WO2011132938A2 - Gpcr에 특이적으로 결합하는 gpcr-bpb - Google Patents
Gpcr에 특이적으로 결합하는 gpcr-bpb Download PDFInfo
- Publication number
- WO2011132938A2 WO2011132938A2 PCT/KR2011/002838 KR2011002838W WO2011132938A2 WO 2011132938 A2 WO2011132938 A2 WO 2011132938A2 KR 2011002838 W KR2011002838 W KR 2011002838W WO 2011132938 A2 WO2011132938 A2 WO 2011132938A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gpcr
- type
- trp
- thr
- glu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0002—General or multifunctional contrast agents, e.g. chelated agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/001—Preparation for luminescence or biological staining
- A61K49/0013—Luminescence
- A61K49/0017—Fluorescence in vivo
- A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
- A61K49/0056—Peptides, proteins, polyamino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B30/00—Methods of screening libraries
- C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/10—Libraries containing peptides or polypeptides, or derivatives thereof
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
- G01N2333/726—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
Definitions
- the present invention relates to a GPCR—BPB that specifically binds to a GPCR.
- Antibodies are immunoglobulin proteins, a type of plasma protein produced by B cells, that specifically inactivate and inactivate antigens by specifically recognizing and binding to specific sites of antigens.
- immunoglobulin proteins a type of plasma protein produced by B cells, that specifically inactivate and inactivate antigens by specifically recognizing and binding to specific sites of antigens.
- antibodies such as Rituximab and Hereptin have shown effectiveness in more than 50% of patients who have not responded to other treatments. Studies have shown that monoclonal antibodies have been successful in the treatment of lymphoma, colon cancer or breast cancer.
- the total market for therapeutic antibodies is estimated to grow at an annual rate of 20%, from $ 10 billion in 2004 to $ 30 billion in 2010, and the market is expected to grow exponentially.
- the reason why the development of new drugs using antibodies is active is that the drug development period is short, the investment cost is small, and the side effects can be easily predicted.
- the antibody is a herbal drug, the human body is hardly affected and the half-life in the body is low molecular weight drug. Compared to the overwhelmingly long compared to the patient-friendly.
- monoclonal antibodies in humans are recognized as foreign antigens and can cause severe allergic reactions or hypersensitivity reactions.
- the anti-cancer monoclonal antibody is used clinically, the production cost is high, and thus the price of the therapeutic agent increases rapidly.
- Antibody-replacement protein is a recombinant protein made to have constant and variable regions like antibodies, and a part of small and stable protein is replaced with amino acid of random sequence to make a library and screen it against the target material to make high affinity and good Substances with specificity can be found.
- avimers and affibodies among antibody replacement proteins have been reported to have a picomol affinity for a target substance. It is reported that these antibody replacement proteins are small and stable, can penetrate deep into cancer cells, and generally produce less immune response.
- the present invention focused on peptide-based antibody replacement proteins that are different from antibody replacement proteins using proteins up to now.
- Peptides have been widely used in place of antibody therapeutics due to their proper pharmacokinetics, mass productivity, low toxicity, antigenic inhibition and low production cost compared to antibodies.
- the advantages of peptides as therapeutic drugs are low production costs, high safety and responsiveness, relatively low patent loyalty, less exposure to unwanted immune systems, which can inhibit the production of antibodies to the peptides themselves, synthesis Deformation through is easy and accurate.
- most peptides show low affinity and specificity for specific protein targets compared to antibodies, they cannot be used in various applications. therefore, There is a need in the art for the development of new peptide-based antibody replacement proteins that can overcome the disadvantages of peptides.
- the present inventors have tried to develop a peptide material capable of specific binding with high affinity to a biological target molecule. This is expected to be a technology that can produce new drug candidates with high affinity and specificity in a short time using peptides having low affinity reported for a large number of targets.
- GPCRs G protein-coupled receptors
- GPCRs are known to play a pivotal role in the process of mediating various physiology or pathologies. Therefore, research on GPCR is currently used not only as an academic research subject but also as an important target of drug development.
- many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
- an object of the present invention is to provide a G protein-coupled receptor (GPCR) -bipodal peptide binder (GPCR-BPB).
- GPCR G protein-coupled receptor
- Another object of the present invention is to provide a G protein-coupled receptor (GPCR) -bipodal peptide binder (GPCR-BPB).
- GPCR G protein-coupled receptor
- GPCR-BPB G protein-coupled receptor-BPB
- the invention provides a G protein-coupled receptor (GPCR) —bipodal peptide binder (GPCR-BPB) comprising:
- the present inventors have tried to develop a system capable of transporting various substances into or on the cell surface based on GPCR binding and specificity.
- the structure stabilization site having a relatively rigid peptide backbone
- BPB bipodal peptide binder
- the basic strategy of the present invention is to connect a peptide that is bound to a target at both ends of a rigid peptide backbone.
- the rigid peptide backbone acts to stabilize the overall structure of the bipodal peptide provider and enhances the binding of target binding site I and target binding site ⁇ to the target molecule.
- Structural stabilization sites available in the present invention include parallel, antiparallel or parallel and antiparallel amino acid strands, interstrand hydrogen bonds, electrostatic interactions, hydrophobic interactions, van der Waals interactions, pi-pi Protein structure motifs in which non-covalent bonds are formed by interaction, bi-pi interaction, or a combination thereof.
- Non-covalent bonds formed by hydrogen bonds, electrostatic interactions, hydrophobic interactions, van der Waals interactions, pi-pi interactions, cation-pi interactions, or a combination of these strands are the rigidity of the structural stabilization site. Contribute to.
- interstrand non-covalent bonds at the structure stabilization site include hydrogen bonds, hydrophobic interactions, van der Waals interactions, pi-pi interactions or combinations thereof.
- disulfide bonds can be formed at the structured stabilization site to further increase the firmness of the structure stabilized site.
- the increase in firmness by such covalent bonds is given in consideration of the specificity and affinity of the bipodal peptide binder for the target.
- the amino acid strands of the structure stabilization site are linked by a linker.
- linker as used to refer to the strands refers to the material that connects the strands.
- the turn sequence on the hairpin acts as a linker
- leucine zipper a substance connecting two C-terminus of leucine zipper (eg, Peptide linkers) serve as linkers.
- the linker connects the parallel, antiparallel or parallel and antiparallel amino acid strands. For example, at least two strands (preferably two strands) aligned in parallel fashion, at least two strands (preferably two strands) aligned in antiparallel fashion, and at least three strands aligned in parallel and antiparallel fashion.
- the linker (preferably three strands) is connected by the linker.
- the linker is a turn sequence or peptide linker.
- the turn sequence is-turn, turn, ⁇ one turn, ⁇ -turn or ⁇ one loop (Venkatachalam CM (1968), Biopolymers, 6, 1425-1436; Nemethy G and Printz MP (1972), Macro / no IcuJes, 5, 755-758; Lewis PN et al., (1973), Biochi. Biophys. Acta, 303, 211-229; Toniolo C. (1980) CRC Crit. Rev. Biochem., 9, 1-44; Richardson JS. (1981), Adv.
- the turn sequence used in the present invention is ⁇ -turn.
- ⁇ -turn When ⁇ -turn is used as the turn sequence, it is preferably a type I, type 1 ', type ⁇ , type ⁇ ', type m or type ⁇ 'turn sequence, more preferably type I, type 1', type ⁇ , type ⁇ 'turn sequence, even more preferably type ⁇ or type ⁇ ' turn sequence, most preferably the type turn sequence (B. L ⁇ Sibanda et al ', J. Mol. Biol., 1989 , 206, 4, 759-777; BL Sibanda et al., Methods Enzymol., 1991, 202, 59-82).
- the turn sequence in the present invention is H. Jane Dyson et al., Eur. J. Biochem. 255: 462-471 (1998), which is incorporated herein by reference.
- What can be used as the turn sequence includes the following amino acid sequences: X-Pro-Gly-Glu-Val; Ala-X-Gly-Glu-Val (X is selected from 20 amino acids).
- X is selected from 20 amino acids.
- ⁇ _sheet or leucine zipper it is preferable that the peptide linker connects two strands arranged in parallel or two strands arranged in an antiparallel manner. desirable.
- Peptide linkers can be used in any known in the art.
- the sequence of a suitable peptide linker can be selected in consideration of the following factors: (a) the ability to be applied to a flexible extended conformat ion; (b) a secondary structure that interacts with a biological target molecule Ability to not generate; And (C) absence of hydrophobic residues or residues with charges that interact with the biological target molecule.
- Preferred peptide linkers include Gly, Asn and Ser residues. Other neutral amino acids such as Thr and Ala can also be included in the linker sequence. Suitable amino acid sequences for linkers are described in Maratea et al. , Gene 40: 39-46 (1985); Murphy et al. , Proc. Natl. Acad Sci. USA 83: 8258-8562 (1986); US Pat. Nos. 4,935,233, 4,751,180 and 5,990,275.
- the peptide linker sequence may consist of 1-50 amino acid residues.
- the structural stabilization site is a ⁇ -sheet connected by a ⁇ -hairpin linker or a leucine zipper connected by a linker, more preferably the structural stabilization site is a -sheet connected by a ⁇ -hairpin or linker, Most preferably ⁇ -hairpin.
- ⁇ -hairpin refers to the simplest protein motif comprising two ⁇ strands, the two ⁇ strands representing an antiparallel alignment with each other. In this ⁇ -hairpin the two ⁇ strands are generally linked by turn sequences.
- the turn sequence applied to the ⁇ -hairpin is a type I, type ⁇ , type ⁇ , type ⁇ ', type m or type m' turn sequence, more preferably type I, type ⁇ , type ⁇ , type ⁇ 'turn sequence, even more preferably type ⁇ or type ⁇ ' turn sequence, most preferably the type turn sequence.
- X-Pro-Gly-Glu-Val; or Ala-X-Gly-Glu Turn sequences represented by -Val can also be used for ⁇ -hairpins.
- the type I turn sequence is Asp-Asp-Ala-Thr-Lys-Thr
- the type ⁇ turn sequence is Glu-Asn-Gly-Lys
- the type ⁇ turn sequence is X-Pn > -Gly-Glu-Val
- Ala—X-Gly-Glu-Val X is selected from 20 amino acids
- the type ⁇ 'turn sequence is Ghi "Gly-Asn-Lys or Glu-D—Pro-Asn-Lys.
- Peptides with ⁇ -hairpin formulations are well known in the art.
- tryptophan zipper disclosed in US Pat. No. 6,914,123 and Andrea G. Cochran et al., PNAS, 98 (10): 5578-5583, WO 2005/047503.
- the template-fixed ⁇ -hairpin mimetic disclosed, the ⁇ -hairpin variants disclosed in US Pat. No. 5,807,979 are well known.
- peptides with ⁇ -hairpin conformation are described in Smith & Regan (1995) Science 270: 980-982; Chou & Fassman (1978) Annu. Rev. Biochem.
- tryptophan zipper is used when a peptide having a ⁇ _hairpin conformation is used as a structure stabilization site.
- the tryptophan zipper used in the present invention is represented by the following general formula (I):
- 3 ⁇ 4 is Ser or Gly-Glu
- 3 ⁇ 4 and X ' 2 are independently of each other Thr, His, Val, lie, Phe or Tyr
- X 3 is Trp or Tyr
- 3 ⁇ 4 is type I, type r, type ⁇ , Type ⁇ 'or type m or type m' turn sequence
- 3 ⁇ 4 is Trp or Phe
- 3 ⁇ 4 is Trp or Val
- X 7 is Lys or Thr-Glu.
- 3 ⁇ 4 in Formula I is s e r or Gly-Glu
- X 2 and X'2 are independently of each other Thr, His or Val, 3 ⁇ 4 is Trp or Tyr, X4 is Type I, Type ⁇ , Type ⁇ or Type ⁇ 'turn sequence, 3 ⁇ 4 is Trp or Phe, 3 ⁇ 4 Is Trp or Val and X 7 is Lys or Thr-Glu.
- Xl is Ser or Gly-Glu
- X 2 and X'2 are independently of each other Thr, His or Val
- 3 ⁇ 4 is Trp
- 3 ⁇ 4 is Trp
- 3 ⁇ 4 is Trp
- X 7 is Lys or Thr-Glu.
- 3 ⁇ 4 in Formula I is Ser, 3 ⁇ 4 and
- X'2 is Thr
- 3 ⁇ 4 is Trp
- 3 ⁇ 4 is Trp
- 3 ⁇ 4 is Trp
- X 7 is Lys.
- Formula I is Ser, 3 ⁇ 4 and X'2 are Thr, 3 ⁇ 4 is Trp, is a type ⁇ turn sequence (ENGK) or type ⁇ 'turn sequence (EGNK), 3 ⁇ 4 is Trp 3 ⁇ 4 is Trp and X 7 is Lys.
- ENGK type ⁇ turn sequence
- EGNK type ⁇ 'turn sequence
- amino acid sequences of tryptophan zippers suitable for the present invention are described in SEQ ID NOs: 1 to 3 and 5 to 10.
- ⁇ -hairpin peptides usable as structural stabilization sites in the present invention are peptides derived from B1 domainin of protein G, ie GB1 peptides.
- the structural stabilization site is preferably represented by the following general formula ⁇ :
- 3 ⁇ 4 is Arg, Gly-Glu or Lys-Lys
- X 2 is Gin or Thr
- 3 ⁇ 4 is type I, type 1 ', type ⁇ , type ⁇ ' or type m or type ⁇ turn sequence
- X4 is Gin, Thr-Glu or Gln-Glu.
- the structural stabilization site of the general formula ⁇ is
- 3 ⁇ 4 is Gly-Glu or Lys-Lys
- 3 ⁇ 4 is type I, type 1 ', type ⁇ , type ⁇ ' or type m or type ⁇ turn sequence
- 3 ⁇ 4 is Thr-Glu or Gln-Glu.
- Exemplary amino acid sequences of GB1-hairpins suitable for the present invention are described in SEQ ID NO: 4 and 14 to 15 sequences.
- ⁇ -hairpin peptides usable as structural stabilization sites in the present invention are described in SEQ ID NO: 4 and 14 to 15 sequences.
- the structural stabilization site is preferably represented by the following general formula m:
- 3 ⁇ 4 is Lys or Lys-Lys
- 3 ⁇ 4 is Trp or Tyr
- 3 ⁇ 4 is Val or Thr
- 3 ⁇ 4 is Trp or Ala
- 3 ⁇ 4 is Trp or Val
- X 7 is Glu or Gln-Glu.
- ⁇ -hairpin peptide that can be used as a structural stabilization site in the present invention is represented by the following general formula IV:
- 3 ⁇ 4 is Lys-Thr or Gly
- X 2 is Trp or Tyr
- 3 ⁇ 4 is type I, type ⁇ , type II, type ⁇ 'or type m or type ⁇ turn sequence, and is Thr-Glu or Gly.
- amino acid sequences of ⁇ -hairpins of the general formulas [pi] and IV are described in SEQ ID NO: 11 to 12, 15, and 16 to 19 sequences.
- a ⁇ -sheet connected by a linker may be used as the structure stabilization site.
- two or more amino acid strands, which are parallel or antiparallel, preferably antiparallel, are in an extended form, and hydrogen bonds are formed between the amino acid strands.
- ⁇ -sheet structure two adjacent ends of two amino acid strands are connected by a linker.
- linker various turn-sequences or peptide linkers described above may be used. If the turn-sequence is used as a linker, the ⁇ -turn sequence is most preferred.
- leucine zippers or leucine zippers linked by linkers may be used as structural stabilization sites.
- Leucine zippers are conserved peptide domains that cause parallel two-chain dimerization and are commonly found in proteins involved in gene expression. Dimerization domain (“Leucine scissors”. Glossary of Biochemistry and Molecular Biology (Revised). (1997). Ed. David M. Glick. London: Portland Press; Landschulz WH, et al. (1988) Science 240: 1759- 1764).
- Leucine zippers generally comprise a heptad repeat sequence, with the leucine residues located at the fourth or fifth.
- leucine zippers that may be used in the present invention include the amino acid sequence of LEALKEK, LKALEKE, LKKLVGE, LEDKVEE, LENEVAR or LLSKNYH. Specific examples of leucine zippers used in the present invention are described in SEQ ID NO: 39 Sequence. Each half of the leucine zipper consists of short ⁇ -chains with direct leucine contact between the ⁇ -chains.
- the leucine zipper in the transcription factor generally consists of a hydrophobic leucine zipper site and a basic site (site that interacts with the main groove of the DNA molecule). When the leucine zipper is used in the present invention, the basic site is not necessarily required.
- two adjacent ends of two amino acid strands may be linked by a linker.
- linker various turn-sequences or peptide linkers described above may be used, and preferably, a peptide linker that does not affect the structure of the leucine zipper is used.
- ⁇ Random amino acid sequences are joined to both ends of the above-mentioned structural stabilization site.
- the random amino acid sequence forms GPCR-target binding site I and GPCR-target binding site ⁇ .
- One of the biggest features of the present invention is to prepare a peptide binder in a bipodal manner by connecting GPCR-target binding site I and GPCR-target binding site ⁇ at both ends of the structure stabilization site.
- GPCR-target binding site I and GPCR-target binding site ⁇ cooperatively bind to the target, thereby greatly increasing the affinity for GPCR.
- the amino acid number n of the GPCR-target binding site I is not particularly limited, preferably an integer of 2-100, more preferably an integer of 2-50, even more preferably an integer of 2-20, most preferably Is an integer between 3 and 10.
- the amino acid number m of the GPCR-target binding site ⁇ is not particularly limited, preferably an integer of 2-100, more preferably an integer of 2-50, Even more preferably an integer of 2-20, most preferably an integer of 3-10.
- GPCR-target binding site I and GPCR-target binding site ⁇ may each contain different or the same number of amino acid residues.
- GPCR-target binding site I and GPCR-target binding site ⁇ may comprise different or identical amino acid sequences, and preferably include different amino acid sequences.
- the amino acid sequence included in GPCR-target binding site I and / or GPCR-target binding site ⁇ is a linear amino acid sequence or a cyclic amino acid sequence.
- at least one amino acid residue of the amino acid sequence included in GPCR-target binding site I and / or GPCR-target binding site ⁇ is an acetyl group, a fluorenyl methoxy carbonyl group, Formyl, palmitoyl, myristyl, stearyl or polyethylene glycol (PEG).
- GPCR—BPB of the present invention bound to a biological target molecule can be used for the regulation of physiological reactions in vivo, detection of in vivo substances, in vivo molecular imaging, in vitro cell imaging and drug delivery targeting, escorts It can also be used as a molecule.
- the cargo is bound to the structure stabilization site, GPCR-target binding site I or GPCR-target binding site ⁇ (more preferably, the linker of the structure stabilization site) more preferably than the structure stabilization site. It is.
- the cargo include, but are not limited to, labels, chemicals, biopharmaceuticals or nanoparticles that generate detectable signals.
- the label that generates the detectable signal may be a T1 contrast medium (e.g.,
- T2 contrast agents eg, superparamagnetics (eg magnetite, Fe 3 0 4 , y-Fe 2 0 3 , manganese ferrite, cobalt ferrite and nickel ferrite)
- radioisotopes eg, U C
- fluorescent materials fluorescein, phycoerythrin, rhodamine, lysamine (lissamine), and Cy3 and Cy5
- chemiluminescent groups magnetic particles, mass labels or electron-dense particles.
- the chemicals include, for example, anti-inflammatory drugs, analgesics, anti-arthritis agents, antispasmodics, antidepressants, antipsychotics, neurostabilizers, anti-anxiety agents, drug antagonists, antiparkin's disease drugs, cholinergic agonists, anticancer agents, antiangiogenic agents, Immunosuppressants, antivirals, antibiotics, appetite suppressants, analgesics, anticholiners, antihistamines, antimigraine, hormones, coronary, cerebrovascular or peripheral vasodilators, contraceptives, antithrombotics, diuretics, antihypertensives, cardiovascular diseases , Cosmetic ingredients (eg, anti-wrinkle agents, anti-aging agents and skin lightening agents) and the like, but are not limited thereto.
