WO2011136651A1 - Nouvelle protéine de glycosyltransférase et son rôle dans le métabolisme de composés phénylpropanoïdes volatils chez la tomate - Google Patents

Nouvelle protéine de glycosyltransférase et son rôle dans le métabolisme de composés phénylpropanoïdes volatils chez la tomate Download PDF

Info

Publication number
WO2011136651A1
WO2011136651A1 PCT/NL2011/050291 NL2011050291W WO2011136651A1 WO 2011136651 A1 WO2011136651 A1 WO 2011136651A1 NL 2011050291 W NL2011050291 W NL 2011050291W WO 2011136651 A1 WO2011136651 A1 WO 2011136651A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
gene
sequence
tomato
nucleic acid
Prior art date
Application number
PCT/NL2011/050291
Other languages
English (en)
Inventor
Arnaud Guillaume Bovy
Yury Tikunov
Original Assignee
Stichting Dienst Landbouwkundig Onderzoek
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Stichting Dienst Landbouwkundig Onderzoek filed Critical Stichting Dienst Landbouwkundig Onderzoek
Publication of WO2011136651A1 publication Critical patent/WO2011136651A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention is related to plant biochemistry and genetics, more specifically to tomato biochemistry and genetics. Especially, it is related to a glycosyltransferase enzyme that is involved in the regulation of emission of volatile compounds.
  • the invention relates to the taste and aroma of tomatoes on basis of the absence or presence of this enzyme, and to methods ensuring this.
  • Tomato Solanum ly coper sicum
  • Statiles are considered as major determinants of tomato fruit flavour.
  • Several hundred tomato fruit volatile compounds have been described in literature (Petro-Turza, M., 1987, Food Rev. Int. 2:309-351), but only a small part of this diversity.is believed to have an impact on tomato fruit organoleptic properties (Baldwin, E.A. et al, 2000, Hort. Science 35: 1013- 1022).
  • PhP phenylpropanoid
  • MeSA methyl salicylate
  • guiacol guiacol
  • MeSA content has been shown to be negatively correlated with typical tomato flavour (Krumbein, A. and Auerswald, H., 1998, Academic 42:395-399).
  • Guiacol is also a well-known flavouring compound and has been associated with so-called "pharmaceutical" aroma in tomato fruits (Causse, M. et al., 2002, J. Exp. Bot. 53:2089-2098).
  • eugenol is a well-known odorant that gives the distinctive, pungent flavour to cloves (Syzygium aromaticum) and significantly contributes to the aroma of cinnamon (Cinnamonum verum). Therefore, there is clear potential for the release of these compounds to influence, either positively or negatively, tomato flavour.
  • PhP volatiles are primarily derived from phenylalanine (Phe). Cinnamic acid, directly derived from Phe by a deamination catalyzed by Phe ammonia lyase, can either be ⁇ -oxidatively or non-oxidatively converted into benzoic acid. This can be further hydroxylated into salicylic acid by benzoic acid 2-hydroxylase. Salicylic acid is the immediate precursor of the volatile MeSA through the action of salicylic acid methyl transferase (Boatright, J., et al, 2004, Plant Physiol. 135:1993-2011).
  • Cinnamic acid can also be converted to other phenolic acids: p-coumaric acid, caffeic acid, and ferulic acid. Ferulic acid can be converted into coniferyl alcohol and further to eugenol (Gang, D.R., 2005, Ann. Rev. Plant Biol. 56:301-325).
  • the biochemical origin of guiacol in plants is not completely known. However, its chemical structure clearly points to the same PhP origin, as has already been demonstrated for bacteria (Chang, S.S. and Kang, D.H., 2004, Crit. Rev. Microbiol. 30:55-74).
  • Glycosylation is a common means to conjugate plant secondary metabolites in order to facilitate their transport and storage and to reduce their reactivity by blocking reactive hydroxyl groups.
  • many volatile compounds including PhP volatiles, are bound as glycosides, thus representing an aroma reserve.
  • Such glycosidically bound volatiles can be liberated when cell compartmentation is destroyed, as happens on consumption of fresh fruits or industrial processing, or as may happen during late ripening stages.
  • endogenous and/or exogenous cleavage enzymes such as glycosyl hydrolases (glycosidases), which leads to glycoside cleavage and volatile emission.
  • the current invention provides an amino acid sequence of a protein that is capable of glycosylation of a phenylpropanoid (PhP) volatile diglycoside, comprising the sequence of SEQ ID NO:2 or an amino acid sequence which is more than 70% identical thereto, more preferably having the amino acid sequence of SEQ ID NO:2.
  • a protein that is capable of glycosylation of a phenylpropanoid (PhP) volatile diglycoside, comprising the sequence of SEQ ID NO:2 or an amino acid sequence which is more than 70% identical thereto, more preferably having the amino acid sequence of SEQ ID NO:2.
  • the invention also provides a nucleic acid sequence encoding for a protein according to the invention, more preferably the nucleic acid sequence of SEQ ID NO:l or a nucleic acid sequence which is more than 70% identical thereto.
  • Also part of the invention is a vector comprising such a nucleic acid and a host organism comprising such a vector or such a nucleic acid
  • the invention comprises a method for providing plants with a phenotype of lacking smoky flavour, wherein said plants are provided with a nucleic acid sequence according to the invention.
  • the invention also comprises a method for providing plants with a phenotype of smoky flavour, wherein in said plants the expression of the protein according to the invention.
  • the present invention relates to a method for providing plants with a phenotype of lacking smoky flavour, comprising:
  • step c) selfing and /or further crossing said progeny selected in step c),
  • step d) selecting progeny resulting from the crossing in step d) for a genotype a gene encoding a protein according to the invention
  • steps f) optionally repeating said steps of selfing and/or crossing and selection of steps d) and e) to provide a plant having a genotype that is homozygous for said gene, wherein at least one selection as performed in steps a), c) or e) is performed by marker-assisted selection.
  • Also part of the invention is a method for selecting a plant having a phenotype lacking smoky flavor said method comprising:
  • the presence of the gene is tested by assessing the presence of any of the markers listed in Table 1.
  • the plant used in the methods of the invention is a tomato plant.
  • Also part of the invention is the use of a marker for selecting a plant having a phenotype lacking smoky flavour or having a phenotype showing smoky flavour, wherein said marker is selected from the markers listed in table 1, or wherein said marker is a sequence that is identical or homologous to a part of the sequence encoding the protein according to the invention.
  • PCA Principal Components Analysis
  • PhP-V di- and triglycosides divided the entire F2 population for two groups.
  • Fruits of the first group (A, encircled green) contained PhP- V diglycosides susceptible to enzymatic hydrolysis.
  • Fruits of the second group (A, encircled red) contained PhP-V triglycosides resistant to hydrolysis.
  • the analysis of volatile emission from this fruits reported previously showed a correlation of this grouping to PhP-V emission.
  • chromosome 9 A— a PhP-V emission region was located between markers TG348 and C2_At3g24010; B - 3 scaffolds 05382 (scfld_l), 03668 (scfld_3), 01402 (scfld_2) retrieved using markers in this region; C— expressed DGE tags found on the three scaffolds. A cluster of tags whose expression patterns correlate to the PhP-V glycoside modification (induced upon ripening in "non-smoky” (NS) fruits compared to "smoky” fruits (S) are depicted by a brace. MG— mature green fruits, T— turning fruits.
  • ORF403908 and glycosyltransferases with known functionality (Masada, S. et al., 2009, Plant Cell Physiol. 50:1401- 1415).
  • the tree was constructed in CLUSTALW
  • a cluster depicted in color represents GTases that possess glycoside- glycosyltransferase activity.
  • FIG. 4 Digital Gene Expression data (A) of tag403908. (B) qRT-PCR expression data of ORF403908_1 detected in a 690-bp genomic DNA 'slice' upstream of tag403908.
  • FIG. 1 qRT-PCR analysis of fruits of 10 genotypes of the '4-parent' F2 segregation population.
  • A Results of metabolic analysis of the genotypes: 5 high PhP-V emitters contain PhP volatiles bound as diglycosides; 5 low PhP-V emitters contain PhP volatiles bound as triglycosides and malonyltriglycosides (the data exemplified by guaiacol glycosides).
  • B Expression of ORF403908 in the fruits of 10 contrasting genotypes.
  • Figure 10 Genomic sequence alignment of the + and— allele of the NSGT1 gene. Putative ATG start and stop codons are boxed. The 5'and 3'primer used for pyrosequencing is denoted by arrows.
  • NSGT2 genes Putative ATG start and stop codons are boxed.
  • the 5'and 3'primer used for pyrosequencing is denoted by arrows.
  • the SNP used for pyrosequencing and the EcoRI SNP are marked with blue boxes.
  • FIG. 13 Promoter sequence alignment of the + and— alleles of the NSGT2 gene. Putative ATG start codons are boxed. The Spel SNP used as CAPS marker is indicated as a blue box
  • Figure 14 A map of the pACYDuet-GTorf403908 expression vector.
  • FIG. 15 LC-MS results of microbial assays of the glycosyltransferase encoded by the NSGTl- (ORF403908) gene. Chromatograms and corresponding mass spectra shows: A - guaiacol di- and triglycosides, B - methyl salicylate di- and triglycosides and C— eugenol di- and triglycosides.
  • FIG. 16 Production of PhP-V triglycosides in 'smoky' tomato fruits which transiently express NSGTl gene.
  • tumefacience culture were infiltrated in fruits: Fruits infiltrated with P19 gene only were used as controls (Cl,2,3).
  • dHP di-hexose-pentoside.
  • MdHP malonyl di-hexose-pentoside
  • plant or part thereof means any complete or partial plant, single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which tomato plants can be regenerated.
  • plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
  • tomato means any plant, line or population formerly known under the genus name of Lycopersicon including but not limited to Lycopersicon cerasiforme, Lycopersicon cheesmanii, Lycopersicon chilense,
  • Lycopersicon chmielewskii Lycopersicon esculentum ( ow Solanum ly coper sicum), Lycopersicon hirsutum, Lycopersicon parviflorum, Lycopersicon pennellii,
  • Lycopersicon peruvianum Lycopersicon pimpinellifolium, or Solanum lycopersicoides.
  • the newly proposed scientific name for Lycopersicon esculentum is Solanum lycopersicum.
  • the names of the wild species may be altered.
  • L. pennellii has become Solanum pennellii
  • L. hirsutum may become S. habrochaites
  • L. peruvianum may be split into S. 'N peruvianum ' and S. 'Callejon de Huayles ', S. peruvianum
  • S. corneliomuelleri, L. parviflorum may become S.neorickii, L.
  • chmielewskii may become S. chmielewskii
  • L. chilense may become S. chilense
  • L. cheesmaniae may become S. cheesmaniae or S. galapagense
  • L. pimpinellifolium may become S. pimpinellifolium (Solanacea Genome Network (2005) Spooner and Knapp;
  • S. lycopersicum refers to any variety or cultivar of the garden tomato.
  • population means a genetically heterogeneous collection of plants sharing a common genetic derivation.
  • the term "variety" is as defined in the UPOV treaty and refers to any plant grouping within a single botanical taxon of the lowest known rank, which grouping can be: (a) defined by the expression of the characteristics that results from a given genotype or combination of genotypes, (b) distinguished from any other plant grouping by the expression of at least one of the said characteristics, and (c) considered as a unit with regard to its suitability for being propagated unchanged.
  • cultivar for cultivated variety
  • cultivated variety is defined as a variety that is not normally found in nature but that has been cultivated by humans, i.e. having a biological status other than a "wild" status, which "wild" status indicates the original non-cultivated, or natural state of a plant or accession.
  • cultivar further includes, but is not limited to, semi-natural, semi-wild, weedy, traditional cultivar, landrace, breeding material, research material, breeder's line, synthetic population, hybrid, founder stock/base population, inbred line (parent of hybrid cultivar), segregating population, mutant/genetic stock, and
  • crossing means the fertilization of female plants (or gametes) by male plants (or gametes).
  • gamete refers to the haploid or diploid reproductive cell (egg or sperm) produced in plants by meiosis, or by first or second restitution, or double reduction from a gametophyte and involved in sexual reproduction, during which two gametes of opposite sex fuse to form a diploid or polyploid zygote.
  • the term generally includes reference to a pollen (including the sperm cell) and an ovule (including the ovum).
  • Crossing therefore generally refers to the fertilization of ovules of one individual with pollen from another individual, whereas “selfing” refers to the fertilization of ovules of an individual with pollen from genetically the same individual.
  • '3 ⁇ 4ackcrossing means the process wherein the plant resulting from a cross between two parental lines is crossed with one of its parental lines, wherein the parental line used in the backcross is referred to as the recurrent parent. Repeated backcrossing results in the genome becoming more and more similar to the recurrent parent, as far as this can be achieved given the level of homo- or heterozygosity of said parent.
  • selfing is defined as refers to the process of self-fertilization wherein an individual is pollinated or fertilized with its own pollen.
  • recipient refers to the plant or plant line receiving the trait, introgression or genomic segment from a donor, and which recipient may or may not have the have trait, introgression or genomic segment itself either heterozygous or homozygous.
  • breeding line refers to a line of a cultivated tomato having commercially valuable or agronomically desirable characteristics, as opposed to wild varieties or landraces.
  • the breeding line is characterized either by lacking the 'smoky flavor' or by having the 'smoky flavor'.
  • the term includes reference to elite breeding line or elite line, which represents an essentially homozygous, e.g. inbred or doubled haploid, line of plants used to produce Fl hybrids.
  • hybrid means any offspring of a cross between two genetically unlike individuals, more preferably the term refers to the cross between two (elite) breeding lines which will not reproduce true to the parent from seed.
  • donor refers to the plant or plant line from which the trait, introgression or genomic segment originates, and which donor may have the trait, introgression or genomic segment itself either heterozygous or homozygous.
  • seed as used herein includes all tissues which result from the development of a fertilized plant egg; thus, it includes a matured ovule containing an embryo and stored nutrients, as well as the integument or integuments differentiated as the protective seed coat, or testa.
  • the nutrients in seed tissues may be stored in the endosperm or in the body of the embryo, notably in the cotyledons, or both.
  • growing refers to the growth of a plant, a process wherein the plant biomass is increased and which coincides with a progressive development of the plant.
  • identifying refers to a process of establishing the identity or distinguishing character of a plant, such as exhibiting a certain trait.
