WO2011128445A1 - Inhibiteurs de l'accumulation de transcrits sprd chez s. aureus - Google Patents

Inhibiteurs de l'accumulation de transcrits sprd chez s. aureus Download PDF

Info

Publication number
WO2011128445A1
WO2011128445A1 PCT/EP2011/056052 EP2011056052W WO2011128445A1 WO 2011128445 A1 WO2011128445 A1 WO 2011128445A1 EP 2011056052 W EP2011056052 W EP 2011056052W WO 2011128445 A1 WO2011128445 A1 WO 2011128445A1
Authority
WO
WIPO (PCT)
Prior art keywords
sprd
gene
aureus
sequence
transcripts
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2011/056052
Other languages
English (en)
Inventor
Svetlana Chabelskaya
Brice Felden
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite de Rennes 1
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Universite de Rennes 1
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite de Rennes 1, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Universite de Rennes 1
Publication of WO2011128445A1 publication Critical patent/WO2011128445A1/fr
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/36Adaptation or attenuation of cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs

Definitions

  • the present invention relates to inhibitors of the accumulation and / or transcription of small RNA located and expressed from the genome of bacteria (in particular Golden Staphylococci), called Spr for "small pathogenicity island rNAs" and their applications in particular for the detection, prevention and / or treatment of a staphylococcal infection.
  • the present invention also relates to a method for the selection or identification of compounds useful for the prevention and / or treatment of a staphylococcal infection, said compounds being capable of complexing with the transcripts SprD and / or of inhibiting the transcription of the gene DPRS.
  • Staphylococcal infections are widespread in both community and hospital settings, affecting both humans and animals.
  • Staphylococcus The bacteria of the genus Staphylococcus were discovered by Louis Pasteur in 1880. To date, about twenty species have been identified. Of these, the most commonly encountered in human and / or animal pathology are Staphylococcus epidermidis, Staphylococcus saprophyticus, Staphylococcus hyicus, Staphylococcus intermedius and Staphylococcus aureus.
  • Staphylococcus epidermidis may be responsible for infections of the skin, nasal and also of endocarditis and localized infections in immunocompromised patients.
  • Staphylococcus saprophyticus has been identified as responsible for some urinary tract infections.
  • Staphylococcus hyicus and Staphylococcus intermedius may be responsible for various infections in animals such as exudative piglet dermatitis (S. hyicus) or furunculosis of the dog (S. intermedius).
  • Staphylococcus aureus The most pathogenic species of Staphylococcus bacteria is Staphylococcus aureus (S. aureus).
  • S. aureus is a member of human commensal flora in a fraction of the population. However, if mucosal barriers are breached or the host's immune defenses are altered, S. aureus can become an opportunistic pathogen and one of the leading causes of nosocomial infections and community-acquired infections in humans and humans. animals (Lowy, 1998).
  • S.aureus-associated disease usually begins with a local infection (eg, infection of a wound, boil, cellulitis), then can be followed by systemic spread (bacteremia), followed by metastatic infections (by example endocarditis, osteomyelitis and septic arthritis).
  • S. aureus is also one of the pathogens most frequently isolated from bovine mastitis in both the United States and Europe. Affected cows then have a drop in milk production which has serious economic consequences for farms.
  • S. aureus is able to bypass the defenses of the host by producing traps of the immune response of the infected host such as the SpA protein ("Staphylococcal protein A", Moks et al., 1986 and Sbi protein ("S. aureus IgG binding protein” Zhang L, Jacobsson K, Vasi J, Lindberg M and Frykberg L (1998) A second IgG-binding protein in Staphylococcus aureus, Microbiology 145: 985-991).
  • SpA protein Staphylococcal protein A
  • Moks et al. 1986
  • Sbi protein S. aureus IgG binding protein
  • antibiotics such as penicillins (penicillin G, methicillin, oxacillin cephalosporins), macronides and tetracyclines.
  • AR SprD has a major role in the virulence of Staphylococcus aureus.
  • strains N315 (agr-), Newman (agr +) and R1 (agr +) strains of Staphylococcus aureus
  • strains N315 (agr-) strains N315 (agr-)
  • Newman agr +
  • R1 agr +
  • Staphylococcus aureus can be obtained by:
  • the inhibition of the transcription of the SprD gene by acting on the transcribed sequence of the gene (deletion of all or part of the transcribed sequence, site-directed mutagenesis to modify the recognition by the transcription machinery) or via molecules preventing the transcription of the gene by binding to its promoter sequence blocking the initiation of transcription of the sprd gene.
  • inhibitors of the activity of the SprD transcripts in particular the inhibitors capable of preventing recognition between the SprD transcript and its targets.
  • bacteria of the genus Staphylococcus in the sense of the present invention, the set of bacterial strains of the genus Staphylococcus.
  • the bacteria of the genus Staphylococcus according to the invention are chosen from the group comprising bacterial strains of the genus Staphylococcus whose genome contains a gene encoding an RNA comprising the sequence SEQ ID No. 1 or a sequence homologous to the sequence SEQ ID No. 1 and fragments thereof.
  • strains can be easily identified by those skilled in the art, for example, by screening techniques of libraries (genomic DNA or cDNA of bacteria of the genus Staphylococcus) using probes or primers specific to a sequence belonging to bacterial strains of the genus Staphylococcus as defined above.
  • probes or primers can be selected from the polynucleotide sequences according to the invention.
  • the bacteria of the genus Staphylococcus according to the invention are strains of Staphylococcus aureus.
  • the subject of the invention is an inhibitor of the accumulation of transcripts SprD (such as the inhibitors of the stability of transcripts SprD) and / or the transcription of the gene SprD.
  • transcript sprD or “transcript of the gene sprD” is meant a transcript, that is to say a RNA synthesized during the transcription of the gene sprD.
  • transcript immobilization inhibitor SprD or "agent for inhibiting the accumulation of transcripts SprD” is used herein to denote a molecule capable of inducing a decrease of at least 20%, in particular from at least 35% and especially at least 50% of the level of transcripts of the gene sprD accumulated in particular over time in a bacterial strain expressing sprD, relative to the rate of transcripts of the accumulated gene sprD, in particular over time in said bacterial strain expressing sprD in the absence of said molecule.
  • the inhibition of the accumulation of transcripts SprD can be determined by techniques well known to those skilled in the art such as by "Northern Blot", using at least one specific probe of said transcript or by "RT-PCR” using at least two specific primers of said transcript, in particular by studying the accumulation of the transcript level sprD in a bacterial strain in culture expressing sprD, under expression conditions of the gene sprD.
  • the inhibition of the accumulation of transcripts can be determined by the technique as described in point 1.2 of the examples below ("RNA isolation and Northern blots") and the results of which are shown in FIG. 1A.
  • sprD gene transcription inhibitor or "sprD gene transcription inhibiting agent” is used herein to refer to a molecule capable of inhibiting by at least 20%, in particular by at least 35% and particularly at least 50% the transcription of the gene sprD, compared to the transcription rate of the gene sprD in the absence of said molecule.
  • transcriptional inhibition of the SprD gene is meant a decrease of at least 20%, in particular at least 35% and most particularly at least 50% of the transcription of the SprD gene. Inhibition of the transcription of the sprD gene can be determined by techniques well known to those skilled in the art as exemplified below.
  • such an inhibitor comprises an isolated polynucleotide whose sequence comprises or consists of a sequence selected from the group consisting of:
  • sequence SEQ ID No. 4 the derived sequences having at least 70%, in particular at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and at least at least 99% of identity with the sequence SEQ ID No. 4 and the fragments of at least 5 nucleotides thereof, in particular the sequence SEQ ID No. 8; and the corresponding DNA sequences, in particular the sequences SEQ ID No. 5 and SEQ ID No. 9;
  • said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 2.
  • the present invention also relates to a first isolated polynucleotide whose sequence comprises or consists of a sequence selected from the group consisting of:
  • sequence SEQ ID No. 4 the derived sequences having at least 70%, in particular at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% identity with the sequence SEQ ID No. 4 and fragments of at least 5 nucleotides thereof, preferably the sequence SEQ ID No. 4 and the sequence SEQ ID No. 8 and most preferably the sequence SEQ ID No. 4;
  • said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 2.
  • polynucleotide is intended to mean a polymer composed of several nucleotides linked by phosphodiester bonds, such as DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
  • DNA has the advantage of being more stable than RNA.
  • Sequence derived from a second sequence means a sequence having at least 70% identity, in particular at least 80%, at least 85%, at least 90%, at least 95%, at least 96% at least 97%, at least 98% and most preferably at least 99% identity with a second sequence.
  • identity refers to the identity between two polynucleotide sequences.
  • the identity can be determined by comparing the nucleotides present at one position in each of the polynucleotide sequences aligned for that purpose. When, at a given position, a nucleotide is identified as identical on the two aligned sequences, said sequences are said to be identical at this position.
  • the percentage identity between two polynucleotide sequences is a function of the number of identical nucleotides at the different positions on the two aligned nucleotide sequences.
  • the percentages of identity to which reference is made in the context of the disclosure of the present invention are determined on the basis of an overall alignment of the sequences to be compared, that is to say on an alignment of the sequences taken in their completeness, using the algorithm of NEEDLEMAN and WUNSCH (J. Mol. Biol. 48, 443-453, 1970).
  • This sequence comparison can be performed for example using the needle software using the parameter "Gap open” equal to 10.0, the parameter "Gap Extend” equal to 0.5, and a matrix "Blosum 62".
  • needle is available on the ebi.ac.uk world wide website under the name "Align”.
  • DNA sequence corresponding to the sequence of an RNA means said RNA sequence in which the ribonucleotides comprising an uracil base have been replaced by deoxyribonucleotides comprising a thymine base.
  • said fragments according to the invention may comprise at least 5 nucleotides, in particular at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140 nucleotides.
  • Said fragments according to the invention may comprise at most 140, in particular at most 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10 nucleotides.
  • the specific hybridization ability of a first polynucleotide sequence with a second polynucleotide sequence can be determined in vitro by tests well known to those skilled in the art. By way of example, mention may be made of the test described in C. Pichon & B. Felden (2005, with the example of the SprA regulatory RNA and its SA2216 mRNA target), which comprises the following steps:
  • a first polynucleotide sequence is radioactively labeled, purified and increasing amounts of a second unlabeled polynucleotide sequence are added and analyzed by electrophoresis gel under native conditions. Obtaining a migration delay on this gel involves the formation of a complex between these two polynucleotide sequences, by hybridization;
  • the hybridization between the first two polynucleotide sequences will be considered specific if (i) said complex preformed between the first two polynucleotide sequences remains stable in the presence of this excess of the third polynucleotide sequence (ex: tRNA) and if (ii) said preformed complex is destabilized in the presence of small amounts of the first unlabeled polynucleotide sequence.
  • the derived sequences and the fragments of the first isolated polynucleotide according to the invention which have the capacity to hybridise specifically to the sequence ID No. 2 also have the capacity to inhibit the accumulation of transcripts SprD and / or to inhibit the transcription of the gene sprD.
  • the polynucleotides isolated according to the present invention may be capable of hybridizing specifically to the SprD RNA and of inducing the degradation of the SprD RNA by a degradation mechanism linked to the recruitment of ribonucleases on the RNA-RNA duplex.
  • the example described experimentally in Staphylococcus aureus being ribonuclease III (for the degradation of AR III mRNA targets).
  • the SprD RNA is therefore degraded and can no longer produce its effects.
  • Such polynucleotides are therefore particularly useful for the prevention and / or treatment of staphylococcal infections, particularly antibiotic-resistant strains.
  • the polynucleotides according to the invention have the advantage unlike putative treatments, to have a targeted action on bacteria of the genus Staphylococcus thus optimizing their action and limiting the risk of side effects.
  • the present invention also relates to the in vitro or ex vivo use of the first polynucleotide isolated according to the invention as an inhibitory agent for the accumulation of transcripts SprD and / or the transcription of the gene sprD, in particular said isolated polynucleotide according to the invention.
  • the invention having a sequence comprising or consisting of a sequence selected from the group consisting of:
  • sequence SEQ ID No. 4 the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and the fragments of at least 5 nucleotides thereof, preferably the sequence SEQ ID N ° 4 and the sequence SEQ ID No. 8 and most preferably the sequence SEQ ID No. 4;
  • SEQ ID No. 9 and most particularly the sequence SEQ ID No. 5; said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 2 and in particular having the further ability to inhibit the accumulation of transcripts SprD and / or to inhibit the transcription of the gene SprD .
  • the subject of the invention is also a second isolated polynucleotide comprising at its 5 'and 3' ends respectively the nucleotide sequences SEQ ID No. 6 and SEQ ID No. 7 (corresponding respectively to the sequence of the genomic DNA upstream of the gene sprD and to the genomic DNA sequence downstream of the sprD gene).