- the biopharmaceutical is insulin, IGF-K insulin—like growth factor 1), growth hormone, erythropoietin, G-CSFs (granulocyte-colony stimulating factors), GM-GSFs (gr anu 1 ocy te / macr ophage- co 1 ony stimulating factors), interferon alpha, interferon beta, interferon gamma, interleukin-1 alpha and beta, interleukin— 3, interleukin-4, interleukin-6, interleukin-2, epidermal growth factors (EGGF), calcitonin , ACTH (adrenocorticotropic hormone), TNF (tumor necrosis factor), Atobisban, buserel in, cetrorel ix, deslorelin, desmopressin (desmopressin), dynorphin A (1-13), elcatonin, eleidosin, eptifibatide, GHRH-I I (growth hormone releasing hormone
- GPCR-target binding site I and / or GPCR-target binding site ⁇ comprises an amino acid sequence that binds to GPCR.
- GPCRs preferably Class A (or 1) (Rhodopsin-1 ike), Class B (or 2) (Secretin receptor family), Class C (or 3) (Metabotroic glutamate / pheromone), Class D ( or 4) (Fungal mating pheromone receptors), Class E (or 5) (Cyclic AMP receptors) and Class F (or 6) (Frizzled / Smoothened) GPCRs, more preferably a luteinizing hormone receptor, a follicle stimulating hormone receptor, a thyroid stimulating hormone receptor, a calcitonin receptor, a glucagon receptor, a glucagon ⁇ 1 ike peptide 1 receptor (GLP ⁇ 1), a metabotropic glutamate receptor, a parathyroid hormone receptor, a vasoactive intestinal peptide receptor, a secret in receptor, a growth hormone releasing factor (GRF) receptor, protease—activated receptors (PARs), cholecystokin
- GPCR-BPB of the present invention binds to the extracellular domain of GPCR, preferably GPCR, and acts as an agonist or antagonist for GPCR.
- Agonists for GPCRs promote intracellular signaling triggered by GPCRs, and antagonists for GPCRs act to inhibit intracellular signaling triggered by GPCRs.
- GPCR-BPB of the present invention may bind to the extracellular domain of GPCR exposed to the cell surface, but may also bind to the intracellular domain to regulate the action of GPCR.
- GPCR-BPB targets an intracellular domain, preferably GPCR-BPB additionally comprises a cell transmembrane peptide (CPP).
- CPP cell transmembrane peptide
- the CPP includes various CPPs known in the art and include, for example, HIV-1 Tat protein, oligoarginine, ANTP peptide, HSV VP22 transcriptional regulator protein, MTS peptide derived from vFGF, Penetratin, Transport an, Pep -1 peptide, Pep-7 peptide, Buforin II, model amphi hatic peptide (MAP), k-FGF, Ku 70, pVEC, SynBl or HN-1.
- MAP model amphi hatic peptide
- k-FGF Ku 70, pVEC, SynBl or HN-1.
- There are various methods for binding the CPP to the bipodal peptide for example, covalently linking the CPP with a lysine residue in the loop portion at the structural stabilization site of the bipodal peptide.
- the bipodal peptide binder of the present invention is typically referred to as "one strand of the N-GPCR-target binding site I-structure stabilization site-linker-structure stabilization site -GPCR-target binding site ⁇ — C”.
- between the GPCR-target binding site I and one strand of the structural stabilization site and / or between the other strands of the structural stabilization site -GPCR-target binding site ⁇ in the GPCR-bipodal peptide binder of the present invention Includes a structure influence inhibiting region that blocks the cross-structural effects between the GPCR-target binding site and the structure stabilization site.
- At the site of rotation are amino acids that are relatively free of rotation of ⁇ and 3 ⁇ 4 ⁇ in the peptide molecule.
- the amino acids with relatively free rotation of ⁇ and ⁇ are glycine, alanine and serine. 1-10 amino acids, preferably 1-8, and more preferably 1-3 amino acid residues may be located at the structure influence inhibitory site.
- the library of GPCR-bipodal peptide binders of the present invention having the constructs described above can be obtained by various methods known in the art.
- the GPCR-bipodal peptide binder will have a random sequence, which has no sequence preference or designation (or immobilization) at any position of GPCR-target binding site I and / or GPCR-target binding site ⁇ . It means no amino acid residues.
- a library of GPCR-bipodal peptide binders can be used for the split-synthesis method (Lam et al. (1991) Nature 354: 82; WO 92/00091) performed on a solid support (eg, polystyrene or polyacrylamide resin).
- a solid support eg, polystyrene or polyacrylamide resin
- a library of GPCR-bipodal peptide binders is constructed in a ce ii surface display manner (eg, phage display, bacterial display or yeast display).
- the library of GPCR-bipodal peptide binders can be prepared via display methods based on plasmids, bacteriophages, phagemids, yeasts, bacteria, mRNA or ribosomes.
- Phage display is a technique for displaying various polypeptides in the form of proteins fused to coat proteins on the surface of the phage (Scott, JK and Smith, GP (1990) Science 249: 386; Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001); Clacks on and Lowman, Phage Display, Oxford University Press (2004). Random peptides are displayed by fusing the gene to be expressed in the gene ⁇ or gene uptake of the filamentous phage (eg M13).
- Phageimide may be used for the fiji display.
- Phageimide is a plasmid vector with one copy of the bacterial origin of replication (eg, ColEl) and the intergenic site of the bacteriophage. DNA fragments cloned in this phagemid are propagated like plasmids.
- a preferred embodiment of the present invention comprises the following steps: (0 phage coat protein (eg, gene m or gene of filamentous phage such as M13) A fusion gene in which a gene encoding a coat coat) and a gene encoding a bipodal tempide binder are fused, and a library of expression vectors comprising a transcriptional regulatory sequence (eg, a lac promoter) operably linked to the fusion gene. ( ⁇ ) introducing the expression vector library into a suitable host cell; (iii) culturing the host cell to produce recombinant phage or phagemid virus particles. Forming so that the fusion protein is displayed on the surface; (iv) contacting the viral particles with a GPCR molecule to bind the particles to a target molecule; And (V) separating particles not bound to GPCR molecules.
- phage coat protein eg, gene m or gene of filamentous phage such as M13
- the method for preparing an expression vector comprising a bipodal temptide binder gene may be performed according to methods known in the art.
- known phagemid or phage vectors e.g. pIGT2, fUSE5, fAFFl, fd-CATl, m663, fdtetDOG, HENl, pComb3, pComb8, pCANTAB 5E (Pharmacia) LamdaSurfZap, pIF4, PM48, PM52, PM54, fdH) And p8V5
- an expression vector can be prepared.
- phage display methods are performed using filamentous phage, lambda phage display (W0 95/34683; US Pat. No. 5,627,024), T4 phage display (Ren et al, (1998) Gene 215: 439; Zhu (1997) CAN 33: 534) and T7 phage display (US Pat. No. 5,766,905) can also be used to build a library of bipodal peptide binders.
- the method of introducing the vector library into a suitable host cell can be carried out according to a variety of transformation methods, most preferably according to the electroporation method (see US Pat. Nos. 5,186,800, 5,422,272, 5,750,373), suitable hosts are gram negative bacterial cells such as E. coli, and suitable E. coli hosts are JM101, E. coli 12 strain 294, E. coli strain W3110 and E. coli XL-lBlue. It is recommended that host cells be prepared with competent cells prior to transformation (Sambrook, J. et al, Molecular Cloning. A Laboratory Manual, 3rd ed. Cold). Spring Harbor Press (2001)). Selection of transformed cells generally includes antibiotics (eg, tetracycline and ampicillin).
- antibiotics eg, tetracycline and ampicillin
- helper phage phages include, but are not limited to, Ex helper phages, M13-K07, M13-VCS, and R408.
- the selection of viral particles that bind to biological target molecules can be routinely performed through a biopanning process (Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Clackson and Lowman, Phage Display, Oxford University Press (2004).
- the present invention provides a nucleic acid molecule encoding the aforementioned GPCR-bipodal peptide binder.
- the invention provides a vector for the expression of a GPCR-bipodal peptide binder comprising a nucleic acid molecule encoding a GPCR-bipodal peptide binder.
- the present invention provides a transformant comprising a vector for expression of a GPCR-bipodal peptide binder.
- nucleic acid molecule is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides that are the basic building blocks of nucleic acid molecules are naturally modified nucleotides, as well as modified sugar or base sites.
- Analogues Schott-Propanediol, RNA-Propanediol, RNA-Propanediol, RNA-Propanediol-N-phosphatethyl-N-(2-aminotyl)
- nucleotides that are the basic building blocks of nucleic acid molecules are naturally modified nucleotides, as well as modified sugar or base sites.
- Analogues Schot, Nucleotide Analogs,
- the vector of the present invention is a powerful promoter capable of transferring transcription to the nucleic acid molecule in addition to the nucleic acid molecule encoding the GPCR-bipodal peptide binder (e.g., tac promoter, lac promoter, / adJV5 Promoter, lpp promoter, p L promoter, p / promoter, ra> promoter, shock promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosomal binding site and transcription / detox termination sequence for initiation of translation It includes.
- the GPCR-bipodal peptide binder e.g., tac promoter, lac promoter, / adJV5 Promoter, lpp promoter, p L promoter, p / promoter, ra> promoter, shock promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.
- the vector of the present invention signals to the 5'-direction of the nucleic acid molecule encoding the GPCR-bipodal peptide binder. Sequences (eg, pelB) may be further included.
- the vector of the present invention further comprises a tagging sequence (eg, myc tag) for confirming that the bipodal peptidide binder is well expressed on the surface of the phage.
- the vector of the present invention comprises a phage coat protein, preferably a gene encoding filamentous phage such as M13 or a gene VII coat protein.
- the vector of the present invention comprises an origin of replication of bacteria (eg ColEl) and / or a bacteriophage.
- the vector of the present invention may include antibiotic resistance genes commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neo Resistance genes for mycin and tetracycline.
- the transformants of the present invention are preferably Gram-negative bacterial cells such as E. coli, and suitable E. coli hosts are JM101, E. coli K12 strain 294 E. coli strain W3110 and E. coli XL-lBlue (Stratagene) It includes, but is not limited to.
- the method of carrying the vector of the present invention into a host cell includes the CaCl 2 method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973)), one method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973); and Hanahan, J. Mo J. Biol., 166: 557—580 (1983)) and electroporation methods (US Pat. Nos. 5,186,800, 5,422,272, 5, 750, 373) and the like.
- the GPCR-bipodal peptide binders of the present invention exhibit peptides with very low levels (eg, nM levels) of K D values (dissociation constants), resulting in very high affinity to GPCR molecules, as described in the Examples below.
- the bipodal temptide binder exhibits a high affinity of about 10 2 -10 5 times (preferably about 10 3 -10 4 times) as compared to the binder produced by the monopodal method.
- the GPCR-bipodal peptide binder of the present invention not only has a use as a medicament, but also can be used for the detection of substances in vivo, in vivo molecular imaging, in vitro cell imaging and drug delivery, and as an escort molecule. Can be used.
- the features and advantages of the present invention are as follows:
- the present invention provides GPCR-BPB that specifically binds to GPCR.
- the 6bibipodal peptide binders of the present invention thus exhibit very low levels (eg, nM levels) of K D values (dissociation constants), resulting in very high affinity to the target.
- GPCR-BPB of the present invention may bind to GPCR in vivo and act as antagonist or agonist for GPCR.
- La shows a schematic diagram of a bipodal-peptide binder and GPCR-BPB containing ⁇ -hairpin as a structural stabilization site.
- Lb shows a schematic diagram of GPCR— ⁇ including ⁇ -sheets linked by linkers as structural stabilization sites.
- Figure lc shows a schematic of GPCR-BPB including leucine zippers linked by linkers as structural stabilization sites.
- Id shows a schematic of GPCR-BPB comprising a leucine-rich motif linked by linker as a structural stabilization site.
- Figure 2 shows a strategy for cloning the GPCR-BPB library.
- the pelB signal sequence myc tag
- myc tag is a tagging sequence to confirm that the gene of interest is well expressed on the surface of the phage.
- the lac promoter was used as a promoter.
- 3 is a result of the aequorin reporter gene assay for analyzing the antagonist action on the GPCR of sex peptide receptor-BPB.
- Figure 4 shows the structure of a bipodal peptide binder library that binds to the formyl peptide receptor like-1 protein, a GPCR protein.
- 5 is a result of the aequorin reporter gene assay for analyzing agonist action on the formyl peptide receptor like-1, a GPCR protein.
- Beta— F1 (5'-TTCTATGCGGCCCAGCTGGCC (NNK) 6 GGATCTTGGACATGGGAAAACGGAAAA-3 ') and Beta-Bl (5'-
- N is A, T, G or C; K is G or T; M is C or A.
- Beta-Fl 4 ⁇ , Beta-Bl 4 ⁇ , 2.5 mM dNTP mixture 4 ⁇ , ExTaq DNA polymerase 1 ⁇ (Takara, Seoul, Korea) and 5 ⁇ of 10XPCR buffer were mixed and a total of 50 ⁇ A total of 25 mixtures with distilled water added were made.
- Is a common hapaek PCR reaction After creating (5 minutes at 94 ° C, 60 cycles 3C 30 sec at C, at 72 ° C for 30 seconds and 72 ° C 7 minutes) to the double-stranded PCR purification kit (GeneAll, Seoul, Korea) to obtain a bipodal peptide binder gene.
- the restriction gene was treated to the insert gene and the pIGT2 phagemid vector.
- E. coli XL1-BLUE cells (American Type Culture Collection, Manassas, USA) were plated on LB agar-plates. After the inoculating colonies grown in an agar plate medium in LB medium with 5 heunhap at 37 ° C at a rate of 200 rpm and incubated for one day. Cultured 10 ⁇ cells were inoculated in 2 LB medium and incubated in the same manner until the absorbance was 0.3-0.4 at a wavelength of 600 nm. The incubated flask was left on ice for 30 minutes, then 4 ° C.
- Electroporation was performed by dispensing 25/100 of the phagemid vector 12 and the bipodal peptide binder into which the insert DNA 2.9 i was linked.
- the competent cells were thawed on ice, mixed with 200 ⁇ of competent cells and mixed with solution 4 ⁇ , and placed in a prepared 0.2 cm cuvette. Placed on ice for 1 minute later.
- An electroporator (BioRad, Hercules, CA) was programmed at 200 ⁇ at 25 uF and 2.5 kV, drained the prepared cuvettes, placed in the electroporator and pulsed (time constant is 4.5-5 msec).
- the cells were placed in 1 LB medium containing 20 mM glucose, prepared at 37 ° C., and a total of 25 cells obtained were transferred to a 100 ra tube. After incubation at 200 rpm at 37 ° C. for one hour, 10 ⁇ was diluted and plated in ampicillin agar medium to measure the number of libraries. The remaining cells were added 20 mM glucose and 50 g / ampicillin in 1 «LB and incubated for one day at 30 ° C. Centrifugation at 4 ° C. at 4,000 ⁇ g for 20 minutes to remove all supernatants except for the precipitated cells, resuspended in 40 LB and stored at ⁇ 80 ° C. with glycerol at a final concentration of at least 20%. Recombinant Phage Production and PEG Precipitation in Libraries
- Recombinant phage was produced in a bipodal peptide binder library stored at -80 ° C.
- ampicillin 50 ⁇ / ⁇
- 20 mM glucose were added to a 100 m £ LB medium, and then library 1 i stored at -80 ° C was added at 150 rpm at 37 ° C for one hour.
- Cultures were mixed at speed.
- Ex helper phage Ig therapy, Chuncheon, Korea
- ixi0 u pfu was added thereto and incubated under the same conditions for one hour.
- Biopanning was performed on the sex peptide receptor of fruit fly as a protein of GPCR. Phage peptides recovered in every biopanning order were subjected to biopanning of the BPB (Bipodal-peptide binder) library prepared in Example 1 to CH0-K1 cells transformed with each sex peptide receptor gene. Their output phage / input phage ratio was determined. Each biopanning process involves the removal of CH0-K1-specific phage by injecting phage into non-transformed CH0-K1 cells. This is called 'counter selection'. Specific bio panning method is as follows.
- Drosophila sex peptide receptor DNA (pcDNA3.1 (+)-SPR) cloned into pcDNA3.1 (+) vector was transfected into CH0-K1 cells using 1 ipofect amine, and then cultured in a 10 Cm culture dish for 24 hours. Used for biopanning. First, 2% BSA was added to the CH0-K1 culture dish transfected with SPR gene to block the surface of the dish for 1 hr. On the other hand, 10 11 cfu or more of library phages were mixed with 2% BSA, rotated for 15 minutes, mixed and stored on ice.
- Example 3 Fruit fly sex peptide receptor specific phage peptide detection (phage titration) After 5 times of biopanning, the recovered phages were infected with E.
- E. coli and placed in ampicillin LB solid medium at 37 degrees for overnight incubation. Each generated E. coli colony corresponds to one phage clone. 40 colonies were randomly selected and inoculated in 1 ml LB liquid medium in a 1.5 ml tube, ampicillin and helper phage 10 10 pfu were added together, and incubated for 2 days at 37 ° C and 200 rpm to amplify phage clones. Recover supernatant by centrifugation and titrate. Add 2% BSA, rotate and mix thoroughly.
- CH0-K1 and non-transfected CHO cells transfected with pcDNA3.1 (+)-SPR DNA one day prior to 40 wells were put into 96 well plates and cultured. At this time, the number of cells per well is adjusted to 3 ⁇ 10 3 level. 50 ul of phage solution mixed with 2% BSA was first added to non-transfected CH0 cells, stored at 37 ° C for 1 hour, and then the supernatant was carefully collected. After spin down, supernatant was added to CH0-K1 transfected with pcDNA3.1 (+)-SPR and stored at 37 ° C for 30 minutes.
- a bipodal peptide binder peptide specific for the sex peptide receptor overlapped in DNA sequencing was synthesized (Anigen, Korea). Twenty four hours prior to assay, 3 x 10 3 CHO-Kl cells co-transfected with pcDNA3.1 (+)-SPR and pcDNA3.1 (+)-aequorin DNA were incubated. Assay method is as follows. Coelenterazine was injected into CH0-K1 cells prepared by dissolving 0.5 mM coelenterazine in 1/10 dilution of 10x assay buffer (1.25 M KC1, 50 mM MgC12, 20 mM K / PIPES, pH 6.8, 200 mM sorbitol) for 1 hour.
- the stable beta-hairpin motif was used as the structure stabilization site of the bipodal tempide binder.
- tryptophan zippers (Andrea et al., Proc. Natl. Acad. Sci. 98: 5578—5583 (2001)), which stabilize the beta-hairpin motif structure by the interaction of tryptophan-tryptophan amino acids, were used.
- Variable regions were created in two portions by randomly arranging six amino acids in each of the N- and C-terminal portions of the backbone tryptophan zipper (FIG. La).
- This is called a bipodal peptide binder and has variable regions on both sides so that it can be cooperatively attached to the antigen and thus have high affinity and specificity.
- the structure stabilization site of the bipodal peptide binder may be configured in various ways as shown in FIGS.
- a Bipodal Peptide Binder Library Bioengineers a 5th-order Biotransfer to CH0-K1 Cells Transfected with Fruit Fly Sex Peptide Receptor Panning was performed and the phage / input phage ratio of the phage peptides recovered at each panning step was determined (Table 1).
- Fruit fly sex peptide receptor A total of 40 candidate phage clones were obtained by performing 4 specific phage peptide searches. Phage genomes were extracted from the phage clones infected with E. coli, sequenced, and identified bipodal peptide binder amino acid sequences. 40 bipodal peptide binder amino acid sequences were arranged through the ClustalW program and clones with identical sequences were detected. This yielded overlapping specific peptide sequences (Tables 2a and 2b).