  • selecting refers to a process of picking out a certain individual from a group of individuals, usually based on a certain identity of that individual.
  • marker- assisted selection refers to the diagnostic process of identifying, optionally followed by selecting a plant from a group of plants using the presence of a molecular marker as the diagnostic characteristic or selection criterion. The process usually involves detecting the presence of a certain nucleic acid sequence or polymorphism in the genome of a plant.
  • marker as used herein means any indicator that is used in methods for inferring differences in characteristics of genomic sequences.
  • RFLP restriction fragment length polymorphism
  • AFLP amplified fragment length polymorphism
  • SNPs single nucleotide polymorphisms
  • SSRs sequence-characterized amplified regions
  • SCARs sequence-characterized amplified regions
  • CAS cleaved amplified polymorphic sequence
  • linked refers to a marker the presence of which in the genome of the plant coincides with the presence of the trait.
  • the term refers to a genetic marker that falls within the physical boundaries of a genomic region spanned by at least two markers having established LOD scores above a certain threshold thereby indicating that no or very little recombination between these markers and the trait locus occurs in crosses; as well as any marker in linkage disequilibrium to the trait locus; as well as markers that represent the actual causal mutations within the trait locus.
  • the term “linked” is used in its broadest sense and indicates that the marker and the gene are located within a continuous DNA sequence of several centiMorgan.
  • the term is used herein with reference to the linkage between markers and phenotype and refers to a distance of preferably less than 20 cM, preferably less than 10 cM, still more preferably less than 6, 5, 4, 3, 2, or 1 cM.
  • QTL is used herein in its art-recognised meaning.
  • QTL associated with pharmaceutical aroma as well as the term “QTL associated with smoke aroma/scent” refers to a region located on chromosome 9 of tomato that is associated with at least one gene that encodes for the PhP glycosyltransferase of the invention. The phenotypic expression of that gene may for instance be observed as a reduced smoky aroma.
  • the QTL of the present invention may be defined by indicating the genetic location in the genome using one or more molecular genomic markers. One or more markers, in turn, indicate a specific locus. Distances between loci are usually measured by frequency of crossing-over between loci on the same chromosome.
  • centimorgan is equal to 1% recombination between loci (markers).
  • gene means a hereditary unit (often indicated by a sequence of DNA) that occupies a specific location on a chromosome and that contains the genetic instruction for the presence or absence of a particular phenotypic
  • locus is defined as the genetic or physical position that a given gene occupies on a chromosome of a plant.
  • allele(s) means any of one or more alternative forms of a gene, all of which alleles relate to the presence or absence of a particular phenotypic trait or characteristic in a plant. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous
  • haplotypes i.e. an allele of a chromosomal segment
  • allele should be understood to comprise the term “haplotype”.
  • heterozygous as used herein, and confined to diploids, means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
  • homozygous is defined as a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
  • the term "nulliplex”, “simplex”, “duplex”, “triplex” and “quadruplex” is defined as a genetic condition existing when a specific allele at a corresponding locus on corresponding homologous chromosomes is present 0, 1, 2, 3 or 4 times, respectively.
  • the phenotypic effect associated with a recessive allele is only observed when the allele is present in quadruplex condition, whereas the phenotypic effect associated with a dominant allele is already observed when the allele is present in a simplex or higher condition.
  • prophysive allele as used herein is defined as an allele whose phenotypic effect is not expressed in an individual organism which genotype is heterozygous for the allele, but is only expressed in an individual organism which genotype is homozygous or quadruplex for the recessive allele.
  • dominant allele is defined as an allele whose phenotypic effect is expressed in an individual organism due to the presence of at least one copy, irrespective of the zygosity of the plant. .
  • haploid diploid
  • tetraploid as used herein are defined as having respectively one, two and four pairs of each chromosome in each cell (excluding reproductive cells).
  • polymorphism is defined as an allelic variant that occurs in a population.
  • the polymorphism can be a single nucleotide difference present at a locus, or can be an insertion or deletion of one or a few nucleotides such as an indel, or the insertion of a large stretch of nucleotides such as a transposons insertion.
  • SNP single nucleotide polymorphism
  • a single nucleotide polymorphism is characterized by the presence in a population of at least two, of the four nucleotides (i. e., adenosine, cytosine, guanosine or thymidine) at a particular homologous position or locus in a genome such as the potato genome.
  • haplotype means a combination of alleles at multiple loci that are transmitted together on the same chromosome. This includes haplotypes referring to as few as two loci, and haplotypes referring to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci. It also includes a set of polymorphisms on a single chromatid that are statistically associated with each other.
  • the term "infer” or “inferring, means drawing a conclusion about the presence of the PhP glycosyltransferase in a plant or part thereof using a process of analyzing a nucleic acid sample of the plant or part thereof, or phenotypical examination.
  • recombinant refers to a plant carrying a foreign (donor) gene combined, in whole or in part, in recipient genome.
  • introduction refers to both a natural and artificial process of crossing, and the resulting events, whereby genes of one species, variety or cultivar are moved into the genome of another species, variety or cultivar, by crossing those species.
  • the process may optionally be completed by backcrossing to the recurrent parent.
  • primer refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH.
  • the (amplification) primer is preferably single stranded for maximum efficiency in amplification.
  • the primer is an oligodeoxyribonucleotide.
  • primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization.
  • the exact lengths of the primers will depend on many factors, including temperature and source of primer.
  • a "pair of bi-directional primers" as used herein refers to one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
  • probe means a single- stranded oligonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a
  • stringency or “stringent hybridization conditions” refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence.
  • the terms as used include reference to conditions under which a probe or primer will hybridise to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher
  • Tm thermal melting point
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60°C for long probes or primers (e.g. greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary low stringent conditions or "conditions of reduced stringency" include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37°C and a wash in 2x SSC at 40°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in O.lx SSC at 60°C.
  • Hybridization procedures are well known in the art and are described in e.g. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,Seidman, J.G., Smith, J.A., Struhl, K. eds. (1998) Current protocols in molecular biology. V.B. Chanda, series ed. New York: John Wiley & Sons.
  • Recombinant DNA technology refers to procedures used to join together DNA sequences as described, for example, in Sambrook et al., 1989, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Coding sequence refers to a nucleotide (DNA or RNA) sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i. e., lacking an intron, such as in a cDNA or it may include one or more introns bound by appropriate splice junctions.
  • An "intron” is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein. Also the DNA coding for said sequence of RNA is designated as "intron”.
  • “Exons” are the coding parts of the DNA or RNA sequence, which are separated from each other by introns. “Expression” refers to the transcription and/or translation of an endogenous gene or a transgene in plants. In the case of antisense constructs, for example, expression may refer to the transcription of the antisense DNA only.
  • Polynucleotide construct as used herein means a nucleotide sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is optionally operably linked to 3' sequences, such as 3' regulatory sequences or termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
  • the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA that, in the sense or antisense direction or as a double- stranded sequence, inhibits expression of a particular gene, e. g.
  • the polynucleotide construct comprising the nucleotide sequence of interest may be chimeric, meaning that the nucleotide sequence is comprised of more than one DNA sequences of distinct origin which are fused together by recombinant DNA techniques resulting in a nucleotide sequence which does not occur naturally, and which particularly does not occur in the plant to be transformed.
  • the polynucleotide construct may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • the polynucleotide construct is heterologous with respect to the host, i.e., the particular DNA sequence of the polynucleotide construct does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event.
  • the expression of the nucleotide sequence in the polynucleotide construct may be under the control of a constitutive or tissue-specific promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus.
  • the promoter can also be specific to a particular tissue or organ or stage of development.
  • polynucleotide construct is usually inserted into the nuclear genome of a plant and is capable of directing the expression of a particular nucleotide sequence from the nuclear genome of said plant.
  • Gene refers to a coding sequence and associated regulatory sequences wherein the coding sequence is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA.
  • regulatory sequences are promoter sequences, 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
  • Heterologous as used herein means of different natural or of synthetic origin. For example, if a host cell is transformed with a nucleic acid sequence that does not occur in the untransformed host cell, that nucleic acid sequence is said to be heterologous with respect to the host cell.
  • the transforming nucleic acid may comprise a heterologous promoter, heterologous coding sequence, or heterologous termination sequence.
  • the nucleic acid which is introduced into a plant (cell) may be completely heterologous or may comprise any possible combination of heterologous and endogenous nucleic acid sequences.
  • heterologous refers to a nucleotide sequence derived from and inserted into the same natural, original cell type, but which is present in a non-natural state, e. g. a different copy number, or under the control of different regulatory elements.
  • a regulatory DNA sequence is said to be "operably linked to” or “associated with” a DNA sequence that codes for an RNA or a protein if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence.
  • Regulator elements refer to sequences involved in conferring the expression of a nucleotide sequence.
  • Regulator elements comprise a promoter operably linked to the nucleotide sequence of interest and, optionally, 3' sequences, such as 3' regulatory sequences or termination signals. They also typically encompass sequences required for proper translation of the nucleotide sequence.
  • Promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper
  • Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter” also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an “enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter.
  • promoter is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter.
  • enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • the "initiation site” is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i. e., further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5'direction) are denominated negative.
  • Constant expression refers to expression using a constitutive promoter.
  • Constant promoter refers to a promoter that is able to express the open reading frame (ORF) that it controls in all or nearly all of the plant tissues during all or nearly all developmental stages of the plant.
  • ORF open reading frame
  • open reading frame and “ORF” refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
  • initiation codon and “termination codon” refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
  • Regular promoter refers to promoters that direct gene expression not constitutively, but in a temporally- and/or spatially-regulated manner, and includes both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences. Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered, numerous examples may be found in the compilation by Okamuro, J.K. and Goldberg, R.B. (1989) Chapter 1, "Regulation of Plant Gene Expression: General Principles" in Stumpf, P.K. and Conn, E.E. Eds., The
  • tissue-specific promoter refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as roots, stems, leaves or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells).
  • “Overexpression” or “Overproduction” refers to a level of expression or production of a protein or metabolite which exceeds the demand and may lead to accumulation and storage.
  • 'Transformation refers to introduction of a nucleic acid into a cell and in particular, the stable integration of a DNA molecule into the genome of an organism of interest.
  • 'Smoky flavor', 'smoky scent' or 'pharmaceutical flavor' is a trait that occurs in tomato plants, more particularly in tomato fruits, which is caused by the presence of phenylpropanoid volatile compounds, in particular guiacol, MeSA (the methyl ester of salicylic acid) and eugenol, which are released when the fruits are eaten or otherwise prepared.
  • the 'smoky' flavour in tomatoes is produced by cleavage of the glycosidically bound volatile precursors through glycosidases liberated or activated upon disruption of cellular components when cells become stressed or damaged (Mizutani, M. et al., 2002, Plant Physiol. 130:2164-2176).
  • the 'triglycosidically' bound volatile precursors showed to be resistant to hydrolysis upon fruit tissue disruption.
  • the conversion from a diglycoside into a (malonyl)triglycoside seems to prevent the glycosidic bonding being cleaved by endogenous enzymes.
  • the inventors now have identified the gene that is responsible for the conversion from diglycosides to triglycosides. It appears to be a glycosyltransferase (GTase) which transfers a nucleotide diphosphate-activated sugar moiety to an aglycone or an already exisition sugar group.
  • GTase glycosyltransferase
  • Many GTases were already described in plants and orthologous enzymes thereof in tomato could be potential candidates for this target gene.