  • said second polynucleotide is less than 10,000 nucleotides in size, in particular less than 5,000 nucleotides, 2,500 nucleotides, 1,500 nucleotides, 1,000 nucleotides, 750 nucleotides, 500 nucleotides, 450 nucleotides, 250 nucleotides, 150 nucleotides, 100 nucleotides, nucleotides, 50 nucleotides, 25 nucleotides.
  • said second polynucleotide has a size of between 5 and 10,000 nucleotides, especially between 10 and 5,000 nucleotides, 25 and 2,500 nucleotides, 50 and 1,500 nucleotides, 75 and 1,000 nucleotides, 100 and 750 nucleotides, 150 and 500 nucleotides.
  • This second polynucleotide may be useful in particular for completely deleting the gene sprD genome of bacteria belonging to the genus Staphylococcus, in particular whose genome contains the sequence SEQ ID No. 1, in particular, belonging to the species Staphylococcus aureus.
  • the subject of the invention is also an inhibitor of the accumulation of transcripts, which comprises a vector comprising the nucleotide sequences SEQ ID No. 6 and SEQ ID No. 7 and a recombinant vector comprising a second polynucleotide according to the invention.
  • Said recombinant vector (such as pBT2AsprD) thus generated can be transformed, for example, into RN4220 and then N315 strains to allow the integration of the ermB gene into the genome by homologous recombination.
  • the deletion of the sprD gene can be validated by Northern blots, with the absence of the sprD transcript. The inventors have shown on a mouse model of septicemia that the bacteria in which the gene sprD is deleted lose their virulence.
  • the present invention also encompasses the polynucleotides according to the invention, synthetic, semisynthetic, recombinant and their analogues.
  • the analogs of the polynucleotides according to the invention have the capacity to hybridize specifically with the sequence SEQ ID No. 2 or to be transcribed into polynucleotides having the capacity to hybridize specifically with the sequence SEQ ID No. 2.
  • the analogs of the polynucleotides according to the invention also have the capacity to inhibit the accumulation of transcripts SprD and / or to inhibit the transcription of the SprD gene.
  • analogue means polynucleotides comprising at least one chemical modification at the level of their sugar, phosphate, their base or their 5 'and 3'ends; said modification can be carried out by chemical or enzymatic synthesis.
  • the polynucleotides according to the invention may comprise at least one chemical modification intended in particular to increase their stability, their resistance to degradation by the endo and exonucleases, to promote their ability to enter a cell of interest and / or in the case of the first polynucleotide according to the invention to increase its ability to negatively regulate the accumulation of transcripts sprD.
  • the increase of the capacity of the first polynucleotide (in particular of sequence SEQ ID No. 4) according to the invention to negatively regulate the accumulation of transcripts SprD can be obtained, for example, by a chemical modification allowing the increase of the formation and / or stability of a complex between the first polynucleotide according to the invention and the sequence SEQ ID No.
  • the polynucleotides according to the invention may comprise modified nucleotides in terms of their sugar, phosphate, base and / or may have modifications, in particular post-transcriptionally, at their 5 'and 3' ends.
  • modified nucleotides may be selected from the group consisting of: 2'-O-methylnucleotides, 2'-O-methoxyethylnucleotides, deoxynucleotides such as 2'-deoxynucleotides and 2'-deoxy-2'-fluoronucleotides, nucleotides with peptide bonds, fluorochromes, radioactive elements.
  • polynucleotides according to the invention may also further comprise, at their 5 'and / or 3' ends, structural elements (such as stable RNA or DNA helices) reinforcing their stability and / or their resistance to degradation.
  • structural elements such as stable RNA or DNA helices
  • polynucleotides according to the invention can be obtained by methods well known to those skilled in the art, such as by screening methods of libraries (genomic DNA or cDNA of bacteria of the genus Staphylococcus) by probes or primers. specific of said polynucleotides (selected for example from the polynucleotide sequences according to the invention), but also, by chemical syntheses (Beaucage SL., 2008) or by enzymatic reactions (Sherlin LD et al, 2001).
  • the subject of the invention is also an expression cassette comprising a DNA sequence as defined in point b) above, in particular said DNA sequence corresponding to a sequence included in the group consisting of: the sequence SEQ ID No. 4, the derived sequences having at least 70% identity with the sequence SEQ ID No. 4 and the fragments of at least 5 nucleotides thereof, in particular the sequence SEQ ID No. 4 and the sequence SEQ ID No. 8 and most particularly the sequence SEQ ID No. 4;
  • said derived sequences and said fragments having the ability to hybridize specifically with the sequence SEQ ID No. 2 and in particular having the further ability to inhibit the accumulation of transcripts SprD and / or to inhibit the transcription of the gene SprD .
  • the present invention relates to an expression cassette comprising the DNA sequence of sequence SEQ ID No. 5 or SEQ ID No. 9, most particularly of sequence SEQ ID No. 5.
  • the subject of the invention is also an expression cassette comprising a DNA sequence according to the invention that can be transcribed in sequence SEQ ID No. 4.
  • expression cassette means a cassette comprising a promoter and a transcription termination region in which a DNA sequence of interest is operably linked to the promoter in order to allow the transcription of said DNA sequence.
  • the promoter can be any promoter or derived sequence, inducible or not, allowing the transcription of a polynucleotide according to the invention.
  • the promoter is chosen from promoters allowing the transcription of a polynucleotide according to the invention in at least one bacterial strain of the genus Staphylococcus. Examples of such promoters include the bacteriophage T7 promoter (Milligan JF et al., 1989) or constitutive natural promoters.
  • the subject of the invention is also a recombinant vector comprising:
  • an isolated polynucleotide chosen from the group of polynucleotides isolated according to the invention, in particular from the first and second isolated polynucleotides according to the invention; or
  • the vectors that may be used may be viral vectors, such as bacteriophages, or non-viral vectors, such as plasmid vectors.
  • the plasmid vector may be chosen from the group comprising the plasmids pCN35 and pCN38 described in Charpentier et al. (2004). These plasmids have the advantage of being maintained and thus allow the expression of polynucleotides according to the invention in transformed bacteria of the genus Staphylococcus.
  • Plasmid pBT2 (Bruckner, 1997, FEMS Microbiol Lett 151: 1-8) may be used for the deletion of all or part of the SprD gene by homologous recombination.
  • the vector according to the invention is a bacteriophage.
  • said bacteriophage is capable of infecting at least one bacterial strain of the genus Staphylococcus.
  • the term "bacteriophage capable of infecting a bacterial strain of the genus Staphylococcus” means any bacterial virus capable of introducing part of its genetic material into the genome of a bacterial strain of the genus Staphylococcus (prophage) or to allow transitory expression of this genetic material in the recipient bacterium without chromosomal integration.
  • Bacteria of the genus Staphylococcus are infected by three types of phages: obligatory, temperate and chronic lyrical (Nicholas H. Mann, 2008). All of these phages can be used as a vector according to the invention.
  • the phages that can be used as vectors according to the invention are preferably broad-spectrum and capable of infecting as many as possible bacterial strains of the genus Staphylococcus responsible for infections in humans and / or animals.
  • the use of bacteriophages as a vector according to the invention has the advantage of optimizing the prevention and / or treatment of a staphylococcal infection or a disorder related to at least one bacterium of the genus Staphylococcus.
  • the use of bacteriophage as a vector according to the invention has the advantage that the bacteriophage used is potentially effective against various bacterial strains of the genus Staphylococcus, even those resistant to antibiotics (Nicholas H. Mann, 2008) and not have side effects, including being devoid of adverse effects on the eukaryotic cells of the infected host.
  • the subject of the invention is a host cell transformed by an expression cassette according to the invention or a recombinant vector according to the invention.
  • the cell may be a prokaryote such as E. coli, in particular strain DH5a and advantageously a bacteriophage as described above.
  • the invention also relates to a composition
  • a composition comprising at least one component selected from the group consisting of an inhibitor of the accumulation of transcripts SprD according to the invention, an isolated polynucleotide according to the invention, an expression cassette according to the invention.
  • invention a vector according to the invention and a host cell according to the invention.
  • said composition according to the invention is a pharmaceutical composition.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable vector and at least one component selected from the group consisting of an isolated polynucleotide according to the invention, an expression cassette according to the invention, a vector according to the invention. and a host cell according to the invention.
  • compositions according to the invention can be well-known vectors of the person skilled in the art.
  • compositions or medicaments according to the invention have the advantage, unlike the putative medicaments, of having a targeted action on bacteria of the genus Staphylococcus, including strains resistant to antibiotics, thus optimizing their action and limiting the risks of side effects. .
  • said components are present in the pharmaceutical composition or the drug according to the invention in therapeutic quantities (active and non-toxic amounts).
  • therapeutic amounts may be determined by those skilled in the art by routine tests comprising the evaluation of the effect of the administration of said components mentioned above on pathologies and / or disorders that one seeks to prevent and / or to be treated by the administration of said pharmaceutical composition or medicament according to the invention, for example a staphylococcal infection and on toxicity.
  • tests can be implemented by quantitatively and qualitatively analyzing the effect of the administration of different amounts of said aforementioned components on a set of markers (biological and / or clinical) characteristic of these pathologies and / or of these disorders, as well as by bacterial counting in samples of biological samples.
  • the therapeutic index of the pharmaceutical composition or drug according to the invention can be determined by tests well known to those skilled in the art.
  • the inhibitors and the compositions in particular the pharmaceutical compositions or medicinal products according to the invention, may be administered directly, preferably using a suitable pharmaceutically acceptable vehicle to facilitate their entry into the body. cell of interest and / or protect them from their chemical or enzymatic degradation.
  • suitable pharmaceutically acceptable vehicles include microspheres, liposomes, nanoparticles.
  • Inhibitors according to the invention can also be administered via a vector such as advantageously a bacteriophage as described above.
  • compositions or medicaments according to the invention may be administered by different routes compatible with the desired effect and preferably orally, parenterally, subcutaneously, topically, intraocularly, sublingually and most preferably intraocularly.
  • compositions or medicaments according to the invention may be administered in one or more times or in continuous release.
  • compositions or medicaments according to the invention may be in various forms well known to those skilled in the art and adapted to the routes and modes of administration used.
  • pharmaceutical compositions when administered to animals, they may be included in food compositions (for example in the form of powders or granules).
  • the invention also relates to an inhibitor of the accumulation of transcripts SprD according to the invention, or an expression cassette according to the invention, or a vector according to the invention or a host cell according to the invention. invention for its application as a medicament for the prevention and / or treatment of a staphylococcal infection.
  • the invention also relates to the use of at least one component selected from the group consisting of an inhibitor of the accumulation of transcripts SprD according to the invention, an isolated polynucleotide according to the invention, an expression cassette according to the invention, a vector according to the invention, a host cell according to the invention, for the preparation of a medicament for the prevention and / or treatment of a staphylococcal infection.
  • the invention also relates to a pharmaceutical composition according to the invention for its use for the prevention and / or treatment of a staphylococcal infection.
  • the invention also relates to a method for preventing and / or treating a staphylococcal infection comprising administering to a subject a therapeutic amount of at least one component selected from the group consisting of an isolated polynucleotide according to the invention.
  • a therapeutic amount can be easily determined by tests well known to those skilled in the art.
  • the term "subject” means a mammal and especially humans.
  • said subject has a staphylococcal infection.
  • the subject of the invention is also a product containing:
  • At least one other antistaphylococcal agent as a combination product for simultaneous, separate and / or extended use for the prevention and / or treatment of a staphylococcal infection.
  • Staphylococcal infections include all infections that cause bacteria of the genus Staphylococcus. These infections include all pathologies and / or disorders that can be improved and / or avoided by reducing the accumulation and / or reducing the transcription of transcripts SprD.
  • staphylococcal infections include Staphylococcus aureus infections including superficial or deep folliculitis (such as boils, anthrax and staphylococcal sycosis), staphylococcal syndrome of scalded children, wound infections, furuncle, bacteremia, endocarditis, osteomyelitis or septic arthritis.
  • Staphylococcus aureus infections including superficial or deep folliculitis (such as boils, anthrax and staphylococcal sycosis), staphylococcal syndrome of scalded children, wound infections, furuncle, bacteremia, endocarditis, osteomyelitis or septic arthritis.