- an aequorin reporter gene assay was performed. Sex peptide receptors alter intracellular Ca ++ levels through signal transduction when they are affected by ligand.
- the bipodal peptide sequence overlapped from genome DNA sequence of phageclone was synthesized (Anigen, Korea).
- Beta-Bl (5'- AACAGTTTCTGCGGCCGCTCCTCCTCC (MNN) 6 TCCOTCCATGTCCATTTTCCGTT-3') and Beta-F2 (5 '-TOTATGC (: CCA (TG ( ⁇ (OT (6)) ⁇ ACATG ⁇ AAAACGGAAAA-3 ') and Bet a-B2 (5' -AACAGTTTCTGCGGCCGCTCCTCC
- TCC (CCACCACCACCAGCGCCA) TCCOTCCATGTCCATTTTCCGn-3 ') (N is A, T, G or C; K is G or T; M is C or A).
- Beta-Fl 4 ⁇ , Beta-Bl 4 ⁇ (or Beta-F2 4 ⁇ , Beta-R2 4 ⁇ ), 2,5 mM dNTP mixture 4 ⁇ , ExTaq DNA polymerase 1 Takara, Seoul , Korea) and 10XPCR buffer 5 / ⁇ were mixed to make a total of 25 mixtures with the addition of distilled water to a total of 50 ⁇ .
- E. coli XL1-BLUE cells American Type Culture Collection, Manassas,
- Electroporation was performed by dispensing 25 ⁇ into 2.9 // g. Competent cells were dissolved on ice, mixed with 200 ⁇ of competent cells and mixed with 4 ⁇ solution, placed in a 0.2 cm cuvette prepared separately and placed on ice for 1 minute.
- the electroporator BioRad, Hercules, CA
- the electroporator was programmed at 200 ⁇ at 25 uF and 2 ⁇ 5 kV, drained the prepared cuvettes, placed in the electroporator and pulsed (time constant is 4.5-5 msec). . Thereafter immediately placed in 1 ⁇ LB liquid medium containing 20 mM glucose prepared at 37 ° C. A total of 25 cells obtained were transferred to a 100 mi test tube.
- Recombinant phage was produced in a bipodal peptide binder library stored at -80 ° C.
- a bipodal peptide binder library stored at -80 ° C.
- ampicillin 50 ⁇ and 20 mM glucose
- Library 1 stored at -80 ° C for 1 hour at 150 rpm at 37 ° C.
- lxio H pfu Ex helper phage (Ig therapy, Chuncheon, Korea) was added thereto and incubated under the same conditions for an hour again. The supernatant was removed by centrifugation for 10 minutes with l.OOOXg and Recombinant phage was produced by adding 100 ml of LB liquid medium containing ampicillin (50 nglv) and kanamycin (25) to the culture supernatant.
- GPCR protein Another example protein of GPCR protein was biopanned against formyl peptide receptor like-1.
- the biopodal BPB (Bipodal-peptide binder) library prepared in Example 1 was subjected to biopanning 5 times for CH0-K1 cells transformed with each formyl peptide receptor like-1 gene, and output phage / The input phage ratio was determined. Each time the output phage was injected into non-transformed CH0-K1 cells to remove the CH0-K1 specific phage. This is called 'counter selection'.
- the specific method is as follows. Formyl peptide receptor like-1 DNA (pcDNA3.l (+)-FPRLl) cloned into pcDNA3.1 (+) vector was transferred to CH0-K1 cells using 1 ipofectamine.
- Example 3 Formyl peptide receptor like-1 (FPRL-1) specific phage peptide detection (phage titration method)
- the recovered phages are infected with E. coli and placed on an Ampicillin LB plate and incubated at 37 ° C overnight. Each colony of E. coli generated was one phage clone. A random selection of 40 colonies was inoculated into a 1.5 ml tube containing 1 ml LB liquid medium and ampicillin and helper phage 10 10 pfu, 37 degrees. Incubate at 200 rpm for 2 days to amplify phage clones. Recovered and titration of supernatant by centrifugation. Add 2% BSA, rotate and mix well.
- the pcDNA3.1 (+) before the day-by and FPRL1 is turned on by each well 40 a transfection CH0-K1, non transfected CH0 cells in 96 well plate and incubated eu wherein the well 3 X 10 3 cells, the level number per Fit. 50 ul of phage solution mixed with 2% BSA first Stored at 37 ° C for 1 hour after inoculation into non-transfected CHO cells and carefully collect the supernatant. After spin down, supernatant was added to CH0-K1 transfected with pcDNA3.1 (+)-FPRLl and stored at 37 ° C for 30 minutes.
- Example 5 Construction of Bipodal Peptide Binder Library
- a stable beta-hairpin motif was used.
- tryptophan zippers (Andrea et al., Proc. Natl. Acad. Sci. 98: 5578—5583 (2001)), which stabilize the beta-hairpin motif structure by the interaction of tryptophan-tryptophan amino acids, were used.
- a bipodal library comprising 'WRWWWW' at the N-terminus of the skeletal tryptophan zipper and 6 random amino acids at the C-terminus, or 6 random amino acids at the N-terminus or WRW 'at the C-terminus Produced (FIG. 4).
- the bipodal peptide binder library was subjected to biopanning 5 times on Formyl peptide receptor like-1 transfected CHO-Kl cells, and the ratio of output phage / input phage of phage peptides recovered at each panning step was determined (Table 3). .
- Table 3
- Example 8 aequorin reporter gene assay for Formyl peptide receptor like-1
- Aequorin reporter gene assay was performed to investigate the effect of peptide on the activity of Formyl peptide receptor like-1, GPCR. Increased capacity of agonists over WRWWWW peptides would increase intracellular Ca ++ levels through the downstream signaling pathway of Formyl peptide receptor like-1. Through the Aequorin reporter gene assayAssay, it was confirmed that all five peptides act more strongly as agonists than the conventionally known WRWWW (FIG. 5).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Peptides Or Proteins (AREA)
Abstract
본 발명은 (a) 가닥간(interstrand) 비공유결합이 형성된 패러럴(parallel), 안티패러럴(antiparallel) 또는 패러럴(parallel)과 안티패러럴(antiparallel) 아미노산 가닥들을 포함하는 구조 안정화 부위(structure stabilizing region); 및 (b) 상기 구조 안정화 부위의 양 말단에 결합되어 있고 무작위적으로 선택된 각각 n 및 m개의 아미노산을 포함하는 GPCR-타겟 결합 부위 I(GPCR-target binding region I) 및 GPCR-타겟 결합 부위 Ⅱ(GPCR-target binding region Ⅱ)를 포함하는 GPCR에 특이적으로 결합하는 GPCR-바이포달 펩타이드 바인더에 관한 것으로서, 본 발명의 GPCR-바이포달 펩타이드 바인더는 GPCR에 대하여 매우 낮은 수준(예컨대, nM 수준)의 KD 값(해리상수)을 나타내어, GPCR 타겟에 매우 높은 친화도를 나타낸다. 본 발명의 GPCR-바이포달 펩타이드 바인더는 의약으로서의 용도를 가질 뿐만 아니라, 인 비보 분자 이미징, 인 비트로 세포 이미징 및 약물전달용 타겟팅을 하는 데 이용될 수 있으며, 에스코트 분자로도 매우 유용하게 이용될 수 있다.
Description
【명세서】
【발명의 명칭】
GPCR에 특이적으로 결합하는 GPCRᅳ BPB 【기술 분야】
본 발명은 GPCR에 특이적으로 결합하는 GPCR— BPB에 관한 것이다.
【배경 기술】
항체는 B 세포가 생산하는 혈장단백질의 일종인 면역글로불린 단백질로써 외부에서 들어온 항원의 특정부위를 특이적으로 인식하여 결합함으로써 항원을 비활성화하거나 무력화시킨다. 이러한 항원 -항체 반응의 특이성과 고도의 친화도 및 수천만 종류의 항원을 구별할 수 있는 항체의 다양성을 응용하여 오늘날 진단제와 치료제 등을 포함하는 많은 종류의 항체 제품이 출현하게 되었다. 현재 FDA 에서는 21 개의 단일클론항체를 승인하였으며 리턱시맵 (Rituximab) 및 헤르셉틴 (Her eptin)과 같은 항체는 다른 치료에서 전혀 반응을 보이지 않던 환자들의 50% 이상에서 효과를 보인바 있으며 실질적으로 여러 연구에서 단일클론항체를 이용하여 림프종, 대장암 또는 유방암 등에 성공적인 임상치료를 보여주고 있다. 치료용 항체의 전체 시장 규모는 2004 년 100 억 달러 규모에서 2010 년에는 300 억 달러로 연평균 20%의 성장률을 보일 것으로 추정하고 있으며, 그 시장 규모는 기하급수적으로 증가할 것으로 추정되고 있다. 항체를 이용한 신약개발이 활발해지는 이유는 약품의 개발기간이 짧으며 투자비용이 작고 부작용을 쉽게 예측할 수 있기 때문이다。 또한 항체는 생약이어서 인체가 거의 영향을 받지 않으며 체내에서의 반감기가 저 분자량 약품에 비하여 압도적으로 길어서 환자에게 친화적이다. 이러한 유용성에도 불구하고 인간에서 단일클론항체는 외래 항원으로 인식하여 심한 알레르기 반웅 또는 과민반웅을 일으키기도 한다. 또한, 이러한 항암 기능의 단클론 항체를 임상적으로 사용할 경우 생산 단가가 높기 때문에 치료제로서의 가격이 급격히 상승한다는 단점이 있으며, 항체를 배양하는 방법 및 정제 방법 등
광범위한 분야의 기술들이 각종 지적 소유권에 의해 보호받고 있기 때문에 비싼 라이센싱비를 지불해야 한다.
따라서 이 문제를 해결하기 위해서 미국을 중심으로 유럽연합에서 항체 대체 단백질 개발이 태동기에 있다. 항체 대체 단백질은 항체와 같이 불변영역과 가변영역을 가질 수 있도록 만든 재조합 단백질로 크기가 작고 안정한 단백질의 일정부분을 무작위 서열의 아미노산으로 바꾸어 라이브러리를 만들고 이를 표적물질에 대해 스크리닝올 하여 높은 친화력과 좋은 특이성을 가진 물질을 찾을 수 있다. 예를 들어 항체 대체 단백질중 아비머 (avimer)와 아피바디 (af f ibody)는 표적물질에 대해 피코몰 (picomole) 정도의 친화력을 가진 예시가 보고되어 있다. 이런 항체 대체 단백질은 크기가 작고 안정해서 암세포에 깊이 침투 가능하며 일반적으로 면역반웅을 적게 일으킨다고 보고되어 있다. 그리고 무엇보다도 광범위한 항체 특허 문제에서 벗어 날 수 있으며 박테리아에서 쉽게 대량정제 할 수 있기 때문에 생산단가가 낮아 경제적으로 항체보다 큰 장점을 가진다. 현재 개발된 항체 대체 단백질은 40 개가 있으나 이 증 벤처 회사나 다국적 제약회사에서 상용화를 시도하고 있는 항체 대체 단백질은 피브로넥틴 타입 ΙΠ 도메인, 리포칼린, LDLR-A 도메인, 크리스탈린, 프로테인 A, 안키린 리피트 (Ankyrin repeat), BPTI 라는 단백질을 이용하고 있으며 타겟에 대한 피코몰에서 수 나노몰정도의 높은 친화력을 가지고 있다. 그 중 애드넥틴 (Adnectin), 아비머, 쿠니츠 (Kunitz) 도메인은 현재 FDA 임상 실험이 진행 중이다.
본 발명은 지금까지의 단백질을 이용한 항체대체 단백질과는 다른 펩타이드 기반 항체대체 단백질에 초점을 맞추었다. 펩타이드는 항체에 비해 적절한 약물동력학, 대량생산성, 낮은 독성, 항원성 억제 및 낮은 생산 단가 등으로 인해 현재 항체 치료제를 대체하여 다양하게 활용되고 있다. 치료용 약으로서의 펩타이드의 장점은 생산 단가가 낮고, 안전성 및 반웅성이 높으며, 특허 로얄티가 상대적으로 저렴하고, 원하지 않는 면역시스템에 덜 노출되어 펩타이드 자체에 대한 항체 생산을 억제 할 수 있으며, 합성을 통한 변형이 쉽고 정확하다는 것이다. 그러나 대부분의 펩타이드는 항체에 비해 특정 단백질 타켓에 대해 낮은 친화력 및 특이성을 보이기 때문에 여러 웅용분야에 사용되지 못하는 단점이 있다. 따라서,
펩타이드의 단점을 극복할 수 있는 새로운 펩타이드 기반 항체 대체 단백질 개발에 대한 요구가 당업계에 대두되고 있다. 이에 본 발명자들은 생물학적 타겟 분자에 높은 친화성으로 특이적 결합이 가능한 펩타이드 물질을 개발하고자 노력하였다. 이는 현재 매우 많은 타겟에 대해 보고된 낮은 친화력를 가진 펩타이드를 이용하여 빠른 시간안에 높은 친화성 및 특이성을 가진 신약후보를 만들 수 있는 기술이 될 것으로 기대된다.
한편, GPCRs(G protein-coupled receptors)의 패밀리는 적어도 250 멤버를 포함한다 (Strader et al . FASEB J. , 9:745-754(1995); Strader et al. Annu. Rev. Biochem. , 63:101-32(1994)). 인간 유전자의 1%가 GPCRs 를 코딩하는 것으로 예측되고 있다. GPCR 에 리간드가 결합하면, GPCR 은 G proteins (guanine nucleot i de-binding proteins)을 활성화 시켜 세포 내 시그널링 경로를 조절한다.
생체 내에서 GPCR 들은 다양한 생리 또는 병리현상을 매개하는 과정에서 중추적인 역할을 수행하는 것으로 알려져 있다. 따라서 GPCR 에 대한 연구는 현재 학술적인 연구대상으로서 뿐만 아니라 신약개발의 중요한 target으로 이용되고 있다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 상세한 설명】
본 발명자들은 본 발명자들은 GPCR 결합성 및 특이성에 기초하여 다양한 물질들을 세포 내 또는 세포 표면에 운반할 수 시스템을 개발하고자 노력하였다. 그 결과, 비교적 리지드 (rigid)한 펩타이드 골격을 가지는 구조안정화 부위의 양 말단에 무작위적 (random)으로 펩타이드를 결합시키고 이 두 펩타이드를 공동으로 GPCR 분자에 결합시키는 경우에는 크게 증가된 결합능 및 특이성을 가지는 바이포달 펩타이드 바인더 (BPB)를 얻을 수 있음을 확인함으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 GPCR(G protein-coupled receptor )- 바이포달 펩타이드 바인더 (GPCR-BPB)를 제공하는 데 있다.
본 발명의 다른 목적은 GPCR(G protein-coupled receptor)-바이포달 펩타이드 바인더 (GPCR-BPB)를 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다. 본 발명의 일 양태에 따르면, 본 발명은 다음을 포함하는 GPCR(G protein-coupled receptor)—바이포달 펩타이드 바인더 (GPCR-BPB)을 제공한다:
(a) 가닥간 (interstrand) 비공유결합이 형성된 패러럴 (paral lei ) , 안티패러럴 (antiparallel) 또는 패러럴 (parallel)과 안티패러럴 (antiparallel) 아미노산 가닥들을 포함하는 구조 안정화 부위 (structure stabilizing region); 및
(b) 상기 구조 안정화 부위의 양 말단에 결합되어 있고 무작위적으로 선택된 각각 n 및 m개의 아미노산을 포함하는 GPCR-타겟 결합 부위 KGPCR- target binding region I) 및 GPCR-타겟 결합 부위 Π (GPCR-target binding region Π)를 포함하는 GPCR 에 특이적으로 결합하는 GPCR-바이포달 펩타이드 바인더 .
본 발명자들은 본 발명자들은 GPCR 결합성 및 특이성에 기초하여 다양한 물질들을 세포 내 또는 세포 표면에 운반할 수 시스템을 개발하고자 노력하였다ᅳ 그 결과, 비교적 리지드 (rigid)한 펩타이드 골격을 가지는 구조안정화 부위의 양 말단에 무작위적 (random)으로 펩타이드를 결합시키고, 이 두 펩타이드를 공동으로 GPCR 분자에 결합시키는 경우에는 크게 증가된 결합능 및 특이성을 가지는 바이포달 펩타이드 바인더 (BPB)를 얻을 수 있음을 확인하였다ᅳ
본 발명의 기본적인 전략은 리지드한 펩타이드 골격의 양 말단에 타겟에 결합되는 펩타이드를 연결하는 것이다. 이 경우 리지드한 펩타이드 골격은 바이포달 펩타이드 바이더의 전체적인 구조를 안정화시키는 작용을 하며, 타겟 결합 부위 I 및 타겟 결합 부위 Π가 타겟 분자에 결합되는 것을 강화시킨다。
본 발명에서 이용 가능한 구조안정화 부위는 패러럴, 안티패러럴 또는 패러럴과 안티패러럴 아미노산 가닥들을 포함하며, 가닥간 (interstrand) 수소결합, 정전기적 상호작용, 소수성상호작용, 반데르 발스 상호작용, 파이 -파이 상호작용, 양이은 -파이 상호작용 또는 이들의 조합에 의한 비공유결합이 형성되는 단백질 구조 모티프들을 포함한다. 가닥간 수소결합, 정전기적 상호작용, 소수성상호작용, 반데르 발스 상호작용, 파이 -파이 상호작용, 양이온 -파이 상호작용 또는 이들의 조합에 의한 형성되는 비공유결합은 구조안정화 부위의 견고성 (rigidity)에 기여한다.
본 발명의 바람직한 구현예에 따르면, 구조안정화 부위에서의 가닥간 (interstrand) 비공유결합은 수소결합, 소수성상호작용, 반데르 발스 상호작용, 파이 -파이 상호작용 또는 이들의 조합을 포함한다.
선택적으로, 구조화안정화 부위에 공유결합이 있을 수 있다. 예를 들어, 구조화안정화 부위에 이황화결합을 형성시켜 구조안정화 부위의 견고성을 더 증가시킬 수 있다. 이러한 공유결합에 의한 견고성 증가는 바이포달 펩타이드 바인더의 타겟에 대한 특이도 및 친화도를 고려하여 부여한다.
본 발명의 바람직한 구현예에 따르면, 구조 안정화 부위의 아미노산 가닥들은 링커로 연결되어 있다. 본 명세서에서 가닥을 언급하면서 사용되는 용어 "링커" 는 가닥과 가닥을 연결시켜 주는 물질을 의미한다. 예컨대, 구조안정화 부위로서 β-헤어핀이 이용되는 경우에는 _헤어핀에 있는 턴 서열이 링커의 역할을 하며, 루이신 지퍼가 이용되는 경우에는 루이신 지퍼의 두 C-말단을 연결하는 물질 (예컨대, 펩타이드 링커)이 링커의 역할을 한다.
링커는 패러럴, 안티패러럴 또는 패러럴과 안티패러럴 아미노산 가닥들을 연결한다. 예컨대, 패러럴 방식으로 정렬된 최소 2 개의 가닥 (바람직하게는 2 개의 가닥), 안티패러럴 방식으로 정렬된 최소 2 개의 가닥 (바람직하게는 2 개의 가닥), 패러럴 및 안티패러럴 방식으로 정렬된 최소 3개의 가닥 (바람직하게는 3개의 가닥)을 링커가 연결하게 된다.
