WO2011136602A9 - Method for selecting antibody-producing cell line, and kit thereof - Google Patents

Abstract

The present invention relates to a method for selecting an antibody-producing cell line by using a split fluorescent protein, and a kit for selecting an antibody-producing cell line. The use of a split fluorescent protein in selection of an antibody-producing cell line according to the present invention enables easy detection of an antibody-producing cell line just with observing the expression of a single fluorescent color by recombination of a split fluorescent protein, thereby remarkably reducing the time and cost for selecting an antibody-producing cell line with high productivity.

Description

Antibody Production Cell Line Screening Methods and Screening Kits

The present invention relates to a method for selecting antibody producing cell lines using split fluorescent protein and a selection kit for selecting antibody producing cell lines.

The selection of highly productive cell lines is an important step in the production of therapeutic antibodies using animal cell lines. Conventionally known methods for screening high productivity animal cell lines include limiting dilution methods, gel microdrop technology, and automated machines. In the selection of animal cell lines producing therapeutic antibodies, the limiting dilution method is currently used most widely because of the simplicity and low cost of the method itself, but it is inefficient compared to other methods and is not suitable for high throughput screening (HTS). On the contrary, the gel microdrop technique and the method of using an automated device have great advantages in HTS, but they have problems in public use due to the complexity and high cost of the method itself. In detail, the gel microdrop technique requires a skilled process and has limitations such as low efficiency gel formation. The relatively high cost of using an automated device is a big problem in use.

Therefore, there is a need for the development of a new system that can select high productivity cell lines with a simple, efficient and low cost.

An object of the present invention is to provide a method for easily selecting antibody-producing cell lines using recombination force of a cleavage fluorescence protein, and a selection kit therefor.

In order to solve the above problems, the present invention provides a first expression vector comprising a sequence encoding a first fragment of a fluorescent protein and a sequence encoding a heavy chain of an antibody and a second fragment of the fluorescent protein. Transfecting the cell with a second expression vector comprising the sequence and the sequence encoding the light chain of the antibody; And it provides a method for screening antibody-producing cell lines comprising the step of selecting the antibody-producing cell line by identifying the fluorescence shown by the recombination of the first and second fragments of the fluorescent protein.

The present invention also provides a first expression vector comprising a sequence encoding a first fragment of a fluorescent protein and an introduction region into which a sequence encoding a heavy chain of an antibody can be introduced; And a second expression vector comprising a sequence encoding a second fragment of the fluorescent protein and an introduction region into which a sequence encoding a light chain of the antibody can be introduced.

[Favorable effect]

By using cleavage fluoroproteins in the selection of antibody-producing cell lines according to the present invention, it is possible to easily detect antibody-producing cell lines only by observing the expression of a single fluorescence color by recombination of cleavage fluorescence proteins. The screening time and screening cost of the production cell line can be significantly reduced.

1 is a green fluorescence represented by the recombination GFP formed by the expression of the N- and C-terminal fragments of the green fluorescent protein (GFP) can be used as a marker indicating the production of the antibody by the simultaneous expression of the heavy and light chain structure of the antibody. This is a schematic diagram of the present invention showing that it is possible to select antibody-producing animal cell lines.

Figure 2 is a view showing the results observed by confocal microscopy of the formation of recombination GFP through the co-expression of expression vectors pcDNA-NGFP and pcDNA-CGFP.

Figure 3 is a structure for the structure of pCGFP-Heavy, a vector which simultaneously expresses the N-terminal fragment of GFP and the light chain structure of the antibody, pNGFP-Light and the C-terminal fragment of GFP and the heavy chain structure of the antibody It is a schematic diagram.

Figure 4A is a view showing the results observed through the confocal microscope to form the recombination GFP through the co-expression of the expression vectors pNGFP-Light and pCGFP-Heavy according to the present invention.

Figure 4B is a view showing the result of measuring the amount of antibody generated through the co-expression of the expression vector pNGFP-Light and pCGFP-Heavy in accordance with the present invention by enzyme immunoassay.

5 is a primary cell established by isolating individual cells (high 1%) expressing GFP in a CHO cell line (non-separated pool) coexpressing the expression vectors pNGFP-Light and pCGFP-Heavy according to the present invention by flow cytometry. It is a graph showing GFP expressing cell ratio and antibody specific productivity of the separation pool and the secondary separation pool.

6 is a graph showing the correlation between GFP expression and antibody specific productivity for 30 individual cell lines established according to the present invention.