  • an agent for controlling at least one bacterial strain of the genus Staphylococcus in particular against at least one bacterial strain of the genus Staphylococcus selected from the group comprising bacterial strains of the genus Staphylococcus whose genome contains: a gene encoding an AR comprising the sequence SEQ ID No. 1 or a sequence homologous to the sequence SEQ ID No. 1 and the fragments thereof, and most particularly an agent intended to combat at least a strain of Staphylococcus aureus.
  • Said antistaphylococcal agent may be chosen from the group comprising:
  • antibiotics for preventing and / or treating local infections such as fusidic acid, mupirocin; antibiotics for preventing and / or treating systemic infections such as rifampicin, fluoroquinolones, fusidic acid, trimethoprim-sulfamethoxazole, glycopeptides; and bacteriophages such as ⁇ 812, K and ⁇ 1.
  • the combination products according to the invention comprising another antistaphylococcal agent have the advantages of optimizing the prevention and / or treatment of a staphylococcal infection and of being able to reduce the therapeutic amount of each component.
  • the subject of the present invention is also a process for obtaining a non-virulent bacterial strain or one whose virulence (pathogenicity) is reduced, in particular non-virulent, said strain belonging to the genus Staphylococcus, in particular to the species Staphylococcus aureus, said method comprising a step of total or partial deletion of the gene sprD in the genome of a bacterial strain of the genus Staphylococcus, in particular a total deletion of the gene sprD.
  • Decreasing the virulence or pathogenicity of a bacterial strain, in particular belonging to the genus Staphylococcus can be determined by any technique well known to those skilled in the art, in particular such as by the method described in the examples below.
  • the total or partial deletion of the sprD gene may be carried out by homologous recombination, preferably by the introduction into said strain of an isolated polynucleotide comprising at its 5 'and 3' ends respectively the nucleotide sequences SEQ ID No. 6 and SEQ ID # 7.
  • Such an introduction can be carried out for example by electroporation.
  • the present invention also relates to a method for in vitro or ex vivo selection or identification of compounds for the prevention and / or treatment of a staphylococcal infection, comprising the following steps;
  • test compound b) Determining the ability of the test compound to complex, in particular to hybridize, with the transcripts SprD; and or
  • step d) the selection of compounds capable of complexing with the transcripts SprD and / or of inhibiting the transcription of the gene SprD; and possibly furthermore e) contacting or introducing the test compound selected in step d) with or into a virulent bacterial strain belonging to the genus Staphylococcus;
  • the term "compound capable of complexing" with transcripts SprD any compound capable of forming a complex with the transcripts SprD, in particular able to hybridize with said transcripts.
  • Said compounds can be in particular proteins, polynucleotides such as a DNA molecule or an RNA molecule.
  • said compound may be antisense RNA, siRNA, shRNA, LNA, PNA.
  • the ability of a compound to form a complex, in particular to hybridize with the transcripts SprD can be determined by any technique well known to those skilled in the art, such as by the detection of the complex that may be formed between said compound and transcripts sprD. As an example of such a technique, mention may be made of gel retardation techniques, Northern blotting, RT-PCR.
  • the term "compound capable of inhibiting the transcription of the gene SprD” means any molecule capable of inhibiting by at least 20%, in particular by at least 35% and especially at least 50%, the transcription of the gene. sprD, relative to the transcription rate of the sprD gene in the absence of said compound.
  • the inhibition of transcripts SprD can be determined by tests well known to those skilled in the art such as by Northern blot using at least one probe specific for said transcript or by RT-PCR using at least two specific primers of said transcript. .
  • test compound to reduce or eliminate the virulence of a strain can be determined using techniques well known to those skilled in the art and in particular by the technique as described in point 1.3 of the examples below, in using a mouse model for example intravenous septicemia.
  • a mouse model for example intravenous septicemia.
  • test compound into a bacterial strain can be carried out by any technique conventionally known to a person skilled in the art, such as by transformation, transfection, for example by an electroporator.
  • viral strain of the genus Staphylococcus is intended to mean a pathogenic strain, in particular which expresses the SprD gene, in particular of sequence SEQ ID No. 1.
  • Said method according to the invention has the advantage of allowing the selection or identification of compounds for the prevention and / or treatment of a staphylococcal infection which unlike the putative drugs allow to have a targeted action on bacteria of the genus Staphylococcus , including strains resistant to antibiotics, optimizing their action and limiting the risk of side effects.
  • the present invention also relates to a method for the selection or identification in vitro or ex vivo of compounds capable of inhibiting the accumulation of transcripts SprD and / or the transcription of the gene sprD, comprising the following steps:
  • test compound ii) Determining the ability of the test compound to complex, in particular to hybridize, with the transcripts SprD; and or
  • step d) contacting or introducing the test compound selected in step d) with or into a virulent bacterial strain belonging to the genus Staphylococcus;
  • Said bacterial strain expressing the gene sprD in steps a) and i) processes according to the invention can be in particular a strain belonging to the genus Staphylococcus whose genome comprises the gene sprD in particular of sequence SEQ ID No. 1, preferably a strain belonging to the species Staphylococcus aureus.
  • Said bacterial strain expressing the gene sprD in steps a) and i) processes according to the invention may also be a bacterial strain not belonging to the genus Staphylococcus and for example that has been transformed with the gene sprD, in particular of sequence SEQ ID No. 1.
  • the present invention also relates to a compound obtainable by at least one of the selection or identification methods according to the invention, in particular as a medicament and particularly for the prevention and / or treatment of a staphylococcal infection.
  • Figure 1A shows the accumulation of the transcript sprD at different growth phases for a culture of S. aureus N315 (agr-) and for a culture of S. aureus RN1 (agr +).
  • the accumulation of 5S rRNA is used as a charge control.
  • Five ⁇ g of total RNA is loaded per well.
  • the probe used is a specific probe of the transcript sprD.
  • Figure 1B illustrates the accumulation of the transcript sprD for a culture of S. aureus N315
  • Figure 2A the virulence of a culture of S. aureus N315 (agr-), the virulence of a culture of S. aureus N315 (agr-) deleted from the gene sprD and the virulence of a culture of S. aureus N315 (agr-) deleted from the complemented sprD gene.
  • This graph gives the percentage of live animals as a function of the time elapsed from the infection of the animals by a culture of S. aureus N315 (agr-), culture of S. aureus N315 (agr-) deleted from the gene sprD or a culture of S. aureus N315 (agr-) deleted complemented sprD gene.
  • Figure 2B the virulence of a culture of S. aureus R 1 (agr +) and the virulence of a culture of S. aureus R Nl (agr +) deleted from the gene sprD.
  • This graph gives the percentage of live animals as a function of the time elapsed from infection of the animals by a culture of S. aureus RN1 (agr +) or culture of S. aureus RN1 (agr +) deleted from the gene sprD.
  • FIG. 3 represents the results of the bacterial count carried out on the kidneys taken from animals infected by a culture of S. aureus N315 (agr-), a culture of S. aureus N315 (agr-) deleted from the sprD gene or a culture of S. aureus N315 (agr-) deleted from the sprD gene complemented. Kidney removal and bacterial counts are performed 6 days after infection of the animals.
  • S. aureus strains and plasmids used in this study are listed in Table 1.
  • Strains of S. aureus were cultured in the usual way at 37 ° C in brain and heart infusion broth (BHI, Oxoid). If necessary, the inventors used chloramphenicol and erythromycin 10
  • the strain DH5a of E. Coli was used as a bacterial host for the construction of the plasmid. Strains of E. Coli were grown in a medium of Luria-Bertani (LB).
  • plasmid pCN38-SprD the gene encoding SprD is expressed under the control of its own promoter.
  • sprD with 40 nucleotides upstream and 35 nucleotides downstream was amplified by PCR from genomic RNA of S. aureus strain N315 as a fragment of 217 base pairs with Pst I and EcoR I flanking restriction. The PCR product was cloned between these two sites in the low copy number vector pCN38 (Charpentier et al, 2004).
  • the erythromycin resistance gene is cloned in 3 'of a nucleotide sequence of 1010 bp corresponding to the 1010 bp upstream of the gene SprD and 5' of a nucleotide sequence of 813 bp corresponding to the 813 pb downstream of the sprD gene.
  • the 1010 bp DNA fragment upstream of the SprD gene and the 813 bp DNA fragment downstream of the SprD gene were amplified by PCR from the genomic DNA of strain N315 from S. aureus.
  • PCR make it possible to obtain an amplicon of approximately 1000 bp, respectively presenting at its 5 'ends the Xbal restriction sites.
  • the primers used are the following:
  • Antisense primer GCCCGGATCCAAGGTAATATTAACATAAAATGGCTAC
  • the primers used are the following:
  • Antisense primer AGCGGAGCTCGAATTCGAAGGGTGTGTATTGTTATTTACCTA
  • the amplicons obtained are cloned into the vector pGEM-T (PROMEGA), this vector is already prepared with a thymidine (T) at the 3 'ends thus making it possible to clone the PCR products for which an A is added by the DNA polymerase during the PCR.
  • T thymidine
  • the digested and purified fragment is cloned between the XbaI-EcoRI sites of the plasmid vector pBT2.
  • the plasmid pBT2AsprD is used to transform a bacterial strain of S. aureus, strain RN44220, which is used as an intermediate host cell since it will promote the integration of the erythromycin resistance gene by homologous recombination in the genome of S. aureus.
  • 5S RNA and other RNAs Northern blots were run with 5 ⁇ g of denaturing PAGE denaturing gel-denatured total RNA as described in Pichon and Felden (2005).
  • S. aureus strain N315 (agr-), strain 5 * . aureus N315 (agr-) deleted from the sprD gene and S. aureus strain N315 (agr-) deleted from the complemented sprD gene were analyzed using a mouse model of intravenous septicemia.
  • mice were inoculated with 300 of a bacterial suspension containing 10 9 S. aureus cells in 0.9% NaCl.
  • the mice were infected with the> S strain. aureus N315 (agr-), with S. aureus strain N315 (agr-) deleted from the sprD gene or with S. aureus strain N315 (agr-) deleted from the complemented SprD gene.
  • Other mice were infected with the S. aureus RN1 strain (agr +) or with the S. aureus RN1 (agr +) strain deleted from the sprD gene.
  • the survival of the infected mice was analyzed for 21 days, and the significance of the differences between the different infected groups was analyzed by the Mann-Withney U test. A difference is considered significant when the P value is less than 0.05.
  • mice Three other groups of 5 mice were infected with 5 x 10 9 bacteria.
  • One group of mice was infected with S. aureus strain N31 (agr-)
  • the second group of mice was infected with S. aureus strain N315 (agr-) deleted from the sprD gene and the last group of mice was infected with S. aureus strain N315 (agr-) deleted complemented sprD gene.
  • Six days after inoculation the mice were sacrificed and their kidneys removed. The organs removed were then homogenized, diluted in a solution of 0.9% NaCl and spread on a medium agar sand 5% for the bacterial count.
  • strain S. aureus RN1 (agr +) deleted from the SprD gene ( ⁇ ).
  • mice inoculated with S. aureus strain N315 (agr-) deleted from the SPRD gene are alive at the 21 th day post-infection ( ⁇ in Fig. 2A and 2B) while the animals inoculated with the strain S. aureus N315 (agr-) (WT in Fig. 2A) all died 16 days after infection.
  • S. aureus N315 (agr-) WT in Fig. 2A
  • results also show that for mice inoculated with S. aureus strain N31 (agr-) deleted from the supplemented SprD gene, only half of the animals survive 21 days after infection ( ⁇ + SprD in Fig. 2A), indicating that the virulence can be restored S. aureus strain N315 (agr-) deleted from the SprD gene by transfection of a plasmid vector capable of expressing the gene sprD.
  • mice inoculated with S. aureus strain RN1 (agr +) deleted from the SprD gene survive longer infection compared to mice inoculated with S. aureus strain RN1 ( agr +) (WT in Fig. 2B).
  • the inventors are thus the first to have demonstrated the major role of a small non-coding RNA, SprD, in the virulence of S. aureus.
  • plasmids constitutively or induced expressing an antisense RNA whole or truncated nucleotide sequences more or less extensive are constructed by techniques known to those skilled in the art.
  • Staphylococcus host bacteria are then transformed with each of the plasmid constructs obtained.
  • the transformed bacteria are selected and their ability to inhibit the in vivo accumulation of the SprD RNA, will be verified by Northern blots as well as its ability to decrease virulence is tested as previously described.
  • mice were inoculated with 300 ⁇ l of a bacterial suspension containing 10 9 cells of S. aureus in 0.9% NaCl.
  • the mice are infected with a S. aureus strain expressing the entire antisense RNA sprD, or a S. aureus strain expressing the antisense RNA spD deleted from one or more nucleotide domains or a S. aureus strain expressing antisense RNA sprD. whole or deleted of one or more nucleotide domains complemented.
  • the survival of the infected mice is analyzed for 21 days, and the significance of the differences between the different infected groups was analyzed by the Mann-Withney U test. A difference is considered significant when the P value is less than 0.05.
  • mice were infected with 5 x 10 9 bacteria.
  • One group of mice was infected with the S. aureus strain expressing whole antisense RNA
  • other groups of mice were infected with S. aureus strains expressing the antisense RNA deleted from one or more nucleotide domains
  • other groups of mice were infected with S. aureus strains expressing whole or deleted antisense RNA from one or more domains nucleotides complemented.
  • Six days after inoculation the mice were sacrificed and their kidneys removed. The organs removed were then homogenized, diluted in a solution of 0.9% NaCl and spread on a 5% agar medium for bacterial counting.
  • the toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709-712.
  • Staphylococcal protein A consists of IgG-binding domains. Eur. J. Biochem. 156: 637-