  • glycosyltransferase that is present on this QTL on chromosome 9 is responsible for the conversion of diglycosides to triglycoside complexes of the PhP volatile compounds. It appears that the complete sequence encoding this GTase has not been publicly available, neither as part of the tomato genome sequence, nor in any EST or other database.
  • the gene has two alleles, one (also indicated as the NSGT1- allele) that codes for the active enzyme (and which is responsible for the smoky phenotype) and one allele (NSGT1+) allele which differs from the NSGT1- allele in its promoter region and its 5' aminoterminal region.
  • SEQ ID NO:2 has the following sequence:
  • SEQ ID NO:l has the following DNA sequence:
  • GTase proteins which are at least 70% identical to the GTase protein of SEQ ID NO:2, but more preferably more than 80% identical, more preferably more than 90% identical and most preferably more than 95%, 96%, 97%, 98%, or 99% identical to said GTase protein and which are also capable of the conversion of diglycosides to triglycoside complexes of the PhP volatile compounds.
  • the BLAST algorithm can be used (Nucl. Acids Res., 1997, 25, 3389-3402) using default parameters or, alternatively, the GAP algorithm (J. Mol.
  • 'sequence identity' or 'identity' or 'homology' in the context of two protein sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window.
  • the portion of the amino acid sequence or nucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence for optimal alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which the identical amino acid or nucleic acid base residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity.
  • a conservative substitution is given a score between 0 and 1.
  • the scoring of conservative substitutions is calculated, e.g. according to the algorithm of Meyers and Miller (Computer Applic. Biol. Sci., 1998, 4, 11-17).
  • Glycosyltransferases consist of two important domains: (i) amino acid residues in the N-terminal part are responsible for recognition and binding acceptor molecules (molecules that sugar moieties are transferred to) and (ii) the C-terminal region comprises regions where the donor sugars bind to.
  • nucleotide sequences will need to be expressed in the plant(s) into which they are transformed.
  • a genetic construct expression cassette
  • the expression of the nucleotide sequence depends on the operational elements contained in such a construct, such as a promoter, a terminator, and enhancing elements.
  • any heterologous promoter region can be used as long as it is functional in the host cell where expression is desired.
  • the heterologous promoter can be either constitutive, tissue or developmental specific or regulatable.
  • a constitutive promoter such as the CaMV 35S promoter or T-DNA promoters, all well known to the person skilled in the art, are promoters, which are subjected to substantially no regulation such as induction or repression, but which allow for a steady and substantially unchanged transcription of the DNA sequence to which it is functionally bound in all or most of the active cells of the organism provided that other requirements for the transcription to take place are fulfilled.
  • a tissue-specific promoter is a promoter, which restricts the expression of the coding sequence to a limited part of the plant, i.e.
  • a regulatable or inducible promoter is a promoter of which the function is regulated by one or more factors, either internally present or externally added (Trends in Biot., 2005, 23, 283-290).
  • a factor may bind specifically to an inducible promoter to activate transcription, said factor being present in an inactive form and convertible (either directly or indirectly) to an active form by the inducer.
  • the inducer may be a chemical/biochemical agent, such as a protein, metabolite (sugar, alcohol, etc.) a growth regulator, a herbicide, or a phenolic compound.
  • the inducer may be a directly imposed physiological stress (for example, heat, salt, wounding, toxic elements, etc.) or an indirectly imposed physiological stress (for example, the action of a pathogen or disease agent, such as a virus).
  • a plant cell containing an inducible promoter may be exposed to an inducer by external application of the inducer to the cell such as by spraying, watering, heating, or similar methods.
  • inducible promoters include the inducible 70 kD heat shock promoter of Drosophila melanogaster (Ann. Rev. Genet., 1985, 19, 297-323) and the alcohol dehydrogenase promoter which is induced by ethanol (Nagao, R.T.
  • a terminator is a short piece of DNA that serves to terminate the transcription of the DNA into RNA and is preferably selected from the group consisting of plant transcription terminator sequences, bacterial transcription terminator sequences and plant virus terminator sequences known to those skilled in the art.
  • Enhancing elements such as the 35S enhancer and other elements like scaffold attachment regions (SARs) can be used to increase expression of the genes of the invention. It is also possible to boost expression by introducing an intron (e.g. the Adh-intron) in the open reading frame or to use viral enhancer sequences.
  • an intron e.g. the Adh-intron
  • an expression cassette usually further comprises a transcriptional termination region located downstream of the open reading frame, allowing transcription to terminate and polyadenylation of the primary transcript to occur.
  • the codon usage may be adapted to accepted codon usage of the host of choice.
  • the open reading frame In order for the open reading frame to be maintained in a host cell it will usually be provided in the form of a replicon comprising said open reading frame according to the invention linked to DNA, which is recognised and replicated by the chosen host cell. Accordingly, the selection of the replicon is determined largely by the host cell of choice. Such principles as govern the selection of suitable replicons for a particular chosen host are well within the realm of the ordinary skilled person in the art.
  • a special type of replicon is one capable of transferring itself, or a part thereof, to another host cell, such as a plant cell, thereby co-transferring the open reading frame according to the invention to said plant cell.
  • Replicons with such capability are herein referred to as vectors.
  • An example of such vector is a Ti-plasmid vector, which, when present in a suitable host, such as Agrobacterium tumefaciens, is capable of transferring part of itself, the so-called T-region, to a plant cell.
  • Ti-plasmid vectors are now routinely being used to transfer DNA sequences into plant cells, or protoplasts, from which new plants may be generated which stably incorporate said DNA in their genomes.
  • a particularly preferred form of Ti-plasmid vectors are the so-called binary vectors (as claimed in EP 0 120 516 Bl and US 4,940,838) such as pGreen (Hellens, R.P. et al., 2000, Plant mol. Biol. 42:819-832).
  • Other suitable vectors which may be used to introduce DNA according to the invention into a plant host, may be selected from the viral vectors, e.g.
  • non-integrative plant viral vectors such as derivable from the double stranded plant viruses (e.g. CaMV) and single stranded viruses, Gemini viruses and the like.
  • CaMV double stranded plant viruses
  • the use of such vectors may be advantageous, particularly when it is difficult to stably transform the plant host. Such may be the case with woody species, especially trees and vines.
  • host cells incorporating a DNA sequence according to the invention in their genome shall mean to comprise cells, as well as multicellular organisms comprising such cells, or essentially consisting of such cells, which stably incorporate said DNA into their genome thereby maintaining the DNA, and preferably transmitting a copy of such DNA to progeny cells, be it through mitosis or meiosis.
  • plants are provided, which essentially consists of cells that incorporate one or more copies of said DNA into their genome, and which are capable of transmitting a copy or copies to their progeny, preferably in a Mendelian fashion.
  • Inhibition of the above mentioned genes is preferably accomplished by providing a plant with a construct which is able to express an inhibiting compound in the seed.
  • Inhibition of gene expression refers to the absence (or observable decrease) in the level of protein and/or mRNA product from a target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of outward properties of the cell or the organism (in the specific case of the invention, the inability to germinate or sprout) or by biochemical techniques such as RNA solution
  • the nucleotide sequence coding for the GTase protein, or at least a part thereof of 40 nucleotides or more is put behind a constitutive or fruit- specific promoter in anti-sense direction. After transcription of this nucleotide sequence an mRNA is produced which is complementary to the mRNA formed through transcription of the endogenous GTase. It is well proven by now that production of such an anti-sense mRNA is capable of inhibition of the endogenous expression of the gene for which it is complementary. Furthermore, it has been proven that to achieve this effect even sequences with a less than 100% homology are useful. Also antisense mRNA's which are shorter than the endogenous mRNA which they should inhibit can be used.
  • sense co- suppression This phenomenon occurs when the gene encoding the GTase protein or part of said gene is expressed in its sense direction. Although this kind of expression when full length genes are used most often results in overexpression of the gene, it has been found that in some cases and especially in cases when a sequence shorter than the full length sequence is used, expression of this gene or fragment causes inhibition of the endogenous gene.
  • the principal patent reference on sense co-suppression is EP 465,572 in the name of DNA Plant Technology Inc.
  • Sense and antisense gene regulation is reviewed by Bird and Ray (Gen. Eng. Reviews 9: 207-221, 1991). Gene silencing can thus be obtained by inserting into the genome of a target organism an extra copy of the target gene coding sequence which may comprise either the whole or part or be a truncated sequence and may be in sense or in antisense orientation. Additionally, intron sequences which are obtainable from the genomic gene sequence may be used in the construction of suppression vectors. There have also been reports of gene silencing being achieved within organisms of both the transgene and the endogenous gene where the only sequence identity is within the promoter regions.
  • RNAi RNAi technology
  • dsRNA intracellularly or added extracellularly is extremely capable of inhibiting translation of the mRNA into a protein. It is believed that this phenomenon works through the intermediate production of short stretches of dsRNA (with a length of 32 nucleotides).
  • a construct is made harbouring both a sense and an antisense nucleotide sequence (together also called an inverted repeat) of at least 40 nucleotides of which one is complementary to the endogenous gene which needs to be silenced.
  • the sense and antisense nucleotide sequences can be connected through a spacer nucleotide sequence of any length which allows for a fold back of the formed RNA so that a double stranded RNA is formed by the sense and antisense sequence.
  • the spacer then serves to form the hairpin loop connecting both sense and antisense sequence.
  • the order of the sense and antisense sequence is not important. It is also possible to combine more than one sense- antisense combination in one and the same construct. If the simple form is depicted as: prom— S— spac— AS— term, also the following constructs can be applied: prom - Si - spac - ASl - spac - S2 - spac - AS2 - term, or prom - S2 - spac - Si - spac - ASl - spac - AS2 - term.
  • the double stranded structure may be formed by two separate constructs coding for complementary RNA strands, where RNA duplex formation occurs in the cell.
  • these constructs look like: proml-Sl-terml and prom2-ASl-term2.
  • Proml and prom2 can be the same or different but should both be constitutive or fruit-specific promoters, terml and term2 can be the same or different. Both constructs can be introduced into the cell on the same vector, but can also be introduced using two different vectors.
  • RNA containing nucleotide sequences identical to a portion of the target gene are preferred for inhibition.
  • RNA sequences with insertions, deletions and single point mutations relative to the target sequence have also been found effective for inhibition.
  • sequences with a sequence identity of less than 100% may be used.
  • Sequence identity may be calculated by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Aanlysis Primer, Stockton Press, 1991, and references cited therein), for instance by using the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g. University of Wisconsin Computing Group).
  • the duplex region of the RNA may be defined functionally as a (double stranded) nucleotide sequence that is capable of hybridising with a portion of the target gene transcript (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C to 65°C hybridization for 12-16 hours; followed by washing).
  • a portion of the target gene transcript e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C to 65°C hybridization for 12-16 hours; followed by washing.
  • the length of the identical nucleotide sequences should be at least 40 nucleotides, but preferably larger: 50, 100, 200, 300 or 400 bases.
  • constructs having a nucleotide sequence under control of a fruit-specific promoter wherein said nucleotide sequence comprises a part of 40 or more nucleotides in a sense direction, or in an antisense direction or in an inverted repeat form, of the sequence of SEQ ID NO:l or sequences that are more than 70%, preferably more than 80%, more than 90%, more than 95% or more than 98% identical therewith.
  • the recombinant DNA constructs for use in the methods according to the present invention may be constructed using recombinant DNA technology well known to persons skilled in the art.
  • the recombinant gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene product in the transformed cells.
  • vectors which may be commercially available, suitable for transforming into plants and suitable for expression of the gene product in the transformed cells.
  • binary vectors which are useful for plant transformation using
  • Agrobacterium This invention could also provide a way to induce 'smoky flavor' through gene knockout of the abovementioned GTase gene using T-DNA insertion, point mutation and deletion.
  • Such a mutation in the genotype can be caused in several ways, but one preferred way to accomplish a mutation is by TILLING (CM. McCallum, L. Comai, E.A. Greene and S. Henikoff (2000), Plant Physiology 123:439-442).
  • the allele encoding for the active GTase of the invention is a dominant allele, care should be taken to knock-out all the allelic variants of the gene: if much residual GTase activity is left, the tomato will not have the complete 'smoky flavour' phenotype..
  • Transformation of plant species is now routine especially for tomato plants.
  • any transformation method may be used to introduce chimeric DNA according to the invention into a suitable ancestor cell, as long as the cells are capable of being regenerated into whole plants.
  • a preferred method according to the invention comprises Agrobacterium-mediated DNA transfer.
  • Especially preferred is the use of the so-called binary vector technology as disclosed in EP A 120 516 and U.S. Patent 4,940,838.