The present invention provides a first expression vector comprising a sequence encoding a first fragment of a fluorescent protein and a sequence encoding a heavy chain of the antibody, and a sequence encoding a second fragment of the fluorescent protein and a light chain of the antibody. transfecting a cell with a second expression vector comprising a sequence encoding a chain); And it provides a method for screening antibody-producing cell lines comprising the step of selecting the antibody-producing cell line by identifying the fluorescence shown by the recombination of the first and second fragments of the fluorescent protein.

In one embodiment of the invention, the fluorescent protein is, for example, green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), yellow fluorescence Proteins (yellow fluorescent protein (YFP), cyan fluorescent protein (CFP) or enhanced fluorescent protein (EFP)) may be, but not limited to, fluorescent proteins that fluoresce by stimulation of light Anything can be used.

The fluorescent protein fragment according to the present invention means split fluorescent protein, and the split fluorescent protein loses the ability to fluoresce when the fluorescent protein is cut into a plurality of fragments, and the plurality of fragments recombine. (reassembly) refers to a fragment of the fluorescent protein that restores its ability to fluoresce again.

As used herein, "reassembly" means that the fluorescent protein fragments that have lost the ability to generate fluorescence bind to each other to form a fluorescent protein having recovered fluorescence.

As can be seen from Examples 1 and 2 below, as a result of experiments on the recovery of the fluorescence generating ability of the recombined fluorescence protein using the fluorescence protein fragment of the green fluorescent protein (GFP) which is a representative example of the fluorescence protein, When two vectors expressing the first fragment and the second fragment of the lost fluorescent protein, respectively, were transfected into the same animal cell and expressed, the fluorescent protein fragments were recombined to restore the fluorescence generating ability.

A first expression vector comprising a sequence encoding a first fragment of a fluorescent protein and a sequence encoding a heavy chain of the antibody and a sequence encoding a second fragment of the fluorescent protein and a light chain of the antibody ( A second expression vector comprising a sequence encoding a light chain) simultaneously expresses the first fragment of the fluorescent protein and the heavy chain of the antibody and simultaneously expresses the second fragment of the fluorescent protein and the light chain of the antibody. There is a correlation between each fragment of the fluorescent protein and the expression level of the heavy or chain of the antibody. Therefore, when the first expression vector and the second expression vector are transfected together in the same cell, the ratio of the heavy and light chains of the antibody to form an antibody protein and the first and second fragments of the fluorescent protein recombine and fluorescence Since the ratio of the ratio is proportional, the amount of fluorescence represented by the recombined fluorescent protein can be used as a marker indicating the amount of antibody produced. That is, by confirming the amount of fluorescence caused by the recombination of the first and second fragments of the fluorescent protein, it is possible to easily select a highly productive antibody-producing cell line with a large amount of fluorescence. At this time, the cell line may be selected using any method known in the art, for example, fluorescence activated cell sorting (FACS) may be used.

In one embodiment of the present invention, any one of the first and second fragments of the fluorescent protein may be a C-terminal fragment of the fluorescent protein, the other may be an N-terminal fragment of the fluorescent protein. That is, if the first fragment of the fluorescent protein is a C terminal fragment of the fluorescent protein, the second fragment of the fluorescent protein is the N-terminal fragment of the fluorescent protein, and if the first fragment of the fluorescent protein is the N-terminal fragment of the fluorescent protein, The two fragments are the C terminal fragments of the fluorescent protein.

In addition, the cleavage site in the full-length fluorescence protein for producing the first and second fragments of the fluorescence protein, the fluorophore is preserved in any one fragment of the fluorescence protein, so that the fluorescence by recombination of each fragment It can be appropriately selected by those skilled in the art as long as the ability to regenerate can be restored, and some sequences can be inserted or deleted in the full-length fluorescent protein sequence. For example, when using green fluorescent protein (GFP) as the fluorescent protein, the cleavage site for generating the first and second fragments of GFP may be between the 157 and 158 amino acid residues of full length GFP (US Pat. No. 6,780,599). Reference), but is not limited thereto. In the embodiment of the present invention, the sequence of SEQ ID NO: 5 was used as the sequence encoding the first fluorescent protein fragment, and the sequence of SEQ ID NO: 11 was used as the sequence encoding the second fluorescent protein fragment.

In another embodiment of the present invention, the first expression vector further comprises a sequence encoding a first linker peptide linked to a sequence encoding a first fragment of the fluorescent protein, wherein the second expression vector is a vector of the fluorescent protein. And further comprising a sequence encoding a second linker peptide linked to a sequence encoding a two segment, wherein the first linker peptide and the second linker peptide may be configured to bind to each other.