본 발명의 바람직한 구현예에 따르면, 링커는 턴 서열 또는 펩타이드 링커이다。
본 발명의 바람직한 구현예에 따르면, 상기 턴 서열은 -턴, 턴, α一턴, π—턴 또는 ω一 loop 이다 (Venkatachalam CM (1968) , Biopolymers, 6, 1425-1436; Nemethy G and Printz MP. (1972), Macro/no I ecu J es, 5, 755- 758; Lewis PN et al . , (1973), Biochi . Biophys. Acta, 303, 211-229; Toniolo C. (1980) CRC Crit. Rev. Biochem. , 9, 1-44; Richardson JS. (1981), Adv. Protein Chem. , 34, 167-339; Rose GD et al . , (1985), Adv. Protein Chem. , 37, 1-109; Milner-White EJ and Poet R. (1987), TIBS, 12, 189-192; Wilmot CM and Thornton JM. (1988), J. Mol. Biol. , 203,.221- 232; Milner-White EJ. (1990), J. Mol. Biol. , 216, 385-397; Pavone V et al. (1996), Biopolymers, 38, 705-721; Rajashankar KR and Ramakumar S. (1996), Protein Sci . , 5, 932-946) . 가장 바람직하게는, 본 발명에서 이용되는 턴 서열은 β-턴이다.
턴 서열로서 β-턴이 이용되는 경우, 바람직하게는 타입 I, 타입 1', 타입 Π, 타입 Π', 타입 m 또는 타입 ΙΠ' 턴 서열이고, 보다 바람직하게는 타입 I, 타입 1', 타입 Π, 타입 π' 턴 서열이고, 보다 더 바람직하게는 타입 Γ 또는 타입 π' 턴 서열이며, 가장 바람직하게는 타입 턴 서열이다 (B. Lᅳ Sibanda et alᅳ , J. Mol. Biol. , 1989, 206, 4, 759- 777; B. L. Sibanda et al. , Methods Enzymol . , 1991, 202, 59—82).
본 발명의 다른 바람직한 구현예에 따르면, 본 발명에서 턴 서열로서 이용될 수 있는 것은 H. Jane Dyson et al ., Eur. J. Biochem. 255:462- 471(1998)에 개시되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다. 턴 서열로 이용될 수 있는 것은 다음의 아미노산 서열을 포함한다: X-Pro- Gly-Glu-Val; Ala-X-Gly-Glu-Val (X는 20 개의 아미노산으로부터 선택된다). 본 발명의 일 구현예에 따라, 구조안정화 부위로서 β_쉬트 또는 루이신 지퍼가 이용되는 경우, 패러럴 방식으로 정렬된 2 개의 가닥 또는 안티패러럴 방식으로 정렬된 2 개의 가닥을 펩타이드 링커가 연결하는 것이 바람직하다.
펩타이드 링커는 당업계에 공지된 어떠한 것도 이용 가능하다. 적합한 펩타이드 링커의 서열은 다음과 같은 요소를 고려하여 선택될 수 있다: (a) 유연한 연장된 컨포메이션 (flexible extended conformat ion)에 적용될 수 있는 능력; (b) 생물학적 타겟 분자와 상호작용 하는 이차구조를
생성하지 않는 능력; 및 (C) 생물학적 타겟 분자와 상호작용하는 소수성 잔기 또는 전하를 갖는 잔기의 부재. 바람직한 펩타이드 링커는 Gly, Asn 및 Ser 잔기를 포함한다. Thr 및 Ala 과 같은 다른 중성 아미노산들도 링커 서열에 포함될 수 있다. 링커에 적합한 아미노산 서열은 Maratea et al. , Gene 40: 39-46 ( 1985); Murphy et al. , Proc. Natl. Acad Sci . USA 83:8258-8562(1986); 미국 특허 제 4,935,233 호 제 4,751,180 호 및 제 5,990,275 호에 개시되어 있다. 펩타이드 링커 서열은 1-50 아미노산 잔기로 구성될 수 있다.
본 발명의 바람직한 구현예에 따르면, 구조안정화 부위는 β-헤어핀 링커로 연결된 β-쉬트 또는 링커로 연결된 루이신 지퍼이고, 보다 바람직하게는 구조안정화 부위는 β-헤어핀 또는 링커로 연결된 - 쉬트이며, 가장 바람직하게는 β-헤어핀이다.
본 명세서에서 용어 "β-헤어핀 " 은 두 개의 β 가닥을 포함하는 가장 간단한 단백질 모티프를 의미하며, 이 두 개의 β 가닥은 서로 안티패러럴한 정렬을 나타낸다. 이 β-헤어핀에서 두 개의 β 가닥은 일반적으로 턴 서열에 의해 연결된다.
바람직하게는, β—헤어핀에 적용되는 턴 서열은 타입 I, 타입 Γ , 타입 π, 타입 π', 타입 m 또는 타입 m' 턴 서열이고, 보다 바람직하게는 타입 I, 타입 Γ, 타입 Π, 타입 π' 턴 서열이고, 보다 더 바람직하게는 타입 Γ 또는 타입 Π ' 턴 서열이며, 가장 바람직하게는 타입 턴 서열이다。 또한, X-Pro-Gly-Glu-Val; 또는 Ala-X-Gly-Glu-Val (X는 20 개의 아미노산으로부터 선택된다)으로 표시되는 턴 서열도 β-헤어핀에 이용될 수 있다.
본 발명의 예시적인 실시예에 따르면, 타입 I 턴 서열은 Asp-Asp- Ala-Thr-Lys-Thr 이고, 타입 Γ 턴 서열은 Glu-Asn-Gly-Lys 이며, 타입 Π 턴 서열은 X-Pn>-Gly-Glu-Val; 또는 Ala— X-Gly-Glu-Val (X 는 20 개의 아미노산으로부터 선택된다)이고, 타입 Π ' 턴 서열은 Ghi"Gly-Asn-Lys 또는 Glu-D— Pro-Asn-Lys이다.
β-헤어핀 콘포메이션을 갖는 펩타이드는 당업계에 잘 알려져 있다. 예를 들어, 미국 특허 제 6,914,123호 및 Andrea G. Cochran et al ., PNAS, 98(10) :5578-5583)에 개시되어 있는 트립토판 지퍼 , W0 2005/047503 에
개시되어 있는 주형-고정된 β_헤어핀 미멕틱, 미국 특허 제 5,807,979호에 개시되어 있는 β-헤어핀 변형체들이 잘 알려져 있다. 이외에도, β— 헤어핀 콘포메이션을 갖는 펩타이드는 Smith & Regan (1995) Science 270:980-982; Chou & Fassman (1978) Annu. Rev. Biochem. 47 :251-276; Kim & Berg (1993) Nature 362:267-270; Minor & Kim (1994) Nature 367: 660- 663; Minor & Kim (1993) Nature 371:264-267; Smith et al . Biochemistry (1994) 33:5510-5517; Searle et al . (1995) Nat. Struct. Biol. 2:999- 1006; Haque & Gel 1 man (1997) J. Am. Chem. Soc. 119:2303—2304; Blanco et al. (1993) J. Am. Chem. Soc. 115:5887-5888; de Alba et al. (1996) Fold. Des. 1: 133-144; de Alba et al . (1997) Protein Sci. 6:2548-2560; Ramirez-Alvarado et al . (1996) Nat. Struct. Biol. 3 :604-612; St anger & Gel 1 man (1998) J. Am. Chem. Soc. 120:4236-4237; Maynard & Searle (1997) Chem. Commun. 1297-1298; Griffiths-Jones et al . (1998) Chem. Commun. 789-790; Maynard et al. (1998) J. Am, Chem. Soc. 120:1996- 2007; 및 Blanco et al. (1994) Nat. Struct. Biol. 1: 584-590 에 개시되어 있으며, 상기 문헌은 본 명세서에 참조로서 삽입된다.
β_헤어핀 콘포메이션을 갖는 펩타이드를 구조안정화 부위로 이용하는 경우 가장 바람직하게는 트립토판 지퍼를 이용한다.
본 발명의 바람직한 구현예에 따르면, 본 발명에서 이용되는 트립토판 지퍼는 다음 일반식 I로 표시된다:
일반식 I
X1-Trp(X2)X3-X4-X5(X'2)X6-X7
¾은 Ser 또는 Gly-Glu이고, ¾ 및 X'2는 서로 독립적으로 Thr, His, Val, lie, Phe 또는 Tyr 이며, X3는 Trp 또는 Tyr 이고, ¾는 타입 I, 타입 r , 타입 π , 타입 π ' 또는 타입 m또는 타입 m' 턴 서열이고, ¾는 Trp 또는 Phe이며, ¾는 Trp 또는 Val이고, X7는 Lys 또는 Thr-Glu이다.
보다 바람직하게는, 상기 일반식 I에서 ¾은 ser 또는 Gly-Glu이고,
X2 및 X'2 는 서로 독립적으로 Thr, His 또는 Val 이며, ¾ 는 Trp 또는 Tyr 이고, X4는 타입 I, 타입 Γ, 타입 Π 또는 타입 Π ' 턴 서열이고, ¾는 Trp 또는 Phe이며 , ¾는 Trp 또는 Val이고, X7는 Lys 또는 Thr-Glu이다.
보다 더 바람직하게는, 일반식 I 에서 Xl은 Ser 또는 Gly-Glu 이고, X2 및 X'2는 서로 독립적으로 Thr, His 또는 Val 이며, ¾는 Trp이고, 는 타입 I, 타입 Γ, 타입 Π 또는 타입 Π' 턴 서열이고, ¾는 Trp이며, ¾는 Trp이고, X7는 Lys또는 Thr-Glu이다.
보다 더욱 더 바람직하게는, 일반식 I 에서 ¾은 Ser 이고, ¾ 및
X'2는 Thr 이며, ¾는 Trp 이고, 는 타입 Γ 또는 타입 Π ' 턴 서열이고, ¾는 Trp이며, ¾는 Trp이고, X7는 Lys이다.
가장 바람직하게는, 일반식 I 에서 은 Ser 이고, ¾ 및 X'2 는 Thr 이며 , ¾는 Trp 이고, 는 타입 Γ 턴 서열 (ENGK) 또는 타입 Π ' 턴 서열 (EGNK)이고, ¾는 Trp이며, ¾는 Trp이고, X7는 Lys이다.
본 발명에 적합한 트립토판 지퍼의 예시적인 아미노산 서열은 서열목록 제 1서열 내지 제 3서열 및 제 5서열 내지 제 10서열에 기재되어 있다.
본 발명에서 구조안정화 부위로서 이용가능한 β-헤어핀 펩타이드는 단백질 G의 B1도멘인으로부터 유래된 펩타이드, 즉 GB1 펩타이드이다. 본 발명에서 GB1 펩타이드가 이용되는 경우, 바람직하게는 구조안정화 부위는 다음 일반식 Π로 표시된다:
일반식 Π
Xi-Trp-X2-Tyr-X3-Phe-Thr-Va 1 -X4
¾은 Arg, Gly-Glu또는 Lys-Lys이고, X2는 Gin또는 Thr이며, ¾는 타입 I, 타입 1', 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, X4는 Gin, Thr-Glu또는 Gln-Glu이다.
보다 바람직하게는, 일반식 π의 구조안정화 부위는 다음 일반식
ΙΓ으로표시된다:
일반식 Π
¾은 Gly-Glu 또는 Lys-Lys 이고, ¾는 타입 I, 타입 1', 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, ¾ 는 Thr-Glu 또는 Gln-Glu이다.
본 발명에 적합한 GB1 -헤어핀의 예시적인 아미노산 서열은 서열목록 제 4서열 및 제 14서열 내지 제 15서열에 기재되어 있다.
본 발명에서 구조안정화 부위로서 이용 가능한 β-헤어핀 펩타이드는
HP 펩타이드이다. 본 발명에서 HP 펩타이드가 이용되는 경우, 바람직하게는 구조안정화 부위는 다음 일반식 m으로 표시된다:
일반식 m
Xi-X2-X3-Trp-X4-X5-Thr-X6-X7
¾은 Lys 또는 Lys-Lys이고, ¾는 Trp또는 Tyr이고, ¾는 Val 또는 Thr 이며, 는 타입 I, 타입 Γ, 타입 II, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, ¾는 Trp 또는 Ala 이며 , ¾는 Trp 또는 Val 이고, X7은 Glu또는 Gln-Glu이다.
본 발명에서 구조안정화 부위로서 이용 가능한 또 다른 β-헤어핀 펩타이드는 다음 일반식 IV로 표시된다:
일반식 IV
¾은 Lys-Thr 또는 Gly이고, X2는 Trp또는 Tyr 이고, ¾는 타입 I, 타입 Γ, 타입 II, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, 는 Thr-Glu또는 Gly이다.
일반식 ΠΙ 및 IV 의 β-헤어핀의 예시적인 아미노산 서열은 서열목록 계 11 서열 내지 제 12 서열, 제 15 서열 및 계 16 서열 내지 제 19서열에 기재되어 있다.
본 발명에 따르면, 구조안정화 부위로서 링커로 연결된 β-쉬트를 이용할 수 있다. β-쉬트 구조에서 패러럴 또는 안티패러럴한, 바람직하게는 안티패러럴한 두 개의 아미노산 가닥이 뻗은 구조 (extended form)로 되어 있으며, 아미노산 가닥사이에 수소 결합이 형성된다.
β-쉬트 구조에서 두 개의 아미노산 가닥의 인접한 두 말단은 링커에 의해 연결된다. 링커로서는 상술한 다양한 턴 -서열 또는 펩타이드 링커가 이용될 수 있다. 턴-서열이 링커로 이용되는 경우, β-턴 서열이 가장 바람직하다。
본 발명의 다른 변형예에 따르면, 구조안정화 부위로서 루이신 지퍼 또는 링커로 연결된 루이신 지퍼가 이용될 수 있다. 루이신 지퍼는 패러럴한 2 개의 α—사슬의 다이머화를 야기하는 보존성 펩타이드 도메인이며, 일반적으로 유전자 발현에 관여하는 단백질에 발견되는
다이머화 도메인이다 ("Leucine scissors" . Glossary of Biochemistry and Molecular Biology (Revised). (1997). Ed. David M. Glick. London: Portland Press; Landschulz WH, et al. (1988) Science 240:1759-1764). 루이신 지퍼는 일반적으로 헵태드 (heptad) 반복 서열을 포함하며, 루이신 잔기가 4 번째 또는 5 번째에 위치해 있다. 예를들어, 본발명에 이용될 수 있는 루이신 지퍼는 LEALKEK, LKALEKE, LKKLVGE, LEDKVEE, LENEVAR또는 LLSKNYH 의 아미노산 서열을 포함한다. 본 발명에서 이용되는 루이신 지퍼의 구체적인 예를 서열목록 제 39 서열에 기재되어 있다. 루이신 지퍼의 각각의 반은 짧은 α-사슬로 이루어져 있으며, α-사슬간의 직접적인 루이신 접촉이 있다. 전사인자에 있는 루이신 지퍼는 일반적으로 소수성 루이신 지퍼 부위 및 염기성 부위 (DNA 분자의 주 그루브와 상호작용하는 부위)로 이루어져 있다. 본 발명에서 루이신 지퍼가 이용되는 경우에는 염기성 부위는 반드시 필요로 하지 않는다. 루이신 지퍼 구조에서 두 개의 아미노산 가닥 (즉, 두 개의 α-사슬)의 인접한 두 말단은 링커에 의해 연결될 수 있다. 링커로서는 상술한 다양한 턴 -서열 또는 펩타이드 링커가 이용될 수 있으며, 바람직하게는 루이신 지퍼의 구조에 영향을 미치지 않는 펩타이드 링커가 이용된다. \ 상술한 구조안정화 부위의 양 말단에는 무작위 아미노산 서열이 결합된다. 상기 무작위 아미노산 서열이 GPCR-타겟 결합 부위 I 및 GPCR- 타겟 결합 부위 Π를 형성한다. 본 발명의 가장 큰 특징 중 하나는, 구조안정화 부위의 양쪽 말단에 GPCR-타겟 결합 부위 I 및 GPCR-타겟 결합 부위 Π를 연결하여 바이포달 방식으로 펩타이드 바인더를 제작하는 것이다. GPCR-타겟 결합 부위 I 및 GPCR-타겟 결합 부위 Π는 서로 협동적으로 (cooperatively) 타겟에 결합함으로써, GPCR 에 대한 친화도를 크게 증가시킨다。
GPCR-타겟 결합 부위 I 의 아미노산 개수 n 은 특별하게 제한되지 않으며, 바람직하게는 2-100 의 정수, 보다 바람직하게는 2-50 의 정수, 보다 더욱 더 바람직하게는 2-20 의 정수, 가장 바람직하게는 3-10 의 정수이다ᅳ
GPCR-타겟 결합 부위 Π의 아미노산 개수 m 은 특별하게 제한되지 않으며, 바람직하게는 2-100 의 정수, 보다 바람직하게는 2-50 의 정수,
보다 더욱 더 바람직하게는 2-20 의 정수, 가장 바람직하게는 3-10 의 정수이다.
GPCR-타켓 결합 부위 I 및 GPCR-타겟 결합 부위 Π에는 서로 각각 다른 또는 동일한 개수의 아미노산 잔기가 포함될 수 있다. GPCR-타겟 결합 부위 I 및 GPCR-타겟 결합 부위 Π에는 서로 각각 다른 또는 동일한 아미노산 서열이 포함될 수 있으며, 바람직하게는 서로 각각 다른 아미노산 서열이 포함된다.
GPCR-타겟 결합 부위 I 및 /또는 GPCR-타겟 결합 부위 Π에 포함되는 아미노산 서열은 선형의 아미노산 서열 또는 환형의 아미노산 서열이다. 타겟 결합 부위의 펩타이드 서열의 안정성을 증가시키기 위하여, GPCR-타겟 결합 부위 I 및 /또는 GPCR-타겟 결합 부위 Π에 포함되는 아미노산 서열 중에서 적어도 하나의 아미노산 잔기는 아세틸기, 플루오레닐 메록시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜 (PEG)로 변형될 수 있다.
생물학적 타겟 분자에 결합되는 본 발명의 GPCR— BPB 는 생체 내 생리학적 반웅의 조절, 생체 내 물질의 검출, 인 비보 분자 이미징, 인 비트로 세포 이미징 및 약물전달용 타겟팅을 하는 데 이용될 수 있으며, 에스코트 분자로도 이용될수 있다.
본 발명의 바람직한 구현예에 따르면, 구조 안정화 부위, GPCR-타켓 결합 부위 I 또는 GPCR-타겟 결합 부위 Π (보다 바람직하게는, 구조안정화 부위 보다 더 바람직하게는 구조안정화 부위의 링커)에 카르고가 결합되어 있다. 상기 카르고의 예는 검출가능한 신호를 발생시키는 레이블, 화학약물, 바이오약물 또는 나노입자를 포함하나, 이에 한정되는 것은 아니다.
상기 검출가능한 신호를 발생시키는 레이블은 T1 조영물질 (예컨대,
Gd 킬레이트 화합물), T2 조영물질 (예컨대, 초상자성 물질 (예: 마그네타이트, Fe304, y-Fe203, 망간 페라이트, 코발트 페라이트 및 니켈 페라이트)), 방사성 동위 원소 (예컨대, UC, 150, 13N, P32, S35, 44Sc, 45Ti,
1181, 136La, 198T1 , 200Τ1, 205Bi 및 206Bi), 형광물질 (플루오리신 (fluorescein), 피코에리트린 (phycoerythrin) , 로다민, 리사민
(lissamine), 그리고 Cy3 와 Cy5), 화학발광단, 자기입자, 매스 표지 또는 전자밀집입자를 포함하나 이에 제한되는 것은 아니다.
상기 화학약물은 예를 들어, 항염증제, 진통제, 항관절염제, 진경제, 항우울증제, 항정신병약물, 신경안정제, 항불안제, 마약길항제, 항파킨스질환 약물, 콜린성 아고니스트, 항암제, 항혈관신생억제제, 면역억제제, 항바이러스제, 항생제, 식욕억제제, 진통제, 항콜린제, 항히스타민제, 항편두통제, 호르몬제, 관상혈관, 뇌혈관 또는 말초혈관 확장제, 피임약, 항혈전제, 이뇨제, 항고혈압제, 심혈관질환 치료제, 미용성분 (예컨대, 주름개선제, 피부노화 억제제 및 피부미백제) 등을 포함하나, 이에 한정되는 것은 아니다.