  • Another method for introducing an expression vector into a plant is based on microprojectile-mediated transformation (particle bombardment) wherein DNA is carried on the surface of microprojectiles.
  • the expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate plant cell walls and membranes.
  • Another method for introducing DNA to plants is via the sonication of target cells.
  • liposome or spheroplast fusion has been used to introduce expression vectors into plants.
  • Direct uptake of DNA into protoplasts using CaCl 2 precipitation, polyvinyl alcohol or poly-L-ornithine has also been reported. Electroporation of protoplasts and whole cells and tissues has also been described.
  • BACs wherein parts of the tomato genome are introduced into bacterial artificial chromosomes (BACs), i.e. vectors used to clone DNA fragments (100- to 300-kb insert size; average, 150 kb) in Escherichia coli cells, based on naturally occurring F-factor plasmid found in the bacterium E. coli may for instance be employed in combination with the BIBAC system to produce transgenic plants. Transformation can be facilitated by the use of selectable or screenable markers to discriminate between transformed plants or plant cells and non-transformed plants or plant cells. However, possibly so-called marker-free transformation protocols, such as for instance described in WO 01/29240, WO 02/097102 and WO 03/010319, can be used.
  • selectable markers which are encoded by plant expressible genes co-transferred with the nucleic acid sequence according to the invention, where after the transformed material is regenerated into a whole plant.
  • Genes which can be used as selectable marker genes can be roughly divided in antibiotic resistance marker genes, such as nptll (giving resistance to kanamycin) and hpt (giving resistance to phosphonotricin), and developmental or metabolic selection marker genes, such as the trehalase gene, the mannose gene (both metabolic markers) and the IPT gene.
  • putatively transformed plants may be evaluated, for instance using Southern analysis, for the presence of the DNA coding for a regulatory gene, copy number and/or genomic organization. After the initial analysis, transformed plants showing the desired copy number and expression level of the newly introduced DNA according to the invention may be tested for increased expression of health-promoting substances.
  • the transformed plants may be grown directly, but usually they may be used as parental lines in the breeding of new (inbred) varieties or in the creation of hybrids and the like.
  • plants including plant varieties, with increased production and content of health-promoting substances may be grown in the field, in the greenhouse, or at home or elsewhere.
  • Plants or edible parts thereof are preferably used for animal feed or human consumption, or they may be processed for food, feed or other purposes in any form of agriculture or industry.
  • Plant breeders and in particular seed companies employ elite breeding lines, generally referred to as "elite lines” to provide a constant quality product.
  • the elite lines are the result of many years of inbreeding and combine multiple superior characteristics such as high yield, fruit quality, and resistance to pests, disease, or tolerance to abiotic stress.
  • the average yield of these elite lines is generally much higher than the original wild (landrace) accessions from which many of the modern tomato varieties are descendants.
  • the elite lines can be used directly as crop plant, but are typically used to produce so-called Fl or single-cross hybrids, produced by a cross between two (homozygous or inbred) elite lines.
  • the Fl hybrids thus combine the genetic properties of the two parents into a single plant.
  • An add-on benefit of hybrids is that they express hybrid vigour or heterosis, the poorly understood phenomenon that hybrid plants grow better than either (inbred) parent and show higher yields.
  • Backcross or pedigree selection is one method by which breeders add desirable agronomic traits to their elite breeding lines. The method involves crossing the breeding line with a line that expresses the desirable trait followed by
  • Recurrent selection is an alternative breeding method for improving breeding lines and involves systematic testing and selection of desirable progeny followed by recombination of the selected individuals to form a new population. Recurrent selection has proven effective for improving quantitative traits in crop plants.
  • Recurrent selection decreases the rate of broadening genetic basis underlying the various traits in a breeding program, and its potential is therefore limited.
  • the present invention makes it possible to create tomato plants having the desired phenotype (either having or not having the 'smoky flavor') by marker assisted breeding techniques.
  • Markers for the GTase gene of the invention can be derived from the nucleic acid sequence encoding the protein of the invention by taking any sequence or complementary sequence that can be used as a probe for identifying the gene. It is also possible to choose markers that lie outside the coding sequence, but are sufficiently close to not be disturbed by cross-over events. In general, every marker that lies within a distance of less than 5 cM - can be used. Publicly available markers spanning a 2.5 cM interval around the putative glycosyltransferase ORF403908 are listed in Table 1. These markers are potential candidates to use for marker- assisted breeding with respect to the presence or absence of 'smoky' flavor.
  • a preferred primer pair for marker C2_Atlg07310 is forward primer:
  • the sequence that makes up marker T1190 is:
  • Preferred primer sets for this marker is forward primer:
  • GCGTTCTCGTTACTGGTGCT and reverse primer GTTGCATGGTTGACATCAGG.
  • FIG. 10 shows the differences in the nucleotide sequences of these alleles as indicated by light background colouring. As can be seen the major differences reside in the 5' region of the coding sequence.
  • a preferred marker to distinguish between both alleles is a marker that can be used in pyrosequencing.
  • a marker for this was developed, which looks as follows:
  • the 3' primer is specific for NSGT1.
  • the amplification product of 639 bp can be used for pyrosequencing with the 5'primer.
  • NSGT1+ will have a C following the 5'primer, whereas the NSGT1- allele gives a T.
  • nucleotide sequence can be used as a marker.
  • Any suitable method for screening the nucleic acids for the presence or absence of polymorphisms is considered to be part of the instant invention. Such methods include, but are not limited to: DNA sequencing, restriction fragment length polymorphism (RFLP) analysis, amplified fragment length polymorphism (AFLP) analysis; heteroduplex analysis, single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), real time PCR analysis (e.g.
  • CFLP cleavase fragment length polymorphism
  • SCAR sequence-characterized amplified region
  • CAS cleaved amplified polymorphic sequence
  • nucleic acid probes for the detection of specific DNA sequences is well known in the art. Usually these procedures comprise the hybridization of the target DNA with the probe followed by post-hybridization washings. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal.
  • Tm 81.5 °C + 16.6 (log M) + 0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
  • Tm is reduced by about 1°C for each 1 % of mismatching; thus, the hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with > 90% identity are sought, the Tm can be decreased 10°C.
  • stringent conditions are selected to be about 5 C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH.
  • primers and probes useful for the detection of polymorphic positions in a nucleic acid are within the realm of ordinary skill (see for instance Sambrook, J., Russell D.W., Sambrook, J. (2001) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
  • nucleic acid amplification techniques allow the amplification of fragments of nucleic acids, which may be present in very low amounts.
  • the SNP-specific sequences must be determined for which primers or probes may then be developed.
  • the nucleic acid may be isolated from any raw sample material, optionally reverse transcribed into cDNA and directly cloned and/or sequenced.
  • DNA and RNA isolation kits are commercially available from for instance QIAGEN GmbH, Hilden, Germany, or Roche Diagnostics, a division of F. Hoffmann-La Roche Ltd, Basel, Switzerland.
  • a sample useful for practicing a method of the invention can be any biological sample of a subject that contains nucleic acid molecules, including portions of the gene sequences to be examined, or corresponding encoded polypeptides, depending on the particular method.
  • the sample can be a cell, tissue or organ sample, or can be a sample of a biological fluid such as semen, saliva, blood, and the like.
  • a nucleic acid sample useful for practicing a method of the invention will depend, in part, on whether the SNPs of the haplotype to be identified are in coding regions or in non- coding regions.
  • the nucleic acid sample generally is a deoxyribonucleic acid (DNA) sample, particularly genomic DNA or an
  • RNA which includes unspliced mRNA precursor RNA molecules
  • a cDNA or amplification product thereof can be used.
  • the methods of the invention generally are exemplified with respect to a nucleic acid sample, it will be recognized that particular SNPs can be in coding regions of a gene and can result in polypeptides containing different amino acids at the positions corresponding to the SNPs due to non- degenerate codon changes. As such, in another aspect, the methods of the invention can be practiced using a sample containing polypeptides of the subject.
  • an SNP does not reside in a coding region, but still gives rises to changes in the encoded protein. This can for example be accomplished if the SNP lies in an intron and gives rise to a change in splicing of the mRNA, thereby introduction of an extra amino acid sequence or deletion of a part of the original amino acid sequence.
  • nucleic acid hybridization probes and/or nucleic acid amplification primers may be designed an used in a detection assay for detecting the presence of the one or more SNPs in a sample, and hence the presence of the specific allele/haplotype.
  • the DNA, or alternatively, the cDNA may be PCR amplified by using for instance Pfu and Taq DNA polymerases and amplification primers specific for the SNP DNA sequences. Also complete commercially available systems may be used for PCR (e.g. available from various suppliers such as Roche Diagnostics).
  • a suitable method may for instance include mixing into a suitable aqueous buffering system (e.g. a commercially available PCR buffer) a suitable amount of total DNA as a template (e.g. 1 to 5 g), a suitable amount (e.g. 10 pmol) of a pair of bi-directional a suitable aqueous buffering system (e.g. a commercially available PCR buffer) a suitable amount of total DNA as a template (e.g. 1 to 5 g), a suitable amount (e.g. 10 pmol) of a pair of bi-directional
  • amplification primers a suitable amount of dNTPs and the DNA polymerase, denaturing the nucleic acids by boiling for 1 min, and performing a cycling reaction of around 10-50 alternating cycles of stringent primer hybridization, strand elongation and denaturing, at suitable temperatures to obtain DNA copies of the DNA template as amplification product.
  • the amount of copies produced upon a certain number of cycles correlates directly to the amount of target DNA in the DNA template.
  • hybridization signal refers to the amount of amplification product produced upon a certain number of cycles and thus to the amount of target DNA available as template in the reaction.
  • NSGT2 NSGT2+ version contains a 38 bp deletion in its C-terminal part, leading to a frameshift and a premature stopcodon. Consequently this results in the loss of a functional UDP-glucose binding domain and hence an inactive glycosyltransferase.
  • a second SNP marker was found in the promoter region of the NSGT2 gene: an Spel site was present in the promoter of the NSGT2+ allele (see Figure 13), and not present in any of the other NSGT alleles found. Also this marker was used to screen the segregating population and confirmed the results obtained with the EcoRI SNP marker.
  • any sequence of any of the alleles of both NSGTl and NSGT2, and/or of the sequences surrounding these genes, as long as they enable discrimination of the + and— alleles could be useful as a marker.
  • a marker can be a primer that is located near a polymorphism in the alleles (such as a change in one or more nucleotides, or a deletion/insertion) which is used - in conjunction with another primer - to amplify the part of the allele containing the polymorphism, after which the polymorphism is detected on the amplified sequences.
  • the primer itself generally will be a sequence that recognizes any allele of NSGTl and/or NSGT2, and the primer thus can be a sequence of any of these alleles that can serve as a primer sequence in amplification reactions, i.e. having a length of at least 15 nucleotides, more preferably about 18-25 nucleotides.
  • additional techniques well known to a person skilled in the art, are required to detect the polymorphism in the amplified band, such as sequence analysis, pyrosequencing, melting curve analysis of a resttiction digestion.
  • the primer itself may be discriminatory, when it overlaps with the polymorphism and therefore differentially binds to and amplifies a specific allele.
  • a first method would comprise introgressing the trait from a tomato plant exhibiting the trait, into a plant of a tomato line of interest. This may for instance be achieved by crossing a plant of a recipient breeding line of S. lycopersicum capable of producing commercially valuable fruits, with a plant of a donor line of a tomato species, having the desired trait. This will result in a situation wherein the DNA harbouring the genetic basis for the trait is in the genetic background of the tomato line of interest. The establishment of the proper introgression in offspring plants may be monitored by using specific markers as defined herein.
  • Recombination is the exchange of information between two homologous chromosomes during meiosis.
  • DNA that is originally present on a specific location within the chromosome is exchanged for DNA from another plant (i.e. maternal for paternal or vice versa).
  • DNA from another plant i.e. maternal for paternal or vice versa.
  • the normal way to find such a recombinant is to screen a population of F2-plants. This population must be of sufficient size in order to detect the rare (low frequency) double recombinants.
  • the frequency of recombination can be expressed in a genetic distance.
  • a single recombinant in a 10 cM area can be found with a frequency of 10% (1 centimorgan is defined as 1% recombinant progeny in a testcross).
  • the non- smoky trait requires the presence of only one (allelic) copy of the GTase gene, since this is a genetically dominant trait. However, for the presence of the smoky trait all alleles harbouring the GTase gene need to be deleted.
  • the present invention also provides methods of producing the plants of the invention using marker assisted selection (MAS).
  • MAS marker assisted selection
  • the invention therefore relates to methods of plant breeding and to methods to select plants, in particular tomato plants, particularly cultivated tomato plants as breeder plants for use in breeding programs or cultivated tomato plants for having desired genotypic or potential phenotypic properties, in particular related to producing quantities of valuable tomato fruits, also referred herein to as agronomically desirable plants.