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne notamment un inhibiteur de l'accumulation des transcrits sprD et/ou de la transcription du gène sprD et un procédé pour la sélection ou l'identification in vitro ou ex vivo de composés pour la prévention et/ou le traitement d'une infection staphylococcique.

Description

INHIBITEURS DE L'ACCUMULATION DE TRANSCRITS SPRD CHEZ S. AUREUS
La présente invention est relative à des inhibiteurs de l'accumulation et/ou de la transcription de petits ARN situés et exprimés à partir du génome de bactéries (notamment Staphylocoques dorés), appelés Spr pour « small pathogenicity island rNAs » et à leur applications notamment pour la détection, la prévention et/ou le traitement d'une infection staphylococcique. La présente invention concerne également une méthode de sélection ou d'identification de composés utiles pour la prévention et/ou le traitement d'une infection staphylococcique, lesdits composés étant capables de complexer avec les transcrits sprD et/ou d'inhiber la transcription du gène sprD.
Les infections staphylococciques sont très répandues dans le monde aussi bien communautaire qu'hospitalier, affectant aussi bien l'homme que les animaux.
Les bactéries du genre Staphylococcus ont été découvertes par Louis Pasteur en 1880. À ce jour, une vingtaine d'espèces ont été identifiées. Parmi celles-ci, les plus rencontrées en pathologie humaine et/ou animale sont Staphylococcus epidermidis, Staphylococcus saprophyticus, Staphylococcus hyicus, Staphylococcus intermedius et Staphylococcus aureus.
Ces espèces commensales sont dites pathogènes opportunistes puisqu'elles peuvent entraîner des infections dans des conditions particulières.
Ainsi, Staphylococcus epidermidis peut être responsable d'infections de la peau, nasales et aussi d'endocardites et d'infections localisées chez les patients immunodéprimés. Staphylococcus saprophyticus a été identifiée comme responsable de certaines infections urinaires. Staphylococcus hyicus et Staphylococcus intermedius peuvent être responsables d'infections diverses chez l'animal telles que la dermite exsudative du porcelet (S. hyicus) ou encore la furonculose du chien (S. intermedius).
L'espèce la plus pathogène des bactéries du genre Staphylococcus est Staphylococcus aureus (S. aureus). S. aureus est un membre de la flore commensale humaine chez une fraction de la population. Cependant, si des barrières mucosales sont franchies ou si les défenses immunes de l'hôte sont altérées, S. aureus peut devenir un pathogène opportuniste et l'une des principales causes des infections nosocomiales et des infections acquises en communauté chez l'homme et les animaux (Lowy, 1998). La pathogenèse de la maladie associée à S.aureus débute habituellement par une infection locale (par exemple, infection d'une blessure, furoncle, cellulite), puis peut se poursuivre par une diffusion systémique (bactériémie), puis par des infections métastatiques (par exemple endocardite, ostéomyélite et arthrite septique). S. aureus est également l'un des agents pathogènes isolés le plus fréquemment lors de mammites bovines aussi bien aux Etats-Unis qu'en Europe. Les vaches atteintes présentent alors une chute de production laitière qui entraîne de lourdes conséquences économiques sur les exploitations agricoles.
L'étude des mécanismes moléculaires permettant à l'infection staphylococcique de se mettre en place et de perdurer dans l'organisme colonisé a permis de montrer qu'une des causes principales de succès des infections staphylococciques, en particulier à S. aureus, est leur capacité à produire un grand nombre de facteurs de virulence. Certains de ces facteurs sont exportés à la surface des cellules et d'autres sont excrétés.
Ainsi, par exemple, S. aureus est capable de contourner les défenses de l'hôte par la production de pièges de la réponse immunitaire de l'hôte infecté telles que la protéine SpA (« Staphylococcal protein A », Moks et al., 1986) et la protéine Sbi (« S. aureus IgG binding protein » Zhang L, Jacobsson K, Vasi J, Lindberg M and Frykberg L (1998) A second IgG- binding protein in Staphylococcus aureus. Microbiology 145: 985-991).
Jusqu'à présent, le traitement le plus répandu à une infection staphylococcique est à base d'antibiotiques tels que les pénicillines (pénicilline G, méthicilline, oxacilline céphalosporines) les macro lides et les tétracyclines.
Cependant, avec l'utilisation répandue des antibiotiques, la diffusion de souches de bactéries du genre Staphylococcus, en particulier S. aureus, fortement résistantes aux antibiotiques, notamment à la méthicilline (SARM), a considérablement augmenté ces dernières années et constitue un défi clinique et épidémio logique mondial, notamment dans les hôpitaux.
Dans une optique de traitement mais également de prévention d'infection staphylococcique, il existe un besoin, tant chez l'homme que chez l'animal de disposer de nouvelles classes d'agents antistaphylococcique comme alternatives aux antibiotiques et de nouveaux outils diagnostiques.
Les inventeurs ont à présent mis en évidence que l'AR SprD a un rôle majeur dans la virulence de Staphylococcus aureus. Ils ont notamment montré que la délétion du gène SprD, dans au moins trois souches différentes de Staphylococcus aureus (les souches N315 (agr-), Newman (agr+) et R l (agr+)), est responsable de la diminution voire de la perte de virulence par les bactéries sur un modèle d'infection septicémique. Ils ont en outre montré par des expériences de complémentation que la virulence des bactéries délétées du gène SprD peut être au moins partiellement rétablie lorsqu'un vecteur exprimant le transcrit SprD est introduit dans les bactéries mutantes. Ainsi, ces résultats des travaux de recherche menés par les inventeurs indiquent que la virulence des souches bactériennes exprimant le gène sprD, notamment les souches appartenant au genre Staphylococcus et tout particulièrement à l'espèce Staphylococcus aureus, peut être diminuée voire supprimée par l'inhibition ou la suppression des effets de l'ARN sprD.
L'inhibition ou la suppression des effets de l'ARN SprD sur la virulence des bactéries
Staphylcoccus aureus pourra être obtenue par :
- l'inhibition de la transcription du gène SprD en agissant sur la séquence transcrite du gène (délétion de tout ou partie de la séquence transcrite, mutagenèse dirigée pour modifier la reconnaissance par la machinerie de transcription) ou via des molécules empêchant la transcription du gène en se fixant sur sa séquence promotrice bloquant l'initiation de la transcription du gène sprd.
- les inhibiteurs de l'activité des transcrits SprD, notamment les inhibiteurs susceptibles d'empêcher la reconnaissance entre le transcrit SprD et ses cibles.
- la mutagénèse dirigée du gène SprD pour modifier la reconnaisance entre le transcrit SprD et sa cible.
- les agents affectant la stabilité des transcrits SprD et/ou les inhibiteurs de l'accumulation des transcrits SprD.
On entend par « bactéries du genre Staphylococcus » au sens de la présente invention, l'ensemble des souches bactériennes du genre Staphylococcus.
En particulier, les bactéries du genre Staphylococcus selon l'invention sont choisies dans le groupe comprenant les souches bactériennes du genre Staphylococcus dont le génome contient un gène codant un ARN comprenant la séquence SEQ ID N°l ou une séquence homologue de la séquence SEQ ID N°l et les fragments de celles-ci.
Ces souches peuvent être aisément identifiées par l'Homme du Métier, par exemple, par des techniques de criblage de banques (d'ADN génomique ou d'ADNc de bactéries du genre Staphylococcus) à l'aide de sondes ou d'amorces spécifiques d'une séquence appartenant à des souches bactériennes du genre Staphylococcus telle que définies ci-dessus. De telles sondes ou amorces peuvent être sélectionnées à partir des séquences de polynucléotides selon l'invention.
Tout particulièrement, les bactéries du genre Staphylococcus selon l'invention sont des souches de Staphylococcus aureus. Selon un premier aspect, l'invention a pour objet, un inhibiteur de l'accumulation des transcrits sprD (tels que les inhibiteurs de la stabilité des transcrits sprD) et/ou de la transcription du gène sprD.
On entend par « transcrit sprD » ou « transcrit du gène sprD », un produit de transcription, c'est- à-dire un ARN synthétisé lors de la transcription du gène sprD.
L'expression « inhibiteur de l'accumulation des transcrits sprD » ou « agent inhibiteur de l'accumulation des transcrits sprD » est utilisée ici pour désigner une molécule capable d'induire une diminution d'au moins 20 %, en particulier d'au moins 35 % et tout particulièrement d'au moins 50 % du taux de transcrits du gène sprD accumulés en particulier dans le temps dans une souche bactérienne exprimant sprD, par rapport au taux de transcrits du gène sprD accumulés, en particulier dans le temps dans ladite souche bactérienne exprimant sprD en l'absence de ladite molécule. L'inhibition de l'accumulation de transcrits sprD peut être déterminée par des techniques bien connues de l'Homme du Métier telles que par « Northern Blot », utilisant au moins une sonde spécifique dudit transcrit ou par « RT-PCR » utilisant au moins deux amorces spécifiques dudit transcrit, notamment en étudiant l'accumulation du taux de transcrit sprD dans une souche bactérienne en culture exprimant sprD, dans des conditions d'expression du gène sprD. En particulier, l'inhibition de l'accumulation des transcrits peut être déterminée par la technique telle que décrite au point 1.2 des exemples ci-après (« Isolation de l'ARN et Northern Blots ») et dont les résultats sont présentés sur la figure 1A.
L'expression « inhibiteur de la transcription du gène sprD » ou « agent inhibiteur de la transcription du gène sprD » est utilisée ici pour désigner une molécule capable d'inhiber d'au moins 20%, en particulier d'au moins 35 % et tout particulièrement d'au moins 50% la transcription du gène sprD, par rapport au taux de transcription du gène sprD en l'absence de ladite molécule. On entend par « inhibition de la transcription du gène sprD » une diminution d'au moins 20%, en particulier d'au moins 35 % et tout particulièrement d'au moins 50% de la transcription du gène sprD. L'inhibition de la transcription du gène sprD peut être déterminée par des techniques bien connues de l'Homme du Métier telles qu'exemplifïées ci-dessous.
De manière préférentielle, un tel inhibiteur comprend un polynucléotide isolé dont la séquence comprend ou consiste en une séquence choisie dans le groupe consistant en :
- la séquence SEQ ID N°4, les séquences dérivées ayant au moins 70 %, en particulier au moins 80 %, au moins 90 %, au moins 95 %, au moins 96%, au moins 97 %, au moins 98% et tout particulièrement au moins 99% d'identité avec la séquence SEQ ID N°4 et les fragments d'au moins 5 nucléotides de celles-ci, en particulier la séquence SEQ ID N°8 ; et les séquences d'ADN correspondantes, en particulier les séquences SEQ ID N°5 et SEQ ID N°9;
lesdites séquences dérivées et lesdits fragments ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2.
La présente invention concerne également un premier polynucléotide isolé dont la séquence comprend ou consiste en une séquence choisie dans le groupe consistant en :
a) la séquence SEQ ID N°4, les séquences dérivées ayant au moins 70%, en particulier au moins 80%, au moins 90 %, au moins 95 %, au moins 96%, au moins 97 %, au moins 98% et tout particulièrement au moins 99% d'identité avec la séquence SEQ ID N°4 et les fragments d'au moins 5 nucléotides de celles-ci, de préférence la séquence SEQ ID N°4 et la séquence SEQ ID N°8 et tout préférentiellement la séquence SEQ ID N°4 ; et
b) les séquences d'ADN correspondantes, en particulier la séquence SEQ ID N°5 et la séquence SEQ ID N°9 et tout particulièrement la séquence SEQ ID N°5 ;
lesdites séquences dérivées et lesdits fragments ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2.
On entend par « polynucléotide » au sens de la présente invention, un polymère composé de plusieurs nucléotides liés par des liaisons phosphodiesters, tel que l'ADN (Acide DésoxyriboNucléique) et l'ARN (Acide RiboNucléique). L'ADN présente l'avantage d'être plus stable que l'ARN.
On entend par « séquence dérivée d'une deuxième séquence », une séquence ayant au moins 70 % d'identité, en particulier au moins 80 %, au moins 85%, au moins 90 %, au moins 95 %, au moins 96%, au moins 97 %, au moins 98 % et tout particulièrement au moins 99% d'identité avec une deuxième séquence.
Le terme « identité » se réfère à l'identité existant entre deux séquences de polynucléotides. L'identité peut être déterminée par la comparaison des nucléotides présents à une position dans chacune des séquences de polynucléotide alignées dans ce but. Lorsque, à une position donnée un nucléotide est identifié comme identique sur les deux séquences alignées, lesdites séquences sont dites identiques à cette position. Le pourcentage d'identité entre deux séquences de polynucléotides est fonction du nombre de nucléotides identiques aux différentes positions sur les deux séquences de nucléotides alignées. Les pourcentages d'identité auxquels il est fait référence dans le cadre de l'exposé de la présente invention sont déterminés sur la base d'un alignement global des séquences à comparer, c'est-à-dire sur un alignement des séquences prises dans leur intégralité, en utilisant l'algorithme de NEEDLEMAN et WUNSCH (J. Mol. Biol. 48, 443-453, 1970). Cette comparaison de séquences peut être effectuée par exemple à l'aide du logiciel needle en utilisant le paramètre "Gap open" égal à 10.0, le paramètre "Gap Extend" égal à 0.5, et une matrice « Blosum 62 ». Le logiciel needle est par exemple disponible sur le site internet ebi.ac.uk world wide, sous la dénomination « Align ».
On entend notamment par séquence d'ADN correspondant à la séquence d'un ARN, ladite séquence d'ARN dans laquelle les ribonucléotides comprenant une base uracile ont été remplacées par des désoxyribonucléotides comprenant une base thymine.
En particulier, lesdits fragments selon l'invention peuvent comprendre au moins 5 nucléotides, en particulier au moins 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140 nucléotides.
Lesdits fragments selon l'invention peuvent comprendre au maximum 140, en particulier au maximum 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10 nucléotides.
La capacité d'hybridation spécifique d'une première séquence de polynucléotide avec une deuxième séquence de polynucléotide peut être déterminée in vitro, par des tests bien connus de l'Homme du Métier. A titre d'exemple, on peut citer le test décrit dans C. Pichon & B. Felden (2005 ; avec l'exemple de l'ARN régulateur SprA et sa cible ARNm SA2216), qui comprend les étapes suivantes :
- une première séquence de polynucléotide est marquée radioactivement, purifiée et des quantités croissantes d'une deuxième séquence de polynucléotide non marquée sont ajoutées et analysées par gel d'électrophorèse en conditions natives. L'obtention d'un retard de migration sur ce gel implique la formation d'un complexe entre ces deux séquences de polynucléotides, par hybridation ;