상기 바이오약물은 인슐린, IGF-K insulin— like growth factor 1), 성장호르몬, 에리쓰로포이에틴, G-CSFs (granulocyte-colony stimulating factors) , GM-GSFs ( gr anu 1 ocy t e/ macr ophage-co 1 ony stimulating factors) , 인터페론 알파, 인터페론 베타, 인터페론 감마, 인터루킨 -1 알파 및 베타, 인터루킨— 3, 인터루킨 -4, 인터루킨 -6, 인터루킨 -2, EGFs (epidermal growth factors) , 칼시토닌 (calcitonin) , ACTH (adrenocorticotropic hormone) , TNF (tumor necrosis factor) , 아토비스반 (atobisban) , 부세레린 (buserel in) , 세트로렉릭스 (cetrorel ix) , 데스로레린 (deslorel in) , 데스모프레신 (desmopressin), 디노르판 A (dynorphin A) (1-13), 엘카토닌 (elcatonin), 엘레이도신 (eleidosin) , 엡티피바타이드 (eptifibatide), GHRH-I I (growth hormone releasing hormone-II) , 고나도레린 (gonadorelin) , 고세레린 (goserel in), 히스트레린 (histrelin), 류프로레린 ( leuprorelin), 라이프레신 ( lypressin), 옥트레오타이드 (octreotide), 옥시토신 (oxytocin), 피트레신 (pitressin) , 세크레틴 (secretin), 신칼라이드 (sincal ide), 테르리프레신 (terl ipressin), 티모펜틴 (thymopentin), 티모신 (thymosine) αΐ, 트리프토레린 (triptorelin), 바이발리루딘 (bivalirudin), 카르베토신 (carbetocin), 사이클로스포린, 엑세딘 (exedine) , 란레오타이드 (lanreotide), LHRH ( luteinizing hormone一 re leasing hormone) , 나파레린 (nafarelin), 부갑상선 호르몬, 프람린타이드 (pramlintide), T-20 (enfuvirtide), 타이말파신 (thymalfasin), 지코노타이드, RNAᅳ DNA, cDNA,
안티센스 올리고뉴클레오티드 및 siRNA 가 될 수 있으나, 이에 한정되지는 않는다.
GPCR-타겟 결합 부위 I 및 /또는 GPCR-타겟 결합 부위 Π는 GPCR 에 결합하는 아미노산서열을 포함한다.
본 발명의 BPB 분자가 결합하는 GPCR 은 당업계에 공지된 다양한
GPCR을포함하며 , 바람직하게는 Class A (or 1) (Rhodopsin-1 ike) , Class B (or 2) (Secretin receptor family), Class C (or 3) (Metabotro ic glutamate/pheromone) , Class D (or 4) (Fungal mating pheromone receptors) , Class E (or 5) (Cyclic AMP receptors) 및 Class F (or 6) (Frizzled/Smoothened) GPCRs 를 포함하며, 보다 바람직하게는 a luteinizing hormone receptor , a follicle stimulating hormone receptor , a thyroid stimulating hormone receptor , a calcitonin receptor, a glucagon receptor , a glucagonᅳ 1 ike peptide 1 receptor (GLPᅳ 1), a metabotropic glutamate receptor, a parathyroid hormone receptor , a vasoactive intestinal peptide receptor , a secret in receptor , a growth hormone releasing factor (GRF) receptor , protease— activated receptors (PARs) , cholecystokinin receptors, somatostatin receptors, melanocortin receptors , ADP receptors, adenosine receptors, thromboxane receptors , platelet activating factor receptor , adrenergic receptors , 5-HT receptors , CXCR4 , CCR5, chemokine receptors , neuropeptide receptors, opioid receptors, parathyroid hormone (PTH) receptor , ghrel in receptor 및 vasoactive intestinal peptide (VIP) receptor , formyl peptide receptor , sex peptide receptor를 포함한다。
본 발명의 GPCR-BPB 는 GPCR, 바람직하게는 GPCR 의 세포외 도메인에 결합하여 GPCR 에 대한 아고니스트 또는 안타고니스트 작용을 한다. GPCR 에 대한 아고니스트는 GPCR 에 의해 촉발되는 세포 내 시그널링을 촉진하며 , GPCR 에 대한 안타고니스트는 GPCR 에 의해 촉발되는 세포 내 시그널링을 억제하는 작용을 한다.
본 발명의 GPCR-BPB 는 세포 표면에 노출된 GPCR 의 세포외 도메인에 결합할 수도 있지만, 세포 내 도메인에도 결합하여 GPCR 의 작용을 조절할 수 있다.
GPCR-BPB 가 세포 내 도메인을 타겟팅 하는 경우, 바람직하게는 GPCR-BPB는 추가적으로 세포막투과 펩타이드 (CPP)를 포함한다.
상기 CPP 는 당업계에 공지된 다양한 CPP 를 포함하며, 예를 들어 HIV-1 Tat 단백질, 을리고알지닌, ANTP 펩타이드, HSV VP22 전사조절단백질, vFGF에서 유래된 MTS펩타이드, Penetratin, Transport an, Pep-1 펩타이드, Pep-7 펩타이드, Buforin II, MAP (model amphi hatic peptide), k-FGF , Ku 70, pVEC, SynBl 또는 HN-1 를 포함하나, 이에 한정되는 것은 아니다. 상기 CPP를 바이포달 펩타이드에 결합시키는 방법은 다양한 방법이 있으며 , 예를 들어 바이포달 펩타이드의 구조 안정화 부위에 있는 루프 부분의 라이신 잔기와 CPP를 공유결합 시킨다.
상술한 바와 같이, 본 발명의 바이포달 펩타이드 바인더는 전형적으로 "N-GPCR-타겟 결합 부위 I-구조안정화 부위의 한 가닥-링커- 구조안정화 부위의 다른 가닥 -GPCR-타겟 결합 부위 Π— C"의 컨스트럭트를 갖는다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 GPCR-바이포달 펩타이드 바인더에서 GPCR-타겟 결합 부위 I 과 구조안정화 부위의 한 가닥 사이 및 /또는 구조안정화 부위의 다른 가닥 -GPCR-타겟 결합 부위 Π 사이에는, GPCR-타겟 결합 부위와 구조안정화 부위 간의 상호 구조적 영향을 차단하는 구조영향 억제부위 (structure influence inhibiting region)를 포함한다. 회전 부위에는 펩타이드 분자에서 ^와 ¾ ^의 회전이 비교적 자유로운 아미노산이 위치한다. 바람직하게는, ø와 ^의 회전이 비교적 자유로운 아미노산은 글라이신, 알라닌 및 세린이다. 구조영향 억제부위에는 1-10 개, 바람직하게는 1-8 개 , 보다 바람직하게는 1-3 개의 아미노산 잔기가 위치할 수 있다.
상술한 컨스트럭트를 갖는 본 발명의 GPCR-바이포달 펩타이드 바인더의 라이브러리는 당업계에 공지된 다양한 방법으로 얻을 수 있다. 이 라이브러리에서 GPCR-바이포달 펩타이드 바인더는 무작위 서열을 갖게 되며, 이는 GPCR-타겟 결합 부위 I 및 /또는 GPCR-타켓 결합 부위 Π의 어떤 위치에서도 서열 선호도 (sequence preference)가 없거나 또는 지정 (또는 고정)된 아미노산 잔기가 없다는 것을 의미한다.
예를 들어, GPCR-바이포달 펩타이드 바인더의 라이브러리는 고상지지체 (예컨대, 폴리스틸렌 또는 폴리아크릴아미드 수지) 상에서 실시되는 스플리트 -합성 방법 (Lam et al. (1991) Nature 354: 82; WO 92/00091)에 따라 구축될 수 있다.
본 발명의 바람직한 구현예에 따르면, GPCR-바이포달 펩타이드 바인더의 라이브러리는 세포 표면 전시 (ceii surface display)방식 (예컨대 , 파아지 디스플레이, 박테리아 디스플레이 또는 이스트 디스플레이)으로 구축된다. 바람직하게는, GPCR-바이포달 펩타이드 바인더의 라이브러리는 플라스미드, 박테리오파아지, 파아지미드, 이스트, 박테리아, mRNA 또는 라이보좀을 기반으로 하는 디스플레이방법을 통하여 제작될 수 있다ᅳ
파아지 디스플레이는 파아지의 표면 상의 코트 단백질에 융합된 단백질 형태로 다양한 폴리펩타이드를 디스플레이하는 기술이다 (Scott, J. K. and Smith, G. P. (1990) Science 249: 386; Sambrook, J. et al . , Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press(2001); Clacks on and Lowman , Phage Display, Oxford University Press(2004)). 필라멘트성 파아지 (예컨대, M13)의 유전자 ΠΙ 또는 유전자 珊에 발현하고자 하는 유전자를 융합시켜 무작위 펩타이드를 디스플레이한다.
파이지 디스플레이에는 파아지미드가 이용될 수 있다. 파아지미드는 박테리아의 복제원점 (예컨대, ColEl) 및 박테리오파아지의 인터제닉 (intergenic) 부위의 한 카피를 갖는 플라스미드 백터이다. 이 파아지미드에 클로닝된 DNA 단편은 플라스미드처럼 증식된다。
GPCR-바이포달 펩타이드 바인더의 라이브러리를 파아지 디스플레이 방식으로 구축하는 경우, 본 발명의 바람직한 구현예는 다음의 단계를 포함한다: (0 파아지 코트 단백질 (예컨대, M13 과 같은 필라멘트성 파아지의 유전자 m 또는 유전자 覆 코트 단백질)을 코딩하는 유전자와 바이포달 템타이드 바인더를 코딩하는 유전자가 융합된 융합 유전자; 및 상기 융합 유전자에 작동적으로 결합된 전사 조절 서열 (예컨대, lac 프로모터)을 포함하는 발현 백터의 라이브러리를 제작하는 단계; (Π) 상기 발현 백터 라이브러리를 적합한 숙주 세포에 도입시키는 단계; (iii) 상기 숙주세포를 배양하여 재조합 파아지 또는 파아지미드 바이러스 파티클을
형성시켜 융합 단백질이 표면에 디스플레이 되도록 하는 단계; (iv) GPCR 분자와 상기 바이러스 파티클을 접촉시켜 파티클을 타겟 분자에 결합시키는 단계; 및 (V) GPCR분자에 결합하지 않은 파티클을 분리하는 단계.
파아지 디스플레이를 이용하여 펩타이드 라이브러리를구축하고 이들 라이브러리를 스크리닝 하는 방법은 미국 특허 제 5,723,286 호, 제 5,432,018 호, 제 5,580,717 호, 제 5,427,908 호, 제 5,498,530 호, 제 5,770,434 호, 제 5,734,018 호, 제 5,698,426 호, 제 5,763,192 호 및 제 5,723,323호에 개시되어 있다,
바이포달 템타이드 바인더를 유전자를 포함하는 발현 백터를 제작하는 방법은 당업계에 공지된 방법에 따라 실시될 수 있다. 예를 들어, 공지의 파아지미드 또는 파아지 백터 (예컨대, pIGT2, fUSE5, fAFFl, fd-CATl, m663, fdtetDOG, HENl, pComb3, pComb8, pCANTAB 5E (Pharmacia) LamdaSurfZap, pIF4, PM48, PM52, PM54, fdH 및 p8V5)에 바이포달 펩타이드 바인더를 유전자를 삽입시켜 발현 백터를 제작할 수 있다.
대부분의 파아지 디스플레이 방법이 필라멘트성 파아지를 이용하여 실시되지만, 람다 파아지 디스플레이 (W0 95/34683; 미국 특허 제 5,627,024호), T4파아지 디스플레이 (Ren et al, (1998) Gene 215: 439; Zhu (1997) CAN 33:534) 및 T7 파아지 디스플레이 (미국 특허 제 5,766,905호)도 바이포달 펩타이드 바인더의 라이브러리를 구축하는 데 이용될 수 있다.
백터 라이브러리를 적합한 숙주 세포에 도입시키는 방법은 다양한 형질전환 방법에 따라 실시될 수 있으며 , 가장 바람직하게는 전기천공 (electroporation) 방법에 따라 실시된다 (참조: 미국 특허 제 5,186,800호, 제 5,422,272호, 제 5,750,373호), 본 발명에 적합한 숙주는 세포는 E. coli 와 같은 그람 음성 박테리아 세포이며, 적합한 E. coli숙주는 JM101, E. coli 12 strain 294, E. coli strain W3110 및 E. coli XL-lBlue (Stratagene)을 포함하나, 이에 한정되는 것은 아니다ᅳ 숙주세포는 형질전환 전에 컴피턴스 세포로 준비하는 것이 ti "람직하다 (Sambrook, J. et al,, Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press(2001)) . 형질전환된 세포의 선별은 일반적으로 항생제 (예컨대, 테트라사이클린 및 암피실린)를 포함하는
배지에서 배양하여 실시된다. 선별된 형질전환 세포를 헬퍼 파아지의 존재 하에서 추가적으로 배양하여 재조합 파아지 또는 파아지미드 바이러스 파티클을 생성시킨다. 상기 헬퍼 파아지 파아지로 적합한 것은, Ex 헬퍼 파아지, M13-K07, M13-VCS 및 R408을 포함하나, 이에 한정되는 것은 아니다. 생물학적 타겟 분자와 결합하는 바이러스 파티클의 선별은 통상적으로 바이오패닝 과정을 통하여 실시될 수 있다 (Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001); Clackson and Lowman , Phage Display, Oxford University Press(2004)).
본 발명의 또 다른 양태에 따르면 , 본 발명은 상술한 GPCR-바이포달 펩타이드 바인더를 코딩하는 핵산 분자를 제공한다.
본 발명의 다른 양태에 따르면, 본 발명은 GPCR-바이포달 펩타이드 바인더를 코딩하는 핵산 분자를 포함하는 GPCR-바이포달 펩타이드 바인더의 발현용 백터를 제공한다.
본 발명의 다른 양태에 따르면, 본 발명은 GPCR-바이포달 펩타이드 바인더의 발현용 백터를 포함하는 형질전환체를 제공한다.
본 명세서에서 용어 "핵산 분자" 는 DNA (gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 갖으며, 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드뿐만 아니라, 당 또는 염기 부위가 변형된 유사체 (analogue)도 포함한다 (Scheit, Nucleotide Analogs,
John Wiley, New York (1980); Uhlman 및 Peyman , Chemical Reviews,
90:543-584(1990)).
본 발명의 바람직한 구현예에 따르면, 본 발명의 백터는 GPCR- 바이포달 펩타이드 바인더를 코딩하는 핵산 분자 이외에 상기 핵산 분자에, 전사를 진행시킬 수 있는 강력한 프로모터 (예컨대, tac 프로모터, lac 프로모터, /adJV5 프로모터, lpp 프로모터, pL 프로모터, p /프로모터, ra > 프로모터, 卿프로모터, recA프로모터, SP6 프로머터, trp프로모터 및 T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사 /해독 종결 서열을 포함한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 백터는 GPCR- 바이포달 펩타이드 바인더를 코딩하는 핵산 분자의 5 '-방향쪽에 시그널
서열 (예컨대, pelB)를 추가적으로 포함할 수 있다. 또한, 본 발명의 바람직한 구현예에 따르면, 본 발명의 백터는 바이포달 펩ᅳ타이드 바인더가 파아지의 표면에 잘 발현되었는지를 확인하기 위한 태깅 서열 (예컨대, myc tag)을 추가적으로 포함한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 백터는 파아지 코트 단백질, 바람직하게는 M13 과 같은 필라멘트성 파아지의 유전자 m 또는 유전자 環 코트 단백질을 코딩하는 유전자를 포함한다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 백터는 박테리아의 복제원점 (예컨대, ColEl) 및 /또는 박테리오파아지의 복제원점을 포함한다. 한편, 본 발명의 백터는 선택표지로서 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함할 수 있으며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및 테트라사이클린에 대한 내성 유전자를 포함할 수 있다.
본 발명의 형질전환체는 바람직하게는 E. coli 와 같은 그람 음성 박테리아 세포이며, 적합한 E. coli숙주는 JM101, E. coli K12 strain 294 E. coli strain W3110 및 Ε· coli XL-lBlue (Stratagene)을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 백터를 숙주 세포 내로 운반하는 방법은, CaCl2 방법 (Cohen, S.N. et al . , Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), 하나한 방법 (Cohen, S.N. et al . , Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); 및 Hanahan, 으, J. Mo J. Biol., 166:557— 580(1983)) 및 전기 천공 방법 (미국 특허 제 5,186,800호, 제 5,422,272호 제 5, 750, 373호) 등에 의해 실시될 수 있다.
본 발명의 GPCR-바이포달 펩타이드 바인더는 매우 낮은 수준 (예컨대, nM 수준)의 KD 값 (해리상수)을 나타내어, GPCR 분자에 매우 높은 친화도를 나타내는 펩타이드를 제공한다, 하기 실시예에 기재된 바와 같이, 모노포달 방식으로 제작된 바인더와 비교하여 바이포달 템타이드 바인더는 약 102-105배 (바람직하게는, 약 103-104배) 높은 친화도를 나타낸다.
본 발명의 GPCR-바이포달 펩타이드 바인더는 의약으로서의 용도를 가질 뿐만 아니라, 생체 내 물질의 검출, 인 비보 분자 이미징, 인 비트로 세포 이미징 및 약물전달용 타겟팅을 하는 데 이용될 수 있으며, 에스코트 분자로도 이용될 수 있다.
본 발명의 특징 및 이점을요꺅하면 다음과같다:
( i ) 본발명은 GPCR에 특이적으로 결합하는 GPCR-BPB를 제공한다.
(ii) 본 발명의 GPCR-바이포달 펩타이드 바인더에서 구조안정성 부위의 양 말단에 결합되어 있는 이격된 (distal) 두 개의 GPCR-타겟 결합 부위는 서로 협동적으로 (cooperatively), 시너직 (synergetically)하게 타겟에 결합한다.
(iii) 이에, 본 발명의 6이바이포달 펩타이드 바인더는 매우 낮은 수준 (예컨대, nM 수준)의 KD 값 (해리상수)을 나타내어, 타겟에 매우 높은 친화도를 나타낸다.
(iv) 본 발명의 GPCR-BPB 는 생체 내 GPCR 에 결합하여 GPCR 에 대한 antagonist 또는 agonist 작용을 할 수 있다.
【도면의 간단한 설명】
도 la 는 구조안정화 부위로서 β-헤어핀 (hairpin)을 포함하는 바이포달 펩타이드 바인더 (bipodal-peptide binder) 및 GPCR-BPB 의 모식도를 나타낸다ᅳ
도 lb 는 구조안정화 부위로서 링커로 연결된 β-쉬트를 포함하는 GPCR— ΒΡΒ의 모식도를 나타낸다 .
도 lc 는 구조안정화 부위로서 링커로 연결된 루이신 지퍼를 포함하는 GPCR-BPB의 모식도를 나타낸다 .
도 Id 는 구조안정화 부위로서 링커로 연결된 루이신 -리치 모티프 (leucine-rich motif)를 포함하는 GPCR-BPB의 모식도를 나타낸다.
도 2 는 GPCR-BPB 라이브러리를 클로닝하기 위한 전략을 나타낸다。 pIGT2 파이지미드 백터 맵에서, pelB시그널서열, myc tag은 목적 유전자가 파아지의 표면에 잘 발현되었는지를 확인하기 위한 태깅 서열이다. 프로모터로서 lac 프로모터가 이용되었다.
도 3 은 sex peptide receptor-BPB 의 GPCR 에 대한 안타고니스트로 작용을 분석하기 위한 aequorin reporter gene assay 결과이다.
