WO2011161437A1 - Methods for cartilage repair using tfgbeta and fgf - 2 - Google Patents

Abstract

The invention relates to a novel combination of growth factors that induce morphogenic changes in cartilage leading o maturation of the phenotype; and the use of these growth factors in culture medium and therapeutics for repairing damaged cartilage.

Description

METHODS FOR CARTILAGE REPAIR USING TFGBETA AND FGF - 2

The invention relates to a novel cell culture medium and a therapeutic for use particularly, but not exclusively, in cartilage repair of the musculoskeletal system. Moreover, the invention also concerns the use of said medium and said therapeutic to treat particularly, but not exclusively, cartilage injuries of the musculoskeletal system including a method of medical treatment involving the use or administration, respectively, of said media or therapeutic.

Introduction

Articular cartilage is a tissue that lines the ends of bones and in combination with ligaments and muscles allows near frictionless and pain-free movement of these joints. The joint cartilage is composed of a single cell type, the chondrocyte, that is suspended at a low cell to volume ratio in an extracellular matrix that resembles a stiff hydrogel. The extracellular matrix (ECM) chiefly consists of a fibrous component, mainly collagen type II, and a proteoglycan, aggrecan. Aggrecan is extensively glycosylated and this property causes the molecule to be highly hydrated; the hydrated proteoglycans are held under tension by collagen fibrils. It is an increase in the size of the ECM, and so an increase in collagen type II and aggrecan production, that essentially represents growth of this tissue.

Mature and fully functional articular cartilage is characterised by a specific distribution and orientation of chondrocytes in three distinct zones within the tissue; 3-5 layers of cells near or at the surface (the superficial zone) are arranged as discs, giving way to cells which appear to be randomly distributed within a slightly larger transitional zone, leading to chondrocytes arranged in columns in the deep zone that occupies the largest volume within the tissue. This specific arrangement of chondrocytes occurs during post-natal developmental maturation and occurs concurrently with changes in the alignment of collagen fibrils. Immature cartilage is characterised by randomly orientated collagen fibrils in the ECM, whereas in mature cartilage, fibrils in the deep zone are orientated perpendicularly to the surface, and in the surface zone, which is principally composed of collagen type I, fibrils lie parallel to the surface resisting the shear tensile forces generated through movement.

At birth, articular cartilage is morphologically distinct compared to adult tissue; immature cartilage is much thicker, chondrocytes appear to be isotropically distributed throughout the tissue with no specific zonal architecture apparent, and, collagen fibrils appear to be randomly aligned. It has been hypothesised that articular cartilage growth and, importantly, maturation proceeds from this stage through a gradual process of resorption from below and appositional growth from the surface. The two processes are thought to work in tandem to generate new tissue under the influence of dynamical mechanical forces and compressive loading that are much less prior to birth. Notably, it is universally accepted that the afore forces are required to stimulate articular cartilage maturation. Remodeling during this post-natal growth stage results in tissue that displays all the hallmarks of mature, fully functional articular cartilage; cartilage with specific zonal architecture, cellular distribution and collagen fibril alignment.

Growth factors are growth promoting molecules that are classified in large families of structurally and evolutionarily related proteins. These families are listed as follows: Adrenomedullin (AM), Autocrine motility factor, Bone morphogenetic proteins (BMPs), Epidermal growth factor (EGF), Erythropoietin (EPO), Fibroblast growth factor (FGF), Granulocyte -colony stimulating factor (G-CSF), Granulocyte- macrophage colony stimulating factor (GM-CSF), Growth differentiation factor-9 (GDF9), Hepatocyte growth factor (HGF), Hepatoma derived growth factor (HDGF), Insulin-like growth factor (IGF), migration- stimulating factor, Myostatin (GDF-8), Nerve growth factor (NGF) and other neurotrophins, Platelet-derived growth factor (PDGF), Thrombopoietin (TPO), Transforming growth factor alpha(TGF-a), Transforming growth factor beta (TGF-β), Vascular endothelial growth factor (VEGF), placental growth factor (P1GF), Foetal Bovine Somatotrophin (FBS), IL-1- Cofactor for IL-3 and IL-6, IL-2- T-cell growth factor, IL-3, IL-4, IL-5, IL-6, and 11-7.

Growh factors have a role to play in both cartilage growth and maturation. The former being characeterised by an increase in cell mass or ECM mass and the latter by a change in the morphogenetic characteristics of the tissue as explained in some detail above. Typically, growth factors act in an anabolic fashion promoting cartilage matrix synthesis leading to chondrocytes being surrounded by abundant matrix. An example of a growth factor that has this effect is FGF-18 (1). Other growth factors, such as TGF-alpha or TGF-beta have also been shown to have anabolic and homeostatic effects resulting in a regulated increase in glycosaminoglycan and collagen content of the ECM leading to growth of the hyaline cartilage (2).

However, FGF has also been shown to inhibit chondrocyte proliferation by initiating multiple pathways that result in the induction of antiproliferative functions (3). Further, a cocktail of growth factors i.e. IGF-I, FGF- 2 (also known as FGF-basic or bFGF), and TGF-beta 1 have been shown to regulate their own and each other's activities, their interactions ranging from inhibitory to synergistic effects. These studies suggest that interactions among IGF-I, FGF-2, and TGF-betal substantially modulate their regulatory functions (4).

It follows that the role of growth factors in the growth or maturation process of cartilage is not clearly defined. Specifically, in this tissue, it is not known which growth factors will have an anabolic effect and which will have a catabolic effect. Moreover, it is also not known what will be the interactive effect of any particular combination of growth factors.

In the treatment of cartilage defects it is known that normal articular cartilage is unique in that it is aneural, alymphatic and also avascular. These latter characteristics and the fact that the tissue is composed of a highly hydrated extracellular matrix impede repair and/or regeneration following trauma or disease. This poor intrinsic capacity to heal does not support spontaneous healing of small chondral defects. This impasse has led to the development of transplantation strategies to repair focal defects in articular cartilage that untreated would otherwise lead to the development of osteoarthritis, the progressive, multifactorial, destruction of joint tissue, impairing movement and causing considerable pain. Autologous chondrocyte implantation (ACI) is a surgical procedure of two parts; firstly small pieces of cartilage from the non-weightbearing part of the joint are excised, the chondrocytes isolated, cultured and expanded, then in a second procedure, the cells are reimplanted in combination with fibrin as a scaffold under a sutured collagenous flap that covers a focal defect in the weightbearing portion of the joint. Studies have shown that in many cases, fibrocartilagenous tissue is formed which is biomechanically inferior to normal hyaline articular cartilage. Because fibrocartilage is a poor substitute for hyaline cartilage in weightbearing regions, this can lead to repair tissue failure. The lack of appropriate stimuli, present post-natally but not in adult tissue probably contributes to a lack of maturation of the implanted tissue such that it follows a default development pathway leading to the formation of fibrocartilage. Where maturation has been observed following surgical follow-up, it is generally thought that this process requires at least 2 years.

Tissue engineering, the generation of biofunctional and biocompatible tissue for therapeutic regeneration and repair, has advanced to the stage where it is possible to generate artificial cartilage constructs that can be either pre-conditioned and grown in vitro prior to implantation, or, designed to fulfill the latter objectives in vivo following implantation. Unfortunately, despite the numerous advances in generation of cellular sources and scaffolds for articular cartilage repair, the lack of maturation of tissue engineered constructs still remains problematic, and is the source of great frustration. The stimuli that enable the progressive remodeling of immature articular cartilage, the structure and architecture of which tissue engineered articular cartilage most closely resembles, to form mature tissue, have remained to date, elusive.