  • a cultivated plant is defined as a plant being purposely selected or having been derived from a plant having been purposely selected in agricultural or horticultural practice for having desired genotypic or potential phenotypic properties, in particular a plant obtained by inbreeding.
  • the gene can only be properly identified phenotypically when the plant carries fruits that either have or do not the 'smoky flavor', it is of particular advantage that the establishment of the proper introgression in offspring plants may be monitored by using the gene-specific markers as provided herein, either in cis or in trans coupling as explained below.
  • MAS marker assisted selection
  • MAB marker assisted breeding
  • the present invention thus also provides methods for selecting a tomato plant exhibiting the presence or absence of 'smoky flavor', comprising detecting in said plant the presence or absence of a gene encoding a functional GTase as defined herein.
  • the method comprises:
  • the step of providing a sample of genomic DNA from a tomato plant may be performed by standard DNA isolation methods well known in the art.
  • the step of detecting a molecular marker may, in a preferred embodiment, comprise the use of CAPS markers, which constitute a set of bidirectional primers in combination with a restriction enzyme. This allows for the detection of specific SNPs linked to the trait. Bi-directional means that the orientation of the primers is such that one functions as the forward and one as the reverse primer in an amplification reaction of nucleic acid.
  • the step of detecting a molecular marker may in another preferred embodiment, comprise the use of a nucleic acid probe having a base sequence which is substantially complementary to the nucleic acid sequence defining said molecular marker (e.g.
  • nucleic acid probe specifically hybridizes under stringent conditions with a nucleic acid sequence defining said molecular marker.
  • a suitable nucleic acid probe may for instance be a single strand oligonucleotide of the amplification product corresponding to the marker.
  • the step of detecting a molecular marker may also comprise the performance of a unique nucleic acid amplification reaction on said genomic DNA to detect said gene. This can suitable be done by performing a PCR reaction using a pair of marker-specific primers based on the internal or adjacent (up to 500 kilo base) sequence.
  • said step b) comprises the use of at least one pair of primers defining a marker for said gene (e.g. being complementary to said marker or hybridizing specifically to said marker or allowing polymerase chain extension to occur when bound to said marker), or a pair of primers which specifically hybridize under stringent conditions with the nucleic acid sequence of a marker for said gene.
  • the step of detecting an amplified DNA fragment having a certain predicted length or a certain predicted nucleic acid sequence may be performed such that the amplified DNA fragment has a length that corresponds (plus or minus a few bases, e.g. a length of one, two or three bases more or less) to the expected length as based on the nucleotide sequence of the genes and markers identified herein.
  • trans-markers markers that are absent in plants having the introgression as defined herein (donor plants), while they are present in the plants receiving the introgression (recipient plants) (so-called trans-markers), may also be useful in assays for detecting the introgression among offspring plants, although detecting the presence of a specific introgression is not optimally demonstrated by the absence of a marker.
  • the step of detecting an amplified DNA fragment having the predicted length or the predicted nucleic acid sequence may be performed by standard gel- electrophoresis techniques, real time PCR, or by using DNA sequencers. The methods need not be described here as they are well known to the skilled person. It should be noted that a marker is usually defined based on its nucleotide sequences in combination with its position relative to other markers on a linkage map.
  • Molecular markers are used for the visualisation of differences in nucleic acid sequences. This visualisation is possible due to DNA-DNA hybridisation techniques after digestion with a restriction enzyme (RFLP) and/or due to techniques using the polymerase chain reaction (e.g. STS, microsatellites, AFLP). All differences between two parental genotypes will segregate in a mapping population (e.g., BCi, F2) based on the cross of these parental genotypes. The segregation of the different markers may be compared and recombination frequencies can be calculated. The recombination frequencies of molecular markers on different chromosomes is generally 50%.
  • the recombination frequency depends on the distance between the markers.
  • a low recombination frequency corresponds to a short genetic distance between markers on a chromosome. Comparing all recombination frequencies will result in the most logical order of the molecular markers on the chromosomes. This most logical order can be depicted in a linkage map. A group of adjacent or contiguous markers on the linkage map that is associated with tolerance to continuous light, pinpoints the position of a gene associated with tolerance to continuous light.
  • markers identified herein may be used in various aspects of the invention as will now be illustrated. Aspects of the invention are not limited to the use of the markers identified herein. It is stressed that the aspects may also make use of markers not explicitly disclosed herein or even yet to be identified.
  • Any marker that is linked to the gene e.g. falling within the physical boundaries of the genomic region spanned by the markers, wherein between said markers and the gene no or very little recombination occurs in crosses; as well as any marker in linkage disequilibrium to the gene; as well as markers that represent the actual causal mutations within the gene, may be used in MAS procedures.
  • markers identified herein are mere examples of markers suitable for use in MAS procedures.
  • the gene, or the specific trait- conferring part thereof is introgressed into another genetic background (i.e. into the genome of another plant line)
  • some markers may no longer be found in the offspring although the trait is present therein, indicating that such markers are outside the genomic region that represents the specific trait- conferring part of the gene in the original parent line only and that the new genetic background has a different genomic organisation.
  • detecting the presence of a gene of the invention is performed with at least one of the markers for a gene as defined herein.
  • the present invention therefore also relates to a method for detecting the presence of a gene for conferring 'smoky flavor' as defined herein in tomato by the use of the said markers.
  • the method may also comprise the steps of providing an oligonucleotide or polynucleotide capable of hybridizing under stringent hybridization conditions to a nucleic acid sequence of a marker linked to said gene, contacting said oligonucleotide or polynucleotide with nucleic acid of a tomato plant, and determining the presence of specific hybridization of said oligonucleotide or polynucleotide to said nucleic acid.
  • said method is performed on a nucleic acid sample obtained
  • the skilled person may, once the nucleotide sequence of the gene has been determined, design specific hybridization probes or oligonucleotides capable of hybridizing under stringent hybridization conditions to the nucleic acid sequence of said gene and may use such hybridization probes in methods for detecting the presence of a gene of the invention in a tomato plant.
  • protoplast fusion can be used for the transfer of nucleic acids from a donor plant to a recipient plant.
  • Protoplast fusion is an induced or spontaneous union, such as a somatic hybridization, between two or more protoplasts (cells of which the cell walls are removed by enzymatic treatment) to produce a single bi- or multi-nucleate cell.
  • the fused cell that may even be obtained with plant species that cannot be interbred in nature, is tissue cultured into a hybrid plant exhibiting the desirable combination of traits. More specifically, a first protoplast can be obtained from a tomato plant lacking 'smoky flavor'.
  • a second protoplast can be obtained from a second tomato plant variety, preferably a tomato line that comprises commercially valuable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc, but which has a 'smoky flavor' phenotype.
  • the protoplasts are then fused using traditional protoplast fusion procedures, which are known in the art.
  • embryo rescue may be employed in the transfer of a nucleic acid comprising the gene as described herein from a donor plant to a recipient plant.
  • Embryo rescue can be used as a procedure to isolate embryo's from crosses wherein plants fail to produce viable seed. In this process, the fertilized ovary or immature seed of a plant is tissue cultured to create new plants.
  • the present invention also relates to a method for providing a plant of a tomato breeding line with the presence of a gene encoding the GTase which prohibits 'smoky flavor', comprising the steps of:
  • step (b) selfing and/or backcrossing said progeny tomato plant selected in step (b) using said tomato breeding line as a recurrent parent;
  • step (c) selecting a progeny tomato plant resulting from the selfing or backcrossing in step (c) having an introgression from said second tomato line,
  • said first tomato breeding line is an elite line. It is submitted that if there is a desire to make an elite line having the 'smoky flavor' phenotype, the first breeding line in the method above will harbour the GTase gene of the invention, and the second tomato line will have a genotype in which no functional GTase gene will be expressed.
  • the marker- assisted selection procedure comprises the selection for at least one marker as exemplified herein.
  • the introgression of the nucleic acid sequence comprising the gene for GTase as described herein may suitably be accomplished by using traditional breeding techniques.
  • the gene is preferably introgressed into commercial tomato varieties by using marker- assisted selection (MAS) or marker- assisted breeding (MAB).
  • MAS and MAB involves the use of one or more of the molecular markers for the identification and selection of those offspring plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on selection of the gene of the present invention or markers associated therewith.
  • MAS can also be used to develop near-isogenic lines (NIL) harboring the gene of interest, or the generation of gene isogenic recombinants (QIRs), allowing a more detailed study of each gene effect and is also an effective method for
  • Tomato plants developed according to this embodiment can advantageously derive a majority of their traits from the recipient plant, and derive the absence of the 'smoky flavor' from the donor plant.
  • Crossing can be achieved by mechanically pollinating the female flower of one parent plant with pollen obtained from male flowers of another parent plant.
  • a donor tomato plant that exhibits the absence of 'smoky flavor' and comprising a nucleic acid sequence encoding for the GTase gene as defined herein is crossed with a recipient tomato plant (preferably a plant of an elite line) that exhibits agronomically desirable characteristics, such as, but not limited to, disease (e.g.
  • the resulting plant population (representing the Fi hybrids) is then self- pollinated and set seeds (F2 seeds).
  • the F2 plants grown from the F2 seeds are then screened for the absence of 'smoky flavor'.
  • the population can be screened in a number of different ways.
  • the population can be screened using a bioassay wherein the plant is grown until fruits are developed and they can be tested on the presence or absence of 'smoky flavor'.
  • marker-assisted selection can be performed using one or more of the hereinbefore-described molecular markers to identify those progeny that comprise a nucleic acid sequence encoding the GTase gene as defined herein. Other methods, described above by methods for detecting the presence of a gene may be used. Also, marker-assisted selection can be used to confirm the results obtained from the phenotype scores, and therefore, several methods may also be used in
  • Inbred tomato plant lines exhibiting presence or absence of 'smoky flavor' can be developed using the techniques of recurrent selection and backcrossing, selfing and/or dihaploids or any other technique used to make parental lines.
  • the 'non-smoky flavor'-conferring genetic element as disclosed herein can be introgressed into a target recipient plant (the recurrent parent) by crossing the recurrent parent with a first donor plant, which differs from the recurrent parent and is referred to herein as the "non-recurrent parent".
  • the recurrent parent is a plant of which the trait is to be improved and possesses agronomically desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the non-recurrent, or donor, parent may suitably be a plant of suitable donor line which comprises a nucleic acid sequence that encodes for the GTase gene that confers the absence of smoky flavor.
  • the donor parent can be any plant variety or inbred line that is cross -fertile with the recurrent parent and has acquired the gene for absence of smoky flavor in an earlier cross with a plant of the said donor line.
  • the progeny resulting from a cross between the recurrent parent and non-recurrent parent is backcrossed to the recurrent parent.
  • the resulting plant population is then screened for the desired characteristics, which screening may occur in a number of different ways. For instance, the population can be screened using phenotypic screens as described herein.
  • marker-assisted selection can be performed using one or more of the hereinbefore described molecular markers, hybridization probes or polynucleotides to identify progeny that comprise a nucleic acid sequence encoding the GTase gene responsible for het absence of smoky flavor.
  • the Fi hybrid plants that exhibit the desired phenotype and thus comprise the requisite nucleic acid sequence encoding for a gene conferring absence of smoky flavor are then selected and backcrossed to the recurrent parent for a number of generations in order to allow for the tomato plant to become increasingly elite.
  • This process can be performed for two to five or more, such as 6, 7 or 8 generations.
  • the progeny resulting from the process of crossing the recurrent parent with the non-recurrent parent are heterozygous for one or more genes that encode for absence of smoky flavor.
  • the recurrent parent is lacking, and should be provided with the trait 'smoky flavor'.
  • the non-recurrent parent could have a genetic background in which the GTase gene is lacking or mutated so that no functional enzyme is produced.
  • a method of introducing a desired trait into a hybrid tomato variety comprises the steps of:
  • the last backcross generation may be selfed in order to provide for homozygous pure breeding (inbred) progeny exhibiting absence of smoky flavor.
  • inbred pure breeding
  • the result of recurrent selection, backcrossing and selfing is the generation of lines that are genetically homozygous for the GTase gene as well as other genes associated with traits of commercial interest.
  • heterozygous plants having the GTase gene for absence of smoky flavor may also be of interest as intermediate products, and such plants are therefore also an aspect of the present invention.