In the present invention, an "expression vector" refers to a DNA construct comprising an external DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Expression vectors of the invention can typically be constructed as a vector for expression. Preferably, the expression vector of the present invention is a vector for expressing a recombinant peptide or protein. In addition, the expression vector of the present invention can be constructed using prokaryotic or eukaryotic cells as host cells. The recombinant expression vector of the present invention may be, for example, a bacteriophage vector, cosmid vector, YAC (Yeast Artificial Chromosome) vector and the like. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for such purposes include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising a marker gene and a restriction enzyme cleavage site (c) can be inserted into foreign DNA fragments. Although no suitable restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA. Expression vectors used in the present invention can be constructed through a variety of methods known in the art.

A sequence encoding a first segment of a fluorescent protein in a first expression vector according to the present invention; A sequence encoding a first linker peptide linked to said sequence; And a sequence encoding a heavy chain of the antibody is operably linked, the sequence encoding a second fragment of a fluorescent protein in the second expression vector; A sequence encoding a second linker peptide linked to said sequence; And sequences encoding the light chain of the antibody are also operably linked.

"Operably linked" means that the functional binding between a nucleic acid expression control sequence (eg, an array of promoter, signal sequences, or transcriptional regulator binding sites) and another nucleic acid sequence (eg, a sequence encoding a fluorescent protein fragment) Wherein the regulatory sequence controls the transcriptional and / or translational process of the other nucleic acid sequence.

The first linker peptide and the second linker peptide are configured to bind to each other. The sequences encoding the first linker peptide and the second linker peptide are directly bound to the sequences encoding the first and second fragments of the fluorescent protein, respectively, so that when the protein is expressed, the first linker peptide and the first fragment of the fluorescent protein and The second linker peptide and the second fragment of the fluorescent protein are each expressed in the form of a fusion protein. Thus, when the first linker peptide and the second linker peptide bind to each other. The first and second fragments of the fluorescent protein recombine close to each other to restore the fluorescence property. The linker peptide may be a leucine zipper, for example as shown in US Pat. No. 6,780,599, and described in Chen, N. et al. J. Biotechnol., 2009, 142, 205-213 and Lindman, S. et al. Protein Sci., 2009, 18, 1221-1229, but may be an EF1 / EF2 peptide, but is not limited thereto. In the embodiment of the present invention, the EF1 sequence was used as the first linker peptide sequence, and the EF2 sequence was used as the second linker peptide sequence.

According to the present invention, the construction of a vector for simultaneously expressing a fluorescent protein fragment and a heavy or light chain of an antibody in a vector may be appropriately implemented by those skilled in the art. For example, an expression vector of a bicystronic mode may be used. In addition, internal ribosome entry sites (IRS) inside the pIRES expression vector may be used, but are not limited thereto.

According to one embodiment of the invention, between the sequence encoding the first fragment of the fluorescent protein of the first expression vector and the introduction region into which the heavy chain sequence of the antibody is introduced; And an internal ribosome entry site (IRES) sequence between the sequence encoding the second fragment of the fluorescent protein of the second expression vector and the introduction region into which the light chain sequence of the antibody is introduced. In the case of using the IRES, it is advantageous because the expression ratios of the fluorescent protein fragments and the heavy or light chains of the antibody can be controlled differently in each vector.

The antibody producing cell lines usable in the present invention are generally animal cell lines but are not particularly limited and may be E. coli, yeast or plant cell lines. In addition, when the cell line is an animal cell line, the animal cell may be, for example, HEK293, COS7, HeLa, CHO cells, but is not limited thereto.

In another embodiment of the present invention, the method for screening an antibody-producing cell line may further comprise the step of confirming whether the antibody-producing cell line has been produced by the method described above. This step is an additional step to verify the correlation between the amount of fluorescence generated by recombination of the first and second fragments of the fluorescent protein and the amount of antibody produced by the binding of the heavy and light chains of the antibody. The antibody-producing cell line can be accurately selected by secondarily verifying the actual antibody-producing ability of the selected antibody-producing cell line. The method for determining whether the antibody-producing cell line is produced or not may be used by any method known in the art, for example, it may be confirmed by an enzyme immunoassay.

The present invention also provides a first expression vector comprising a sequence encoding a first fragment of a fluorescent protein and an introduction region into which a sequence encoding a heavy chain of an antibody can be introduced; And a second expression vector comprising a sequence encoding a second fragment of the fluorescent protein and an introduction region into which a sequence encoding a light chain of the antibody can be introduced.