도 4 는 GPCR 단백질인 formyl peptide receptor like-1 단백질에 결합하는 바이포달 펩타이드 바인더 라이브러리의 구조를 나타내는 도면.
도 5 는 GPCR 단백질인 formyl peptide receptor like-1 에 대한 아고니스트로 작용을 분석하기 위한 aequorin reporter gene assay 결과이다.
【실시예】
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서 , 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 실시예
실시예 A. fruit fly sex peptide receptor 결합 바이포달 펩타이드 발굴
실험재료 및 실험방법
실시예 1: 라이브러리의 제작
바이포달펩타이드 바인더 유전자제작및파아지미드 백터에의삽입
두 개의 올리고뉴클레오티드 Beta— F1 ( 5 ' -TTCTATGCGGCCCAGCTGGCC (NNK)6GGATCTTGGACATGGGAAAACGGAAAA-3' ) 및 Beta-Bl (5'-
AACAGTTTCTGCGGCCGCTCCTCC TCC(MNN)6TCCCTTCCATGTCCATTTTCCGTT-3 ' ) (N 은 A, T, G또는 C; K 는 G 또는 T; M 은 C 또는 A)를 합성하였다. 이중 사슬을 만들기 위해서 Beta-Fl 4 μΜ, Beta-Bl 4 μΜ, 2.5 mM dNTP 흔합액 4 μΐ, ExTaq DNA 중합효소 1 ^(Takara, Seoul , Korea) 및 10XPCR 버퍼 5 μί를 흔합하여 총 50 ^가 되도록 증류수를 첨가한 흔합액을 총 25 개 만들었다. 이 흔합액을 PCR 반응 (94°C에서 5분, 60 싸이클: 3C C에서 30초, 72°C에서 30 초 및 72°C에서 7 분)을 하여 이중 사슬로 만든 후 PCR 정제 키트 (GeneAll, Seoul , Korea) 를 이용하여 정제하여, 바이포달 펩타이드 바인더 유전자를 얻었다. 바이포달 펩타이드 바인더에 삽입시킬 유전자를 pIGT2 파아지미드 백터 (Ig therapy, Chuncheon, Korea) 에 연결하기 위해 인서트 유전자와 pIGT2 파아지미드 백터에 제한효소를 처리하였다. 약 11
/g의 인서트 DNA 를 5///(New Engl nd Biolabs(NEB, Ipswich) 및 Λ¾ /(ΝΕΒ, Ipswich)으로 각각 4 시간 씩 반웅시킨 후 PCR 정제 키트를 이용하여 정제하였다. 또한, 약 40 ;/g의 pIGT2 파아지미드 백터를 Sfil 및 Notl 으로 각각 4 시간 씩 반응시킨 후 CIAPCCalf Intestinal Alkaline Phosphatase) (NEB, Ipswich)를 넣고 1 시간 동안 반응시킨 후, PCR 정제 키트를 이용하여 정제하였다. 이들을 UV-가시광선 분광기 (Ultrospec 2100pro, Amersham Bioscience)로 정량하여 2.9 /g의 인서트 유전자를 T4 DNA 리가아제 (Bioneer, Dae j eon, Korea)를 이용하여 IGT2 파아지미드 백터 12 과 18°C에서 15 시간 동안 연결한 후, 에탄을로 침전시켜 TE 버퍼 100 ^로 DNA를 용해시켰다. 컴피턴트 세포의 준비
E.coli XL1-BLUE 세포 (American Type Culture Col lection, Manassas, USA)를 LB 아가 -플레이트에 선상 도말하였다. 한천 평판 배지에서 자란 군락을 5 의 LB 배지에 접종한후 37°C에서 200 rpm의 속도로 흔합하면서 하루 동안 배양하였다. 배양된 10 ^의 세포들을 2 의 LB 배지에 접종하고 같은 방식으로 600 nm의 파장에서 흡광도가 0.3— 0.4가 될 때까지 배양하였다ᅳ 배양된 플라스크를 30 분 동안 얼음에 방치한 후, 4°C 에서 4,000X g로 20분 동안 원심 분리하여 가라앉은 세포들을 제외한 상층액을 모두 제거하고, 1 의 냉각된 멸균 증류수로 현탁시켰다. 이것을 다시 같은 방법으로 원심분리하고 상층액을 제거한 후, 1 의 냉각된 멸균 증류수로 재현탁시키고 같은 방식으로 10% 글리세를 용액 40 로 세척올 반복하여 원심 분리한 후, 마지막으로 10% 글리세를 용액 4 으로 현탁시킨 후, 200 ^씩 분주하여 액체 질소에 넁동시킨 뒤 -80°C에 보관하였다. 전기천공법
파아지미드 백터 12 과 바이포달 펩타이드 바인더에 인서트 DNA 2.9 i 을 연결 반응시킨 100 /^를 25개로 분주하여 전기 천공을 수행하였다. 컴피턴트 세포를 얼음 위에서 녹이고, 200 ^의 컴피턴트 세포를 연결 반응시킨 용액 4 ^와 흔합한 후, 넁각하여 준비된 0.2 cm 의 큐벳에 넣은
뒤 1 분 동안 얼음 위에 두었다. 전기 천공기 (BioRad, Hercules, CA)를 200 Ω에서 25 uF 및 2.5 kV 의 조건으로 프로그램하고 준비된 큐벳의 물기를 제거하고 전기 천공기에 위치시킨 후 펄스를 주었다 (시간 상수는 4.5-5 msec). 이후 즉시 37°C로 준비한 20 mM 의 글루코오스가 포함된 1 의 LB 액체배지에 넣고 얻어진 총 25 의 세포를 100 ra^ 시험관에 옮겼다. 한 시간 동안 37°C에서 200 rpm 의 속도로 흔합하며 배양한 후 라이브러리의 개수를 측정하기 위해 10 ^를 희석해서 암피실린 아가 배지에 도말하였다. 남은 세포를 1 «의 LB 에 20 mM 글루코오스 및 50 g/ 의 암피실린을 넣고 30°C에서 하루 동안 배양하였다. 4°C 에서 4,000Xg 로 20 분 동안 원심 분리하여 침전된 세포들을 제외한 상층액을 모두 제거하고, 40 의 LB 로 재현탁시킨 후 글리세를을 최종 농도 20% 이상 넣고 -80°C에 보관하였다. 라이브러리에서재조합파아지 생산과 PEG침전
-80°C에 저장된 바이포달 펩타이드 바인더 라이브러리에서 재조합 파아지를 생산하였다. 500 플라스크에 100 m£의 LB 액체배지에 암피실린 (50 μ /χΆί) 및 20 mM 의 글루코오스를 넣은 후, -80 °C 에 보관된 라이브러리 1 i 을 추가하여 한 시간 동안 37°C에서 150 rpm 의 속도로 흔합하며 배양하였다. 여기에 ixi0upfu 의 Ex 헬퍼 파아지 (Ig therapy, Chuncheon, Korea)를 넣고 다시 한 시간 동안 같은 조건으로 배양하였다. l,000Xg 로 10 분 동안 원심 분리하여 상층액을 제거하고 여기에 암피실린 (50 βg/vi) 및 카나마이신 (25 Mg/i )이 포함된 LB 액체배지 100 을 넣고 하루 동안 배양하여 재조합 파아지를 생산하였다. 배양액을 3,000Xg 로 10 분 동안 원심 분리하여 얻은 상층액 100 에 PEG/NaCl 25 111£을 흔합하고 얼음에 1 시간 동안 방치시킨 후, 4°C에서 20 분 동안 10, 000 X g로 원심 분리하여 상층액은 조심스럽게 제거하고 2 의 PBS(pH 7.4)로 펠렛을 재현탁시켰다. 실시예 2: 바이오 패닝
GPCR 의 단백질로서 fruit fly 의 sex peptide receptor 에 대하여 바이오 패닝을 하였다.
상기 실시예 1 에서 제작한 BPB(Bipodal -peptide binder) 라이브러리를 각각의 sex peptide receptor 유전자가 형질전환된 CH0-K1 세포에 대해 5 차에 걸쳐 바이오패닝을 실시하고 매 바이오패닝 차수마다 회수한 파아지 펩타이드들의 output phage/ input phage 비 (ratio)를 결정하였다. 매 회 바이오패닝과정에는 비 형질전환 CH0-K1세포에 파지를 투입하여 CH0-K1 특이적인 phage 를 제거하는 과정이 포함됨 . 이를 'counter selection '이라 한다. 구체적인 바이오 패닝 방법은 아래와 같다. pcDNA3.1(+) vector 에 클로닝 된 초파리 sex peptide receptor DNA(pcDNA3.1(+)-SPR)를 1 ipofect amine 을 이용해 CH0-K1 세포에 transfection 시킨 후 지름 10 Cm culture dish 에서 24 시간 배양한 후 바이오패닝에 사용함. 먼저 SPR유전자가 transfection 된 CH0-K1 culture dish 에 2% BSA 를 투입하여 dish 표면과 세포를 1 hr 동안 blocking 함. 한편으로 1011 cfu 이상의 라이브러리 파지를 2% BSA 에 섞어 15 분 간 rotation 하여 흔합한 후 얼음에 보관함. SPR(sex peptide receptor)유전자가 transfection 된 CH0—K1 dish 를 PBS 로 가볍게 3 회 세척한 후 준비한 BSA/파지 흔합액을 조심히 투입하고 37 도 incubator 에 lhr 보관한 후 lx PBS 를 이용해 3 회 세척함. 바이오패닝 차수에 따라 세척 회수를 늘려나감. pH 2.0, 0.2 M glycine 버퍼를 2ml 투입하고 15 분간 37 도에서 보관한 후 회수함. Spin down 하고 상등액만 회수함. pH 9.1, 2M Tris-Cl, 120 ul 용액을 투입하여 용액을 중화시킴. 중화된 파지용액을 미리 2 % BSA로 blocking 된 non-transfected CHO-K1 세포 dish 에 투입함。 30 분, 37 도에서 보관한 후 용액을 회수함. Spin down하여 debris를 침전시키고 상등액을 취함. 처음 투입된 파지와 최종 회수된 파지를 titration 하고 회수된 파지는 대장균에 감염시키고 helper 파지를 이용해 증폭시킴. 37 도, overnight 배양 후 PEG/NaCl 침전법으로 증폭된 파지를 회수하여 다음 차수 바이오패닝을 준비함. 총 5회 바이오패닝을 수행함 실시예 3: Fruit fly sex peptide receptor 특이적인 파아지 펩타이드 검색 (파아지 titration)
5 회 바이오패닝을 수행 후 회수된 파지를 대장균에 감염시켜서 ampicillin LB 고체배지에 깔고 37 도, overnight 배양함. 생성된 대장균 colony 각 각은 한 가지 파지클론에 해당함. 40 개 colony 를 무작위로 선정하여 1.5 ml tube 의 1 ml LB 액체 배지에 접종하고 ampicillin 과 helper 파지 1010 pfu를 함께 투입하고 37도, 200 rpm에서 2 일간 배양하여 파지클론을 증폭함. 원심분리를 통해 상등액을 회수하고 titration 함。 2% BSA 를 투입, rotation 하며 충분히 섞는다. 한편, 하루 전에 pcDNA3.1(+)-SPR DNA 를 transfection 시킨 CH0-K1 과 non transfected CHO 세포를 96 well plate 에 각 각 40 well 씩 투입 후 배양한다. 이때 한 well당 세포 수는 3 X 103 수준으로 맞춘다. 2 % BSA와흔합된 파지액 50 ul 를 먼저 non transfected CH0 세포에 투입 후 1 시간, 37 도에서 보관한 후 상등액을 조심스럽게 회수함. Spin down 후 상등액을 다시 pcDNA3.1(+)-SPR 이 transfection 된 CH0-K1 에 투입하고 30 분, 37 도에서 보관함.
0.1% PBST 로 3 회 세척하고 pH 2.0, 0.2M glycine 버퍼 50ul 를 투입하고 15 분간 보관함. 조심스럽게 상등액을 회수하고 spin down 함。 회수된 상등액을 pH 9.2-2M Tris buffer 3 ul 를 투입하여 중화시킨 후 대장균에 재감염시켜 최종 회수된 파지수를 titration 함. Output /input 파지 비율을 구하고 높은 비율을 보이는 순서대로 10 개 파지클론을 선정하여 보관함.
위의 Fruit fly sex peptide receptor 특이적인 파아지 펩타이드 검색 작업을 총 4 회 수행하여 총 40 개의 후보 파지클론을 확보함. 해당 파지클론이 감염된 대장균으로부터 파지 genome 을 추출하여 서열분석하고 바이포달 펩타이드 바인더 아미노산서열을 확인함. 40 개의 바이포달 펩타이드 바인더 아미노산서열을 ClustalW 프로그램을 통해 배열하고 동일서열을 가지는 클론을 탐색함. 동일서열이 여러 번 나오는 바이포달 펩타이드 서열이 높은 affinity를 가질 가능성이 높음. , 실시예 4: 바이포달 펩타이드의 sex peptide receptor 활성저해 어세이
DNA 시퀀싱에서 중복되어 나온 sex peptide receptor 에 특이적인 바이포달 펩타이드 바인더 펩타이드를 합성 (애니젠 , 한국)을 하였다ᅳ
Assay 24시간 전에 pcDNA3.1(+ )-SPR와 pcDNA3.1(+ )-aequorin DNA가 cotransfection 된 CHO-Kl 세포를 well 당 3 x 103 개 투입하여 배양해 둔다. Assay 방법은 다음과 같음. 10x assay buffer ( 1.25 M KC1 , 50 mM MgC12, 20 mM K/PIPES, pH 6.8, 200 mM sorbitol)을 1/10 희석한 용액에 0.5 mM coelenterazine 을 녹여 준비한 CH0-K1 세포에 1 시간동안 투입하여 coelenterazine 이 세포내로 충분히 침투하여 aequorin 과 결합하도록 유도함ᅳ 2 차례 세척 후 lx assay buffer 에 500ug/ml 농도로 녹인 바이포달 펩타이드를 투입하고 ELISA reader 에서 469nm emmision 빛을 real time으로 읽는다. 실험 결과
실시예 5: 바이포달 펩타이드 바인더 라이브러리의 제작
바이포달 템타이드 바인더의 구조 안정화 부위로는 안정한 베타- 헤어핀 모티프를 사용하였다. 특히 트립토판-트립토판 아미노산의 상호 작용에 의해 베타-헤어핀 모티프 구조를 안정하게 이루어 주는 트립토판 지퍼 (Andrea et al . , Proc. Natl. Acad. Sci . 98:5578— 5583(2001))을 이용하였다. 뼈대인 트립토판 지퍼의 N- 및 C-말단 부분에 각각 6 개 아미노산을 무작위로 배열함으로써 두 부분에 가변적 부위를 생성하였다 (도 la). 이를 바이포달 펩타이드 바인더라고 명명하였으며 양쪽의 가변적 부위를 가지고 있어 항원에 공동작용으로 붙을 수 있어 높은 친화력 및 특이성을 가질 수 있다. 또한, 바이포달 펩타이드 바인더의 구조 안정화 부위는 도 lb 내지 도 le와 같이 여러 가지로 구성될 수 있다.
합성한 2 개의 무작위 서열 올리고뉴클레오티드를 PCR 반웅을 통해 이중 사슬로 만든 후 제한효소인 5//I 및 Not\ 으로 자른 후 pIGT2 파아지미드 백터에 클로닝을 하여 8X108 이상의 라이브러리를 구축하였다 (도 2). 실시예 6: 바이오 패닝 결과
바이포달 펩타이드 바인더 라이브러리를 fruit fly sex peptide receptor 유전자가 transfection 된 CH0-K1 세포에 5 차에 걸쳐 바이오
패닝을 실시하고 각 패닝 단계에서 회수한 파아지 펩타이드들의 파아지 /인풋 파아지의 비율을 결정하였다 (표 1 ).
【표 1】
Sex peptide receptor 삽입된 CH0-K1세포에 대한 바이오 패닝 결과
Fruit fly sex peptide receptor 특이적인 파아지 펩타이드 검색 작업을 총 4 회 수행하여 총 40 개의 후보 파지클론을 확보함. 해당 파지클론이 감염된 대장균으로부터 파지 genome 을 추출하여 서열분석하고 바이포달 펩타이드 바인더 아미노산서열을 확인함. 40 개의 바이포달 펩타이드 바인더 아미노산서열을 ClustalW 프로그램을 통해 배열하고 동일서열을 가지는 클론을 검출함. 이로부터 중복된 특이적인 펩타이드 시뭔스를 얻었다 (표 2a 및 2b).
【표 2a]
서열분석된 바이포달 펩타이드 서열에 대한 multiple alignment
Multiple Al ignment—(1차 시도)
32 FAFPAFGSWTWENGKWfTWKGWYEWTE
36 RAHSYEGSWTWENGK WKGNYYLSE
6 QAYHYSGS画 ENGW/mVKGWWATPT
29 HAYSYTGS薩 ENGKWTWKG画 SPD
3 VGSPYR6SWTWENGKWTWKGHNEYEY
25 WASGYYGSmiENGKWT KGWDAYGY
8 QADSFWGSlflfTWENGKWT KGGDDWWR
38 PMFCQGS画 ENGKIffTWKGGKDYKR
18 LADYFSGSWTWENGKim GTYDYEW 21 QATPSPGS画 ENGKVTOGRPDSYD
37 FATP I I GS TWENGKVniKGQROLGS 28 MPVSLGS画 ENGKm—WKGQSDQVA
33 AAPVSLGSWTWENGKWTWKGQSDQVA
10 HAALSFGSWTWENGKm"WKGDQFAEQ 15 WAAHSEGSWTWENGKWTWKGKWWYED
17 ASD WYGSWTWENGKWTWKGVMPAQS
39 HATWWGGS画 ENGKWTWKGVTPHY
34 HAQVAMGSWTWENGKWfTWKGSMPTYY
19 TANAnGSWTWENGK TWKGNW I WWD 23 WGNADFGS画 ENGKWTWKGDHMTW
22 AnGPYGSOTENGKWTWKGWEYWWG 31 WGTDNYGSmiENGKWTWKGWT WQD
1 ATPYYYGSVrniENGKVmiKGEPWLTQ 16 ATPYYYGSWTWENGK TWKGEP LTQ 20 ATPmGSI/mENGKWTVIKGEPWLTQ
40 ATPmGSIimVENGK TVIIKGEPWLTQ
35 ATPYYYGTWTWENGKWTWKGWAEDYQ 7 ATPLNYGSVm/iENGKVimWKGOPGTKA
9 ATPLNYGSV/TlNENGKmYIKGDPGTKA 26 AVPYTNGS画 ENGKWTWKGCDTESQ
2 AQ I GDFGSTOENGKVmiKGYDQGDM 5 AQ I GDFGS TWENGKVmNKGYDQGOM
11 AQ I GDFGSVmNENGKWTWKGYDQffiM 13 AQI GDFGSVmVENGKVmV GYDQGDM 14 AQI GDFGSVmiENGK TTWKGYDQGD
12 ASPSYSGSWTWENGKWTWKGSQQSMM
Mu l t i p l e Al i gnment_(2 차 시도 ) 9 HMLSFGSVmiENGKVTOGDQFAEQ
16 HAALSFGSVm/ENGKVmNKGDQFAEQ 19 HMLSFGSVmENGKOTNKGOQFAEQ 20 HAALSFGSVmVENGKmiNKGOQFAEQ
24 HAALSFGSVmVENGKmVKGOQFAEQ
27 HMLSFGS VENGKWT GDQFAEQ
29 HAALSFGSVmiENGKWTlfl/KGOQFAEQ
21 HATDMWGSWTWENGKVmVKGWGYGMQ 2 CANPSGGSmYENGKVmVKGQVADGN
22 CANPSGGSVmfl/ENGKVTOGQVAOGN
3 (WTPSPGSVmiENGKWTWKGRPDSYD
8 QATPSPGSWTOENGKVmVKGRPDSYD
26 QATPSPGSVmNENGKVmNKGRPDSYD 23 AAPVSLGS画 ENGKWm/IKGQSDYVA
28 AAPVSLGSI/mVENGKWTWKGQSOQVA 7 TGYAAVGSWTWENGKVnWKGGNHDEK 12 TC I AATGSVmVENGK TWKGQVVDEO
14 FASSATGSWTWENGKWTWKGSTP I TW 1 AS I TSAGSm/ENGKWTWKGE I QNAP
30 ASAYEWGSWTWENGKWT KGWPQLND 6 FAPPCQGSTOENGK画 KGYDQGSK
25 AVPYTNGSWTWENGKWTWKGCDTESQ
4 LCHATQGSWTWENGK画 KGWSSMSE 5 ATPYYSGS画 ENGK謂 KGDEYYWD
15 -TPSYYGSWTWENGKWTWKGWPEOYY
17 ANPHYYGSWTWENGKWfTWKGKQDGSW
18 AHDAWYGSWTWENGKWTWKGYE QKW 【표 2b]
선택한 바이포달 펩타이드 서 열
"ο"ΤΓ 합성한후보 SPR결합바이포달펩타이드 펩타이드 1 ATP GSWTWENGK画 KGEPWLTQ 펩타이드 2 ATPLNYGS謂 ENGK謂 KGDPGTKA 펩타이드 3 AQ 1 GDFGSWTWENGK謂 KGYDQGDM 펩타이드 4 HAALSFGSWmiVENGK i/VKGDQFAEQ 펩타이드 5 HAALSFGSWmVENGKVIfTWKGDQFAEQ 펩타이드 6 QATPSPGSWTHVENGKI/iTWKGRPDSYD 실시예 8: sex peptide receptor에 대한 aequorin reporter gene assay
펩타이드가 GPCR 의 안타고니스트 또는 아고니스트로 작용할 수 있는지 알아보기 위해서 aequorin reporter gene assay 를 수행하였다. Sex peptide receptor 는 리간드에 의해 활성에 영향을 받을 경우 시그널 전달을 통해 세포내 Ca++ 농도을 변화시킨다. Assay에 사용하는 aequorin 단백질—coelenterazine complex는 세포내 free Ca++ 이온과 결합하여 469nm 빛을 발색함. 파지클론의 genome DNA 시뭔싱에서 중복되어 나온 바이포달 펩타이드 서열을 합성 (애니젠, 한국)을 하였다.
