience Ag Amidons présentant une teneur élevée en amylose et des propriétés de traitement améliorées

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (fr) 1985-03-28 1990-11-27 Cetus Corp
US4683195B1 (fr) 1986-01-30 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
EP0320308A2 (fr) 1987-12-11 1989-06-14 Abbott Laboratories Procédé pour détecter une séquence cible d'acide nucléique
US5455166A (en) 1991-01-31 1995-10-03 Becton, Dickinson And Company Strand displacement amplification
US5270184A (en) 1991-11-19 1993-12-14 Becton, Dickinson And Company Nucleic acid target generation
US5719028A (en) 1992-12-07 1998-02-17 Third Wave Technologies Inc. Cleavase fragment length polymorphism
US5871921A (en) 1994-02-16 1999-02-16 Landegren; Ulf Circularizing nucleic acid probe able to interlock with a target sequence through catenation
US5942391A (en) 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
WO2002034923A2 (fr) 2000-10-23 2002-05-02 Bayer Cropscience Gmbh Cellules vegetales et plantes de monocotyledone permettant de synthetiser de l'amidon modifie
WO2002052026A2 (fr) 2000-12-22 2002-07-04 Universiteit Leiden Integration d'acides nucleiques dans les eucaryotes
WO2005002359A2 (fr) 2003-05-22 2005-01-13 Syngenta Participations Ag Amidon modifie, ses utilisations, ses procedes de production
WO2009000557A1 (fr) * 2007-06-25 2008-12-31 Bayer Cropscience Ag Amidons présentant une teneur élevée en amylose et des propriétés de traitement améliorées

Non-Patent Citations (50)