In the first expression vector, the "introduction region into which the sequence encoding the heavy chain of the antibody can be introduced" or the "introduction region into which the sequence encoding the light chain of the antibody can be introduced" in the second expression vector are to be produced, respectively. It refers to a region containing a restriction enzyme cleavage site into which foreign DNA fragments encoding the heavy or light chain of the antibody of interest can be inserted. Alternatively, when no appropriate restriction enzyme cleavage site is present, a vector and a foreign DNA fragment can be easily ligation using a synthetic oligonucleotide adapter or linker according to a conventional method. It means the area consisting of. The specific configuration of the introduction region into which such foreign DNA fragments can be introduced can be appropriately constructed by those skilled in the art.

Using the antibody cell line selection kit of the present invention comprising a first expression vector and a second expression vector, each containing an introduction region into which a sequence encoding a heavy or light chain of an antibody can be introduced, the heavy and light chains of the desired antibody By introducing a sequence encoding each into the introduction region, an expression vector for selecting a cell line producing the target antibody can be easily and quickly prepared, thereby easily selecting a cell line producing the target antibody.

Antibody-producing cell line selection kit according to the present invention is transfection for introducing the expression vector prepared in the restriction enzyme, primer, etc. for inserting the target antibody gene in the expression vector in addition to the first expression vector and the second expression vector It may include all biological or chemical reagents, instructions for use, etc., for the selection of antibody producing cell lines, including preparations, parent cell lines, and the like. Other configurations of such kits may be appropriately selected by those skilled in the art.

In one embodiment of the invention, the fluorescent protein is a green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP; cyan fluorescent protein) Or enhanced fluorescent protein (EFP).

In another embodiment of the present invention, any one of the first and second fragments of the fluorescent protein may be a C-terminal fragment of the fluorescent protein, and the other may be an N-terminal fragment of the fluorescent protein.

In another embodiment of the present invention, the first expression vector further comprises a sequence encoding a first linker peptide linked to a sequence encoding a first fragment of the fluorescent protein, wherein the second expression vector is a fluorescent protein And further comprising a sequence encoding a second linker peptide linked to a sequence encoding a second segment, wherein the first linker peptide and the second linker peptide may be configured to bind to each other.

In another embodiment of the invention, between the sequence encoding the first fragment of the fluorescent protein of the first expression vector and the region encoding the sequence encoding the heavy chain of the antibody may be introduced; And an internal ribosome entry site (IRES) sequence between the sequence encoding the second fragment of the fluorescent protein of the second expression vector and the introduction region into which the sequence encoding the light chain of the antibody can be introduced.

In the selection kit according to the embodiments, the characteristics of the first expression vector and the second expression vector included in the selection kit, the heavy chain of any antibody instead of including a sequence encoding a heavy or light chain of a specific antibody Or includes all of the characteristics of the first expression vector and the second expression vector previously used in the method for screening an antibody-producing cell line, except that the sequence encoding the light chain includes an introduction region into which it can be introduced. Detailed descriptions are omitted to avoid explanation.

Hereinafter, examples will be described in detail to help understand the present invention. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Example 1: Preparation of expression vectors pcDNA-NGFP and pcDNA-CGFP

To prepare vectors expressing N- and C-terminal fragments of green fluorescent protein (GFP) in animal cells, the fluorescent protein portion of each terminal fragment was obtained using pEGFP-C1 (Clontech) as a template and each The linking protein of the terminal fragment was synthesized by DNA from Bioneer Corporation. To clone the N-terminal fragment of the green fluorescent protein, pEGFP-C1 was used as a template with F1 primer (SEQ ID NO: 1) and R1 primer (SEQ ID NO: 2) for 1 minute 30 seconds at 92 ° C and 1 minute 30 at 55 ° C. Amplification was carried out by performing a total of 25 PCR reactions for 2 minutes at 72 ° C for 2 seconds. The amplified N terminal fragment DNA was named Seq-1 DNA (SEQ ID NO: 5). The portion corresponding to Seq-2 DNA (SEQ ID NO: 6) for synthesizing a linker peptide consisting of an EF1 sequence and a restriction enzyme site was synthesized by Bioneer Corporation. Using the same amount of Seq-1 DNA and Seq-2 DNA, the two DNA conjugates were used as templates, using F2 primer (SEQ ID NO: 3) and R2 primer (SEQ ID NO: 4) for 1 minute and 30 seconds at 92 ° C, 2 minutes at 50 ° C, and Amplification was performed by a total of 35 PCR reactions at 72 ° C. for 2 minutes. The fragments were digested with restriction enzymes HindIII and NotI and then inserted into the expression vector pcDNA3.1 / Zeo vector (Invitrogen), which were digested with the same enzyme, and named as the expression vector pcDNA-NGFP.