- l'effet de l'ajout d'un excès de 100 à 2000 fois, en rapports molaires, d'une troisième séquence de polynucléotide (par exemple un mélange d'ARN de transfert) sur la formation dudit complexe entre les deux premières séquences, est analysé ;
- l'effet de l'ajout d'un excès de 100 à 2000 fois, en rapports molaires, de la première séquence de polynucléotide non marqué sur la formation dudit complexe entre les deux premières séquences, est analysé ;
- l'hybridation entre les deux premières séquences de polynucléotides sera considérée comme spécifique si (i) ledit complexe préformé entre les deux premières séquences de polynucléotide reste stable en présence de cet excès de troisième séquence de polynucléotide (ex : ARNt) et si (ii) ledit complexe préformé est déstabilisé en présence de faibles quantités de la première séquence de polynucléotide non marquée.
L'Homme du Métier pourra aisément déterminer les séquences dérivées et les fragments du premier polynucléotide isolé selon l'invention qui ont la capacité de s'hybrider spécifiquement à la séquence ID N°2, en mettant en œuvre un test d'hybridation spécifique tel que décrit ci-dessus.
En particulier, les séquences dérivées et les fragments du premier polynucléotide isolé selon l'invention qui ont la capacité de s'hybrider spécifiquement à la séquence ID N°2 ont en outre la capacité d'inhiber l'accumulation des transcrits sprD et/ou d'inhiber la transcription du gène sprD.
En particulier, les polynucléotides isolés selon la présente invention peuvent être capables de s'hybrider spécifiquement à l'ARN SprD et d'induire la dégradation de l'ARN sprD par un mécanisme de dégradation lié au recrutement de ribonucléases sur le duplex ARN-ARN, l'exemple décrit expérimentalement chez Staphylococcus aureus étant la ribonucléase III (pour la dégradation des cibles ARNm de l'AR III). Dans ce cas, l'ARN SprD est donc dégradé et ne peut donc plus produire ses effets. De tels polynucléotides sont donc particulièrement utiles pour la prévention et/ou le traitement d'infections staphylococciques, en particulier de souches résistantes aux antibiotiques. En outre, les polynucléotides selon l'invention présentent l'avantage contrairement à des traitements putatifs, d'avoir une action ciblée sur les bactéries du genre Staphylococcus optimisant ainsi leur action et limitant les risques d'effets secondaires.
La présente invention concerne également l'utilisation in vitro ou ex vivo du premier polynucléotide isolé selon l'invention en tant qu'agent inhibiteur de l'accumulation des transcrits sprD et/ou de la transcription du gène sprD, en particulier ledit polynucléotide isolé selon l'invention ayant une séquence comprenant ou consistant en une séquence choisie dans le groupe consistant en :
a) la séquence SEQ ID N°4, les séquences dérivées ayant au moins 70 % d'identité avec la séquence SEQ ID N°4 et les fragments d'au moins 5 nucléotides de celles-ci, de préférence la séquence SEQ ID N°4 et la séquence SEQ ID N°8 et tout préférentiellement la séquence SEQ ID N°4 ; et
b) les séquences d'ADN correspondantes, en particulier les séquences SEQ ID N°5 et
SEQ ID N°9 et tout particulièrement la séquence SEQ ID N°5 ; lesdites séquences dérivées et lesdits fragments ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2 et en particulier ayant en outre la capacité d'inhiber l'accumulation des transcrits sprD et/ou d'inhiber la transcription du gène sprD.
L'invention a également pour objet un deuxième polynucléotide isolé comprenant à ses extrémités 5' et 3' respectivement les séquences nucléotidiques SEQ ID N°6 et SEQ ID N°7 (correspondant respectivement à la séquence de l'ADN génomique en amont du gène sprD et à la séquence de l'ADN génomique en aval du gène sprD). En particulier, ledit deuxième polynucléotide a une taille inférieure à 10 000 nucléotides, tout particulièrement inférieure à 5 000 nucléotides, 2 500 nucléotides, 1 500 nucléotides, 1000 nucléotides, 750 nucléotides, 500 nucléotides, 450 nucléotides, 250 nucléotides, 150 nucléotides, 100 nucléotides, 50 nucléotides, 25 nucléotides.
En particulier, ledit deuxième polynucléotide a une taille comprise entre 5 et 10 000 nucléotides, tout particulièrement entre 10 et 5 000 nucléotides, 25 et 2 500 nucléotides, 50 et 1 500 nucléotides, 75 et 1 000 nucléotides, 100 et 750 nucléotides, 150 et 500 nucléotides.
Ce deuxième polynucléotide peut être utile notamment pour déléter totalement le gène sprD du génome de bactérie appartenant au genre Staphylococcus, en particulier dont le génome contient la séquence SEQ ID N°l, en particulier, appartenant à l'espèce Staphylococcus aureus.
L'invention a également pour objet un inhibiteur de l'accumulation des transcrits sprD qui comprend un vecteur comprenant les séquences nucléotidiques SEQ ID N°6 et SEQ ID N°7 et un vecteur recombinant comprenant un deuxième polynucléotide selon l'invention. Ledit vecteur recombinant (tel que pBT2AsprD) ainsi généré peut être transformé par exemple dans les souches RN4220 puis N315 pour permettre l'intégration du gène ermB dans le génome par recombinaison homologue. La délétion du gène sprD peut être validée par Northern blots, avec absence du transcrit sprD. Les inventeurs ont montré sur un modèle murin de septicémie que les bactéries dans lesquelles le gène sprD est délété perdent leur virulence.
La présente invention englobe également les polynucléotides conformes à l'invention, synthétiques, hémi-synthétiques, recombinants et leurs analogues. Les analogues des polynucléotides selon l'invention ont la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2 ou d'être transcrits en polynucléotides ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2. En particulier, les analogues des polynucléotides selon l'invention ont en outre la capacité d'inhiber l'accumulation des transcrits sprD et/ou d'inhiber la transcription du gène sprD. On entend par « analogue » au sens de la présente invention, des polynucléotides comprenant au moins une modification chimique au niveau de leur sucre, phosphate, de leur base ou de leurs extrémités 5 ' et 3 ' ; ladite modification pouvant être réalisée par synthèse chimique ou enzymatique.
En effet, les polynucléotides selon l'invention peuvent comprendre au moins une modification chimique destinée notamment à augmenter leur stabilité, leur résistance à la dégradation par les endo et exonucléases, favoriser leur capacité à entrer dans une cellule d'intérêt et/ou dans le cas du premier polynucléotide selon l'invention à augmenter sa capacité à réguler négativement l'accumulation de transcrits sprD. L'augmentation de la capacité du premier polynucléotide (en particulier de séquence SEQ ID N°4) selon l'invention à réguler négativement l'accumulation de transcrits sprD peut être obtenu, par exemple, par une modification chimique permettant l'augmentation de la formation et/ou de la stabilité d'un complexe entre le premier polynucléotide selon l'invention et la séquence SEQ ID N°2, par hybridation spécifique. Ainsi, les polynucléotides selon l'invention peuvent comprendre des nucléotides modifiés au niveau de leur sucre, phosphate, de leur base et/ou peuvent présenter des modifications, notamment post-transcriptionnelles, aux niveaux de leurs extrémités 5' et 3'. De tels nucléotides modifiés peuvent être choisis dans le groupe comprenant : les 2'-0- methylnucléotides, les 2'-0-methoxyethylnucléotides, les déoxynucléotides tels que les 2'- déoxynucléotides et les 2'-deoxy-2'-fluoronucléotides, les nucléotides à liaisons peptidiques, des fluorochromes, des éléments radioactifs.
Les polynucléotides selon l'invention peuvent également comprendre en outre, à leurs extrémités 5' et/ou 3' des éléments structuraux (tels que des hélices d'ARN ou d'ADN stables) renforçant leur stabilité et/ou leur résistance aux dégradations.
Les polynucléotides selon l'invention peuvent être obtenus par des méthodes bien connues de l'Homme du Métier telles que par des techniques de criblage de banques (d'ADN génomique ou d'ADNc de bactéries du genre Staphylococcus) par des sondes ou des amorces spécifiques desdits polynucléotides (sélectionnés par exemple à partir des séquences de polynucléotides selon l'invention), mais également, par synthèses chimiques (Beaucage SL., 2008) ou par réactions enzymatiques (Sherlin LD et al, 2001).
L'invention a également pour objet une cassette d'expression comprenant une séquence d'ADN telle que définie au point b) ci-dessus, en particulier ladite séquence d'ADN correspondant à une séquence comprise dans le groupe consistant en : la séquence SEQ ID N°4, les séquences dérivées ayant au moins 70 % d'identité avec la séquence SEQ ID N°4 et les fragments d'au moins 5 nucléotides de celles-ci, en particulier la séquence SEQ ID N°4 et la séquence SEQ ID N°8 et tout particulièrement la séquence SEQ ID N°4 ;
lesdites séquences dérivées et lesdits fragments ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2 et en particulier ayant en outre la capacité d'inhiber l'accumulation des transcrits sprD et/ou d'inhiber la transcription du gène sprD.
En particulier, la présente invention concerne une cassette d'expression comprenant la séquence d'ADN de séquence SEQ ID N°5 ou SEQ ID N°9, tout particulièrement de séquence SEQ ID N°5.
L'invention a également pour objet une cassette d'expression comprenant une séquence d'ADN selon l'invention pouvant être transcrite en séquence SEQ ID N°4.
On entend par « cassette d'expression » au sens de la présente invention, une cassette comprenant un promoteur et une région de terminaison de la transcription dans laquelle une séquence d'ADN d'intérêt est liée de manière opérationnelle au promoteur afin de permettre la transcription de ladite séquence d'ADN.
Il peut s'agir de tout promoteur ou séquence dérivée, inductible ou non, permettant la transcription d'un polynucléotide selon l'invention. En particulier, le promoteur est choisi parmi les promoteurs permettant la transcription d'un polynucléotide selon l'invention dans au moins une souche bactérienne du genre Staphylococcus. À titre d'exemple de tels promoteurs, on peut citer le promoteur du bactériophage T7 (Milligan JF et al., 1989) ou des promoteurs naturels constitutifs.
L'invention a également pour objet un vecteur recombinant comprenant :
- un polynucléotide isolé choisi parmi le groupe de polynucléotides isolés selon l'invention, en particulier parmi le premier et le deuxième polynucléotide isolé selon l'invention ; ou
- une cassette d'expression selon l'invention.
Les vecteurs utilisables peuvent être des vecteurs viraux, tels que des bactériophages, ou non viraux, tels que des vecteurs plasmidiques.
À titre d'exemples de vecteurs plasmidiques utilisables selon l'invention, on peut citer l'ensemble des vecteurs dérivés de pCN décrits dans Charpentier et al. (2004). Certains de ces vecteurs, par exemple pCN51, permettent la transcription d'une séquence d'ADN d'intérêt en ARN par l'utilisation d'un promoteur inductible au Cadmium.
En particulier, le vecteur plasmidique peut être choisi dans le groupe comprenant les plasmides pCN35 et pCN38 décrits dans Charpentier et al. (2004). Ces plasmides présentent l'avantage d'être maintenus et ainsi de permettre l'expression de polynucléotides selon l'invention, dans des bactéries transformées du genre Staphylococcus.
Le plasmide pBT2 (Bruckner, 1997, FEMS Microbiol Lett. 151 : 1-8) pourra être mis en œuvre pour la délétion de tout ou partie du gène SprD par recombinaison homologue.
En particulier, le vecteur selon l'invention est un bactériophage.
De préférence, ledit bactériophage est capable d'infecter au moins une souche bactérienne du genre Staphylococcus. On entend par « bactériophage capable d'infecter une souche bactérienne du genre Staphylococcus », tout virus de bactéries capable d'introduire une partie de son matériel génétique dans le génome d'une souche bactérienne du genre Staphylococcus (prophage) ou de permettre l'expression transitoire de ce matériel génétique dans la bactérie réceptrice sans intégration chromosomique.
Les bactéries du genre Staphylococcus sont infectées par trois types de phages : lyriques obligatoires, tempérés et chroniques (Nicholas H. Mann, 2008). L'ensemble de ces phages est utilisable en tant que vecteur selon l'invention.
Dans le cadre de la prévention et/ou du traitement d'infection staphylococcique, les phages utilisables comme vecteur selon l'invention sont de préférence à large spectre et capable d'infecter le plus grand nombre possible de souches bactériennes du genre Staphylococcus responsables d'infections chez l'homme et/ou l'animal. A titre d'exemple de tels bactériophages, on peut citer le phage lyrique obligatoire φ812, les phages K et (])MR11.
L'utilisation de bactériophages comme vecteur selon l'invention présente l'avantage d'optimiser la prévention et/ou le traitement d'une infection staphylococcique ou d'un trouble lié à au moins une bactérie du genre Staphylococcus. En outre, l'utilisation de bactériophage comme vecteur selon l'invention présente l'avantage que le bactériophage utilisé soit potentiellement efficace contre différentes souches bactériennes du genre Staphylococcus, même celles résistantes aux antibiotiques (Nicholas H. Mann, 2008) et de ne pas présenter d'effets secondaires, notamment en étant dénués d'effets néfastes sur les cellules eucaryotes de l'hôte infecté.
Selon un autre aspect, l'invention a pour objet une cellule hôte transformée par une cassette d'expression selon l'invention ou un vecteur recombinant selon l'invention. La cellule hôte peut être en particulier un procaryote tel que E. coli notamment la souche DH5a et avantageusement un bactériophage tel que décrit ci-dessus.
L'invention a également pour objet une composition comprenant au moins un composant choisi dans le groupe consistant en un inhibiteur de l'accumulation des transcrits sprD selon l'invention, un polynucléotide isolé selon l'invention, une cassette d'expression selon l'invention, un vecteur selon l'invention et une cellule hôte selon l'invention. Avantageusement, ladite composition selon l'invention est une composition pharmaceutique.
L'invention a également pour objet une composition pharmaceutique comprenant un vecteur pharmaceutiquement acceptable et au moins un composant choisi dans le groupe consistant en un polynucléotide isolé selon l'invention, une cassette d'expression selon l'invention, un vecteur selon l'invention et une cellule hôte selon l'invention.
Les vecteurs pharmaceutiquement acceptables utilisables dans les compositions pharmaceutiques selon l'invention peuvent être des vecteurs bien connus de l'Homme du Métier.
Les compositions pharmaceutiques ou médicaments selon l'invention présentent l'avantage contrairement aux médicaments putatifs d'avoir une action ciblée sur les bactéries du genre Staphylococcus, y compris les souches résistantes aux antibiotiques, optimisant ainsi leur action et limitant les risques d'effets secondaires.