Assay 24 시간 전에 pcDNA3.1(+ )-SPR 과 pcDNA3.1(+ )-aequorin
DNA 가 cotransfection 된 CHO-K1 세포를 96 well plate 에 well 당 3 x 103 개 투입하여 배양해 둔다. Assay 방법은 다음과 같음. 10x buffer ( 1.25 M KCl, 50 mM MgC12, 20 mM K/PIPES, pH 6.8, 200 mM sorbitol)을 1/10 희석한 용액에 0.5 mM coelenterazine 을 녹여 준비한 CHOKl 세포에 1 시간동안 투입함. 2 차례 세척 후 lx fusion buffer 에 합성한 바이포달 펩타이드를 500 ug/ml 농도로 녹여 투입하고 ELISA reader 에서 469nm emmision 빛을 읽는다. Assay 를 통해서 펩타이드 6 이 안타고니스트로서 작용하는 것을 확인하였다 (도 3). 실시예 B. formyl peptide receptor- like 1 (FPRL-1) 결합 바이포달 펩타이드 발굴
실험 재료 및 실험 방법
실시예 1: 라이브러리의 제작
바이포달펩타이드 바인더 유전자제작및파아지미드 백터에의삽입
GPCR로서 잘 알려져 있는 formyl peptide receptor-like 1 단백질의 이미 알려져 있는 아고니스트 리간드 펩타이드 서열 'WRWWWW'을 바이포달 펩타이드의 한 쪽 다리 서열로 가지고 있는 새로운 바이포달 펩타이드 라이브러리를 제조하기 위해 아래 와 같은 올리고뉴클레오티드를 제작 하였다. Bet a-Fl ( 5 ' -TTCTATGCGGCCCAGCTGGCC
(TGGCGCTGGTGGTGGTGG)GGATOTGGACATGGGAAAACGGAAAA-3 ' ) 및 Beta-Bl (5'- AACAGTTTCTGCGGCCGCTCCTCCTCC ( MNN ) 6TCCOTCCATGTCCATTTTCCGTT-3 ') 그리고 Beta-F2 (5 ' -TOTATGC( :CCA( TG( C(^)6(^ATOT(^ACATG{^AAAACGGAAAA-3 ' ) 및 Bet a-B2 ( 5 ' -AACAGTTTCTGCGGCCGCTCCTCC
TCC(CCACCACCACCAGCGCCA)TCCOTCCATGTCCATTTTCCGn-3 ' ) (N 은 A, T, G 또는 C; K 는 G 또는 T; M 은 C 또는 A)를 합성하였다. 이중 사슬을 만들기 위해서 Beta-Fl 4 μΜ, Beta-Bl 4 μΜ, (또는 Beta-F2 4 μΜ, Beta-R2 4 μΜ), 2,5 mM dNTP 흔합액 4 ≠, ExTaq DNA 중합효소 1 Takara, Seoul , Korea) 및 10XPCR 버퍼 5 /^를 흔합하여 총 50 ^가 되도록 증류수를 첨가한 흔합액을 총 25 개 만들었다. 이 흔합액을 PCR 반응 (94°C에서 5분, 60싸이클: 30°C에서 30초, 72°C에서 30초 및 72°C에서 7분)을 하여 이중 사슬로 만든 후 PCR 정제 키트 (GeneAll, Seoul, Korea) 를 이용하여 정제하여, 바이포달 펩타이드 바인더 유전자를 얻었다. 바이포달 펩타이드 바인더에 삽입시킬 유전자를 pIGT2 파아지미드 백터 (Ig therapy, Chuncheon, Korea) 에 연결하기 위해 인서트 유전자와 pIGT2 파아지미드 백터에 제한효소를 처리하였다. 약 11 «g의 인서트 DNA 를 5///(New England Biolabs(NEB, Ipswich) 및 Λ /(NEB, Ipswich)으로 각각 4 시간 씩 반웅시킨 후 PCR 정제 키트를 이용하여 정제하였다. 또한, 약 40 //g의 PIGT2 파아지미드 백터를 Sfil 및 Notl으로 각각 4 시간 씩 반응시킨 후 CIAP(Calf Intestinal Alkaline Phosphatase) (NEB, Ipswich)를 넣고 1 시간 동안 반웅시킨 후, PCR 정제 키트를 이용하여 정제하였다。 이들을 UV- 가시광선 분광기 (Ultrospec 2100pro, Amersham Bioscience)로 정량하여 2.9 jg의 인서트 유전자를 T4 DNA 리가아제 (Bioneer, Dae j eon, Korea)를
이용하여 PIGT2 파아지미드 백터 12 과 18°C에서 15시간 동안 연결한 후, 에탄올로 침전시켜 TE 버퍼 100 ≠ — DNA를 용해시켰다. 컴피턴트 세포의 준비
E. coli XL1-BLUE 세포 (American Type Culture Collection, Manassas ,
USA)를 LB 아가 -플레이트에 선상 도말하였다. 한천 평판 배지에서 자란 군락을 5 의 LB 배지에 접종한 후 37°C에서 200 rpm의 속도로 흔합하면서 하루 동안 배양하였다. 배양된 10 ^의 세포들을 2 £의 LB 배지에 접종하고 같은 방식으로 600 nm 의 파장에서 흡광도가 0.3-0.4가 될 때까지 배양하였다. 배양된 플라스크를 30 분 동안 얼음에 방치한 후, 4°C 에서 4,000X g로 20분 동안 원심 분리하여 가라앉은 세포들을 제외한 상층액을 모두 제거하고, 1 의 넁각된 멸균 증류수로 현탁시켰다. 이것을 다시 같은 방법으로 원심분리하고 상층액을 제거한 후, 1 의 넁각된 멸균 증류수로 재현탁시키고 같은 방식으로 10% 글리세롤 용액 40 로 세척을 반복하여 원심 분리한 후, 마지막으로 10% 글리세를 용액 4 ^으로 현탁시킨 후, 200 ^씩 분주하여 액체 질소에 넁동시킨 뒤 -80°C에 보관하였다. 전기천공법
파아지미드 백터 12 /g과 바이포달 펩타이드 바인더에 인서트 DNA
2.9 //g을 연결 반웅시킨 100 ^를 25개로 분주하여 전기 천공을 수행하였다. 컴피턴트 세포를 얼음 위에서 녹이고, 200 ^의 컴피턴트 세포를 연결 반응시킨 용액 4 ^와 흔합한 후, 넁각하여 준비된 0.2 cm 의 큐벳에 넣은 뒤 1 분 동안 얼음 위에 두었다. 전기 천공기 (BioRad, Hercules, CA)를 200 Ω에서 25 uF 및 2ᅳ 5 kV 의 조건으로 프로그램하고 준비된 큐벳의 물기를 제거하고 전기 천공기에 위치시킨 후 펄스를 주었다 (시간 상수는 4.5-5 msec). 이후 즉시 37°C로 준비한 20 mM 의 글루코오스가 포함된 1 ^의 LB 액체배지에 넣고 얻어진 총 25 의 세포를 100 mi 시험관에 옮겼다. 한 시간 동안 37°C에서 200 rpm 의 속도로 흔합하며 배양한 후 라이브러리의 개수를 측정하기 위해 10 μί를 회석해서 암피실린 아가 배지에 도말하였다ᅳ 남은 세포를 1 의 LB 에 20 mM 글루코오스 및 50
/g/m£의 암피실린을 넣고 30°C에서 하루 동안 배양하였다. 4°C 에서 4,000Xg 로 20 분 동안 원심 분리하여 침전된 세포들을 제외한 상층액을 모두 제거하고, 40 의 LB 로 재현탁시킨 후 글리세를을 최종 농도 20¾ 이상 넣고 -80°C에 보관하였다. 라이브러리에서재조합파아지 생산과 PEG침전
-80°C에 저장된 바이포달 펩타이드 바인더 라이브러리에서 재조합 파아지를 생산하였다. 500 v\l 플라스크에 100 의 LB 액체배지에 암피실린 (50 μ ΐνλΐ 및 20 mM 의 글루코오스를 넣은 후, -80°C 에 보관된 라이브러리 1 을 추가하여 한 시간 동안 37°C에서 150 rpm 의 속도로 흔합하며 배양하였다. 여기에 lxioHpfu 의 Ex 헬퍼 파아지 (Ig therapy, Chuncheon, Korea)를 넣고 다시 한 시간 동안 같은 조건으로 배양하였다. l.OOOXg 로 10 분 동안 원심 분리하여 상층액을 제거하고 여기에 암피실린 (50 nglv ) 및 카나마이신 (25 이 포함된 LB 액체배지 100 을 넣고 하루 동안 배양하여 재조합 파아지를 생산하였다. 배양액을 3,000Xg 로 10 분 동안 원심 분리하여 얻은 상층액 100 ^에 PEG/NaCl 25 을 흔합하고 얼음에 1 시간 동안 방치시킨 후, 4°C에서 20 분 동안 10, 000 X g 로 원심 분리하여 상층액은 조심스럽게 제거하고 2 의 PBS(pH 7.4)로 펠렛을 재현탁시켰다. 실시예 2: 바이오 패닝
GPCR 의 단백질의 또 다른 실시예 단백질로서 formyl peptide receptor like-1 에 대하여 바이오 패닝을 하였다.
상기 실시예 1 에서 제작한 BPB(Bipodal-peptide binder) 라이브러리를 각각의 formyl peptide receptor like-1 유전자가 형질전환된 CH0-K1 세포에 대해 5 차에 걸쳐 바이오패닝을 실시하고 각 패닝 마다 output phage/ input phage 비 (ratio)를 결정하였다 , 매 회 output phage 는 비 형질전환 CH0-K1 세포에 투입하여 CH0—K1 특이적인 phage 를 제거하였다. 이를 'counter selection ' 이라 한다. 구체적인 방법은 아래와 같다. pcDNA3.1(+) vector 에 클로닝 된 formyl peptide receptor like-1 DNA (pcDNA3. l(+)-FPRLl) 를 1 ipofectamine을 이용해 CH0-K1 세포에
transfection 시킨 후 지름 10 Cm culture dish 에서 24 시간 배양한 후 바이오패닝에 사용함. 먼저 formyl peptide receptor like-1 유전자가 transfection 된 CH0-K1 culture dish 를 2% BSA 를 투입하여 dish 표면을 lhr 동안 blocking함. 1011 cfu 이상의 라이브러리 파지를 2¾ BSA에 섞어 15 분 간 rotation 하여 흔합한 후 얼음에 보관함. Formyl peptide receptor 1 ike-l(FPRL-l)유전자가 transfection 된 CH0-K1 dish 를 PBS 로 가볍게 3 회 세척한 후 준비한 BSA/파지 흔합액을 조심히 투입하고 37 도 incubator 에 lhr 보관함. lx PBS 를 이용해 3 회 세척함. 바이오패닝 차수에 따라 세척 회수를 늘려나감. pH 2.0, 0.2 M glycine 버퍼를 2ml 투입하고 15 분간, 37 도에서 보관한 후 회수함. Spin down 을 한 후 상등액만 회수함. 120 ul 2 M Tris-Cl, pH 9.1 용액을 투입하여 용액을 중화시킴. 중화된 파지용액을 미리 2Pk BSA 로 blocking 된 non- transfected CH0-K1 세포 dish 에 투입함. 30 분, 37 도에서 보관한 후 용액을 회수함. Spin down 하여 debris 를 침전시키고 상등액을 취함. 처음 투입된 파지와 최종 회수된 파지를 titration 하고 회수된 파지는 대장균에 감염시킨 후, helper 파지를 이용해 증폭시킴. 37도, overnight 배양 후 PEG/NaCl 침전법으로 증폭된 파지를 회수하여 다음 차수 바이오패닝을 준비함. 총 5회 바이오패닝을 수행함 실시예 3: Formyl peptide receptor like-1 (FPRL-1) 특이적인 파아지 펩타이드 검색 (파지 titration법)
5 회 바이오패닝을 수행 후 회수된 파지를 대장균에 감염시켜서 Ampicillin LB plate 에 깔고 37 도, overnight 배양함. 생성된 대장균 colony 각 각은 한 가지 파지클론에 해당함ᅳ 40 개 colony 를 무작위로 선정하여 1 ml LB 액체배지가 담긴 1.5 ml tube 의 접종하고 ampicillin 과 helper 파지 1010 pfu를 함께 투입한 후 37도, 200rpm에서 2일간 배양하여 파지클론을 증폭함. 원심분리를 통해 상등액을 회수하고 titration함. 2% BSA를 투입, rotation하며 층분히 섞는다. 한편 하루 전에 pcDNA3.1(+)- FPRL1 이 transfection 된 CH0-K1, non transfected CH0 세포를 96 well plate 에 각 각 40 well 씩 투입하고 배양한다ᅳ 이때 한 well 당 세포 수는 3 X 103 수준으로 맞춘다. 2% BSA 와 흔합된 파지액 50 ul 를 먼저
non transfected CHO세포에 투입 후 1 시간, 37도에서 보관한 후 상등액을 조심스럽게 회수함. Spin down 후 상등액을 다시 pcDNA3.1(+)-FPRLl 이 transfection된 CH0-K1에 투입하고 30분, 37도에서 보관함.
0.1% PBST 로 3 회 세척하고 pH 2.0, 0.2M glycine 버퍼 50ul 를 투입하고 15 분간 보관함. 조심스럽게 상등액을 회수하고 spin down 함, 회수된 상등액을 중화시킨 후 대장균에 감염시켜 회수된 파지수를 titration함. Out put /input 파지 비율이 높은 순서로 10 개의 파지클론을 선정하여 보관함. Formyl peptide receptor like-1 (FPRL-1)특이적인 파아지 펩타이드 검색 작업을 총 4 회 수행하여, 총 40 개의 후보 파지클론을 확보함. 40 개의 파지클론이 감염된 대장균으로부터 파지 genome을 추출하고 서열분석하여 바이포달 펩타이드 바인더 아미노산서열을 확인함. 40 개의 바이포달 펩타이드 바인더 아미노산서열을
ClustalW 프로그램을 통해 배열하고 동일서열을 가지는 클론을 검출함. 동일서열이 여러 번 나오는 바이포달 펩타이드 서열이 높은 affinity 를 가질 가능성이 높음. 실시예 4: 바이포달 펩타이드의 formyl peptide receptor like-1 활성에 미치는 영향 어세이
DNA 시퀀싱에서 중복되어 나은 sex peptide receptor 에 특이적인 바이포달 펩타이드 바인더 펩타이드를 합성 (애니젠, 한국)을 하였다. Assay 24 시간 전에 pcDNA3.1(+ )-FPRLl 와 pcDNA3,l(+ )-aequorin DNA 가 cotransfection 된 CHO-K1 세포를 well 당 3 x 103 개 투입하여 배양해 둔다. Assay 방법은 다음과 같음. 10x buffer ( 1.25 M KC1 , 50 mM MgC12, 20 mM K/PiPES, pH 6,8, 200 mM sorbitol)을 1/10 희석한 용액에 0.5 mM coe 1 enter azine 을 녹여 준비한 CH0—K1 세포에 1 시간동안 투입함, 2 차례 세척 후 lx fusion buffer 에 500 ug/ml 농도로 녹인 바이포달 펩타이드를 투입하고 ELISA reader 에서 469nm emmision 빛을 실시간으로 읽는다ᅳ ᅳ 실험 결과
실시예 5: 바이포달 펩타이드 바인더 라이브러리의 제작
바이포달 펩타이드 바인더의 구조 안정화 부위로는 안정한 베타- 헤어핀 모티프를 사용하였다. 특히 트립토판-트립토판 아미노산의 상호 작용에 의해 베타-헤어핀 모티프 구조를 안정하게 이루어 주는 트립토판 지퍼 (Andrea et al . , Proc. Natl. Acad. Sci . 98:5578— 5583(2001))을 이용하였다. 뼈대인 트립토판 지퍼의 N-말단에 'WRWWWW ' 및 C-말단 부분에 무작위 6 개 아미노산을 배열하거나, N-말단에 무작위 6 개 아미노산, C-말단에 WRW '를 삽입하는 것으로 하는 바이포달 라이브러리를 생성하였다 (도 4).
합성한 4 개의 올리고뉴클레오티드를 각 각 2 개씩 쌍을 이루어 PCR 반응을 통해 이중 사슬로 만든 후 제한효소인 5//I 및 Not\ 으로 자른 후 PIGT2 파아지미드 백터에 클로닝을 하여 8X108 이상의 라이브러리를 구축하였다 (도 2). 실시예 6: 바이오 패닝 결과
바이포달 펩타이드 바인더 라이브러리를 Formyl peptide receptor like-1 transfected CHO-Kl 세포에 5 차에 걸쳐 바이오 패닝을 실시하고 각 패닝 단계에서 회수한 파아지 펩타이드들의 output phage/ input phage 의 비율을 결정하였다 (표 3). 【표 3】
Formyl peptide receptor like-1 삽입된 CHO-Kl 세포에 대한 바이오 패닝 결과
For my 1 peptide receptor like-1 특이적인 파아지 펩타이드 검색 작업을 총 4 회 수행하여 총 40 개의 후보 파지클론을 확보함. 해당 파지클론이 감염된 대장균으로부터 파지 genome 을 추출하여 서열분석하고 바이포달 펩타이드 바인더 아미노산서열을 확인함. 40 개의 바이포달 펩타이드 바인더 아미노산서열을 ClustalW 프로그램을 통해 배열하고 동일서열을 가지는 클론을 검출함. 동일서열이 여러 번 나오는 바이포달 펩타이드 서열이 높은 affinity 를 가질 가능성이 높음. 이로부터 중복된 특이적인 펩타이드 시퀀스를 얻었다 (표 4a 및 4b ).