To clone the C-terminal fragment of the green fluorescent protein, pEGFP-C1 was used as a template using F3 primer (SEQ ID NO: 7) and R3 primer (SEQ ID NO: 8) for 1 minute 30 seconds at 92 ° C and 1 minute 30 at 55 ° C. Amplification was carried out by a total of 25 PCR reactions for 2 minutes at 72 ° C for 2 seconds. The amplified C terminal fragment DNA was named Seq-3 DNA (SEQ ID NO: 11). The part corresponding to Seq-4 DNA (SEQ ID NO: 12) for synthesizing a linker peptide consisting of an EF2 sequence and a restriction enzyme site was synthesized by Bioneer Corporation. Using the same amount of Seq-3 DNA and Seq-4 DNA, the two DNA conjugates were used as templates, using F4 primer (SEQ ID NO: 9) and R4 primer (SEQ ID NO: 10) for 1 minute and 30 seconds at 92 ° C, 2 minutes at 50 ° C, and Amplification was performed by a total of 35 PCR reactions at 72 ° C. for 2 minutes. The fragments were digested with restriction enzymes HindIII and NotI and then inserted into the expression vector pcDNA3.1 / Zeo vector, which was digested with the same enzyme, and named as expression vector pcDNA-CGFP.

Table 1

Sequence number	Sequence name	order
One	F1 primer	5'-ATGGTGAGCAAGGGCGAG-3 '
2	R1 primer	5'-CTGCTTGTCGGCCATGAT-3 '
3	F2 primer	5'-GCGAAGCTTGCCACCATGGTGAGCAAGGGCGAGGAGC-3 '
4	R2 primer	5'-GCGGCGGCCGCTCATGGACCCTTCAGCAAACTGGG-3 '
5	Seq-1 DNA	5'-ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAG-3 '
6	Seq-2 DNA	5'-CTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGGGTGGCTCTGGCTCTGGCTCGAGCAAGTCTCCAGAAGAACTGAAGGGCATTTTCGAAAAATATGCAGCCAAAGAAGGTGATCCAAACCAACTGTCCAAGGAGGAGCTGAAGCTACTGCTTCAGACGGAATTCCCCAGTCCATGAGA
7	F3 primer	5'-AAGAACGGCATCAAGGTG-3 '
8	R3 primer	5'-TCAGTACAGCTCGTCCAT-3 '
9	F4 primer	5'-GCGAAGCTTGCCACCATGAGCACCCTCGATGAGCTTTTTGAAG-3 '
10	R4 primer	5'-GCGGCGGCCGCTCAGTACAGCTCGTCCATGCCG-3 '
11	Seq-3 DNA	5'-AAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGACTCCCC
12	Seq-4 DNA	5'-AGCACCCTCGATGAGCTTTTTGAAGAACTAGACAAGAATGGAGATGGAGAAGTTAGTTTCGAAGAATTCCAGGTGTTGGTGAAAAAGATATCCCAGACGTCGGGTGGAAGCGGTAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACA-3 '

Example 2: Formation of Recombinant Fluorescent Protein through Co-Expression of Expression Vector pcDNA-NGFP and pcDNA-CGFP and Fluorescence Observation through Confocal Microscopy

PCDNA-NGFP and pcDNA-CGFP were used to determine whether fluorescence was induced by forming recombined GFP in cells using vectors expressing the N- and C-terminal fragments of the green fluorescent protein prepared in Example 1, respectively. Were transfected into HEK293 cells. HEK293 cells were passaged in animal cell medium DMEM (HyClone) added with 10% FBS (Invitrogen) and 4 mM glutamine (Sigma). Covers attachable to HEK293 cells were attached to the bottom of a 12-well plate (Nunc), and then HEK293 cells were incubated for 12 hours. Next, 0.5 mg vector was transfected into cells using 1.5 mL transfection solution (Stratagene). As a control, pEGFP-C1 and pcDNA3.1 / Zeo, which are GFP-expressing vectors, were tracked into HEK293 cells. As an experimental group, pcDNA-NGFP and pcDNA-CGFP, which are vectors expressing N- and C-terminal fragments of the fluorescent protein, were independently transfected. Finally, pcDNA-NGFP and pcDNA-CGFP were mixed and transfected. Transfected cells were further incubated at 30 ° C. for 24 hours. Cultures were removed from 12-well plates to observe fluorescence of recombined GFP with confocal microcsopy. Transfected HEK293 cells on the coverslip attached to the bottom were washed once with PBS solution and then fixed for 10 minutes with PBS solution containing 2% paraformaldehyde. The immobilized cells were washed twice with PBS solution and then treated with a mounting solution containing 4,6-diimidino-2-phenylindole (DAPI) capable of nuclear staining. The coverslips to which the finally transfected HEK293 cells were attached were observed using a confocal microscope (Zeiss Corporation).