Somewhat against the odds, we have discovered that a combination of fibroblast growth factor-2 (FGF2, also known as FGF-basic or bFGF) and transforming growth factor beta-1, 2 or -3 (TGFbl-3) cause precocious maturation, as opposed to simply growth, of immature articular cartilage. This result is all the more remarkable because singularly, FGF2 and TGFbl-3 have homeostatic functions within articular cartilage, and neither is capable, alone, of inducing maturation. However, in combination, FGF2 and TGFbl-3 act synergistically to induce characteristic maturational changes in immature articular cartilage, such as; reduction in cartilage height, resorption of basal cartilage, induction of cell death (in deep zones prior to resorption), induction of cellular proliferation at the apical surface (inducing appositional growth), an increase in mature collagen cross-linking, increased mechanical strength and changes in gene expression consistent with maturational remodeling. This increase in mechanical strength is a particularly surprising feature because it goes against long-held conventional teaching which stipulates that mechanical forces, such as sheer and load, are required to bring about the sort of morphogenic changes that lead to an increase in mechanical strength. In addition, we have observed that tissue engineered articular cartilage subjected to FGF2 and TGFbl-3 induce collagen fibril alignment that mirrors that seen in mature cartilage. Notably, the latter observation also occurred in the absence of a mechanical stimulus.

Moreover, it has been shown (5) that heart tissue, specifically heart valves and their associated connective tissue, share common regulatory and development pathways with chondrocyte tissue, specifically cartilage, and therefore the invention described herein also has application in the repair and ex vivo growth of heart tissue, specifically heart valves.

Statements of Invention

According to a first aspect of the invention there is provided a morphogenic induction medium for the maturation of cartilage tissue comprising, or consisting of, FGF-2 and TGFbl-3 in isotonic solution.

Reference herein to an invention comprising FGF-2 and TGFbl-3 (in isotonic solution or otherwise) includes reference to an invention consisting only of those growth factors but it may include other non-growth factor substances.

Reference herein to cartilage tissue includes reference to cartilage tissue or cells of the musculo-skeletal structure and also to connective tissue of the heart, particularly heart valves.

Those skilled in the art will appreciate that tonicity is a measure of the osmotic pressure (or water potential) of two solutions separated by a semipermeable membrane. Isotonic solutions contain equal concentrations of impermeable solutes on either side of the membrane. Thus, an isotonic solution maintains the integrity of the cell. One example of a suitable isotonic solution is Dulbecco's modified Eagle's medium (DMEM, 155 mM total Na+, 110 mM NaCl). Other isotonic solutions are well known to those skilled in the art.

We have advantageously discovered that FGF-2 and TGFbl-3 work synergistically to mature cartilage tissue and so promote the development of collagen fibrils in the ECM having an orientation, generally, at right angles to the surface of the tissue, as exemplified in Figure 6. Further, these growth factors work synergistically to promote the activation of MMP genes which have a catabolic effect on cartilage tissue and, in particular, the deep zone of cartilage tissue. Further still, these growth factors promote cell division in the surface zone. Moreover, they also induce TIMP1 gene expression (a marker of articular cartilage maturation). Further, these growth factors bring about, induction of cell death (in deep zones prior to resorption), resorption of basal cartilage, an increase in mature collagen cross-linking, increased mechanical strength and a reduction in cartilage height.

Moreover, we have discovered that the culture medium has particular application in the growth of cartilage tissue or cells for the purpose of implantation, whether the tissue is autologous or allogeneic. Thus, the medium is used ex vivo to mature an extract of cartilage tissue or cells taken either from the individual to be treated or an unrelated third party donor. The tissue may be immature cartilage tissue or cells, cartilage progenitor cells, stem cells or adult cartilage tissue or cells. In the instance where the tissue is taken from a third party, cartilage progenitor cells or stem cells are preferred.

Most preferably 1-lOOOng/ml FGF-2 and 0.1-lOOng/ml TGFbl-3 is used. More preferably still, 10- lOOOng/ml FGF-2 and 1-lOOng/ml TGFbl-3 is used. Yet more preferably, there is ten times the amount of FGF-2 to TGFbl-3. Specific and effective combinations are shown in Figure 9. Further, the growth factors of the invention may be naturally occurring, recombinant or artificial/synthetic.

According to a further aspect of the invention there is provided an ex vivo culture medium comprising, or consisting of, FGF-2 and TGFbl-3 in isotonic solution.

This further aspect of the invention may, in preferred embodiments, include or be characterised by any of the afore mentioned features.

In yet a further aspect of the invention there is provided a method for maturing cartilage in culture or ex vivo comprising: culturing tissue or cells selected from the group consisting of immature cartilage tissue or cells, cartilage progenitor cells, stem cells and adult cartilage tissue or cells in a culture medium comprising, or consisting of, FGF-2 and TGFbl-3 in isotonic solution. Ideally, the cartilage is articular.

Most preferably 1-lOOOng/ml FGF-2 and 0.1-lOOng/ml TGFbl-3 is used. More preferably still, 10- lOOOng/ml FGF-2 and 1-lOOng/ml TGFbl-3 is used. Yet more preferably, there is ten times the amount of FGF-2 to TGFbl-3. Specific and effective combinations are shown in Figure 9. Ideally the tissue is cultured at 37°C for approximately 3 weeks.

This further aspect of the invention may, in preferred embodiments, include or be characterised by any of the afore mentioned features.

According to a further aspect of the invention there is provided the use of the afore culture medium in the treatment or repair of cartilage injuries.

Those skilled in the art will appreciate that the afore invention also has application in the in vivo treatment or repair of cartilage by formulating the growth factors of the invention in a suitable fluid such as an injection fluid. According to a further aspect of the invention there is provided an injection fluid comprising, or consisting of, FGF-2 and TGFbl-3 in isotonic solution.

Advantageously, the injection fluid may, in preferred embodiments, include or be characterised by any of the afore mentioned features.

Preferably said fluid is formulated for medical or veterinary use.

More preferably still, the fluid includes at least one carrier, each of the carriers must be acceptable in the sense of being compatible with the other ingredients of the fluid and not deleterious to the recipient.

The formulation includes those suitable for articular administration and may be prepared by any methods well known in the art of pharmacy.

In an alternative embodiment of the inevntion there is provided a composition for topical application comprising, or consisting of, FGF-2 and TGFbl-3.

More preferably still, the composition includes at least one carrier each of the carriers must be acceptable in the sense of being compatible with the other ingredients of the fluid and not deleterious to the recipient.

The composition may be prepared by bringing into association the growth factors of the invention and the carrier. In general, the formulations are prepared by uniformly and intimately bringing into association the growth factors with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product. The invention extends to methods for preparing a pharmaceutical composition comprising bringing the growth factors of the invention in association with a pharmaceutically or veterinarily acceptable carrier or vehicle.

For topical application to the skin, the conjugate may be made up into a cream, ointment, jelly, solution or suspension etc. Cream or ointment formulations that may be used for the conjugate are conventional formulations well known in the art, for example, as described in standard text books of pharmaceutics such as the British Pharmacopoeia.

The above formulations or compositions will generally be sterile.

The precise amount of a formulation or composition of the present invention which is therapeutically effective, and the route by which it is best administered, is readily determined by one of ordinary skill in the art by comparing the joint level of the formulation or composition to the concentration required to have a therapeutic effect.

According to a further aspect of the invention there is provided a method of treating a mammal suffering from a cartilage defect comprising administering to said mammal an effective amount of said injection fluid of the invention.

In a preferred method of the invention said fluid is in the form of any one or more of the preferred or ideal embodiments referred to herein.

In a further preferred method of the invention said mammal is human, equine, canine, feline, porcine, or any other domestic or agricultural species.

According to a further aspect of the invention there is provided a method of treating a mammal suffering from a cartilage defect comprising administering to said mammal an effective amount of said composition of the invention.

In a preferred method of the invention said composition is in the form of any one or more of the preferred or ideal embodiments referred to herein.

In a further preferred method of the invention said mammal is human, equine, canine, feline, porcine, or any other domestic or agricultural species.

In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprises", or variations such as "comprises" or "comprising" is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.