En particulier, lesdits composants sont présents dans la composition pharmaceutique ou médicament selon l'invention en quantités thérapeutiques (quantités actives et non toxiques). De telles quantités thérapeutiques peuvent être déterminées par l'Homme du Métier par des tests de routine comprenant l'évaluation de l'effet de l'administration desdits composants susmentionnés sur des pathologies et/ou des troubles que l'on cherche à prévenir et/ou à traiter par l'administration de ladite composition pharmaceutique ou médicament selon l'invention, par exemple une infection staphylococcique et sur la toxicité. Par exemple, de tels tests peuvent être mis en œuvre en analysant de manière quantitative et qualitative l'effet de l'administration de différentes quantités desdits composants susmentionnés sur un ensemble de marqueurs (biologiques et/ou cliniques) caractéristiques de ces pathologies et/ ou de ces troubles, ainsi que par comptage bactériens dans des échantillons de prélèvements biologiques.
En outre, l'index thérapeutique de la composition pharmaceutique ou médicament selon l'invention peut être déterminé par des tests bien connus de l'Homme du Métier.
Les inhibiteurs et les compositions, en particulier les compositions pharmaceutiques ou médicaments selon l'invention peuvent être administrés directement, de préférence à l'aide d'un véhicule pharmaceutiquement acceptable approprié permettant de faciliter leur entrée dans la cellule d'intérêt et/ou de les protéger de leur dégradation chimique ou enzymatique. À titre d'exemples de tels véhicules pharmaceutiquement utilisables, on peut citer des microsphères, des liposomes, des nanoparticules.
Les inhibiteurs selon l'invention peuvent également être administrés via un vecteur tel qu'avantageusement un bactériophage comme décrit ci-dessus.
Les compositions pharmaceutiques ou médicaments selon l'invention peuvent être administrées par différentes voies compatibles avec l'effet recherché et de préférence par voie orale, parentérale, sous-cutanée, topique, intra-oculaire, sublinguale et tout préférentiellement intra-oculaire.
Les compositions pharmaceutiques ou médicaments selon l'invention peuvent être administrées en une ou plusieurs fois ou en libération continue.
Les compositions pharmaceutiques ou médicaments selon l'invention peuvent se présenter sous différentes formes bien connues de l'Homme du Métier et adaptées aux voies et modes d'administration utilisés. En particulier lorsque les compositions pharmaceutiques sont administrées à des animaux, elles peuvent être incluses dans des compositions alimentaires (par exemple sous forme de poudres ou de granulés).
Selon un autre aspect, l'invention a également pour objet un inhibiteur de l'accumulation des transcrits sprD selon l'invention, ou une cassette d'expression selon l'invention, ou un vecteur selon l'invention ou une cellule hôte selon l'invention, pour son application en tant que médicament pour la prévention et/ou le traitement d'une infection staphylococcique.
L'invention a également pour objet l'utilisation d'au moins un composant choisi dans le groupe consistant en un inhibiteur de l'accumulation des transcrits sprD selon l'invention, un polynucléotide isolé selon l'invention, une cassette d'expression selon l'invention, un vecteur selon l'invention, une cellule hôte selon l'invention, pour la préparation d'un médicament destiné à la prévention et/ou au traitement d'une infection staphylococcique.
L'invention a également pour objet une composition pharmaceutique selon l'invention pour son utilisation pour la prévention et/ou le traitement d'une infection staphylococcique.
L'invention a également pour objet une méthode de prévention et/ou de traitement d'une infection staphylococcique comprenant l'administration à un sujet d'une quantité thérapeutique d'au moins un composant choisi dans le groupe consistant en un polynucléotide isolé selon l'invention, une cassette d'expression selon l'invention, un vecteur selon l'invention, une cellule hôte selon l'invention. La quantité thérapeutique peut être aisément déterminée par des tests bien connus de l'Homme du Métier.
De préférence, on entend par « sujet » un mammifère et tout particulièrement l'Homme. En particulier, ledit sujet est atteint d'une infection staphylococcique.
Selon un autre aspect, l'invention a également pour objet un produit contenant :
- au moins un composant choisi dans le groupe comprenant un polynucléotide isolé selon l'invention, une cassette d'expression selon l'invention, un vecteur selon l'invention, une cellule hôte selon l'invention; et
- au moins un autre agent antistaphylococcique, comme produit de combinaison pour une utilisation simultanée, séparée et/ou étalée dans le temps, pour la prévention et/ou le traitement d'une infection staphylococcique.
Les infections staphylococciques comprennent l'ensemble des infections dont sont responsables les bactéries du genre Staphylococcus. Ces infections comprennent l'ensemble des pathologies et/ou des troubles pouvant être améliorés et/ou évités par la réduction de l'accumulation et/ou par la réduction de la transcription des transcrits sprD.
En particulier, les infections staphylococciques comprennent les infections à Staphylococcus aureus parmi lesquelles on peut citer les folliculites superficielles ou profondes (tels que les furoncles, l'anthrax et le sycosis staphylococcique), le syndrome staphylococcique des enfants ébouillantés, les infections de blessures, un furoncle, une bactériémie, une endocardite, une ostéomyélite ou encore une arthrite septique.
On entend par « agent antistaphylococcique » au sens de la présente invention, un agent destiné à lutter contre au moins une souche bactérienne du genre Staphylococcus, en particulier contre au moins une souche bactérienne du genre Staphylococcus choisie dans le groupe comprenant les souches bactériennes du genre Staphylococcus dont le génome contient : un gène codant un AR comprenant la séquence SEQ ID N°l ou une séquence homologue de la séquence SEQ ID N°l et les fragments de celles-ci, et tout particulièrement un agent destiné à lutter contre au moins une souche de Staphylococcus aureus.
Ledit agent antistaphylococcique peut être choisi dans le groupe comprenant :
des antibiotiques destinés à prévenir et ou à traiter des infections locales tels que l'acide fusidique, la mupirocine ; des antibiotiques destinés à prévenir et/ou traiter des infections systémiques tels que la rifampicine, les fluoroquinolones, l'acide fusidique, le trimethoprime-sulfaméthoxazole, les glycopeptides ; et des bactériophages tels que φ812, K et φΜΜ 1.
Les produits de combinaison selon l'invention comprenant un autre agent antistaphylococcique présentent les avantages d'optimiser la prévention et/ou le traitement d'une infection staphylococcique et de pouvoir réduire la quantité thérapeutique de chaque composant.
La présente invention a également pour objet un procédé d'obtention d'une souche bactérienne non virulente ou dont la virulence (pathogénicité) est diminuée, en particulier non virulente, ladite souche appartenant au genre Staphylococcus, en particulier à l'espèce Staphylococcus aureus, ledit procédé comprenant une étape de délétion totale ou partielle du gène sprD dans le génome d'une souche bactérienne du genre Staphylococcus, en particulier une délétion totale du gène sprD. La diminution de la virulence ou pathogénicité d'une souche bactérienne, en particulier appartenant au genre Staphylococcus, peut être déterminée par toute technique bien connue de l'Homme du Métier, en particulier telle que par la méthode décrite dans les exemples ci-dessous.
La délétion totale ou partielle du gène sprD peut être réalisée par recombinaison homologue, de préférence par l'introduction dans ladite souche d'un polynucléotide isolé comprenant à ses extrémités 5' et 3' respectivement les séquences nucléotidiques SEQ ID N°6 et SEQ ID N°7. Une telle introduction peut être réalisée par exemple par electroporation.
La présente invention concerne également un procédé pour la sélection ou l'identification in vitro ou ex vivo de composés pour la prévention et/ou le traitement d'une infection staphylococcique, comprenant les étapes suivantes ;
a) l'introduction ou la mise en contact d'un composé test dans ou avec une souche bactérienne exprimant le gène sprD ou avec des transcrits sprD ;
b) La détermination de la capacité du composé test à complexer, en particulier à s'hybrider, avec les transcrits sprD ; et/ou
c) la détermination de la capacité du composé test à inhiber la transcription du gène sprD ; et éventuellement en outre
d) la sélection des composés capables de complexer avec les transcrits sprD et/ou d'inhiber la transcription du gène sprD ; et éventuellement en outre e) la mise en contact ou l'introduction du composé test sélectionné à l'étape d) avec ou dans une souche bactérienne virulente appartenant au genre Staphylococcus ;
f) la détermination de la capacité du composé test à diminuer ou à supprimer la virulence de ladite souche ; et éventuellement en outre
g) la sélection des composés tests capables de diminuer ou supprimer la virulence de ladite souche.
On entend par « composé capable de complexer » avec des transcrits sprD, tout composé capable de former un complexe avec les transcrits sprD, en particulier capable de s'hybrider avec lesdits transcrits. Lesdits composés peuvent être notamment des protéines, des polynucléotides tels qu'une molécule d'ADN ou une molécule d'ARN. En particulier, ledit composé peut être un ARN antisens, un siRNA, un shRNA, LNA, PNA. La capacité d'un composé à former un complexe, en particulier à s'hybrider avec les transcrits sprD peut être déterminée par toute technique bien connue de l'Homme du Métier, telle que par la détection du complexe susceptible d'être formé entre ledit composé et les transcrits sprD. A titre d'exemple de telle technique, on peut citer les techniques de retard sur gel, northern-blot, RT-PCR.
On entend par « composé capable d'inhiber la transcription du gène sprD », toute molécule capable d'inhiber d'au moins 20%, en particulier d'au moins 35 % et tout particulièrement d'au moins 50% la transcription du gène sprD, par rapport au taux de transcription du gène sprD en l'absence dudit composé. L'inhibition des transcrits sprD peut être déterminée par des tests bien connus de l'Homme du Métier telle que par Northern blot en utilisant au moins une sonde spécifique dudit transcrit sprD ou par RT-PCR en utilisant aux moins deux amorces spécifiques dudit transcrit sprD.
La capacité du composé test à diminuer ou à supprimer la virulence d'une souche peut-être déterminée en utilisant des techniques bien connues de l'Homme du Métier et notamment par la technique telle que décrite au point 1.3 des exemples ci-après, en utilisant un modèle murin par exemple de septicémie intraveineuse. Par exemple, il est possible d'inoculer à des souris une suspension bactérienne comprenant une souche virulente du genre Staphylococcus dans laquelle a été introduite ledit composé test et en observant l'état (notamment survie ou non) des souris dans le temps en comparaison avec des souris inoculée avec une composition non pathogène comme témoin.
L'introduction du composé test dans une souche bactérienne peut être effectuée par toute technique classiquement connue de l'Homme du Métier telle que par transformation, transfection, par exemple par un electroporateur. On entend par souche virulente du genre Staphylococcus, une souche pathogène, notamment qui exprime le gène sprD, en particulier de séquence SEQ ID N° 1.
Ledit procédé selon l'invention présente l'avantage de permettre la sélection ou Γ identification de composés pour la prévention et/ou le traitement d'une infection staphylococcique qui contrairement aux médicaments putatifs permettent d'avoir une action ciblée sur les bactéries du genre Staphylococcus, y compris les souches résistantes aux antibiotiques, optimisant ainsi leur action et limitant les risques d'effets secondaires.
La présente invention concerne également un procédé pour la sélection ou l'identification in vitro ou ex vivo de composés capables d'inhiber l'accumulation des transcrits sprD et/ou la transcription du gène sprD, comprenant les étapes suivantes :
i) l'introduction ou la mise en contact d'un composé test dans ou avec une souche bactérienne exprimant le gène sprD ou avec des transcrits sprD ;
ii) La détermination de la capacité du composé test à complexer, en particulier à s'hybrider, avec les transcrits sprD ; et/ou
iii) la détermination de la capacité du composé test à inhiber la transcription du gène sprD ; et éventuellement
iv) la sélection des composés capables de complexer avec les transcrits sprD et/ou d'inhiber la transcription du gène sprD ; et éventuellement
v) la mise en contact ou l'introduction du composé test sélectionné à l'étape d) avec ou dans une souche bactérienne virulente appartenant au genre Staphylococcus ;
vi) la détermination de la capacité du composé test à diminuer ou à supprimer la virulence de ladite souche ; et éventuellement
vii) la sélection des composés tests capables de diminuer ou supprimer la virulence de ladite souche.
Ladite souche bactérienne exprimant le gène sprD dans les étapes a) et i) des procédés selon l'invention peut être notamment une souche appartenant au genre Staphylococcus dont le génome comprend le gène sprD notamment de séquence SEQ ID N° 1 , de préférence une souche appartenant à l'espèce Staphylococcus aureus. Ladite souche bactérienne exprimant le gène sprD dans les étapes a) et i) des procédés selon l'invention peut être également une souche bactérienne n'appartenant pas au genre Staphylococcus et par exemple qui a été transformée avec le gène sprD, notamment de séquence SEQ ID N°l . La présente invention concerne également un composé susceptible d'être obtenu par au moins l'un des procédés de sélection ou d'identification selon l'invention, en particulier en tant que médicament et tout particulièrement pour la prévention et/ou le traitement d'une infection staphylo coccique.
D'autres avantages et caractéristiques de l'invention apparaîtront au regard des exemples qui suivent.
Ces exemples sont donnés à titre illustratif et non limitatif.
La Figure 1A représente l'accumulation du transcrit sprD à différentes phases de croissance pour une culture de S. aureus N315 (agr-) et pour une culture de S. aureus RNl (agr+). L'accumulation de l'ARNr 5S est utilisée comme témoin de charge. Pour la culture de S. aureus N315 (agr-) les ARN totaux ont été extraits lorsque la DO à 600 nm est égale 0,25 ; 0,7 ; 1,8 ; 4,5 ; 8,9 ; 12 ; 20 et 21. Pour la culture de S. aureus RNl (agr+) les ARN totaux ont été extraits lorsque la DO à 600 nm est égale à 0,2 ; 0,7 ; 1,1 ; 4,0 ; 8,8 ; 14,3 et 17,2. Cinq μg d'ARN totaux est chargé par puit. La sonde utilisée est une sonde spécifique du transcrit sprD.
La Figure 1B illustre l'accumulation du transcrit sprD pour une culture de S. aureus N315
(agr-), pour une culture de S. aureus RNl (agr+), pour une culture de S. aureus N315 (agr-) délétée du gène sprD, pour une culture de S. aureus RNl (agr+) délétée du gène sprD et pour une culture de S. aureus N315 (agr-) délétée du gène sprD complémentée. L'accumulation de l'ARNr 5S est utilisée comme témoin de charge. Cinq μg d'ARN totaux est chargé par puits. La sonde utilisée est une sonde spécifique du transcrit sprD.
La Figure 2(A-B) illustre :