【표 4a]
서열분석된 바이포달 펩타이드 서열에 대한 multiple alignment
Multiple Al ignmentjl차 시도)
32 WRWWWWGS丽 ENGKVfniVKGSSPLKL
36 WRWWWWGS丽 ENGKVmVKGSSPLKL
6 WRWWW GSWmWENGKVimiVKGSSPLKL
29 WRWWWWGSWTl/llENGKlimilKGSSPLKL
3 WRWWWWGSWTWENGKWTWKGHNEYEY
25 WRWWWWGSWTWENGKWTWKGWDAYGY
8 WRWWWWGSWTWENGKWTWKGGDD丽 R
38 WRWWWWGS画 ENGKVTOGSPLLKL
18 WRWWWWGS画 ENGKWTWKGSPLLKL
21 WRWWWWGS画 ENGKiimVKGSPLLKL
37 WRWWWWGS丽 ENGKWmi/KGSPLLKL
28 MCCSLGSWTWENGKWTWKGWRWWWW
33 AGGVSLGSWTWENGKWTIKGWRWWWW
10 HMLSFGS謂 ENGK謂 KGWRWWWW
15 WAAHSEGSWTWENGKWTWKGWRWW W
17 WRWWWWGS謂 ENGKiimVKGPSSLPP
39 WRWWWWGSVmENGKOTIVKGPSSLPP
34 WR胃 GS謂 IGKVim/IIKGPSSLPP
19 WRWWWWGS謂 ENGKWmiVKGPSSLPP 23 WRWWWWGS画 ENGKV iVKGPSSLPP 22 ATSHPYGSWTWENGKWTWKGWRWWWW 31 WGRRNYGSWTWENGKWTWKGWRWWWW 1 WRWWWWGS謂 ENGKWmiVKGSLPPLL 16 WRWWWWGSOTENGKWmiVKGSLPPLL
20 WRWWWWGS丽 ENGKWTVVKGSLPPLL 40 WRWWWWGS丽 ENGKVimiVKGSLPPLL 35 HHSYYYGWT ENGKWTWKGWRWWWW 7 CTTLNYGSWTWENGKWTWKGWRWWWW 9 AAGG I I GSWTWENGKWTWKGWRWWWW 26 FWFCCSNGSWTWENGKWTWKGWRWWWW 2 WRWWWWGSWT ENGKITO GSLLPPP 5 WRWWWWGSVimiVENGKVimiVKGSLLPPP 1 1 WRWWWWGS謂 ENGKVmVKGSLLPPP
13 WRWWWWGS謂 ENGKW™K6SLLPPP
14 WRWW 6S画 ENGKVTO<GSLLPPP 12 WRWW GS謂 ENGKVTO<GSLLPPP
【표 4b]
합성한 바이포달 펩타이드 서 열
펩타이드가 GPCR 인 Formyl peptide receptor like-1 의 활성에 어떤 영향을 미치는 지 알아보기 위해 aequorin reporter gene assay 를 수행하였다. WRWWWW 펩타이드보다 아고니스트로서 능력 높아졌다면 Formyl peptide receptor like-1 의 하부 시그널 pathway 를 통해서 세포내 Ca++농도 증가현상이 강해질 것이다. Aequorin reporter gene assayAssay 를 통해서 5 종 펩타이드 모두 기존 알려진 WRWWW 보다 아고니스트로서 더 강하게 작용하는 것을 확인하였다 (도 5).
Claims
【청구의 범위】
【청구항 1】
다음의 단계를 포함하는 GPCR(G protein-coupled receptor) 타겟쎄 특이적으로 결합하는 GPCR-바이포달 펩타이드 바인더 (GPCR-BPB)의 제조방법:
(a) (i) 가닥간 (interstrand) 비공유결합이 형성되는 패러럴 (parallel), 안티패러럴 (antiparallel) 또는 패러럴 (paral lei )과 안티패러럴 (antiparallel) 아미노산 가닥들을 포함하는 구조 안정화 부위 (structure stabilizing region); ( ii) 상기 구조 안정화 부위의 양 말단에 결합되어 있고 무작위적으로 선택된 각각 n 및 m 개의 아미노산을 포함하는 GPCR-타겟 결합 부위 KGPCR— target binding region I) 및 GPCR- 타겟 결합 부위 n(GPCR-target binding region Π )를 포함하는 GPCR- 바이포달 펩타이드 바인더 (GPCR-BPB)의 라이브러리를 제공하는 단계;
(b) 상기 라이브러리와 타겟으로서와 GPCR 을 접촉시키는 단겨 1; 그리고,
(c) 상기 GPCR 과 결합된 GPCR-바이포달 펩타이드 바인더 (GPCR- BPB)를 선택하는 단계 .
【청구항 2】
제 1 항에 있어서, 상기 구조 안정화 부위에 형성되는 가닥간 비공유결합은 수소결합, 정전기적 상호작용, 소수성상호작용, 반데르 발스 상호작용, 파이—파이 상호작용, 양이온 -파이 상호작용 또는 이들의 조합인 것을 특징으로 하는 방법 . 【청구항 3】
제 1 항에 있어서, 상기 구조 안정화 부위의 아미노산 가닥들은 링커로 연결된 것을 특징으로 하는 방법.
【청구항 4】
제 1 항에 있어서, 상기 구조 안정화 부위는 β-헤어핀, 링커로 연결된 β-쉬트, 루이신 지퍼, 링커로 연결된 루이신 지퍼, 루이신 리치 모티프 또는 링커로 연결된 루이신 리치 모티프인 것을 특징으로 하는 방법. 【청구항 5】
제 4 항에 있어서, 상기 구조 안정화 부위는 -헤어핀인 것을 특징으로 하는 방법 .
【청구항 6】
제 5 항에 있어서, 상기 β-헤어핀은 서열목록 제 1 서열 내지 제 19 서열로 구성된 군으로부터 선택되는 아미노산 서열을 포함하는 것을 특징으로 하는 방법 . ί청구항 7】
제 6항에 있어서 , 상기 β-헤어핀은 서열목록 제 2서열, 제 14서열 또는 제 18 서열로부터 선택되는 아미노산 서열을 포함하는 것을 특징으로 하는 방법 .
【청구항 8】
제 5 항에 있어서, 상기 β_헤어핀은 다음 일반식 I 로 표시되는 것을 특징으로 하는 방법:
일반식 I
Xi-Trp(X2)X3-X4-X5(X'2)X6-X7
¾은 Ser 또는 Gly-Glu이고, ¾ 및 X'2는 서로 독립적으로 Thr, His, Val, He, Phe또는 Tyr 이며 , ¾는 Trp또는 Tyr 이고, 는 타입 I, 타입 1', 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, ¾는 Trp 또는 Phe이며 , ¾는 Trp또는 Val이고, X7는 Lys 또는 Thr-Glu이다,
【청구항 9】
제 5 항에 있어서, 상기 β—헤어핀은 다음 일반식 Π로 표시되는 것을 특징으로 하는 방법 :
일반식 Π
Χι은 Arg, Gly-Glu또는 Lys-Lys이고, ¾는 Gin또는 Thr이며, ¾는 타입 I, 타입 1', 타입 Π , 타입 Π ' 또는 타입 ΙΠ 또는 타입 ΠΓ 턴 서열이고, X4는 Gin, Thr-Glu 또는 Gln-Glu이다.
【청구항 10】
제 5 항에 있어서, 상기 β-헤어핀은 다음 일반식 ΙΠ으로 표시되는 것을 특징으로 하는 방법:
일반식 m
X1-X2-X3— Trp-X4-X5-Thr-X6-X7
Xi은 Lys 또는 Lys-Lys이고, ¾는 Trp 또는 Tyr이고, X3는 Val 또는 Thr 이며, ¾는 타입 I, 타입 Γ, 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, ¾는 Trp 또는 Ala 이며, ¾는 Trp 또는 Val 이고, X?은 Glu또는 Gln-Glu이다.
【청구항 11】
제 5 항에 있어서, 상기 β-헤어핀은 다음 일반식 IV로 표시되는 것을 특징으로 하는 방법:
일반식 IV
X Xs-Xs-Trp^
¾은 Lys-Thr 또는 Gly이고, ¾는 Trp 또는 Tyr 이고, ¾는 타입 I, 타입 1', 타입 Π, 타입 Π ' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, 는 Thr-Glu 또는 Gly이다.
【청구항 12】
제 8 항에 있어서, 상기 β-헤어핀은 상기 일반식 I 에서 ¾은 Ser 또는 Gly-Glu 이고, ¾ 및 X'2는 서로 독립적으로 Thr, His 또는 Val 이며 , ¾는 Trp 또는 Tyr 이고, 는 타입 I, 타입 Γ , 타입 Π 또는 타입 Π ' 서열이고, ¾는 Trp 또는 Phe이며, ¾는 Trp 또는 Val 이고, X7는 Lys 또는 Thr-Glu이다.
【청구항 13】
제 1 항에 있어서, 상기 GPCR-타겟 결합 부위 I 의 아미노산 개수 n은 2-20인 것을 특징으로 하는 방법 .
【청구항 14】
제 1 항에 있어서, 상기 GPCR-타겟 결합 부위 Π의 아미노산 개수 m은 2-20인 것을 특징으로 하는 방법 .
【청구항 15】
제 1 항에 있어서 상기 라이브러리는 플라스미드, 박테리오파아지 , 파아지미드로, 이스트 또는 박테리아로부터 제작된 것을 특징으로 하는 방법.
【청구항 16】
제 1 항에 있어서, 상기 GPCR-타겟 결합 부위 I 및 GPCR-타겟 결합 부위 Π는 GPCR에 공동으로 작용하여 결합하는 것을 특징으로 하는 방법 .
【청구항 17】
제 1 항에 있어서, 상기 구조 안정화 부위, GPCR-타겟 결합 부위 I 또는 GPCR-타겟 결합 부위 Π에 추가적으로 기능성 분자가 결합되어 있는 것을 특징으로 하는 방법.
【청구항 18】
제 17 항에 있어서, 상기 기능성 분자는 검출가능한 신호를 발생시키는 레이블, 화학약물, 바이오약물, 세포막투과 펩타이드 (CPP) 또는 나노입자인 것을 특징으로 하는 방법.
【청구항 19】
(a) 가닥간 (interstrand) 비공유결합이 형성된 패러럴 (parallel ) , 안티패러럴 (antiparallel) 또는 패러럴 (parallel)과
안티패러럴 (antiparallel) 아미노산 가닥들을 포함하는 구조 안정화 부위 (structure stabilizing region); 및
(b) 상기 구조 안정화 부위의 양 말단에 결합되어 있고 무작위적으로 선택된 각각 n및 m개의 아미노산을 포함하는 GPCR-타겟 결합 부위 KGPCR- target binding region I) 및 GPCR-타겟 결합 부위 Π (GPCR-target binding region Π )를 포함하는 GPCR 에 특이적으로 결합하는 GPCR-바이포달 펩타이드 바인더.
【청구항 20】
제 19 항에 있어서, 상기 구조 안정화 부위에 형성된 가닥간 비공유결합은 수소결합, 정전기적 상호작용, 소수성상호작용, 반데르 발스 상호작용, 파이 -파이 상호작용, 양이온 -파이 상호작용 또는 이들의 조합인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더. 【청구항 21】
제 19 항에 있어서, 상기 구조 안정화 부위의 아미노산 가닥들은 링커로 연결된 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더.
【청구항 22】
제 19 항에 있어서, 상기 구조 안정화 부위는 β-헤어핀, 링커로 연결된 β-쉬트, 루이신 지퍼 또는 링커로 연결된 루이신 지퍼, 루이신 리치 모티프인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더.
【청구항 23】
제 19 항에 있어서, 상기 구조 안정화 부위는 β-헤어핀인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 .
【청구항 24】
제 23 항에 있어서, 상기 β—헤어핀은 서열목록 제 1 서열 내지 제 19 서열로 구성된 군으로부터 선택되는 것을 특징으로 하는 GPCR- 바이포달 펩타이드 바인더 .
【청구항 25】
제 24항에 있어서, 상기 β-헤어핀은 서열목록 제 2서열, 제 14서열 또는 제 18 서열로부터 선택되는 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 .
【청구항 26】
제 23 항에 있어서, 상기 β-헤어핀은 다음 일반식 I 로 표시되는 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 :
일반식 I
XrTrp (¾ )¾-¾-¾0( ' 2 )¾-
¾은 Ser 또는 Gly-Glu이고, ¾ 및 X'2는 서로 독립적으로 Thr, His, Val, lie, Phe또는 Tyr 이며, ¾는 Trp또는 Tyr 이고, 는 타입 I, 타입 1', 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, ¾는 Trp 또는 Phe이며 , ¾는 Trp또는 Val이고, X?는 Lys 또는 Thr-Glu이다.
【청구항 27】
제 23 항에 있어서, 상기 β-헤어핀은 다음 일반식 Π로 표시되는 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 :
일반식 Π
Xi-Trp-Xa-Tyr-Xs-Phe-Thr-Va 1 -X4
¾은 Arg, Gly-Glu또는 Lys-Lys이고, X2는 Gin또는 Thr이며, ¾는 타입 I, 타입 1', 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, X4는 Gin, Thr-Glu또는 Gln-Glu이다.
【청구항 28】
제 23 항에 있어서, 상기 β-헤어핀은 다음 일반식 m으로 표시되는 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더:
일반식 m
Xi-X2-X3-Trp-X4-X5-Thr-X6-X7
¾은 Lys 또는 Lys-Lys이고, ¾는 Trp또는 Tyr이고, ¾는 Val 또는 Thr 이며, 는 타입 I, 타입 Γ, 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, ¾는 Trp 또는 Ala 이며 , ¾는 Trp 또는 Val 이고, X7은 Glu또는 Gln-Glu이다.
【청구항 29】
제 23 항에 있어서, 상기 β-헤어핀은 다음 일반식 IV로 표시되는 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 :
일반식 IV
X Xs-Xs-Trp^
¾은 Lys-Thr 또는 Gly이고, ¾는 Trp또는 Tyr 이고, ¾는 타입 I, 타입 1', 타입 Π, 타입 Π' 또는 타입 m 또는 타입 ΠΓ 턴 서열이고, X4는 Thr-Glu또는 Gly이다. 【청구항 30】
제 24 항에 있어서, 상기 -헤어핀은 상기 일반식 I 에서 ¾은 Ser 또는 Gly-Ghi 이고, X2 및 X'2는 서로 독립적으로 Thr, His 또는 Val 이며, ¾는 Trp 또는 Tyr 이고, 는 타 ¾ I, 타입 Γ, 타입 Π 또는 타입 Π' 서열이고 ¾는 Trp또는 Phe이며, ¾는 Trp또는 Val 이고, X7는 Lys 또는 Thr-Glu 인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더.
【청구항 31]
제 19 항에 있어서, 상기 GPCR-타겟 결합 부위 I 의 아미노산 개수 n은 2-20인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 .
【청구항 32】
제 19 항에 있어서, 상기 GPCR-타겟 결합 부위 Π의 아미노산 개수 m은 2-20인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 . 【청구항 33】
제 19 항에 있어서 , 상기 GPCR-타겟 결합 부위 I 및 GPCR-타겟 결합 부위 Π 는 GPCR 에 공동으로 작용하여 결합하는 것을 특징으로 하는 GPCR- 바이포달 펩타이드 바인더 . 【청구항 34】
제 19 항에 있어서 , 상기 구조 안정화 부위, GPCR-타겟 결합 부위 I 또는 GPCR-타켓 결합 부위 Π 에 추가적으로 기능성 분자가 결합되어 있는 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 . 【청구항 35】
제 34 항에 있어서, 상기 기능성 분자는 검출가능한 신호를 발생시키는 레이블, 화학약물, 바이오약물, 세포막투과 펩타이드 (CPP) 또는 나노입자인 것을 특징으로 하는 GPCR-바이포달 펩타이드 바인더 . 【청구항 36】
상기 제 19 항 내지 제 35 항 중 어느 한 항의 바이포달 펩타이드 바인더를 코딩하는 핵산 분자 .
【청구항 37】
상기 제 36 항의 핵산 분자를 포함하는 바이포달 펩타이드 바인더의 발현용 백터 .
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020127023551A KR20130103300A (ko) | 2010-04-20 | 2011-04-20 | Gpcr에 특이적으로 결합하는 gpcr-bpb |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20100036599 | 2010-04-20 | ||
| KR10-2010-0036599 | 2010-04-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011132938A2 true WO2011132938A2 (ko) | 2011-10-27 |
| WO2011132938A3 WO2011132938A3 (ko) | 2012-05-10 |
Family
ID=44834644
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2011/002838 Ceased WO2011132938A2 (ko) | 2010-04-20 | 2011-04-20 | Gpcr에 특이적으로 결합하는 gpcr-bpb |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR20130103300A (ko) |
| WO (1) | WO2011132938A2 (ko) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101531944B1 (ko) * | 2013-12-24 | 2015-06-29 | 광주과학기술원 | Vegf에 특이적으로 결합하는 vegf-bpb |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5427908A (en) * | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US6914123B2 (en) * | 2001-04-17 | 2005-07-05 | Genentech, Inc. | Hairpin peptides with a novel structural motif and methods relating thereto |
| CA2741040C (en) * | 2008-10-20 | 2015-09-22 | Gwangju Institute Of Science And Technology | Bipodal-peptide binder |
-
2011
- 2011-04-20 KR KR1020127023551A patent/KR20130103300A/ko not_active Withdrawn
- 2011-04-20 WO PCT/KR2011/002838 patent/WO2011132938A2/ko not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2011132938A3 (ko) | 2012-05-10 |
| KR20130103300A (ko) | 2013-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101151805B1 (ko) | 바이포달 펩타이드 바인더 | |
| EP1991560B1 (en) | Peptide having cell membrane penetrating activity | |
| JP5677454B2 (ja) | 細胞内ターゲット結合用二座ペプチドバインダー | |
| KR20200038303A (ko) | 모듈형 결합 단백질 | |
| JP2023509004A (ja) | ニドゲンをベースとする足場タンパク質および治療用ナノ複合体 | |
| KR101323846B1 (ko) | 타겟 친화도가 유지되고 안정성이 개선된 d-앱타이드 | |
| WO2011132938A2 (ko) | Gpcr에 특이적으로 결합하는 gpcr-bpb | |
| Aoki et al. | Chemical Synthesis of Interleukin-6 for Mirror-Image Screening | |
| KR20130103299A (ko) | Rtk에 특이적으로 결합하는 rtk―bpb | |
| KR20130103301A (ko) | 전사인자에 특이적으로 결합하는 tf-bpb | |
| Darlot | Design of modulatory peptides against chemokines | |
| KR101443839B1 (ko) | 펩타이드의 타겟 친화도 개선방법 | |
| KR20110116930A (ko) | 이온채널에 특이적으로 결합하는 이온채널―bpb | |
| Antilla | Improving Cardiac Delivery of Antisense Oligonucleotides With Peptidomimetic Targeting Agents | |
| US20140356285A1 (en) | Compositions and methods related to tissue targeting | |
| Richardson | Design and evaluation of fluorescent and non-fluorescent bivalent ligands to explore their mode of action at neuropeptide Y receptors | |
| CN102224162B (zh) | 双齿肽结合物 | |
| William et al. | Peptide ligands for methuselah, a drosophila g protein-coupled receptor associated with extended lifespan | |
| WO2011132939A2 (ko) | Rtk에 특이적으로 결합하는 rtk-bpb | |
| WO2015132248A2 (en) | Sequamers - a novel non-natural type of peptide libraries randomly constrained by their primary sequences |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11772226 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 20127023551 Country of ref document: KR Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11772226 Country of ref document: EP Kind code of ref document: A2 |