All references, including any patent or patent application, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. Further, no admission is made that any of the prior art constitutes part of the common general knowledge in the art.

Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.

Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.

Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.

The invention will now be described by way of example only with reference to the following figures, wherein :-

Figure 1 shows a combination of FGF2 and TGFbl induce remodeling of immature articular cartilage.

Cartilage explants were cultured, as indicated, in the presence or absence of FGF2 lOOng ml^"1 and TGFbl lOng ml^"1 for 21 days. Histological sections from explants were stained with toluidine blue. Height measurements (n=6) and biochemical analysis (n=5) of explants grown in either chemically defined medium (ITS) or growth factor stimulated medium (ITS-FGF2-TGFbl) for 21 days;

Figure 2 shows culture medium containing foetal bovine serum with or without growth fators FGF2 and TGFbl has no effect on remodeling/maturation in cartilage explants. Explants (FBS and FBS- FGF2TGFbl) were cultured for 21 days in lOmM HEPES pH7.5, lC g ml^"1 sodium ascorbate, 5C^g ml^"1 Gentamicin, DMEM-high glucose and 10% foetal bovine serum (Invitrogen) with or without FGF2 (lOOng ml^"1) and TGFbl (lOng ml^"1). For comparison cartilage explants grown for 21 days in basal medium (ITS) or in basal medium plus growth factors (ITS-FGF2-TGFbl) are also shown. Bar ΙΟΟμιη;

Figure 3 shows FGF2 and TGFbl induce precocious basal resorption of immature articular cartilage.

A toluidine blue stained section is shown of a growth factor treated explant that was decalcified with EDTA prior to processing for histology {left). The black arrow shows the extent of cartilage resorption following growth factor treatment for 21 days. Bar ΙΟΟμιη. DQ-gelatin fluorescence (green), a marker of collagenase activity at the resorption front in control (ITS) and growth factor treated (ITS-FGF2-TGFM) cartilage explants {middle and right). Note the smooth resorption front in ITS cultured explants contrasts with the broken front with spurs of fluorescence, approximately ΙΟΟμιη in height, breaking out in growth factor treated explants (condensed nuclei, stained with propidium iodide are also apparent in these explants). Bar 50μιη;

Figure 4. FGF2 and TGFbl induce apoptosis in a subset of articular chondrocytes in immature articular cartilage. TUNEL analysis {left and upper right) of control (ITS) and growth factor treated immature explants (ITS-FGF2-TGFbl) showed that chondrocytes within the upper and lower deep zone of growth factor treated articular cartilage were susceptible to apoptosis. Nuclei were counterstained with propidium iodide. Bar ΙΟΟμιη. Not all cells within the deep zone were apoptotic. TUNEL-negative chondrocytes lying above the resorption front were nevertheless positive for caspase-3 {upper right). Bar 20μιη; Figure 5. The induction of appositional growth in growth factor treated immature articular cartilage.

Increased cellularity in the surface zone of growth factor treated explants (ITS-FGF2-TGFbl) was evident from fluorescence microscopy of DAPI stained nuclei {upper left). Bar 50μιη. Cell numbers from paired untreated and growth factor treated explants (n=4) were quantified per unit area. BrdU (ΙΟμΜ, 48 hours at end of 21 day incubation) incorporation assays into normal {lower left) or growth factor {lower right) treated immature explants (DIC images merged with fluorescent BrdU-positive nuclei in red) showed the presence of two asymmetric growth zones, interstitial and appositional, the polaritiy of which switch following growth factor treatment. Bar 50μιη. Proliferation as measured via cell viability of isolated superficial zone chondrocytes cultured in basal medium (ITS) or in the presence of FGF2 (lOOng ml^"1), TGFbl(10ng ml^"1) or FGF2-TGFM (lOOng ml^"1 - lOng ml^"1);

Figure 6. Growth factor stimulation of immature articular cartilage promotes collagen cross-linking, pericellular coat formation and explant mechanical strength. Amino-acid analysis (mole/per mole collagen; n=6; upper) of immature hydroxylysinoketonorleucine (HLKNL) and mature lysylpyridinoline (LP) or hydroxylysylpyridinole (HP) collagen cross-links. Growth factor treatment of immature explants induces a significant reduction in immature cross-links coupled to an increase in the ratio of mature to immature crosslinks. Analysis of mechanical strength {middle) of cartilage explants expressed as the Young's modulus (£). Electron microscopy imaging of chondrocytes in growth factor unstimulated explants (ITS, lower left) show the typical morphology of immature cells embedded within an ECM, note the cellular processes interacting with the ECM. In growth factor stimulated cartilage explants (ITS-FGF2-TGFM, lower right), chondrocytes have developed a pericellular coat {double-head arrows) and appear to enclosed within a defined chondron. The chondron and pericellular coat are absent in unstimulated chondrocyes {single arrows);

Figure 7. Reorientation of collagen fibril alignment in tissue engineered articular cartilage. Articular chondrocytes, 5xl0⁶ were grown on 0.6mm diameter Millicell supports (Millipore) in serum containing medium for 21 days to allow ECM accumulation, then grown for a further 21 days in the presence (ITS- FGF2-TGFM) or absence (ITS) of growth factors. Toluidine blue stained sections of tissue-engineered cartilage show accumulation and retention of proteoglycans although no overt structural organisation (Bar ΙΟΟμιη; left). Polarised light microscopy {middle and right) showed reorientation of collagen fibril alignment perpendicular to the surface in the deep zone, randomly in the transitional zone and parallel at the surface was only apparent in growth factor stimulated cartilage;

Figure 8. The pattern of lubricin protein localisation in immature-mature bovine articular cartilage.

Protein secretion was inhibited for 12hrs prior to cryofixation using 0.1 μΜ Monensin. Monoclonal antibody 3-A-4 detects lubricin protein in upper cell layers of the superficial zone and within the lamina splendens of articular cartilage {upper left). Protein localisation in mature articular cartilage is pronounced through all the cells of the superficial layer, the lamina splendens is reduced in size {upper right). A parallel pattern of lubricin labeling is apparent in control (ITS) and growth factor treated (ITS-FGF2-TGFM) treated immature explants (middle row). Labeling for collagen type I in growth factor treated explants shows the surface zone is intact despite the loss of its lamina splendens during remodeling and tissue neoformation;

Figure 9. Fibroblast growth factor 2 (FGF2) and transforming growth factor beta 1 (TGFbl) are effective in inducing maturation of articular cartilage over a wide concentration growth factor range.

Immature articular cartilage explants were grown in DMEM supplemented with insulin-transferrin-selenium either in the absence or presence of growth factors at the concentrations indicated above, for a total of 21 days. The medium was changed every third day. The explants were fixed, processed into wax, sectioned and then stained with Toluidine blue. Changes in morphology of growth factor treated explants show that the growth and resorption of articular cartilage that describes the process of post-natal maturation occur using a 100-fold range of concentrations of growth factor;