* Cited by examiner, † Cited by third party
Title
"Current protocols in molecular biology", 1998, JOHN WILEY & SONS
ANONYMOUS: "Books of abstracts", 27 June 2010 (2010-06-27) - 30 June 2010 (2010-06-30), pages 1 - 83, XP002659863, Retrieved from the Internet <URL:http://www.eucarpia.org/03publications/EAPR_EUCARPIA2010_abstracts.pdf> [retrieved on 20110923] *
BALLVORA A, ERCOLANO MR, WEISS J, MEKSEM K, BORMANN CA, OBERHAGEMANN P, SALAMINI F, GEBHARDT C: "The Rl gene for potato resistance to Late Blight (Phytophthora infestans) belongs to the Leucine ZipperfNBS/LRR class of plant resistance genes", PLANT J, vol. 30, 2002, pages 361 - 371
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193
BLENNOW A, WISCHMANN B, HOUBORG K, AHMT T, JORGENSEN K, ENGELSEN SB, POULSEN P: "Structure function relationships of transgenic starches with engineered phosphate substitution and starch branching", INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES, vol. 36, 2005, pages 159 - 168, XP025279441, DOI: doi:10.1016/j.ijbiomac.2005.05.006
CHASE, J. GENET. CYTOL., vol. 5, 1963, pages 359 - 364
DE JONG W, FORSYTH A, LEISTER D, GEBHARDT C, BAULCOMBE DC: "A potato hypersensitive resistance gene against potato virus X maps to a resistance gene cluster on chromosome 5", THEOR APPL GENET, vol. 95, 1997, pages 246 - 252
D'HOOP BB, PAULO MJ, MANK RA, VAN ECK HJ, VAN EEUWIJK FA: "Association mapping of quality traits in potato (Solanum tuberosum L.", EUPHYTICA, vol. 161, 2008, pages 47 - 60, XP019603845
ELLENBY C: "Resistance to the potato root eelworm, Heterodera rostochiensis Wollenweber", NATURE, vol. 170, 1952, pages 1016
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
HOOGKAMP TJH, VAN DEN ENDE RGT, JACOBSEN E, VISSER RGF: "Development of amylose-free (amf) monoploid potatoes as new basic material for mutation breeding in vitro", POTATO RES, vol. 43, 2000, pages 179 - 189
HOVENKAMP-HERMELINK ET AL., POTATO RES., vol. 31, 1988, pages 241 - 246
HOVENKAMP-HERMELINK ET AL., THEOR. APPL. GENET., vol. 75, 1987, pages 217 - 221
JACOBS ET AL., J CLIN MICROBIOL, vol. 35, 1997, pages 791 - 795
JACOBS JME, VAN ECK HJ, ARENS P, VERKERK-BAKKER B, LINTEL HEKKERT B, BASTIAANSSEN HJM, EL-KHARBOTLY A, PEREIRA A, JACOBSEN E, STIE: "A genetic map of potato (Solanum tuberosum) integrating molecular markers, including transposons, and classical markers", THEOR APPL GENET, vol. 91, 1995, pages 289 - 300
JACOBSEN E, HOVENKAMP-HERMELINK JHM, KRIJGSHELD HT, NIJDAM H, PIJNACKER LP, WITHOLT B, FEENSTRA WJ: "Phenotypic and genotypic characterization of an amylose-free starch mutant of the potato", EUPHYTICA, vol. 44, 1989, pages 43 - 48, XP008017581, DOI: doi:10.1007/BF00022597
JACOBSEN ET AL., EUPHYTICA, vol. 44, 1989, pages 43 - 48
KWOH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, pages 1173 - 1177
LEONARDS-SCHIPPERS C, GIEFFERS W, SALAMINI F, GEBHARDT C: "The Rl gene conferring race-specific resistance to Phytophthora infestans in potato is located on potato chromosome V", MOL GEN GENET, vol. 233, 1992, pages 278 - 283
LIZARDI ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1197
LORBERTH R, RITTE G, WILLMITZER L, KOSSMANN J: "Inhibition of a starch-granule-bound protein leads to modified starch and repression of cold sweetening", NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 473 - 477, XP002111459, DOI: doi:10.1038/nbt0598-473
M. FRISCH: "Selection Theory for Marker-Assisted Backcrossing", GENETICS, vol. 170, no. 2, 1 January 2005 (2005-01-01), pages 909 - 917, XP055007826, ISSN: 0016-6731, DOI: 10.1534/genetics.104.035451 *
MAY, G.D., KMIEC, E.B., AGBIOTECHNET, vol. 2, 2000, pages 1 - 3
MEINKOTH JM, WAHL G: "Hybridization of nucleic acids immobilized on solid supports", ANAL BIOCHEM, vol. 138, 1984, pages 267 - 284, XP024764449, DOI: doi:10.1016/0003-2697(84)90808-X
MUHRBECK P ET AL: "DETERMINATION OF THE PHOSPHORYLATION OF STARCH FROM NATIVE POTATO VARIETIES BY PHOSPHORUS-31 NMR", STARCH, vol. 43, no. 1, 1991, pages 25 - 27, XP002601733, ISSN: 0038-9056 *
MURASHIGE, SKOOG, PHYISOL. PLANT, vol. 15, 1962, pages 473 - 497
NODA ET AL: "Starch phosphorus content in potato (Solanum tuberosum L.) cultivars and its effect on other starch properties", CARBOHYDRATE POLYMERS, vol. 68, no. 4, 16 March 2007 (2007-03-16), APPLIED SCIENCE PUBLISHERS, LTD. BARKING, GB, pages 793 - 796, XP005938838, ISSN: 0144-8617, DOI: 10.1016/J.CARBPOL.2006.08.005 *
OLSDER J, HERMSEN JGT: "Genetics of self-incompatibility in dihaploids of Solanum tuberosum L. 1. Breeding behaviour of two self-compatible dihaploids", EUPHYTICA, vol. 25, 1976, pages 597 - 607