As a result, as shown in Figure 2, it was confirmed that green GFP was observed when the transfection of the pcDNA-NGFP and pcDNA-CGFP mixed.

Example 3: Preparation of expression vectors pNGFP-Light and pCGFP-Heavy

The light chain structure of the model antibody provided by Paweng Shinsa Co., Ltd. to insert the light chain structure of the antibody at the multi cloning site (MCS) -A position of pIRES (Clontech), a vector in which two genes are co-expressed. Using cDNA as a template, F5 primer (SEQ ID NO: 13) and R5 primer (SEQ ID NO: 14) were used for 1 minute 30 seconds at 92 ° C, 1 minute 30 seconds at 55 ° C, and 1 minute at 72 ° C. 25 PCR reactions were performed and amplified. The amplified DNA was digested with restriction enzymes NheI and MluI, and then inserted into pIRES, an expression vector digested with the same enzyme, and named as the expression vector pIRES-Light.

N-terminal fragment of the fluorescent protein was prepared by using the pcDNA-NGFP prepared in Example 1 as a template using F6 primer (SEQ ID NO: 15) and R6 primer (SEQ ID NO: 16) for 1 minute 30 seconds at 92 ℃, 1 minute at 55 ℃ Amplification was performed a total of 25 PCR reactions for 30 seconds and at 72 ° C. for 1 minute. The amplified DNA was digested with restriction enzymes XbaI and SalI and then inserted into MCS-B of pIRES-Light, an expression vector digested with the same enzyme, and named as expression vector pNGFP-Light (FIG. 3).

In order to insert the heavy chain structure of the antibody at the MCS-A position of the expression vector pIRES, F7 primer (SEQ ID NO: 17) using a cDNA corresponding to the heavy chain structure of the model antibody provided by Paweng Corporation And amplified by a total of 25 PCR reactions using R7 primer (SEQ ID NO: 18) under conditions of 1 minute 30 seconds at 92 ° C, 1 minute 30 seconds at 55 ° C, and 2 minutes at 72 ° C. The amplified DNA was digested with restriction enzyme EcoRI and then inserted into pIRES, an expression vector digested with the same enzyme, and named as the expression vector pIRES-Heavy.

C-terminal fragment of the fluorescent protein using pcDNA-CGFP prepared in Example 1 as a template using F8 primer (SEQ ID NO: 19) and R8 primer (SEQ ID NO: 20) for 1 minute 30 seconds, 1 minute at 55 ℃ Amplification was performed a total of 25 PCR reactions for 30 seconds and at 72 ° C. for 1 minute. The amplified DNA was digested with restriction enzymes XbaI and SalI and then inserted into MCS-B of pIRES-Heavy, an expression vector digested with the same enzyme, and named as the expression vector pCGFP-Heavy (FIG. 3).

TABLE 2

Sequence number	Sequence name	order
13	F5 primer	5'-CTAGCTAGCGCCACCATGGGATGGAGCTATATC-3 '
14	R5 primer	5'-CGACGCGTCTAACACTCTCCCCTGTT-3 '
15	F6 primer	5'-TGCTCTAGAGCCACCATGGTGAGCAAGGGCGAG-3 '
16	R6 primer	5'-GCGTGTCGACTCATGGACCCTTCAGCAA-3 '
17	F7 primer	5'-CCGGAATTCGCCACCATGGGATGGAGCTATATC-3 '
18	R7 primer	5'-CCGGAATTCTCATTTACCCGGAGACAG-3 '
19	F8 primer	5'-TGCTCTAGAGCCACCATGAGCACCCTCGATGAG-3 '
20	R8 primer	5'-GCGTGTCGACTCAGTACAGCTCGTCCAT-3 '

Example 4 Fluorescence Verification and Antibody Production Confirmation after Simultaneous Transfection of pNGFP-Light and pCGFP-Heavy, Expression Vectors