Figure 10. Changes in the micro- and nano-scale adhesive and elasticity properties at the apical surface of articular cartilage. Despite having heterogenous apical surfaces, freshly isolated immature cartilage explants exhibited significantly different ranges of both adhesion (C) and elasticity (F) when compared to their mature tissue sample counterparts. Frequency distribution histograms (A, B) shown here indicate that the mature samples showed decreased adhesive properties and a more closely grouped set of readings for the maximum retraction forces employed to remove the cantilever. These differences are visualised in the boxplot representation and proved highly significant through Mann-Whitney statistics; P<0.002 (C). An opposite effect was observed in the sample elasticity, where the mature samples (depicted in E) exhibited a significantly increased Young's modulus (P<0.002, F) compared to immature cartilage (D). A closely grouped set of elasticity readings were observed in the immature cartilage seen by the interquartile values of the boxplot representation (F). The mature samples exhibited a more varied set of readings depicted through the number of outliers represented by * in the boxplot analysis. The nonparametric nature of the data is captured here by the negative values needed for both adhesion and Young's modulus to enable a normal distribution trend line to be fitted to the frequency distribution graphs. Similar heterogenous surfaces were detected in the growth factor treated samples (H, K) and their untreated controls (G, J) to those seen in the immature and mature samples. A decrease in the adhesive status of the surface was observed following treatment when compared to the control samples (I). A significant lowering of the 50% interquartile range is depicted by the boxplot analysis, indicating a reduction in the maximum force needed to withdraw the AFM stylus from the sample surface (I). This was again reversed when analysing the approach curves and the sample elasticity. A significant (P<0.002) increase in sample Young's modulus, and therefore stiffening of the surface was observed following growth factor treatment when compare to the untreated control samples (L); and Figure 11. Biotribological analysis of articular cartilage explants. The coefficient of friction (CoF) was measured for freshly isolated immature (7 -day-old) and mature (>18 month old) cartilages, and, in vitro cultured growth factor treated and untreated immature cartilages (see Materials and Methods). The CoF of freshly isolated mature cartilages was significantly higher than their immature counterparts (P<0.01). The CoF of growth factor treated explants (ITS-FGF2-TGFD 1) was also significantly higher than untreated (ITS) explants (P<0.01). The CoF of growth factor treated cartilage explants increased approximately 3-fold (P<0.05) following in vitro culture for 21 days compared to freshly isolated immature tissue.

Table 1 shows the primer combinations used to perform the qPCR of the genes listed in table 1; and

Table 2. Quantitative PCR analysis of gene expression expressed as the fold difference between immature articular cartilage explants unstimulated or stimulated for 21 days with FGF2-TGF .

Materials & Methods

Cell culture: Articular cartilage was obtained from the medial groove of the metacarpalphalangeal joint of 7- day-old bovine steers using a 6mm diameter biopsy punch (Stiefel) under sterile conditions. The cartilage explants were washed in Dulbecco's Modified Eagles medium (DMEM + GlutaMax-1 including 4.5g/l glucose (Invitrogen: 61965)) to remove loose material and then placed in basal culture medium (DMEM, lOC^g ml^"1 sodium ascorbate, lOmM HEPES pH7.5, 5C^g ml^"1 Gentamicin, insulin-sodium selenite- transferrin (ITS (Sigma: i3146); lC^gmT¹, 5^g ml^"1, 5ng ml^"1, respectively), or basal medium including growth factors, lOOng ml^"1 Fibroblast growth factor-2 (FGF2: Peprotech, UK) and/or lOng ml^"1 transforming growth factor beta-1 (TGFbl : Peprotech, UK). Cartilage explants were incubated in a 5% C02-95% air mixture at 37°C in a humidified incubator. Culture medium was replaced every third day.

Cell culture with FBS: Explants were cultured for 21 days in lOmM HEPES pH7.5, lOC^g ml^"1 sodium ascorbate, 5C^g ml^"1 Gentamicin, DMEM-high glucose and 10% foetal bovine serum (Invitrogen) with or without FGF2 (lOOng ml^"1 and TGFbl (lOng ml^"1).

Histology: Cartilage samples were fixed in PLP fixative (2% paraformaldehyde, 0.075M lysine and 0.01M sodium periodate pH7.4) at 4°C for 12 hours. Samples were then processed for paraffin wax embedding and sectioning. Eight micron sections were then stained for proteoglycans using the metachromatic dye toluidine blue (0.1% aqueous solution: 30 sees). For polarised light microscopy (PLM), sections were first stained with 0.1% direct red 80 (picro-sirius red) in saturated picric acid for 1 hour prior to dehydration and coverslipping under permanent histological mountant. Sections were then viewed under polarised light using a Leitz laborlux-12 light microscope

Dimethylmethylene blue (DMMB) assay for sulphated glycosaminoglycans (sGAG): Forty microlitres of sample culture mediums were added to a 96 well plate, followed by 200 μΕ of dimethylmethylene blue reagent (Sigma Aldrich, Poole, UK). Shark chondroitin-6-sulphate (Sigma) dissolved at a concentration of 0- 40 μg mL^"1 in culture medium was used to produce a standard curve to determine experimental values. The final values for sGAG concentrations were calculated by dividing each value by the DNA value (determined by Hoeschst dye), in micrograms, of each respective explant.

Hydroxyproline assay for quantificaion of collagen content: The method of Creemers et al (1997)(6) for microassay of hydroxyproline (Sigma Aldrich, Poole, UK) in biological samples was utilised. Briefly, samples were hydrolysed in 6N HCL, samples freeze-dried and then reconstituted in water. Samples were then placed in a 96-well plate and mixed with oxidant and colour-reagent and incubated for 20 mins at 70°C. The absorbance of samples at 540nm wavelength were read and compared to hydroxyproline standards.

MTT assay for cell viability: Isolated superficial zone chondrocytes were plated at a concentration of 10³ cells per well in a 96 well plate in culture medium containing serum and allowed to attach for 48 hours. The cells were washed three times in PBS and then cultured in basal medium in the presence or absence of growth factors for a further 7 days. Cell viability was determined by washing the wells with PBS and then adding 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) reagent, 0.5mg ml^"1, in RPMI1640 (without phenol red) to each well and incubating at 37°C for 3 hours. The medium was removed and reagent solubilised using acidified iso-propanol. Absorbance of the dye measured at a wavelength of 540nm with background subtraction at 650nm.

Mechanical strength testing of cartilage explants: the Young's modulus, E, for cartilage explants was determined by indentation testing using a 0.5mm diameter flat cylindrical indenter. The specimens were tested using a Losenhausen servohydraulic testing machine with an MTS FlexTest GT controller (MTS, Eden Prairie, Minnesota) and a 5N load cell (Interface Force Measurement, Crowthrone, Berkshire, UK). For small strains, bovine articular cartilage demonstrates a linear stress-strain relationship. The samples were loaded at a constant speed of 0.1 mm/s. Force displacement curves allowed the aggregate Young's modulus of the cartilage samples to be determined, using the analytical solution of Hayes et al (1972)(7), assuming the initial deformation was isochoric with a Poisson's ratio of 0.5.

Immunohistochemical and immunofluorescent labelling: All sections for immunostaining were dewaxed and hydrated prior to immunolabelling. PLP or cryo-sections were ringed using water repellent pen (DakoCytomation) and washed in Tris-buffered saline with 0.1% Tween-20 (TBS-T) for total of 15 minutes. To allow identification of proliferating chondrocytes, explants were incubated with 10μΜ 5-bromo-2- deoxyuridine (BrdU) for 48 hours prior end of culture period. After processing for wax embedding, PLP- fixed sections were pre-treated with 2N hydrochloric acid for 1 hour at 37°C to denature DNA then incubated with borate buffer (0.1M pH 8.0) to neutralise the acid for 15 minutes. Sections incubated overnight at 4°C in humidity chamber with primary antibodies for mouse anti-BrdU. Following incubation the sections were repeatedly washed with TBS/T and then incubated at room temperature for 10 minutes with a Alexafluor 594 goat anti-mouse secondary antibody. Sections were then washed repeatedly in TBS/T and mounted in Vectashield (Vectorlabs) with propidium iodide to counterstain nuclei. Immunofluorescent labelling was examined using Olympus BX61 fluorescence microscope. For detection of lubricin and caspase-3 we used mouse monoclonal antibody 3A4 (gift Professor Bruce Caterson, Cardiff University) and polyclonal goat anti-caspase-3 (Abeam, Cambridge, UK: ab4051) labelling of cartilage explant cryosections, and primary antibody detected using Alexa 488 conjugated goat anti-mouse and rabbit anti-goat secondary antibodies (Invitrogen, Nottingham, UK), respectively.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to detect DNA fragmentation in apoptotic nuclei: Eight micron paraformaldehyde fixed sections were dewaxed, rehydrated then washed in TBS. Sections were then incubated in the presence of 2C^g/ml proteinase K for 20 minutes at room temperature then equilibriated in terminal deoxynucleotidyl transferase (TdT) buffer (FragEL kit; Merck Chemicals Ltd, Nottingham, UK) prior to incubation with TdT labeling mix containing fluorescein- conjugated deoxynucleotides for 90 minutes at 37°C. Sections were washed repeatedly in TBS and then mounted in Vectashield containing propidium iodide. Sections were viewed using the Olympus BX61 fluorescence microscope.