Figure 2A : la virulence d'une culture de S. aureus N315 (agr-), la virulence d'une culture de S. aureus N315 (agr-) délétée du gène sprD et la virulence d'une culture de S. aureus N315 (agr-) délétée du gène sprD complémentée. Ce graphique donne le pourcentage d'animaux vivants en fonction du temps écoulé à partir de l'infection des animaux par une culture de S. aureus N315 (agr-), culture de S. aureus N315 (agr-) délétée du gène sprD ou une culture de S. aureus N315 (agr-) délétée du gène sprD complémentée.
Figure 2B : la virulence d'une culture de S. aureus R l (agr+) et la virulence d'une culture de S. aureus R Nl (agr+) délétée du gène sprD. Ce graphique donne le pourcentage d'animaux vivants en fonction du temps écoulé à partir de l'infection des animaux par une culture de S. aureus RNl (agr+) ou culture de S. aureus RNl (agr+) délétée du gène sprD.
La figure 3 représente les résultats du comptage bactérien réalisé sur les reins prélevés chez des animaux infectés par une culture de S. aureus N315 (agr-), une culture de S. aureus N315 (agr-) délétée du gène sprD ou une culture de S. aureus N315 (agr-) délétée du gène sprD complémentée. Le prélèvement des reins et le comptage bactérien sont réalisés 6 jours après l'infection des animaux.
EXEMPLES
I. Matériels et méthodes
1.1 Souches et plasmides
Les souches de S. aureus et les plasmides utilisés dans cette étude sont énumérés dans le tableau 1. Les souches de S. aureus ont été cultivées de manière habituelle à 37 °C dans un bouillon d'infusion de cerveau et de cœur (BHI, Oxoid). Si nécessaire, les inventeurs ont utilisé du chloramphénicol et de l'érythromycine à raison de 10
Figure imgf000020_0001
La souche DH5a d'E. Coli a été utilisée en tant qu'hôte bactérien pour la construction du plasmide. Les souches d'E. Coli ont été cultivées dans un milieu de Luria-Bertani (LB).
Dans le plasmide pCN38-sprD, le gène codant pour sprD est exprimé sous le contrôle de son propre promoteur. Pour construire ce plasmide, sprD avec 40 nucléotides en amont et 35 nucléotides en aval a été amplifié par une PCR à partir de l'ARN génomique de la souche N315 de S. aureus en tant que fragment de 217 paires de bases avec des sites de restriction flanquants Pst I et EcoR I. Le produit de la PCR a été cloné entre ces deux sites dans le vecteur pCN38 à faible nombre de copies (Charpentier et al, 2004).
Dans le plasmide pBT2AsprD, le gène de résistance à l'érythromycine est cloné en 3' d'une séquence nucléotidique de 1010 pb correspondant aux 1010 pb en amont du gène sprD et en 5' d'une séquence nucléotidique de 813 pb correspondant aux 813 pb en aval du gène sprD. Pour construire ce plasmide, le fragment d'ADN de 1010 pb en amont du gène SprD et le fragment d'ADN de 813 pb en aval du gène SprD ont été amplifiés par une PCR à partir de l'ADN génomique de la souche N315 de S. aureus. Les amorces sens et antisens utilisées pour la
PCR permettent d'obtenir un amplicon d'environ 1000 pb présentant respectivement à ses extrémités 5' les sites de restriction Xbal.
Les amorces utilisées sont les suivantes :
Amorce sens : TCGCTCTAGAGAATTCGTGGACAACGTCGTTATATAGCG
Amorce antisens : GCCCGGATCCAAGGTAATATTAACATAAAATGGCTAC
et un amplicon d'environ 800 pb présentant respectivement à ses extrémités 5' les sites de restrictions EcoRI.
Les amorces utilisées sont les suivantes :
Amorce sens : GCGGCGCTCGAGTCTATAAATACAATAAGGTATGTCAATTTG Amorce antisens : AGCGGAGCTCGAATTCGAAGGGTGTGTATTGTTATTTACCTA La cassette erythromycine a été amplifiée par PCR avec les amorces suivantes : Amorce
sens :GCAATAGTAGCCATTTTATGTTAATATTACCTTGGATCCGGGCCCACCTAGGAA
TTGAAT
Amorce
antisens :ATCAAATTGACATACCTTATTGTATTTATAGACTCGAGCGCCGCGGAAAAC TGGT
Pour obtenir le fragment d'environ 3kb constitué du 5 ' sprD/cassette erythromycine/3 ' sprD, les trois produits de PCR (5' sprD, cassette erythromycine et 3' sprD) obtenus précédemment ont été mélangées et amplifiés avec les amorces suivantes :
Amorce sens : TCGCTCTAGAGAATTCGTGGACAACGTCGTTATATAGCG
Amorce antisens : AGCGGAGCTCGAATTCGAAGGGTGTGTATTGTTATTTACCTA
Les amplicons obtenus sont clonés dans le vecteur pGEM-T (PROMEGA), ce vecteur est déjà préparé avec une thymidine (T) aux extrémités 3 ' terminales permettant ainsi de cloner les produits de PCR pour lesquels un A est ajouté par la DNA polymérase pendant la PCR. Après digestion avec les enzymes de restriction Xbal et EcoRI, le fragment digéré et purifié est cloné entre les sites Xbal-EcoRI du vecteur plasmidique pBT2.
Le plasmide pBT2AsprD est utilisé pour transformer une souche bactérienne de S. aureus, la souche RN44220, qui est utilisée comme une cellule hôte intermédiaire puisqu'elle va favoriser l'intégration du gène de résistance à l'érythromycine par recombinaison homologue dans le génome de bactéries S. aureus N315 ou RN1, à la place du gène sprD.
Le remplacement du gène sprD par la cassette d'expression du gène de résistance à l'érythromycine est testé par PCR pour les colonies sensibles au chloramphénicol (résultats non présentés). La délétion du gène sprD dans ces bactéries est confimée par l'analyse par Northern Blot de l'accumulation du transcrit SprD.
E. coli DH5a Sambrook et al. 1989
S.aureus
RN4220 Dérivé défectueux de restriction de 8325-4 Kreiswirth et al. 1983
N315
RN1
Plasmides Vecteur à faible nombre de copies (Ampr
pCN51pCN38 dans E coli et Em' dans S. aureus) Charpentier et al. 2004 pCN38-sprD pCN38 avec le gène SprD sous le contrôle
de son promoteur endogène Cette étude pBT2
Vecteur à faible nombre de copies (Ampr
(Briickner, 1997, FEMS dans E coli et réplication thermo-sensible
Microbiol Lett. 151 : 1-8) et Cm1 dans S. aureus)
pBT2AsprD pBT2 avec une cassette d'expression du Cette étude gène de résistance à l'érythromycine cloné
entre une région de 1000 pb en amont du
gène sprD et une région de 800 pb en aval
du gène sprD
Tableau 1
I.2 Isolation de l 'ARN et Northern blots
Les ARN totaux ont été préparés à partir des phases de croissance exponentielle (DO600 = 2,0) ou stationnaire (DO600 = 5,0) de diverses souches de S. aureus comme décrit dans Oh et So (2003). Pour l'ARN 5S et d'autres ARN, des Northern blots ont été effectués avec 5 μg d'ARN totaux dénaturés et purifiés sur gel PAGE 8 % dénaturant, comme décrit dans Pichon et Felden (2005). 1.3 Étude de la délétion du gène sprD
La virulence de la souche S. aureus N315 (agr-), de la souche 5*. aureus N315 (agr-) délétée du gène sprD et de la souche S. aureus N315 (agr-) délétée du gène sprD complémentée ont été analysées en utilisant un modèle murin de septicémie intraveineuse.
Des lots de 10 souris suisses femelles âgées de 6 à 8 semaines (Charles River Laboratories, L'Arbresle, France) ont été inoculés avec 300 d'une suspension bactérienne contenant 109 cellules de S. aureus dans 0,9 % de NaCl. Les souris ont été infectées avec la souche >S. aureus N315 (agr-), avec la souche S. aureus N315 (agr-) délétée du gène sprD ou avec la souche S. aureus N315 (agr-) délétée du gène SprD complémentée. D'autres souris ont été infectées avec la souche S. aureus RN1 (agr+) ou avec la souche S. aureus RN1 (agr+) délétée du gène sprD. La survie des souris infectées a été analysée pendant 21 jours, et la signifïcativité des différences entre les différents groupes infectés a été analysée par le test U de Mann-Withney. Une différence est considérée comme significative lorsque la valeur P est inférieure à 0,05.
Trois autres groupes de 5 souris ont été infectées avec 5 x 109 bactéries. Un groupe de souris a été infecté avec la souche S. aureus N31 (agr-), le deuxième groupe de souris a été infecté avec la souche S. aureus N315 (agr-) délétée du gène sprD et le dernier groupe de souris a été infecté avec la souche S. aureus N315 (agr-) délétée du gène sprD complémentée. Six jours après inoculation, les souris ont été sacrifiées et leurs reins prélevés. Les organes prélevés ont été ensuite homogénéisés, dilués dans une solution de 0,9 % NaCl et étalés sur un mileu agar sand 5 % pour le comptage bactérien.
II. Résultats SprD est impliqué dans la virulence des souches bactériennes S.aureus
Pour étudier la fonction de sprD chez les bactéries S. aureus N315 (agr-) et RNl (agr+), le gène sprD a été substitué, par recombinaison homologue, par une cassette d'expression comprenant un gène de résistance à l'érythromycine. Dans les souches mutantes ainsi obtenues (Δ en Fig. 1B), aucun transcrit SprD n'a pu être détecté par Norhern Blot. L'expression de SprD est rétablie dans la souche mutante S. aureus N315 (agr-) délétée par complémentation avec un plasmide capable d'exprimer SprD sous le contrôle de son promoteur endogène (Δ + SprD en Fig. 1B).
Des souris ont été infectées avec (Fig. 2A et 2B) :
- la souche S. aureus N315 (agr-) (WT),
- la souche S. aureus N315 (agr-) délétée du gène SprD (Δ),
- la souche S. aureus N315 (agr-) délétée du gène SprD complémentée (Δ + SprD),
- la souche S. aureus RNl (agr+) (WT),
- la souche S. aureus RNl (agr+) délétée du gène SprD (Δ).
La survie des souris a été étudiée. Les résultats obtenus montrent que les souris inoculées avec la souche S. aureus N315 (agr-) délétée du gène SprD sont tous vivants au 21eme jour postinfection (Δ en Fig. 2A et 2B) alors que les animaux inoculés avec la souche S. aureus N315 (agr-) (WT en Fig. 2A) sont toutes mortes 16 jours après infection. Ainsi, il semble qu'en absence de transcrit sprD, la virulence des bactéries est inhibée voire supprimée. Les résultats montrent également que pour les souris inoculées avec la souche S. aureus N31 (agr-) délétée du gène SprD complémentée, seulement la moitié des animaux survivent 21 jours après l'infection (Δ + SprD en Fig. 2A), indiquant que la virulence peut être rétablie la souche S. aureus N315 (agr-) délétée du gène SprD par transfection d'un vecteur plasmidique capable d'exprimer le gène sprD.
Les résultats obtenus montrent égelement que les souris inoculées avec la souche S. aureus RNl (agr+) délétée du gène SprD (Δ en Fig. 2B) survivent plus longtemps à une infection par rapport à des souries inoculées avec la souche S. aureus RNl (agr+) (WT en Fig. 2B). Les souris inoculées avec la souche S. aureus RNl (agr+) (WT en Fig. 2B) sont toutes mortes 5 jours après infection tandis que les souris inoculées avec la souche S. aureus RNl (agr+) délétée du gène SprD (Δ en Fig. 2B) sont toutes mortes 11 jours après infection. Ces résultats confirment donc qu'en absence de transcrit sprD, la virulence des bactéries est inhibée voire supprimée.
D'autres résultats expérimentaux viennent soutenir ces conclusions. Notamment après 6 jours d'infection, les reins des souris infectées ont été prélevés et un comptage bactérien sur ces reins a été réalisé. Le comptage des bactéries viables dans les reins des animaux infectés montre qu'il y a moins de bactéries viables dans les reins prélevés chez des souris infectées avec la souche S. aureus N315 (agr-) délétée du gène sprD (Δεη Fig. 3), par rapport aux reins prélevés chez des souris infectées avec la souche S. aureus N315 (agr-) (WT en Fig. 3) ou chez des souris infectées avec la souche S. aureus N315 (agr-) délétée du gène sprD complémentée (Δ + SprD en Fig. 3).
Les inventeurs sont ainsi les premiers à avoir mis en évidence le rôle majeur d'un petit ARN non codant, SprD, dans la virulence de S. aureus.
Des expériences sont ont été réalisés afin d'étudier l'effet de l'expression d'un ARN antisens de SprD sur sa capacité à inhiber l'accumulation in vivo de l'ARN SprD, sa capacité à diminuer la virulence de différentes souches de Staphylocoques (RNl et N315) et de déterminer la taille minimale de SprD capable d'inhiber la virulence ainsi que les séquences nécessaires et suffisantes des ARN antisens permettant d'observer une diminution au moins partielle du taux de transcrit SprD in vivo.
De manière classique, des plasmides exprimant de manière constitutive ou induite un ARN antisens entier ou tronqué de séquences nucléotidiques plus ou moins étendues sont construits par des techniques connues de l'Homme du métier. Des bactéries hôtes de Staphylococcus sont ensuite transformées avec chacune des constructions plasmidiques obtenues. Les bactéries transformées sont sélectionnées et leur capacité à inhiber l'accumulation in vivo de l'ARN SprD, sera vérifiée par Northern blots ainsi que sa capacité à diminuer virulence est testée tel que décrit précédemment.
Des lots de souris suisses femelles âgées de 6 à 8 semaines (Charles River Laboratories, L'Arbresle, France) sont inoculés avec 300 lL d'une suspension bactérienne contenant 109 cellules de S. aureus dans 0,9 % de NaCl. Les souris sont infectées avec une souche S. aureus exprimant l'ARN antisens sprD entier, ou une souche S. aureus exprimant l'ARN antisens sprD délété d'un ou plusieurs domaines nucléotidiques ou une souche S. aureus exprimant l'ARN antisens sprD entier ou délété d'un ou plusieurs domaines nucléotidiques complémentée. La survie des souris infectées est analysée pendant 21 jours, et la signifïcativité des différences entre les différents groupes infectés a été analysée par le test U de Mann-Withney. Une différence est considérée comme significative lorsque la valeur P est inférieure à 0,05.
D'autres groupes de souris sont été infectées avec 5 x 109 bactéries. Un groupe de souris a été infecté avec la souche S. aureus exprimant l'ARN antisens sprD entier, d'autres groupes de souris ont été infectés avec des souches S. aureus exprimant l'ARN antisens sprD délété d'un ou plusieurs domaines nucléotidiques et d'autres groupes de souris ont été infectés avec des souches S. aureus exprimant l'ARN antisens sprD entier ou délété d'un ou plusieurs domaines nucléotidiques complémentées. Six jours après inoculation, les souris ont été sacrifiées et leurs reins prélevés. Les organes prélevés ont été ensuite homogénéisés, dilués dans une solution de 0,9 % NaCl et étalés sur un milieu agar sand 5 % pour le comptage bactérien.
REFERENCES BIBLIOGRAPHIQUES
Beaucage SL. 2008, Solid-phase synthesis of siRNA oligonucleotides, Curr Opin Drug Discov Devel. 11:203-216
Bruckner R. 1997 Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus,
FEMS Microbiol Lett. 1997 Jun 1 ; 151 (1): 1 -8.
Charpentier, E., Anton, A.I., Barry, P., Alfonso, B., Fang, Y., and ovick, R.P. 2004. Novel cassette-based shuttle vector System for gram-positive bacteria. Appl. Environ. Microbiol. 70: 6076-6085.
Kreiswirth, B.N., Lofdahl, S., Betley, M.J., O'Reilly, M., Schlievert, P.M., Bergdoll, M.S., and
Novick, R.P. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709-712.
Lowy FD. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339: 520-532.
Milligan JF, Uhlenbeck OC. 1989, Synthesis of small RNAs using T7 RNA
polymerase.Methods Enzymol. ; 180:51-62.
Moks, T., Abrahmsen, L., Nilsson, B., Hellman, U., Sjoquist, J., and Uhlen, M. 1986.
Staphylococcal protein A consists of fîve IgG-binding domains. Eur. J. Biochem. 156: 637-
643.
Nicholas H. Mann, 2008 The potential of phages to prevent MRSA infections, Research in Microbiology
Pichon, C. and Felden, B. 2005. Small RNA gènes expressed from Staphylococcus aureus
genomic and pathogenicity islands with spécifie expression among pathogenic strains. Proc. Natl. Acad. Sci. USA. 102: 14249-14254
Sherlin LD, Bullock TL, Nissan TA, Perona JJ, Lariviere FJ, Uhlenbeck OC, 2001 Scaringe SA.Chemical and enzymatic synthesis oftRNAs for high-throughput crystallization.RNA. 7: 1671-1678
Zhang, L., Jacobsson, K., Vasi, J., Lindberg, M., and Frykberg L. 1998. A second IgG-binding protein in Staphylococcus aureus. Microbiology 145: 985-991.