 In order to confirm whether the expression vectors pNGFP-Light and pCGFP-Heavy prepared in Example 3 generate two units of an antibody, a heavy chain structure and a light chain structure, an N-terminal fragment and a C-terminal fragment of the fluorescent protein, respectively, pNGFP-Light and pCGFP-Heavy were mixed in equal amounts to transfect HEK293 cells. HEK293 cells were passaged in animal cell medium DMEM supplemented with 10% FBS and 4 mM glutamine. After transfection as described in Example 3, HEK293 cell cultures were centrifuged (21,000 × g, 20 minutes, 4 ° C.) for enzyme immunoassay and then stored at −80 ° C. Coverslips to which the transfected HEK293 cells were attached were subjected to an immobilization step as in Example 2, and fluorescence of recombined GFP was observed by confocal microscopy.

As a result, as shown in FIG. 4A, it was confirmed that green GFP was observed when the expression vector pNGFP-Light and pCGFP-Heavy were mixed and transfected.

In the culture of HEK293 cells transfected with the expression vector pNGFP-Light and pCGFP-Heavy, the enzyme immunoassay was performed to determine whether two units of the antibody, the heavy chain structure and the light chain structure, form an antibody. . Goat anti-human IgG (Pierce) was diluted in PBS solution containing 2% skim milk (BD bioscience) and then 96-well plate (Nunc) at 4 ° C. for 12 hours. Was coated on. The plate was washed three times with PBS solution, and then blocked with PBS solution containing 2% skim milk at room temperature for 1 hour. After washing three times with PBST solution, which is a PBS solution containing 0.05% Tween20, the culture medium and the standard antibody were loaded on a plate and reacted at 37 ° C for 1 hour. After the reaction, the plate was washed three times with PBST solution, and then reacted with alkaline phosphatase-bound goat anti-human IgG (Alkaline phosphatase-conjugated goat anti-human IgG, Pierce) for 1 hour at 37 ° C. After washing three times with PBST solution, finally TMB solution (BD biosciences) was added as a substrate. After completion of the reaction using sulfuric acid, the absorbance was measured at 450 nm on a multipurpose plate reader (BioTek).

As a result, as shown in FIG. 4B, it was confirmed that HEK293 cells produced antibodies when the expression vectors pNGFP-Light and pCGFP-Heavy were mixed and transfected.

Example 5: Isolation and antibody production verification of individual cells expressing GFP using a flow cytometer

In order to verify whether cells expressing green fluorescence are antibody-producing animal cell lines by co-expressing the N- and C-terminal fragments of the green fluorescent protein to form recombined GFP, the expression vector pNGFP-Light prepared in Example 3 and pCGFP-Heavy was transfected into Chinese hamster ovay-K1 (hereafter CHO-K1) cells and passaged three times in animal cell medium IMDM with an additional 10% FBS, 4 mM glutamine and 500 μg / mL G418. It was named non-separating pool. After inoculation into T-25 flasks at a concentration of 0.7 10 ⁵ cells / mL for GFP recombination, the cells were incubated at 37 ° C. for 3 days and then further incubated at 30 ° C. for 2 days. Next, cells having high GFP fluorescence of the upper 1% of the non-separation pool were separated using a flow cytometer, and then passaged three times in the same medium and named as primary separation pools. In the same manner, the cells showing high GFP fluorescence of the top 1% of the primary separation pools were separated using a flow cytometer and passaged three times in the same medium, and then named as secondary separation pools.

In order to measure the ratio of cells exhibiting GFP fluorescence in the non-separation pool, the primary separation pool, and the secondary separation pool, the cells were cultured at 30 ° C. for 2 days and then verified by flow cytometry. In addition, the cell line of each pool was inoculated in a T-25 flask at a concentration of 0.7 10 ⁵ cells / mL, and then the total number of viable cells was measured on days 2 and 4 of the culture at 37 ° C., respectively, and the antibody produced by enzyme immunoassay was measured. Specific antibody productivity was then measured.

As a result, as shown in Figure 5, the ratio of cells including the recombined GFP in the total cell number of each pool increased after separation through flow cytometry. In addition, pools with increased proportion of cells containing recombined GFP showed higher specific productivity.

Example 6 Validation of Separation Using Flow Cytometry for Cell Line Selection

In order to verify the usefulness of primary cell line selection using flow cytometry using GFP as a marker for screening antibody high production animal cell lines, the limiting dilution method in the non-separation pool and the secondary separation pool established in Example 5 was used. Dog clones were randomly selected. After inoculation at a concentration of 1 cell / 3 well in a 96-well plate, the culture was expanded to a T-25 flask through subculture, and each clone was inoculated into a T-25 flask at a concentration of 3.0 10 ⁵ cells / mL. After culturing at 37 ° C. for 3 days, the antibody produced by enzyme immunoassay was measured.