RNA extraction and Reverse-Transcription: Cartilage explants were washed in PBS and then frozen in liquid nitrogen. The frozen explants were then homogenized in the presence of 1 mL frozen TRI Reagent™ (Sigma) using a Mikro-Dismembrator U (B. Braun Biotech International, Melsungen, Germany) and RNA extracted using the RNAeasy RNA extraction columns (Qiagen) with DNAsel treatment. Isolated RNA was resuspended in DEPC -treated water and then quantified by UV spectrophotometry. Total RNA (500 ng) was reverse transcribed using standard molecular biology protocols.

In situ zymography: Cartilage samples were fixed in PLP fixative at 4°C for 12 hours. DQ-Gelatin (DQ- Gelatin, E12055; Invitrogen Ltd, Paisley, UK) was prepared as a mixture containing O.lmg ml^"1 DQ-Gelatin dissolved in 50mM Tris-HCL pH7.6, 150mM NaCL, 5mM CaCl₂. Forty microlitres of probe was added on top of each sample which were then incubated at 37°C for 24 hours in a dark humid chamber. The gelatinolytic activity was observed under fluorescence microscopy (absorption maxima 495nm, emission maxima, 515nm) using an Olympus BX61 fluorescence microscope.

Quantitative polymerase chain reaction (qPCR): qPCR analysis was performed using the GoTaq qPCR mastermix (Promega, WI, USA), 12.5ng cDNA and 0.3μΜ forward and reverse primers. Reactions were performed on a Stratagene Mx3000 real-time PCR analyser (Agilent Technologies, CA, USA) with the following thermal cycling program; 95°C for 10 mins - 1 cycle, 95°C 30s, 55°C 60s, 72°C 30s - 40 cycles. Standard curves over the linear range of amplification were generated for all primer sets, and data was used where the efficiency of amplification was between 95-105% and the melt curves generated a single product. The data shown are the ratio of the concentration of the gene of interest (in nanograms) versus 18S rRNA (in nanograms). The primer combinations used in this study are shown in Table 1.

Preparation of cartilage discs for electron microscopy: Discs were removed from culture, rinsed in serum- free medium and fixed for 3h in 2.5% glutaraldehyde/2% paraformaldehyde in 0.1M sodium cacodylate buffer, pH 7.3 at room temperature. After brief storage in buffer, discs were sliced into blocks approximately 1 x 0.5 x 0.5mm, postfixed in 1% aqueous osmium tetroxide, followed by 0.5% uranyl acetate, each for lh, then dehydrated in ethanol and embedded in Araldite resin (Agar Scientific Ltd, Stansted, UK). Sections, approximately 90nm thick, were cut using a diamond knife on a Leica UC6 ultramicrotome (Leica Microsystems, Vienna, Austria), collected on uncoated copper grids and contrasted with uranyl actetate and lead citrate before examination in a Jeol 1010 transmission electron microscope (Jeol Ltd, Welwyn, UK) equipped with a Gatan Qrius SC1000 CCD camera (Gatan, Oxford, UK).

Statistical Analysis: Results are presented as mean ± standard deviation. Statistical comparison of paired data was performed using the Student's t test.

AFM analysis

All AFM experiments were carried out with a Nanowizard II (JPK Instruments, Berlin, Germany) equipped with nano-positioning sensors in all three axes and closed-loop feedback for precise, repeatable scanning and probe positioning with sub-nanometer resolution. AFM stiffness measurements were based on recording the elastic modulus of the cartilage material by using the AFM tip as a nanoindentor. Explants were washed in Hank's balanced salt solution for 5 minutes and then incubated in serum free tissue culture media (DMEM). The Petri dish was then loaded onto a Nanowizard II Petri dish holder (JPK Instruments) platform and held at 37°C while nanoindentation experiments were conducted. High aspect ratio etched silicon probes (Bruker) with spring constants around 0.32 Nm^"1 and resonant frequency between 40-75 kHz were employed. Each cantilever used in the study was individually calibrated, calculating the sensitivity from a reference, hard force curve taken from the Petri dish surface. The cantilever specific spring constants were calculated using the inbuilt thermal noise method of the Nanowizard instrument. A maximum load force of 20nN was found to be optimal and applied to the surface in each recorded force curve. The cantilever approach and retraction velocity was constant, set at 1.8μιη s^"1. One thousand and twenty four incremental movements towards and away from the sample were monitored and the tissue sample Poisson ratio was assumed to equal 0.5. Nanoindentation force experiments were conducted capturing 100 indentation curves in each scan area (ΙΟμιη² square) of the explant surface. All explants were analysed in triplicate to ensure the collection of robust data sets. Physical manipulations ensure that the data is in a form which can then be interpreted to reveal a number of relevant cell surface phenomena with the definition of the zero force critical [17,18]. This data represent the basis for the estimation of a sample's adhesive properties and Young's modulus (E). Manipulation of both the approach and retraction curves yields different measurements which can be related to cell micromechanical properties and adhesion respectively. The minimum of the retraction curve is the force needed to overcome the adhesion between the sample and the probe. The Hertzian model, based on the size of the indentor (~lxl0^~9) and the thickness of the tissue (mm), was employed as a theoretical framework allowing the approach curve data to be manipulated, yielding insights into the key biomechanical properties of the sample.

Friction testing

The frictional coefficient was assessed on a pin-on-plate tribometer, using a specific lubricant for in vitro biotribological testing (British Standards: BS7271-7). Superficial sections were removed from the 6mm diameter articular cartilage plugs, before immediate fixation on to a nylon housing using cyanoacrylate. Lubricant was applied evenly over the polished glass surface, providing an average depth of approximately lmm. The tissue was then preloaded at 0.1 MPa for 120s prior to disc rotation to ensure consistent boundary lubrication in a manner akin to Neu et al [19]. The sliding speed was then ramped to 12mm/s, before data were recorded for 15s. Retrospective analysis to compute the mean frictional coefficient was then completed using MS Excel (Microsoft, Redmond, WA, USA).

Results

Perinatally-derived bovine articular cartilage from the metacarpalphalangeal (MCP) joint has a cell and extracellular matrix morphology which is described as immature. The tissue is thick, and chondrocytes within it are organised isotropically. We observed that when 6mm diameter immature articular cartilage explants from the MCP joint were cultured as explants in the combined presence of growth factors lOOng ml^{" 1} FGF2 and lOng ml^"1 TGFbl in a chemically defined basal culture medium (lOmM HEPES pH7.5, 50μg ml^{" 1} Gentamicin, 100μg ml^"1, sodium ascorbate and supplemented with insulin-transferrin-selenium (Sigma)) for 21 days there were significant morphology changes evident (Figure 1, upper row). The most significant change was a 52% reduction in height of explants cultured in the presence of FGF2 and TGFbl growth factors compared to explants cultured in basal medium alone (2725±327μιη v 1435±292μιη, respectively). Notably, the hypertrophic cells visible in the deep zone of control explants were absent in growth factor treated explants. The morphological changes described above did not occur in explants stimulated singularly with either FGF2 or TGFbl. Biochemical analysis of FGF2 and TGFbl stimulated explants showed that there was no overall change in glycosaminoglycan (proteoglycan), hydroxyproline (collagen) or water content compared to control unstimulated explants, indicating that resorption of the deep zone following this growth factor stimulation could account for the morphological changes observed (Figure 1, graphs). Additionally, we did observe significant increases in the wet weight (34%; 4.75±0.86mg v 3.53±0.28mg) and dry weights (37%; 1.31±0.26mg v 0.95±0.06mg) of FGF2 and TGFbl growth factor exposed explants indicating that in addition to resorption further significant remodeling within the remaining portion of cartilage was occurring. On the basis of our preliminary observations we hypothesised that this specific combination of growth factors induced accelerated maturational, as opposed to growth, changes of articular cartilage. Foetal bovine serum (FBS) contains a mixture of proteins (albumin, immunoglobulin), minerals, sugars, fatty acids, lipids, growth factors/hormones (peptide and steroidal) and potentially adventitious agents passed to the foetus through the placenta in aqueous solution. FBS is known to contain a number of growth factors including IGF-I and IGF-II (8), BMP-4 (9), and FGF (10). We found no evidence to suggest that culture medium enriched with foetal bovine serum (10%) had any effect on remodelling as previously observed with chemically defined basal medium containing insulin-transferrin-selenium and FGF2-TGFbl (Figure 2). In fact, the presence of serum had a negative effect when FGF2 and TGFbl were added to the culture medium.