PARK TH, VLEESHOUWERS VGAA, KIM JB, HUTTEN RCB, VISSER RGF: "Dissection of foliage and tuber late blight resistance in mapping populations of potato", EUPHYTICA, vol. 143, 2005, pages 75 - 83, XP019240892, DOI: doi:10.1007/s10681-005-2658-0
PIJNACKER, FERWERDA, CAN. J. GENET. CYTOL., vol. 26, 1985, pages 415 - 419
RITTE G, HEYDENREICH M, MAHLOW S, HAEBEL S, KOTTING 0, STEUP M: "Phosphorylation of C6- and C3-positions of glucosyl residues in starch is catalysed by distinct dikinases", FEBS LETTERS, vol. 580, 2006, pages 4872 - 4876, XP028061360, DOI: doi:10.1016/j.febslet.2006.07.085
RITTE G, LLOYD JR, ECKERMANN N, ROTTMANN A, KOSSMANN J, STEUP M: "The starch-related R1 protein is an a glucan, water dikinase", PROC NATL ACAD SCI USA, vol. 99, 2002, pages 7166 - 7171, XP002200501, DOI: doi:10.1073/pnas.062053099
ROSS H: "Proceedings of the Conference 'Broadening Genetic Base Crops", 1979, PUDOC, article "Wild species and primitive cultivars as ancestors of potato varieties", pages: 237 - 245
ROUPPE VAN DER VOORT JNAM, VAN ZANDVOORT P, ECK HJ, FOLKERTSMA RT, HUTTEN RCB, DRAAISTRA J, GOMMERS FJ, JACOBSEN E, HELDER J, BAKK: "Use of allele specificity of comigrating AFLP markers to align genetic maps from different potato genotypes", MOL GEN GENET, vol. 255, 1997, pages 438 - 447
SAFFORD R, JOBLING SA, SIDEBOTTOM CM, WESTCOTT RJ, COOKE D, TOBER KJ, STRONGITHAM BH, RUSSELL AL, GIDLEY MJ: "Consequences of antisense RNA inhibition of starch branching enzyme activity on properties of potato starch", CARBOHYDRATE POLYMERS, vol. 35, 1998, pages 155 - 168, XP004126929, DOI: doi:10.1016/S0144-8617(97)00249-X
SCHWALL G P ET AL: "Production of very-high-amylose potato starch by inhibition of SBE A and B", NATURE BIOTECHNOLOGY, vol. 18, no. 5, 1 May 2000 (2000-05-01), NATURE PUBLISHING GROUP, NEW YORK, NY, US, pages 551 - 554, XP002239695, ISSN: 1087-0156, DOI: 10.1038/75427 *
STADEN R: "The Staden sequence analysis package", MOLECULAR BIOTECHNOLOGY, vol. 5, 1996, pages 233 - 241
STAM P: "Construction of integrated genetic linkage maps by means of a new computer package", JOINMAP. PLANT J, vol. 3, 1993, pages 739 - 744, XP003005041
TAMURA K, DUDLEY J, NEI M, KUMAR S: "MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0", MOL BIOL EVOL, vol. 24, 2007, pages 1596 - 1599
THRALL PH, YOUNG A: "AUTOTET: a program for analysis of autotetraploid genotypic data", J HEREDITY, vol. 91, 2000, pages 348 - 349
TOXOPEUS HJ, HUIJSMAN CA: "Breeding for resistance to potato-root eelworm", EUPHYTICA, vol. 2, 1953, pages 180 - 186
UIJTEWAAL BA: "Ploidy variability in greenhouse cultured and in vitro propagated potato (Solanum tuberosum) monohaploids (2n = x = 12) as determined by flow cytometry", PLANT CELL, vol. 6, 1987, pages 252 - 255
VAN DEN BRULE AJC, POL R, FRANSEN-DAALMEIJER N, SCHOULS LM, MEIJER CJLM, SNIJDERS PJF: "GP5+/6+ PCR followed by reverse line blot analysis enables rapid and high-throughput identification of Human Papillomavirus genotypes", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 40, 2002, pages 779 - 787, XP002468366, DOI: doi:10.1128/JCM.40.3.779-787.2002
VAN DER BEEK JG, VERKERK R, ZABEL P, LINDHOUT P: "Mapping stategy for resistance genes in tomato based on RFLPs between cultivars: CF9 (resistance to Cladosporium fulvum) on chromosome 1", THEOR APPL GENET, vol. 84, 1992, pages 106 - 112
VAN DER LEIJ ET AL., MOLEC. GEN. GENETICS, vol. 228, 1991, pages 240 - 248
VAN OS H, ANDRZEJEWSKI S, BAKKER E, BARRENA I, BRYAN GJ, CAROMEL B, GHAREEB B, ISIDORE E, DE JONG W, VAN KOERT P: "Construction of a 10,000-marker ultradense genetic recombination map of potato: providing a framework for accelerated gene isolation and a genomewide physical map", GENETICS, vol. 173, 2006, pages 1075 - 1087
VISSER ET AL., PLANT SCIENCE, vol. 64, 1989, pages 185 - 192
WECKX S, DEL-FAVERO J, RADEMAKERS R, CLAES L, CRUTS M, DE JONGHE P, VAN BROECKHOVEN C, DE RIJK P: "novoSNP, a novel computational tool for sequence variation discovery", GENOME RES, vol. 15, 2005, pages 436 - 442
WICKRAMASINGHE H A M ET AL: "Physico-chemical and degradative properties of in-planta re-structured potato starch", CARBOHYDRATE POLYMERS, vol. 77, no. 1, 22 May 2009 (2009-05-22), APPLIED SCIENCE PUBLISHERS, LTD. BARKING, GB, pages 118 - 124, XP026019571, ISSN: 0144-8617, [retrieved on 20090421], DOI: 10.1016/J.CARBPOL.2008.12.013 *
WISCHMANN B, BLENNOW A, MADSEN F, JORGENSEN K, POULSEN P, BANDSHOLM 0: "Functional characterisation of potato starch modified by specific in planta alteration of the amylopectin branching and phosphate substitution", FOOD HYDROCOLLOIDS, vol. 19, 2005, pages 1016 - 1024, XP025307815, DOI: doi:10.1016/j.foodhyd.2005.01.002