As shown in Table 3, only 1 of the 116 clones isolated from the non-separated pool showed antibody production of 0.5 to 1.0 mg / L, but 10.0 mg / L from the secondary pool, which was screened by flow cytometry. Four more high-concentration antibody-producing clones were selected.

TABLE 3

Antibody Production Standards (mg / L)	Non-separating pool	Secondary separation pool
0.5 or less	115/116	33/116
More than 0.5 less than 1.0	1/116	1/116
1.0 or more and 5.0 or less	0/116	28/116
5.0 or more and 10.0 or less	0/116	50/116
Greater than 10.0	0/116	4/116

Example 7: Validation of Correlation between Animal Cells Concurrently Expressing Fluorescent Protein to Form Recombined GFP and Antibody Producing Animal Cells

In order to verify the correlation between recombination level of GFP expression and antibody production, flow cytometry and enzyme-immunoassay were performed to determine the expression level of GFP and antibody specific productivity of 30 isolated clones. The GFP expression level was measured by flow cytometry after inoculating each clone into a T-25 flask at a concentration of 0.7 10 ⁵ cells / mL, incubating for 3 days at 37 ° C, and then inducing GFP recombination through additional culture for 2 days at 30 ° C. GFP mean values were measured using a flow cytometer. Determination of antibody specific productivity by enzyme-immunoassay was performed by inoculating each clone into a T-25 flask at a concentration of 0.7 10 ⁵ cells / mL, and then measuring the total number of viable cells on days 2 and 4 of the culture at 37 ° C, respectively. After measuring the antibody produced by the enzyme immunoassay, the specific productivity was measured. The correlation between antibody specific productivity and GFP mean values for each clone was plotted.

As a result, as shown in Figure 6, it can be seen that there is a high correlation between the antibody specific productivity and the GFP mean value, it was confirmed that GFP is a useful marker to select a high concentration of antibody-producing cell line.

Claims (7)

1. A first expression vector comprising a sequence encoding a first fragment of the fluorescent protein and a sequence encoding a heavy chain of the antibody, and a light chain of the sequence and the light chain of the antibody encoding the second fragment of the fluorescent protein. Transfecting the cell with a second expression vector comprising the sequence encoding the cell; And

   Screening for fluorescence caused by recombination of the first and second fragments of the fluorescent protein, the method comprising selecting an antibody-producing cell line

   Method for screening antibody producing cell lines.
2. The method of claim 1,

   The fluorescent protein is a green fluorescent protein (GFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), yellow fluorescent protein (YFP), cyan fluorescent A method for screening antibody producing cell lines, either cyan fluorescent protein (CFP) or enhanced fluorescent protein (EFP).
3. The method of claim 1,

   A method for screening an antibody-producing cell line, wherein any one of the first and second fragments of the fluorescent protein is a C-terminal fragment of the fluorescent protein and the other is an N-terminal fragment of the fluorescent protein.
4. The method of claim 1,

   Wherein the first expression vector further comprises a sequence encoding a first linker peptide linked to a sequence encoding a first segment of a fluorescent protein,

   The second expression vector further comprises a sequence encoding a second linker peptide linked to a sequence encoding a second segment of a fluorescent protein,

   The first linker peptide and the second linker peptide is characterized in that configured to be able to bind to each other

   Method for screening antibody producing cell lines.
5. The method of claim 1,

   Between the sequence encoding the first fragment of the fluorescent protein of the first expression vector and the introduction region into which the heavy chain sequence of the antibody is introduced; And an internal ribosome entry site (IRES) sequence between the sequence encoding the second fragment of the fluorescent protein of the second expression vector and the introduction region into which the light chain sequence of the antibody is introduced.

   Method for screening antibody producing cell lines.
6. The method of claim 1,

   A method for screening antibody-producing cell lines, further comprising the step of confirming whether or not the antibody-producing cell lines have been produced.
7. A first expression vector comprising a sequence encoding a first fragment of a fluorescent protein and an introduction region into which a sequence encoding a heavy chain of an antibody can be introduced; And

   A second expression vector comprising a sequence encoding a second fragment of the fluorescent protein and an introduction region into which a sequence encoding a light chain of an antibody can be introduced.

   Antibody Production Cell Line Selection Kit.

Images