Precocious resorption in cartilage explants induced by growth factors FGF2 and TGFbl could be observed by decalcification of mineralised tissue in the deeper zones of the explants using EDTA prior to fixation and histologic processing (Figure 3; left image). In order to visualise the active process of resorption we overlayed DQ-Gelatin, a collagenase substrate that fluoresces in the presence of collagenase, over pip-fixed sections of control and growth factor treated explants (Figure 3; middle and right images). A smooth boundary between calcified and deep zone hyaline cartilage is delineated by enzymatically activated fluorescent DQ-Gelatin in control explants. In contrast, the same boundary is broken and ragged in FGF2 and TGFbl growth factor treated explants, with spurs of collagenase activity breaking into the hyaline portion of the cartilage. High power images also revealed the presence of condensed nuclei, evidence of apoptosis that was absent in control explants. TUNEL analysis revealed that apoptosis was significantly induced in the deep zone of growth factor FGF2 and TGFbl treated explants (Figure 4, left). Of the cells that were TUNEL-negative in the deep zones of FGF2 and TGFbl growth factor stimulated cartilage, we noted that they expressed caspase-3 indicating that they were on the pathway of apoptosis (Figure 4).

From the image reconstructions of the explants using fluorescent microscopy and from histological analysis we observed an increase in cellular density particularly within the surface zone of growth factor FGF2 and TGFbl stimulated cartilage explants (Figure 4-5). We performed cell counts to quantify this observation and noted a 39% increase in cellular density in treated explants (234.38+33.10 v 169.13+34.06 cells per microscopic field). In addition, in vitro analysis of cellular viability of chondrocytes isolated from the surface zone and cultured in the absence, or presence of FGF2 or TGFbl, or, FGF2 and TGFbl in combination, for 7 days showed that the combination of FGF2 and TGFbl growth factors synergistically induced cellular proliferation of approximately 36% over that found in the absence or presence of either growth factor alone (Figure 5, lower graph). To eliminate the possibility that the increase in cellular density in the surface zone may have been due to dehydration we used bromodeoxyuridine incorporation to directly visualise dividing cells (Figure 5, lower images). Intriguingly, we observed that there appeared to be two growth zones, surface (less active) and interstitial (more active), whose polarity switched upon FGF2 and TGFbl growth factor stimulation.

In order to integrate our observations at the level of gene expression we performed quantitative PCR of groups of proteins known to influence the post-natal maturational process in articular cartilage (Table 2). We saw an expected decrease in collagen type IIB and IX gene expression, no significant change in aggrecan or ADAMTS5 expression but a 20-fold increase in ADAMTS4 transcript levels. These latter observations demonstrate that aggrecan gene expression is not significantly altered, as would be predicted during maturation of cartilage. In adult, mature articular cartilage collagen turnover is significantly reduced whereas aggrecan turnover is maintained in comparison. Interstitial collagenase (metalloproteinase, MMP) MMP1 was significantly upregulated in FGF2 and TGFbl growth factor treated explants as was the upregulation of MMPs -2, -9 -1 and -13. Upregulation of MMP gene expression correlates with the increased gelatinolytic/collagenase activity observed in ITS-FGF2-TGFbl explants (Figure 3). Gene expression levels of tissue inhibitor of MMPs (TIMPs) 1-3 were also increased with the greatest increase of approximately 64- fold occurring for TIMP1. TIMPs are stoichiometric inhibitors of MMP activity, and their expression would be expected to rise in order to protect the remaining articular cartilage from resorption. Additionally, TIMP1 has been shown, experimentally, to increase during maturation in articular cartilage(l l), and therefore, our data strongly suggest that the remodelling phase we are observing is consistent with articular cartilage maturation.

One of the hallmarks of articular cartilage maturation is the increase in collagen cross-linking, specifically the transition from immature divalent hydroxylysinoketonorleucine (HLKNL) cross-links to mature trivalent lysylpyridinoline (LP) or hydroxylysylpyridinoline (HP) cross-links in collagen fibrils catalysed by the enzyme lysyl oxidase. We analysed, using high performance liquid chromatography, the quantity of immature and mature collagen cross-links formed in cartilage explants following FGF2 and TGFbl growth factor stimulation compared to explants grown in basal medium alone, and found a significant reduction of immature (HLKNL) crosslinks in FGF2 and TGFbl growth factor stimulated explants which translated into a significantly greater ratio (68%) of mature to immature collagen-cross-links compared to control explants (Figure 6, upper). We hypothesised that the increase in mature collagen cross-links in FGF2 and TGFbl growth factor stimulated explants may increase their stiffness, and this was tested using paired explants and indentation analysis (Figure 6, middle). FGF2 and TGFbl growth factor treated explants displayed average values for Young's modulus, E, 90% greater than in control explants (4.83±0.98MPa v 2.54+1.52MPa). Using polarised light microscopy (PLM) of pico-sirius red stained sections, the orientation of collagen fibrils within cartilage is analysed. PLM images show intense fluorescence surrounding chondocytes located in the appositional growth zone of FGF2 and TGFbl growth factor stimulated immature cartilage explants. In surface and mid-zone chondrocytes of control cartilage, fluorescence was present but much weaker in intensity. Therefore, an increase in the ratio of mature to immature collagen fibril cross-linking appear to correlate with increases in mechanical strength and fibril alignment. By examining the ultrastructure of chondrocytes and the ECM of unstimulated and FGF2 and TGFbl growth factor stimulated explants, we saw profound differences in structure, namely pericellular coat and chondron formation in the latter explants (Figure 6, lower). In control explants there was no pericellular coat, and processes emerging from the cellular membrane penetrating the surrounding ECM. As collagen fibril alignment appeared to be pronounced in the surface of FGF2 and TGFbl growth factor stimulated cartilage, concurrent with appositional growth, we hypothesised that the effect of FGF2 and TGFbl on collagen fibril alignment might be better visualised in a system where neoformation of cartilage ECM could proceed starting with isolated chondrocytes, i.e. starting with no ECM. Thus, we isolated chondrocytes from MCP joints and grew them as tissue-engineered constructs for 21 days in Millicell supports (Millipore) that mimic in vivo growth, in the presence of foetal bovine serum-containing medium for 21 days, allowing them to accumulate abundant extracellular matrix (Figure 7). Then, constructs were either stimulated with FGF2 and TGFbl in basal medium or cultured in basal medium alone for a further 21 days. Polarised light microscopy of tissue sections showed that in FGF2 and TGFbl growth factor stimulated cartilage constructs collagen fibril alignment was significantly different from that of unstimulated constructs (Figure 7). Specifically, collagen fibrils situated in the superficial zone were parallel to the surface, there was an interruption in fluorescence that characterised the random alignment of cells of the mid zone, and most significantly, collagen fibril alignment in the deep zone was perpendicular to the surface. The latter observations mirror collagen alignments within comparable zones of maturing articular cartilage. The surface of control explants displayed robust fluoresence, and here collagen fibril alignment displayed a crisscross and not parallel configuration. The remaining tissue was weakly fluorescent indicating a random alignment of collagen fibrils.