  • the goal of plant breeding is to combine various desirable traits in a single variety or hybrid.
  • these traits may include resistance to diseases and insects, tolerance to heat and drought, reducing the time to crop maturity, greater yield, and better agronomic quality.
  • Uniformity of plant characteristics such as germination, growth rate, maturity, and plant height may also be of importance.
  • a plant is self-pollinated if pollen from one flower is transferred to the same or another flower of the same plant.
  • a plant is sibling mated when individuals within the same family or line are used for pollination.
  • a plant is cross -pollinated if the pollen comes from a flower on a different plant from a different family or line.
  • Plants that have been self-pollinated and selected for type for many generations become homozygous at almost all gene loci and produce a uniform population of true-bred progeny.
  • a cross between two different homozygous lines produces a uniform population of hybrid plants that may be heterozygous for many gene loci.
  • a cross of two plants each heterozygous at a number of gene loci will produce a population of heterogeneous plants that differ genetically and will not be uniform.
  • an inbred line should comprise homozygous alleles at about 80% or more of its loci.
  • Example 1 Identification of novel volatile glycoconjugates in tomato fruit. Red-ripe fruit material of a commercial tomato germplasm has been previously profiled for volatile and non-volatile metabolites (Tikunov, Y.M. et al., 2005, Plant Physiol. 139:1125-1137). Four cultivars that appeared to be the most contrasting in metabolic composition were selected and crossed according to a scheme depicted in Figure 1 (Crossing scheme):
  • R104 a round tomato, PhP volatiles bound as diglycosides, a high PhP-V emitter
  • ⁇ R075 a round tomato, PhP volatiles bound as diglycosides, a high PhP-V emitter
  • a segregating F2 population consisted of 6 sub-populations (according to individual crossings) was profiled again using LC-QTOF-MS method.
  • the analysis revealed that all the genotypes could be divided into two groups containing either phenylpropanoid volatile (PhP-V) hexose-pentosides (HP or diglycosides) or PhP-V malonyl-dihexose-pentosides (MdHP or triglycosides) ( Figure 1).
  • eugenol MdHP revealed a different behaviour compared to the expected co- segregation with guaiacol MdHP and methyl salicylate (MeSA) MdHP.
  • a comparative analysis of microarray gene composition with all public tomato genetic resources revealed that a significant portion of the genetic information is missing in the available microarrays. For example, only roughly 50% of all 550 predicted glycosyltransferase ESTs found in the tomato genetic resources were present on the design of the 23k Syngenta Affy Oligo Array used for analysis of PhP-V contrasting tomato materials. Besides that, a major part of genes in the databases have been derived from a rather limited set of model tomato genotypes, e.g.
  • the Illumina Digital Gene Expression (DGE) platform (http://www.illumina.com/applications.ilmn) is a high-throughput sequencing approach that provides an untargeted comprehensive gene expression analysis by sequencing a small (21 bp) tag at the 3'-end of each transcript. Counting up all tag reads that belong to the same transcript is measure for its quantitative expression.
  • DGE Illumina Digital Gene Expression
  • the RNA samples derived were subjected to DGE.
  • the DGE resulted in sequencing and detection of ⁇ 650,000 different tags.
  • the tag counts formed expression profiles of the samples.
  • a threshold of 6 tags per million was used to filter out artefacts present due to Solexa sequencing errors. This resulted in ⁇ 23,000 different tags selected for further analysis. These tags were subjected to annotation using the following genetic resources:
  • This region covers a large ( ⁇ 40cM, Tomato- Expen 2000 map: http://solgenomics.net/) region on the genetic map of chromosome 9. Any discrepancy between this and other mapsis likely due to mapping populations and types of genetic markers used.
  • ORFs were predicted to be encoded on these scaffolds, including 4 glycosyltransferases, 4 glycosyl hydrolases and 13 transcription factors.
  • ORF403908_1 The open reading frame ORF403908_1 consisted of only 122 amino acids suggesting that the sequence encoding the putative enzyme in the genomic sequence scaffold was not complete. The 5'-end of the ORF was likely missing due to termination of the scaffold's contigl8861.
  • RACE PCR experiments were performed on cDNA samples of low PhP-V fruit using primers presented in Table 3. This yielded a few fragments which were assembled ( Figure 6) and the assembly revealed an open reading frame encoding a 450-amino acid sequence:
  • the 450 amino acid protein obtained has been annotated by matching its sequence to protein sequences present in public tomato resources: Gene Index— LeGI12 tomato EST data base: http://compbio.dfci.harvard.edu/tgi/, SGN Unigene data base:
  • ORF403908 encoding the 450 amino acid sequence was not present in current releases of tomato genetic resources, although the hits that showed a moderate similarity to ORF403908 confirmed that it belongs to a family of glycosyltransferase genes.
  • the ORF403908 protein was further compared to the NCBI protein database: http://www.ncbi.nlm.nih.gov/. Conservative glycosyltransferase domains were identified in the protein sequences ( Figure 7). Amino acid residues involved in the conserved features, e.g. catalytic or binding sites are present in Table 4.
  • UDP-sugar binding site A major donor sugar binding feature (UDP-sugar binding site) is represented by a few conserved residues in the C-terminal part of the protein ( amino acids 275-450). Another probable UDP-sugar binding site is present in the N-terminal part of the protein, in the acceptor substrate binding pocket. This might indicate that GT ORF403908 recognizes and binds glycosides (e.g. PhP-V diglycosides) as acceptor molecules: it has to recognize and accommodate both a volatile compound and its sugar conjugate.
  • glycosides e.g. PhP-V diglycosides
  • glycosyltransierases with known function were found.
  • Examples are BAH80312.1 and BAH80313.1, glycosyltransierases of Catharanthus roseus. These genes are involved in plant secondary metabolite glycosylation and possess glycoside-glycosyltransferase activity, i.e. transferring additional sugar groups onto an existing sugar moiety of glycosides (Masada, S. et al., 2009). Some other proteins from this functional enzyme clade showed similarity to ORF403908 protein as well.
  • Example 3 Production of transgenic tomato plants overexpressing non- smoky GT (NSGT; SeqID no 1), leading to non-smoky fruit
  • a full length cDNA encoding tomato (Lycopersicon esculentum) NSGT ( Figure 6) was obtained from a cDNA library of low PhP tomato fruit, e.g. cv Aromata.
  • RNA-GT-5'BamHl GGATCCACTAAGCAGCAACAC
  • NSGT- 3 Sail GTCTCGTCGACATGGTCACCGTGGAGGA
  • the PCR product was digested and ligated as a BamHI / Sail fragment into pFLAP50, a pUC derived vector containing a fusion of the double CaMV 35S promoter (Pd35S) and the Agrobacterium tumefaciens nos terminator (Tnos).
  • the resulting plasmid was designated as pNSGTl (Fig. 8).
  • the Pd35S-NSGTl-Tnos construct was transferred as a Pacl/Ascl fragment into pBBC50, a derivative of the plasmid pGPTV-KAN and the final binary plasmid was designated pNSGT- 100 (Fig. 9)
  • the plasmid pPhPl is transferred to A. tumefaciens strain COR308 by the freeze-thaw method (Gynheung, et al, 1988, Binary vectors. In: Plant Molecular Biology Manual, S.B. Gelvin, R.A. Schilperoort, and D.P.S. Verma, eds (Dordrecht, The Netherlands: Kluwer Academic Publishers, pp. A3/1— A3/19).
  • the Agrobacterium mediated tomato (hypocotyls) transformation (cv. Money maker and or Microtom, both smoky tomato varieties) is performed according to the standard protocol (Fillati et al., 1987, Bio.Technol. 5, 726-730).
  • Kanamycin-resistant shoots are transferred to the greenhouse to grow on rock wool.
  • the transgenic status of the plants is confirmed by PCR specific for the introduced gene and by Southern blot hybridisation (DIG labeling, Roche). Plants are allowed to self-pollinate in order to give fruits and offspring.
  • GC-MS For further analysis (GC-MS, LC-MS, DNA and RNA) fruits are harvested at different ripening stages. From each plant at least three fruits are pooled for extraction to minimize sample variation. After harvest, fruits are cut into pieces, ground and immediately frozen in liquid nitrogen. Beside fruit material also young leaves are collected and frozen in liquid nitrogen to store at -80°C for later use.
  • methylsalicylate-, guaiacol- and eugenol glycosides are determined by LC- QTOF-MS, as described by Tikunov et al, 2010: 0.5 g frozen tomato fruit or leaf
  • HPLC system at 190 iL min ⁇ 1 and the gradient linearly increases from 5% to 35% eluent B over a 45 min period, followed by 15 min of washing and equilibration of the column.
  • the column, sample and room temperatures are kept at 40, 20 and 20°C, respectively.
  • Ionization is performed using an electrospray ionization (ESI) source and masses are detected in negative mode.
  • ESI electrospray ionization
  • a collision energy of 10 eV is used for full-scan LC-MS in the range of m/z 100-1500.
  • Leucine enkephalin, [M - H]- 554.2620, is used for on-line mass calibration (lock mass).
  • Volatile glycosides are detected based on their specific mass and retention time (Table 2).
  • Frozen fruit powder (1 g fresh weight) is weighed in a 5-ml screw-cap vial, closed and incubated at 30°C for 10 minutes.
  • An EDTA-NaOH water solution is prepared by adjusting o 100 mM EDTA to pH of 7.5 with NaOH. Then, 1 ml of the EDTA-NaOH solution is added to the sample to a final EDTA concentration of 50 mM. Solid CaCl2 is then immediately added t give a final concentration of 5 M.
  • the closed vials are then sonicated for 5 minutes. A 1 ml aliquot of the pulp is transferred into a 10-ml crimp cap vial (Waters), capped and used for SPME/GC/MS analysis.
  • the samples are automatically extracted and injected into the GC/MS via a Combi PAL autosampler (CTC Analytics AG).
  • Headspace volatiles are extractec by exposing a 65 ⁇ PDMS-DVB SPME fiber (Supelco) to the vial headspace for 20 minutes under continuous agitation and heating at 50°C.
  • the fiber is inserted into a GC 8000 (Fisons Instruments) injection port and volatiles are desorbed for 1 min at 250°C.
  • Chromatography ii performed on an HP-5 (50m X 0.32 mm X 1.05 ⁇ ) column with helium as carrier gas (37 kPa).
  • the GC interface and MS source temperatures are 260°C and 250°C, respectively.
  • the GC temperature program begins at 45°C (2 min), is then raised to 250°C at a rate of 5°C/min and is finally held at 250°C for 5 min.
  • the total run time including oven cooling is 60 min.
  • Mass spectra in the 35— 400 m/z range are recorded by an MD800 electron impact MS (Fisons Instruments) at a scanning speed of 2.8 scans/sec and an ionization energy of 70 eV.
  • the chromatography and spectral data are evaluated using "XcaliburTM" software
  • Total RNA is isolated from tomato fruits as described previously (Bovy et al., 1995).
  • RNA yield is measured by Absorption at 260 nm.
  • a small amount (1 ⁇ g) of each sample is evaluated on a 1% TAE agarose gel.
  • RT Real time quantitative
  • NSGT sequence (Table 3). Two ⁇ g total RNA is used for cDNA synthesis using
  • the expression of the NSGT gene is related to the constitutively expressed gene
  • transgenic plants In total 15 PCR-positive transgenic NSGT TO plants are used for a first biochemical analysis. Based on LC-MS analyses of leaf as well as fruit extracts, transgenic plants can be detected that show a clear increase in the levels of PhP-V triglycosides and a concommittant reduction in the respective volatile diglycosides. GC-MS analysis reveals that this is accompanied with a significant decrease in the levels of the corresponding volatiles released upon fruit blending.
  • NSGT1- Enzyme expression NSGT1- was subcloned into pACYCDUET- 1 using BamHI and Pstl restriction enzymes, and the insert was verified by sequencing.
  • the resulting plasmid, pAC- ORF403908 ( Figure 14) was transformed to E. coli BL21 DE3.
  • a fresh overnight culture was diluted 1:100 in 25 ml 2xYT medium with 30 ⁇ g/ml chloramphenicol, and incubated at 37°C and 250 rpm until an A600 of 0.4 was reached. Subsequently, IPTG was added to a concentration of 0.5 mM, and the incubation was continued overnight at 18°C and 250 rpm.
  • Methanolic extracts were prepared by the extraction of 40 g FW of red-ripe fruit material of a high PhP-V cultivar in 120 ml 100% methanol with 1 hour agitation at room temperature. The methanol was then removed from the supernatant in a vacuum rotary evaporator at 40°C and the glycoside residue was re- dissolved in 50 ml pure water. The extract was passed through a glass column (35 x 1 cm I.D.) packed with up to 20 cm Amberlite XAD-2 resin (Supelco Inc., Bellefonte, USA). The flow rate used was 2 mL min 1 .
  • the column was then rinsed with 50 mL water, followed by 50 mL hexane. Bound compounds were then eluted from the column using 50 ml methanol. Presence of diglycosides of guaiacol, methyl salicylate and eugenol was confirmed by a LC-MS analysis of the eluate. The methanol was then evaporated under vacuum at 40°C and dried glycoside material was stored at -80°C.
  • LC-QTOF- MS quadrupole time-of-flight mass spectrometry
  • Degassed eluent A (ultra pure water:formic acid (1000: l,v/v) ) and eluent B (acetonitril: formic acid (1000:l,v/v) ) were used at 0.19 ml. min- 1.
  • the gradient started at 5% B and increased linearly to 75% B in 45 min, after which the column was washed and equilibrated for 15 min before the next injection.
  • the injection volume was 5 ⁇ .
  • LC-MS analysis revealed following metabolic changes in the assay products derived from the E.coli culture expressing the NSGTl- allele compared to the empty vector control.
  • Guaiacol diglycoside (hexose-pentoside) (characteristic m/z 293, 417 and 463; Figure 15A), methyl salicylate diglycoside (m/z 293, 491; Figure 15B) and eugenol diglycoside (m/z 293, 457 and 503; Figure 15C) that are present in the control assays (pACYCDuet empty vector) were not detected in NSGTl- assays (ORF403908). In the NSGTl- assays three new glycosides were detected.
  • glycosides are: guaiacol triglycoside (hexose-hexose-pentoside) (characteristic m/z 579, 626; Figure 15A), methylsalicylate triglycoside (m/z 607, 653; Figure 15B) and eugenol triglycoside (m/z 619, 665). These triglycosides were not detected in the control assays nor in assays expressing the other four NSGT genes. No other new glycosides of guaiacol, methylsalycylate or eugenol were detected in the NSGTl- assays compared to the control assays. This suggested that the glycosyltransferase enzyme encoded by NSGTl- performed the complete conversion of the volatile diglycosides into corresponding triglycosides by adding an extra glucose onto existing disaccharide moiety.
  • PhP-V triglycosides guaiacol dihexose-pentoside, guaiacol malonyl dihexose-pentoside, methylsalicylate dihexose pentoside and methylsalicylate malonyl dihexose-pentoside ( Figure 16).
  • These triglycosides are typical for 'non-smoky' tomato fruits and are not observed in 'smoky' control fruits.
  • the large variation in the production of PhP-V triglycosides observed between fruits could be due to the localization and extent of Agrobacterium infection and slight differences in fruit ripening stage.