Similar Documents

Publication Publication Date Title
Serba et al. Linkage maps of lowland and upland tetraploid switchgrass ecotypes
AU2017235928B2 (en) Genetic markers for myb28
US20200037527A1 (en) Yield traits for maize
US20170081734A1 (en) Wheat with elevated fructan, arabinoxylan
US8809623B2 (en) Genetic loci associated with resistance to tropical rust in maize
US9670499B2 (en) Yield traits for maize
AU2010336389B2 (en) Genetic markers associated with drought tolerance in maize
US20240049666A1 (en) Marker-assisted breeding in cannabis plants
EP2294912A1 (fr) Procédé pour augmenter le taux de zéaxanthine dans une lignée végétale, procédé de sélection d&#39;une plante ou d&#39;une partie de celle-ci, y compris la graine et le tubercule, et utilisations correspondantes
CN112218526A (zh) 用于单倍体胚基因分型的方法
Vasconcelos et al. Polymorphism of starch pathway genes in cassava
WO2011162612A1 (fr) Procédé permettant de moduler le niveau de phosphorylation de l&#39;amidon dans une lignée végétale, procédé permettant de sélectionner une plante ou une partie de celle-ci, incluant une graine et un tubercule, et son utilisation
CN103220904B (zh) 关联玉米对斐济病毒属的抗性的基因座
EP2356243B1 (fr) Locus génétiques associés à la digestibilité de la paroi cellulaire dans du maïs
NL2003978C2 (en) Method of breeding cysdv-resistant cucumber plants.
CN116590451A (zh) 用于检测不同甜玉米类型的kasp引物组合及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11729188

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OFLOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC

122 Ep: pct application non-entry in european phase

Ref document number: 11729188

Country of ref document: EP

Kind code of ref document: A1