We used immunofluorescence to determine if the distribution and expression of extracellular matrix molecules, such as lubricin, a muccopolysaccharide containing protein vital to maintaining boundary lubrication of joints, in control and FGF2 and TGFbl growth factor stimulated immature cartilage explants was related to the developmental transition from immature to mature articular cartilage (Figure 8). Our data show that the pattern of lubricin protein labelling is identical in immature cartilage and in cartilage explants grown for 21 days in basal medium (ITS), with chondrocytes directly adjacent to the articular surface synthesising the greatest amount of protein. The pattern of lubricin expression in FGF2 and TGFbl growth factor stimulated explants is different from control explants, with extensive cellular labeling present through an extended superficial zone. In mature articular cartilage cellular labeling also extends beyond the chondrocyte cell layers directly adjacent to the surface. The absence of boundary labeling for lubricin in FGF2 and TGFbl growth factor stimulated explants was probably due to remodeling during neoformation of cartilage, as collagen type I protein antibody labeling showed that the surface zone was still intact. Electron microscopy images show that the lamina splendens a transluscent lipid layer that traps lubricin is partially missing in growth factor stimulated explants (data not shown).

Additionally, we show in Figure 9 that fibroblast growth factor 2 (FGF2) and transforming growth factor beta 1 (TGFbl) are effective in inducing maturation of articular cartilage over a wide concentration growth factor range. Immature articular cartilage explants were grown in DMEM supplemented with insulin- transferrin-selenium either in the absence or presence of growth factors at the concentrations indicated above, for a total of 21 days. Changes in morphology of growth factor treated explants ashow that the growth and resorption of articular cartilage that describes the process of post-natal maturation occur using a 100-fold range of concentrations of growth factor.

In this study, we measured the extent to which the biomechanical performance of in vitro cultured immature articular cartilage explants that have undergone FGF2 and TGF i induced maturation compared with normal mature articular cartilage. Biomechanical parameters were analysed using the contact probe method of atomic force microscopy (AFM) that lends itself to micro- through nano-scale analysis of tissue, cell and molecular stiffness and mechanical properties. Stiffness is the mechanical parameter describing the relation between applied non-destructive load and resultant deformation of a material. In this study AFM cantilevers were used as soft nano-indentors to enable the local analysis of cartilage biomechanical properties following maturational stimulus with FGF2 and TGF i. Utilised as a nano-characterisation device, AFM provides a detailed and statistically robust dataset for the analysis of treatment effect on the functional surface properties of the cartilage tissue. AFM and nano-indentation experiments have proven particularly powerful to date, allowing carefully chosen indentation locations as well as post-hoc analysis of created indents, and hence the possibility to assess the properties of microstructural elements of tissues. Stiffness variations are relative to changes in three-dimensional organisational structure of cartilage surfaces and can, therefore, be used to infer changes in maturational states of articular cartilage[16].

One key property of maturing cartilage is a progressive increase in material stiffness [20]. Measuring the nano-scale compressive strength of cartilage using AFM we observed freshly isolated mature articular cartilage showed an increase in Youngs 's modulus, and therefore a strengthening or hardening of the apical surface compared to immature cartilage (97.62+9.32 kPa v 5.79+0.19 kPa, respectively, P<0.05, n=6), Figure 10F. We also observed a similar increase in modulus between immature cartilage explants that had been cultured for 21 days in serum-free medium continually replenished with growth factors FGF2 and TGF i and explants cultured only in control, serum-free medium (155.30+12.1 kPa v 28.31+1.43 kPa, respectively, P<0.05, n=6), Figure 10L. Freshly isolated immature cartilage also exhibited significantly higher maximal adhesion forces than mature cartilage (2.5+0.1 nN versus 1.9+0.1 nN, P<0.05, n=6), Figure IOC, and this trend was also replicated when maximal adhesive forces of growth factor stimulated immature cartilage was compared to unstimulated immature cartilage explants (1.8+0.04 nN v 1.2+0.08 nN, P<0.05, n=6), Figure 101.

The mean instantaneous frictional coefficient of freshly isolated mature cartilage was significantly higher (4.6-fold) than its immature counterpart (P<0.01, n=4), Figure 11. Similarly, the frictional coefficients of growth factor stimulated cartilage explants were also 1.6-fold significantly higher than explants cultured in medium lacking growth factor (P<0.014, n=5). Experimentally induced maturation caused an approximately 3-fold rise in friction coefficient (P<0.02, n=4) compared to freshly isolated immature cartilage. Conclusion

Maturation of articular cartilage occurs post-natally, for example, in New Zealand white rabbits the process takes approximately 3 months following birth (12). In this time, significant morphological changes take place, principally a shift in the isotropic organisation of chondrocytes to one that is anisotropic and a thinning of articular cartilage. Zonal anisotropic reorganisation of chondrocytes is accompanied by reorientation of collagen fibrils such that chondrocytes are aligned in the direction of the fibrils, as columns in the deep zone where fibrils are perpendicular to the surface, or as flattened and discoidal cells in the surface where the fibrils are aligned parallel to the surface of the joint cartilage (13). The mechanisms underlying this morphological transition have remained elusive, but our study supplies evidence that FGF2 and TGFbl-3 act synergistically to accelerate maturation, as opposed to growth, in immature articular cartilage. Alone, FGF2 and TGFbl have been shown to act as homeostatic growth factors, in response to injury and/or in the maintenance of extracellular matrix in immature and mature articular cartilage (1, 4). Our observations that both factors act synergistically to induce morphogenetic maturational changes where an overall tissue volume decrease is observed could therefore not be predicted from their individual profiles.

Growth and maturation of articular cartilage has been hypothesised to be a balance of resorption and tissue neoformation. We show that this is indeed the case, and in this model system, where maturational changes are accelerated, we observe precocious resorption from the basal end of cartilage explants and similarly precocious cellular proliferation at their apical surface. Resorption at the interface between calcified and hyaline cartilage is accompanied by apoptosis of the overlying cells. The majority of the apoptotic cells were located in the deep zone of articular cartilage. Further, we discovered that the cardinal properties of increased stiffness, decreased adhesiveness and increased instantaneous friction coefficient following in vivo maturation of articular cartilage in the bovine metacarpophalangeal joint is replicated by in vitro growth factor stimulated maturation of immature articular cartilage explants from the same joint.

Gene Sequence

i-R A 18S F GGCCTCACIAAACCArCCAA rR A 18S R GC:AATTATTC:CCCA GAACG

ΤΪΜΡΙ F CACCCAC AGACGGCCTTCT

TT PI R CTGGTATAAGGCAGTTTCATTGACTT

ΤΊΜΡ2 F GCTOGACAITGO AGGA AAGA

TJMP2 R CGTCCGGAGAGGAG ATGTAG

11 MP3 F GATGTACCGAGGAITCACCAAGAT

ΪΜΡ3 R GCCGGATGCAAGCGTAGT

MMP i F CAAATGCTGGAGGTATGATGA

MM i R AATTCCGGGAAAGTCTTCTG

MMP2 F CTGGTGTCCAGAAGGTGGAT

MMP2 R TAC JCGCCCTTG A A GAAGTA

MMP9 F GGAGATTAGGAACCGCTTGC

MMP9 R AACAGCAGCACC TACCCTC

MMP i 3 F TGGTGATGAAACCTGGACAA

MMPi 3 R GGCGTTTTGGG ATGTTTAG

A greeari F AGAACATGCGCTCCAATGACT

Aggre an R TGTCXTCGATGCCGTGC

ADAMTS4 F CTCCATGACAACTCGAAGCA

ADAMTS4 R CTAGGAGACAGTGCCCGAAG

A.DAMTS5 F CACCTCAGC^'CACCATCACAG

ADAMTS5 R AGTACTCTGGCCCGAAGGTC

Collagen 11 f CTGGATGCCATGAAGGTTTT

Col! age si i l R GCTCCACCAG^'ITC^'I CTTGG

Collagen IX F ATTAGGATCCATTGTGACCCCCTGC

Collages IX R ATIAGAATTCCCGGTTCACCTGC

Table 1

Collagen 1IB 0.11** collagen IX 0.07**

Aggrecan 0,65 ADA TS4 20.46* ADA TS5 2,25 MP1 5041,18*

MMP2 16.62* MP9 162.75*

MNP] 3 4,82*

TIMP1 64.37* TIMP2 8,85* TIMP3 4,56*

*, P<0.05 * ** P<0.01

Table 2 References

1. Ellman MB, An HS, Muddasani P, Im HJ. Biological impact of the fibroblast growth factor family on articular cartilage and intervertebral disc homeostasis. Gene2008 Aug 15;420(l):82-9.