Abstract

La présente invention concerne une protéine et/ou un acide nucléique codant pour une telle protéine qui est responsable du manque chez la tomate du phénotype de goût fumé du fruit. L'invention concerne également des procédés de sélection assistée par marqueur de plants de tomate soit présentant soit dépourvus du gène ou de l'allèle codant pour ladite protéine, provoquant respectivement l'absence ou la présence du phénotype de goût fumé.
PCT/NL2011/050291 2010-04-28 2011-04-28 Nouvelle protéine de glycosyltransférase et son rôle dans le métabolisme de composés phénylpropanoïdes volatils chez la tomate WO2011136651A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US32896110P 2010-04-28 2010-04-28
US61/328,961 2010-04-28
NL2004624 2010-04-28
NL2004624A NL2004624C2 (en) 2010-04-28 2010-04-28 A new glycosyltransferase protein and its role in the metabolism of phenylpropanoid volatiles in tomato.
US36483910P 2010-07-16 2010-07-16
US61/364,839 2010-07-16

Publications (1)

Publication Number Publication Date
WO2011136651A1 true WO2011136651A1 (fr) 2011-11-03

Family

ID=43105065

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2011/050291 WO2011136651A1 (fr) 2010-04-28 2011-04-28 Nouvelle protéine de glycosyltransférase et son rôle dans le métabolisme de composés phénylpropanoïdes volatils chez la tomate

Country Status (2)

Country Link
NL (1) NL2004624C2 (fr)
WO (1) WO2011136651A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116554291A (zh) * 2023-04-28 2023-08-08 南京农业大学 一种梨bZIP类转录因子PubZIP914及其应用

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0120516A2 (fr) 1983-02-24 1984-10-03 Rijksuniversiteit Leiden Procédé pour l'incorporation de DNA étranger dans le génome de plantes dicotylédones; bactéries agrobacterium tumefaciens et procédé pour la production de celles-ci
EP0240208A2 (fr) 1986-03-28 1987-10-07 Calgene, Inc. Réglage anti-sens d'expression de gènes dans les cellules végétales
EP0116718B1 (fr) 1983-01-13 1990-05-16 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Procédé pour l'introduction de gènes exprimables dans les génomes de cellules de plantes et souches d'agrobactérium contenant des vecteurs plasmidiques Ti-hybrides utilisables dans ce procédé
WO1990008826A1 (fr) 1989-01-26 1990-08-09 Imperial Chemical Industries Plc Interrupteur de gene
EP0465572A1 (fr) 1989-03-30 1992-01-15 Dna Plant Techn Corp Technique de manipulation genetique de nouveaux phenotypes vegetaux.
WO1993001294A1 (fr) 1991-07-02 1993-01-21 Zeneca Limited Enzyme derivee de plantes, sequences d'adn et leurs utilisations
WO1993021334A1 (fr) 1992-04-13 1993-10-28 Zeneca Limited Produits de recombinaison d'adn et plantes les incorporant
WO1996037609A1 (fr) 1995-05-26 1996-11-28 Zeneca Limited Commutateur de gene comprenant un recepteur d'ecdysone
WO1997043427A1 (fr) 1996-05-14 1997-11-20 Novartis Ag Production de graines apomictiques
WO1998050570A2 (fr) * 1997-05-08 1998-11-12 The Regents Of The University Of Michigan Procedes et compositions ayant trait a l'utilisation d'(iso)eugenol methyltransferase
WO2001029240A2 (fr) 1999-10-22 2001-04-26 Expressive Research B.V. Regeneration
WO2002097102A2 (fr) 2001-05-31 2002-12-05 Plant Research International B.V. Modification du genome de vegetaux
WO2003010319A2 (fr) 2001-07-27 2003-02-06 Coöperatieve Verkoop- En Productievereniging Van Aardappelmeel En Derivaten Avebe B.A. Procede de transformation permettant d'obtenir des plantes sans marqueur et plantes ainsi obtenues
WO2006041280A1 (fr) * 2004-09-02 2006-04-20 Universiteit Van Amsterdam Nouvelle proteine de regulation