Claims

REVENDICATIONS
1. Polynucléotide isolé dont la séquence consiste en une séquence choisie dans le groupe consistant en :
- la séquence SEQ ID N°4, les séquences dérivées ayant au moins 90 % d'identité avec la séquence SEQ ID N°4 et les fragments d'au moins 25 nucléotides de la séquence SEQ ID N°4 ; et
les séquences d'ADN correspondantes ;
lesdites séquences dérivées et lesdits fragments ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2.
2. Utilisation in vitro ou ex vivo d'un polynucléotide isolé en tant qu'agent inhibiteur de l'accumulation des transcrits sprD et/ou de la transcription du gène sprD, ledit polynucléotide isolé ayant une séquence comprenant ou consistant en une séquence choisie dans le groupe consistant en :
a) la séquence SEQ ID N°4, les séquences dérivées ayant au moins 90 % d'identité avec la séquence SEQ ID N°4 et les fragments d'au moins 10 nucléotides de celles-ci ; et
b) les séquences d'ADN correspondantes ;
lesdites séquences dérivées et lesdits fragments ayant la capacité de s'hybrider spécifiquement avec la séquence SEQ ID N°2.
3. Polynucléotide isolé caractérisé en ce qu'il comprend à ses extrémités 5' et 3' respectivement les séquences nucléotidiques SEQ ID N°6 et SEQ ID N°7, ledit polynucléotide ayant une longueur inférieure à 10 000 nucléotides.
4. Cassette d'expression comprenant une séquence d'ADN telle que définie selon la revendication 1.
5. Vecteur recombinant comprenant un polynucléotide isolé tel que défini selon l'une des revendications 1 ou 3 ou une cassette d'expression selon la revendication 4.
6. Cellule hôte transformée par une cassette d'expression selon la revendication 4 ou un vecteur selon la revendication 5.
7. Composition pharmaceutique comprenant un vecteur pharmaceutiquement acceptable et au moins un composant choisi dans le groupe consistant en un polynucléotide isolé selon l'une des revendications 1 ou 3, une cassette d'expression selon la revendication 4, un vecteur selon la revendication 5 et une cellule hôte selon la revendication 6.
8. Composition pharmaceutique pour son utilisation pour la prévention et/ou le traitement d'une infection staphylococcique, ladite composition comprenant un vecteur pharmaceutiquement acceptable et au moins un composant choisi dans le groupe consistant en :
- un polynucléotide isolé tel que défini selon l'une des revendications 2 ou 3 ;
- une cassette d'expression comprenant une séquence d'ADN telle que définie selon la revendication 2 ;
- un vecteur recombinant comprenant ledit polynucléotide isolé ou ladite cassette d'expression ; et
- une cellule hôte transformée par ladite cassette d'expression ou ledit vecteur.
9. Procédé d'obtention d'une souche bactérienne non virulente ou dont la virulence est diminuée, ladite souche appartenant au genre Staphylococcus, ledit procédé comprenant une étape de délétion totale ou partielle du gène sprD dans le génome d'une souche bactérienne du genre Staphylococcus.
10. Procédé pour la sélection ou l'identification in vitro ou ex vivo de composés pour la prévention et/ou le traitement d'une infection staphylococcique, comprenant les étapes suivantes ;
a) l'introduction ou la mise en contact d'un composé test dans ou avec une souche bactérienne exprimant le gène sprD ou avec des transcrits sprD ;
b) la détermination de la capacité du composé test à complexer, en particulier à s'hybrider, avec les transcrits sprD ; et/ou c) la détermination de la capacité du composé test à inhiber la transcription du gène sprD.
11. Procédé pour la sélection ou l'identification in vitro ou ex vivo de composés capables d'inhiber l'accumulation des transcrits sprD et/ou la transcription du gène sprD, comprenant les étapes suivantes ;
i) l'introduction ou la mise en contact d'un composé test dans ou avec une souche bactérienne exprimant le gène sprD ou avec des transcrits sprD ;
ii) la détermination de la capacité du composé test à complexer, en particulier à s'hybrider, avec les transcrits sprD ; et/ou
iii) la détermination de la capacité du composé test à inhiber la transcription du gène sprD.
PCT/EP2011/056052 2010-04-16 2011-04-15 Inhibiteurs de l'accumulation de transcrits sprd chez s. aureus Ceased WO2011128445A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR1052933 2010-04-16
FR1052933A FR2958942B1 (fr) 2010-04-16 2010-04-16 Inhibiteurs de l'accumulation de transcrits sprd chez s. aureus

Publications (1)

Publication Number Publication Date
WO2011128445A1 true WO2011128445A1 (fr) 2011-10-20

Family

ID=43414843

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/056052 Ceased WO2011128445A1 (fr) 2010-04-16 2011-04-15 Inhibiteurs de l'accumulation de transcrits sprd chez s. aureus

Country Status (2)

Country Link
FR (1) FR2958942B1 (fr)
WO (1) WO2011128445A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014857A2 (fr) * 2003-06-05 2005-02-17 Wyeth Groupe d'acides nucleiques servant a detecter des souches multiples d'especes non virales
WO2010020694A1 (fr) * 2008-08-22 2010-02-25 Universite De Rennes I Polynucleotides regulant negativement l'expression de la proteine sbi

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005014857A2 (fr) * 2003-06-05 2005-02-17 Wyeth Groupe d'acides nucleiques servant a detecter des souches multiples d'especes non virales
WO2010020694A1 (fr) * 2008-08-22 2010-02-25 Universite De Rennes I Polynucleotides regulant negativement l'expression de la proteine sbi

Non-Patent Citations (22)

* Cited by examiner, † Cited by third party
Title
"Supporting Information", 23 September 2005 (2005-09-23), XP002616229, Retrieved from the Internet <URL:http://www.pnas.org/content/102/40/14249/suppl/DC1> [retrieved on 20110111] *
BEAUCAGE SL: "Solid-phase synthesis of siRNA oligonucleotides", CURR OPIN DRUG DISCOV DEVEL., vol. 11, 2008, pages 203 - 216
BRÜCKNER R.: "Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus", FEMS MICROBIOL LETT., vol. 151, no. 1, 1 June 1997 (1997-06-01), pages 1 - 8, XP002659297
BRÜCKNER, FEMS MICROBIOL LETT., vol. 151, 1997, pages 1 - 8
CHABELSKAYA SVETLANA ET AL.: "A Staphylococcus aureus small RNA is required for bacterial virulence and regulates the expression of an immune-evasion molecule", PLOS PATHOGENS, vol. 6, no. 6, E1000927, June 2010 (2010-06-01), pages 1 - 11, XP002616232 *
CHABELSKAYA SVETLANA ET AL.: "Supporting Information:A Staphylococcus aureus Small RNA Is Required for Bacterial Virulence and Regulates the Expression of an Immune-Evasion Molecule", June 2010 (2010-06-01), XP002620114, Retrieved from the Internet <URL:http://www.plospathogens.org/article/info%3Adoi%2F10.1371%2Fjournal.ppat.1000927> *
CHARPENTIER, E., ANTON, A.I., BARRY, P., ALFONSO, B., FANG, Y., NOVICK, R.P.: "Novel cassette-based shuttle vector system for gram-positive bacteria", APPL. ENVIRON. MICROBIOL., vol. 70, 2004, pages 6076 - 6085
DATABASE EMBL [online] 21 December 2007 (2007-12-21), AOKI K., OGUCHI A., HOSOYAMA A., NAGAI Y., KURODA M., HIRAMATSU K., KIKUCHI H.: "Staphylococcus aureus subsp. aureus N315 DNA, complete genome", XP002616231, Database accession no. BA000018 *
DATABASE EMBL [online] 26 May 2009 (2009-05-26), MOUNTS W.M. ET AL.: "Nucleic acid arrays for detecting multiple strains of non-viral species", XP002643451, Database accession no. HA180999 *
DATABASE EMBL [online] 26 May 2009 (2009-05-26), MOUNTS W.M. ET AL.: "Nucleic acid arrays for detecting multiple strains of non-viral species", XP002643452, Database accession no. HA164052 *
KREISWIRTH, B.N., LOFDAHL, S., BETLEY, M.J., O'REILLY, M., SCHLIEVERT, P.M., BERGDOLL, M.S, NOVICK, R.P.: "The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage", NATURE, vol. 305, 1983, pages 709 - 712
LOWY FD: "Staphylococcus aureus infections", N ENGL. J. MED., vol. 339, 1998, pages 520 - 532
MILLIGAN JF, UHLENBECK OC: "Synthesis of small RNAs using T7 RNA polymerase", METHODS ENZYMOL., vol. 180, 1989, pages 51 - 62, XP008025566, DOI: doi:10.1016/0076-6879(89)80091-6
MOKS ET AL., STAPHYLOCOCCAL PROTEIN A, 1986
MOKS, T., ABRAHMSEN, L, NILSSON, B., HELLMAN, U., SJOQUIST, J., UHLEN, M.: "Staphylococcal protein A consists offive IgG-binding domains", EUR. J. BIOCHEM., vol. 156, 1986, pages 637 - 643, XP008145392, DOI: doi:10.1111/j.1432-1033.1986.tb09625.x
NICHOLAS H. MANN: "The potential of phages to prevent MRSA infections", RESEARCH IN MICROBIOLOGY, 2008
PICHON CHRISTOPHE ET AL.: "Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains (vol 102, pg 14249, 2005)", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 102, no. 46, November 2005 (2005-11-01), pages 16905, XP002616230, ISSN: 0027-8424 *
PICHON CHRISTOPHE ET AL.: "Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 102, no. 40, October 2005 (2005-10-01), pages 14249 - 14254, XP002616228, ISSN: 0027-8424 *
PICHON, C., FELDEN, B.: "Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains", PROC. NATL. ACAD. SCI. USA., vol. 102, 2005, pages 14249 - 14254, XP002616228, DOI: doi:10.1073/pnas.0503838102
SHERLIN LD, BULLOCK TL, NISSAN TA, PERONA JJ, LARIVIERE FJ, UHLENBECK OC: "Scaringe SA.Chemical and enzymatic synthesis of tRNAs for high-throughput crystallization", RNA, vol. 7, 2001, pages 1671 - 1678
ZHANG L, JACOBSSON K, VASI J, LINDBERG M, FRYKBERG L: "A second IgG-binding protein in Staphylococcus aureus", MICROBIOLOGY, vol. 145, 1998, pages 985 - 991, XP001084184
ZHANG, L., JACOBSSON, K., VASI, J., LINDBERG, M, FRYKBERG L.: "A second IgG-binding protein in Staphylococcus aureus", MICROBIOLOGY, vol. 145, 1998, pages 985 - 991, XP001084184

Also Published As

Publication number Publication date
FR2958942A1 (fr) 2011-10-21
FR2958942B1 (fr) 2015-04-17

Similar Documents

Publication Publication Date Title
US11491209B2 (en) Sequence specific antimicrobials
US11135273B2 (en) Sequence specific antimicrobials
US10640788B2 (en) CRISPR-related methods and compositions with governing gRNAs
US20210040506A1 (en) Crispr-related methods and compositions
Wu et al. Staphylococcus epidermidis SrrAB regulates bacterial growth and biofilm formation differently under oxic and microaerobic conditions
JP2018023367A (ja) 転写因子デコイ
JP2022040131A (ja) アンチセンス抗細菌性化合物および方法
CN107805643B (zh) 靶向抑制沙门氏菌耐药外排泵基因acrA的siRNA-DNA纳米系统及其制备方法
US20180002692A1 (en) Sequence Specific and Organism Specific Antimicrobials and Related Materials and Methods
WO2011128445A1 (fr) Inhibiteurs de l&#39;accumulation de transcrits sprd chez s. aureus
US20230405130A1 (en) Compositions and methods for modifying bacterial gene expression
FR2935146A1 (fr) Polynucleotides regulant negativement l&#39;expression de la proteine sbi
WO2016048813A1 (fr) Arn intergeniques et procedes pour la modulation d&#39;expression genique et de photogenese dans la levure candida
Thakur Functional characterization of novel and putative Two Component Systems in Acinetobacter baumannii
TWI354022B (en) Methods and compositions relating to expression fa
CA3173776A1 (fr) Petits arn derives d&#39;arn de transfert chimiquement modifies (arnts) pour cibler des bacteries pathogenes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11714338

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11714338

Country of ref document: EP

Kind code of ref document: A1