2. Tang QO, Shakib K, Heliotis M, Tsiridis E, Mantalaris A, Ripamonti U. TGF-beta3: A potential biological therapy for enhancing chondrogenesis. Expert opinion on biological therapy2009 Jun;9(6):689- 701.

3. Dailey L, Laplantine E, Priore R, Basilico C. A network of transcriptional and signaling events is activated by FGF to induce chondrocyte growth arrest and differentiation. The Journal of cell biology2003 Jun 23;161(6): 1053-66.

4. Shi S, Mercer S, Eckert GJ, Trippel SB. Growth factor regulation of growth factors in articular chondrocytes. The Journal of biological chemistry 2009 Mar 13;284(l l):6697-704.

5. Lincoln J, Lange AW, Yutzey KE. Hearts and bones: shared regulatory mechanisms in heart valve, cartilage, tendon, and bone development. Dev Biol2006 Jun 15;294(2):292-302.

6. Creemers LB, Jansen DC, van Veen-Reurings A, van den Bos T, Everts V. Microassay for the assessment of low levels of hydroxyproline. Biotechniquesl997 Apr;22(4):656-8.

7. Hayes WC, Keer LM, Herrmann G, Mockros LF. A mathematical analysis for indentation tests of articular cartilage. J Biomechl972 Sep;5(5):541-51.

8. Muramatsu T, Pinontoan R, Okumura J. Biopotency of fetal bovine serum, and insulin and insulinlike growth factors I and II in enhancing whole-body protein synthesis of chicken embryos cultured in vitro. Comparative biochemistry and physiology 1995 Jun;l l l(2):281-6.

9. Kodaira K, Imada M, Goto M, Tomoyasu A, Fukuda T, Kamijo R, et al. Purification and identification of a BMP-like factor from bovine serum. Biochemical and biophysical research communications2006 Jul 7;345(3): 1224-31.

10. Gstraunthaler G. Alternatives to the use of fetal bovine serum: serum-free cell culture. Altex2003;20(4):275-81.

11. Mienaltowski MJ, Huang L, Stromberg AJ, MacLeod JN. Differential gene expression associated with postnatal equine articular cartilage maturation. BMC Musculoskelet Disord2008;9: 149.

12. Hunziker EB, Kapfinger E, Geiss J. The structural architecture of adult mammalian articular cartilage evolves by a synchronized process of tissue resorption and neoformation during postnatal development. Osteoarthritis Cartilage2007 Apr;15(4):403-13.

13. Hunziker EB. Articular cartilage repair: basic science and clinical progress. A review of the current status and prospects. Osteoarthritis Cartilage2002 Jun;10(6):432-63.

16. Stolz M, Raiteri R, Daniels AU, VanLandingham MR, Baschong W, et al. (2004) Dynamic elastic modulus of porcine articular cartilage determined at two different levels of tissue organization by -type atomic force microscopy. Biophys J 86: 3269-3283.

17. Luckham PF (2004) Manipulating forces between surfaces: applications in colloid science and biophysics. Adv Colloid Interface Sci 111 : 29-47.

18. Heim LO, Kappl M, Butt HJ (2004) Tilt of atomic force microscope cantilevers: effect on spring constant and adhesion measurements. Langmuir 20: 2760-2764.

19. Neu CP, Reddi AH, Komvopoulos K, Schmid TM, Di Cesare PE (2010) Increased friction coefficient and superficial zone protein expression in patients with advanced osteoarthritis. Arthritis Rheum 62: 2680- 2687.

20. Williamson AK, Masuda K, Thonar EJ, Sah RL (2003) Growth of immature articular cartilage in vitro: correlated variation in tensile biomechanical and collagen network properties. Tissue Eng 9: 625-634.

Claims

1. A morphogenic induction medium for the maturation of cartilage tissue comprising FGF-2 and TGFbl-3 in isotonic solution.

2. A morphogenic induction medium according to claim 1 consisting of FGF-2 and TGFbl-3 in isotonic solution.

3. A morphogenic induction medium according to claim 1 or claim 2 wherein said TGFbl-3 is TGFbl.

4. A morphogenic induction medium according to claims 1 - 3 wherein said cartilage tissue is selected from the group comprising immature cartilage tissue or cells, cartilage progenitor cells, stem cells and adult cartilage tissue or cells.

5. A morphogenic induction medium according to any preceding claim wherein said growth factors are naturally occurring, recombinant or artificial/synthetic.

6. An ex vivo culture medium comprising FGF-2 and TGFbl-3 in isotonic solution.

7. An ex vivo culture medium consisting of FGF-2 and TGFbl-3 in isotonic solution.

8. An ex vivo culture medium according to claim 7 or 8 wherein said TGFbl-3 is TGFbl.

9. A method for maturing cartilage in culture comprising: culturing tissue or cells selected from the group consisting of immature cartilage tissue or cells, cartilage progenitor cells, stem cells and adult cartilage tissue or cells in a culture medium comprising exposing said cartilage to FGF-2 and TGFbl-3 in isotonic solution.

10. A method for maturing cartilage in culture comprising: culturing tissue or cells selected from the group consisting of immature cartilage tissue or cells, cartilage progenitor cells, stem cells and adult cartilage tissue or cells in a culture medium comprising exposing said cartilage to medium consisting of FGF-2 and TGFbl-3 in isotonic solution.

11. A method according to claim 9 or 10 wherein said TGFbl-3 is TGFbl.

12. A method according to calims 9 - 11 wherein said cartilage is articular.

13. A method according to claims 9 - 12 wherein said cartilage is autologous or allogeneic.

14. A method according to claims 9 - 13 wherein the tissue is cultured at 37°C for approximately 3 weeks.

15. Use of a medium according to claims 1-8 in the treatment or repair of cartilage injuries.

16. An injection fluid comprising FGF-2 and TGFbl-3 in isotonic solution.

17. An injection fluid consisting of FGF-2 and TGFbl-3 in isotonic solution.

18. An injection fluid according to claims 16 or 17 wherein said TGFbl-3 is TGFbl.

19. An injection fluid according to claim 16 - 18 wherein said fluid is formulated for medical or veterinary use.

20. A composition for topical application comprising FGF-2 and TGFbl-3.

21. A composition for topical application consisting of FGF-2 and TGFbl-3.

22. A composition for topical applicationaccording to claim 20 or 21 wherein said TGFbl-3 is TGFbl.

23. An composition according to claim 20 - 22 wherein said composition is formulated for medical or veterinary use.

24. Use of an injection fluid according to claims 16 - 19 or a composition according to claims 20 -23 to treat a cartilage disorder.

25. A method of treating a mammal suffering from a cartilage defect comprising administering to said mammal an effective amount of said injection fluid of claims 16 - 19.

26. A method of treating a mammal suffering from a cartilage defect comprising administering to said mammal an effective amount of said composition of claims 20 - 23.

27. A method according to claims 25 or 26 wherein said mammal is human, equine, canine, feline, porcine, or any other domestic or agricultural species.