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0116718B1 (fr) 1983-01-13 1990-05-16 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Procédé pour l'introduction de gènes exprimables dans les génomes de cellules de plantes et souches d'agrobactérium contenant des vecteurs plasmidiques Ti-hybrides utilisables dans ce procédé
EP0120516A2 (fr) 1983-02-24 1984-10-03 Rijksuniversiteit Leiden Procédé pour l'incorporation de DNA étranger dans le génome de plantes dicotylédones; bactéries agrobacterium tumefaciens et procédé pour la production de celles-ci
US4940838A (en) 1983-02-24 1990-07-10 Schilperoort Robbert A Process for the incorporation of foreign dna into the genome of dicotyledonous plants
EP0240208A2 (fr) 1986-03-28 1987-10-07 Calgene, Inc. Réglage anti-sens d'expression de gènes dans les cellules végétales
WO1990008826A1 (fr) 1989-01-26 1990-08-09 Imperial Chemical Industries Plc Interrupteur de gene
EP0465572A1 (fr) 1989-03-30 1992-01-15 Dna Plant Techn Corp Technique de manipulation genetique de nouveaux phenotypes vegetaux.
WO1993001294A1 (fr) 1991-07-02 1993-01-21 Zeneca Limited Enzyme derivee de plantes, sequences d'adn et leurs utilisations
WO1993021334A1 (fr) 1992-04-13 1993-10-28 Zeneca Limited Produits de recombinaison d'adn et plantes les incorporant
WO1996037609A1 (fr) 1995-05-26 1996-11-28 Zeneca Limited Commutateur de gene comprenant un recepteur d'ecdysone
WO1997043427A1 (fr) 1996-05-14 1997-11-20 Novartis Ag Production de graines apomictiques
WO1998050570A2 (fr) * 1997-05-08 1998-11-12 The Regents Of The University Of Michigan Procedes et compositions ayant trait a l'utilisation d'(iso)eugenol methyltransferase
WO2001029240A2 (fr) 1999-10-22 2001-04-26 Expressive Research B.V. Regeneration
WO2002097102A2 (fr) 2001-05-31 2002-12-05 Plant Research International B.V. Modification du genome de vegetaux
WO2003010319A2 (fr) 2001-07-27 2003-02-06 Coöperatieve Verkoop- En Productievereniging Van Aardappelmeel En Derivaten Avebe B.A. Procede de transformation permettant d'obtenir des plantes sans marqueur et plantes ainsi obtenues
WO2006041280A1 (fr) * 2004-09-02 2006-04-20 Universiteit Van Amsterdam Nouvelle proteine de regulation

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology"
"Current protocols in molecular biology", 1998, JOHN WILEY & SONS
ANN. REV. GENET., vol. 19, 1985, pages 297 - 323
BALDWIN ELIZABETH A ET AL: "Flavor trivia and tomato aroma: Biochemistry and possible mechanisms for control of important aroma components", HORTSCIENCE, vol. 35, no. 6, October 2000 (2000-10-01), pages 1013 - 1022, XP008129796, ISSN: 0018-5345 *
BALDWIN, E.A. ET AL., HORT. SCIENCE, vol. 35, 2000, pages 1013 - 1022
BIRD, RAY, GEN. ENG. REVIEWS, vol. 9, 1991, pages 207 - 221
BOATRIGHT, J. ET AL., PLANT PHYSIOL., vol. 135, 2004, pages 1993 - 2011
C.M. MCCALLUM, L. COMAI, E.A. GREENE, S. HENIKOFF, PLANT PHYSIOLOGY, vol. 123, 2000, pages 439 - 442
CAUSSE M ET AL: "QTL analysis of fruit quality in fresh market tomato: A few chromosome regions control the variation of sensory and instrumental traits", JOURNAL OF EXPERIMENTAL BOTANY, vol. 53, no. 377, October 2002 (2002-10-01), pages 2089 - 2098, XP002611887, ISSN: 0022-0957 *
CAUSSE, M ET AL., THEOR. APPL. GENET., vol. 115, 2007, pages 429 - 442
CAUSSE, M. ET AL., J. EXP. BOT., vol. 53, 2002, pages 2089 - 2098
CHAÏB J ET AL: "Stability over genetic backgrounds, generations and years of quantitative trait locus (QTLs) for organoleptic quality in tomato", THEORETICAL AND APPLIED GENETICS ; INTERNATIONAL JOURNAL OF PLANT BREEDING RESEARCH, SPRINGER, BERLIN, DE, vol. 112, no. 5, 1 March 2006 (2006-03-01), pages 934 - 944, XP019322216, ISSN: 1432-2242, DOI: DOI:10.1007/S00122-005-0197-7 *
CHAIB, J. ET AL., THEOR. APPL. GENET., vol. 112, 2006, pages 934 - 944
CHANG, S.S., KANG, D.H., CRIT. REV. MICROBIOL., vol. 30, 2004, pages 55 - 74
COMPUT. CHEM., vol. 17, 1993, pages 149 - 163
COMPUT. CHEM., vol. 17, 1993, pages 191 - 201
DEIKMAN ET AL., EMBO J, vol. 7, 1988, pages 3315 - 3320
FERNANDEZ ET AL., PLANT PHYSIOLOGY, vol. 151, 2009, pages 1729 - 1740
FILLATI ET AL., BIO.TECHNOL., vol. 5, 1987, pages 726 - 730
FIRE ET AL., NATURE, vol. 391, 1998, pages 806 - 811
GANG, D.R., 2005, ANN. REV. PLANT BIOL., vol. 56, pages 301 - 325
GRIBSKOV, DEVEREUX: "Sequence Aanlysis Primer", 1991, STOCKTON PRESS
GURR, RUSHTON, TRENDS IN BIOTECHNOLOGY, vol. 23, 2005, pages 283 - 290
GYNHEUNG ET AL.: "Plant Molecular Biology Manual", 1988, KLUWER ACADEMIC PUBLISHERS, article "Binary vectors", pages: A3 - 1,A3-19
HELLENS, R.P. ET AL., PLANT MOL. BIOL, vol. 42, 2000, pages 819 - 832
J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
KRUMBEIN, A., AUERSWALD, H., NAHRUNG, vol. 42, 1998, pages 395 - 399
MARLATT, C. ET AL., J. AGRIC. FOOD CHEM., vol. 40, 1992, pages 249 - 252
MASADA, S. ET AL., PLANT CELL PHYSIOL., vol. 50, 2009, pages 1401 - 1415
MEINKOTH, WAHL, ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284
MEYERS, MILLER, COMPUTER APPLIC. BIOL. SCI., vol. 4, 1998, pages 11 - 17
MIZUTANI, M. ET AL., PLANT PHYSIOL., vol. 130, 2002, pages 2164 - 2176
NAGAO, R.T. ET AL.: "Oxford Surveys of Plant Molecular and Cell Biology", vol. 3, 1986, OXFORD UNIV. PRESS, pages: 384 - 438
NUCL. ACIDS RES., vol. 25, 1997, pages 3389 - 3402
ORZAEZ ET AL., PLANT PHYSIOLOGY, vol. 140, 2006, pages 3 - 11
PETRO-TURZA, M., FOOD REV. INT., vol. 2, 1987, pages 309 - 351
SALIBA-COLOMBANI V ET AL: "Genetic analysis of organoleptic quality in fresh market tomato. 1. Mapping QTLs for physical and chemical traits", THEORETICAL AND APPLIED GENETICS, vol. 102, no. 2-3, February 2001 (2001-02-01), pages 259 - 272, XP002611888, ISSN: 0040-5752 *
SAMBROOK, J., RUSSELL D.W., SAMBROOK, J.: "Molecular Cloning: a Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hvbridization with Nucleic Acid Probes", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assays"
TIKUNOV YURY ET AL: "A novel approach for nontargeted data analysis for metabolomics. Large-scale profiling of tomato fruit volatiles", PLANT PHYSIOLOGY (ROCKVILLE), vol. 139, no. 3, November 2005 (2005-11-01), pages 1125 - 1137, XP002611889, ISSN: 0032-0889 *
TIKUNOV YURY M ET AL: "A Role for Differential Glycoconjugation in the Emission of Phenylpropanoid Volatiles from Tomato Fruit Discovered Using a Metabolic Data Fusion Approach", PLANT PHYSIOLOGY (ROCKVILLE), vol. 152, no. 1, January 2010 (2010-01-01), pages 55 - 70, XP002611886, ISSN: 0032-0889 *
TIKUNOV, Y. ET AL., PLANT PHYSIOL., vol. 139, 2005, pages 1125 - 1137
TIKUNOV, Y.M. ET AL., PLANT PHYSIOL., vol. 139, 2005, pages 1125 - 1137
TRENDS IN BIOT., vol. 23, 2005, pages 283 - 290

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116554291A (zh) * 2023-04-28 2023-08-08 南京农业大学 一种梨bZIP类转录因子PubZIP914及其应用
CN116554291B (zh) * 2023-04-28 2024-02-09 南京农业大学 一种梨bZIP类转录因子PubZIP914及其应用

Also Published As

Publication number Publication date
NL2004624C2 (en) 2011-11-01

Similar Documents

Publication Publication Date Title
US11371104B2 (en) Gene controlling shell phenotype in palm
KR101388281B1 (ko) 질병 내성 오이 식물체
US10888056B2 (en) Tomato fruit having increased firmness
WO2016007632A1 (fr) Locus génétique à l'origine d'un faible caractère anatabine chez le tabac et ses procédés d'utilisation
CN111902547A (zh) 鉴定、选择和产生疾病抗性作物的方法
CN103820538B (zh) Myb28的遗传标志物
US10340026B2 (en) QTL responsible for tomato fruit firmness
CN113631722A (zh) 鉴定、选择和生产南方玉米锈病抗性作物的方法
WO2013127809A1 (fr) Modulation de la vigueur d'une semence
EP2971001A1 (fr) Identification et utilisation de gènes de la tomate contrôlant la tolérance au sel/à la sécheresse et le goût sucré du fruit
NL2004624C2 (en) A new glycosyltransferase protein and its role in the metabolism of phenylpropanoid volatiles in tomato.
RU2817600C2 (ru) Растение томата, образующее плоды с модифицированным содержанием сахаров
CN114787388A (zh) 用于洋葱中降低的丙酮酸水平性状的分子标记物
WO2021092173A1 (fr) Procédés d'identification, de sélection et de production de cultures résistant à la rouille du maïs du sud
AU2019360344A1 (en) Tomato plant producing fruits with modified sugar content

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11720202

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11720202

Country of ref document: EP

Kind code of ref document: A1