TWI354022B - Methods and compositions relating to expression fa - Google Patents

Description

1354022 IX. Description of the invention: [Technical field to which the invention belongs]

The present invention is directed to several performance factors. The performance or activity of the regulatory expression factors can be adjusted, such as drug efflux, microbial toxicity, and/or cell growth. Performance factors include transcription factors, translation factors, inhibitors, and efflux pumps. The polynucleotide sequence of the expression factor itself may contain one or more mid-sporulation elements (MSEs), or the expression factors may bind to the mid-range spore-forming sequences in the target polynucleotide. To regulate the performance of a self or target polynucleotide sequence. Cellular drug elimination, microbial toxicity and/or cell growth can be regulated by binding between regulatory expression factors and mid-range spore-forming sequences, regulating drug excluding pump performance, or regulating the performance or activity of the expression factor itself. . [Prior Art]

Because of the widespread use of various antimicrobial agents used to treat and prevent disease (in many cases, it will continue to be treated for a period of time after recovery), the drug resistance produced by microorganisms has rendered most drugs ineffective (see eg· , ex ei al., Antimicrob. Agents and Chemother. 39:1 -8, 1 995;

Vanden Bos sc he et a 1., Trends Microbiol. 2:393-400, 1 994). The most common mechanism for causing drug resistance is caused by mutations or mutations in target enzymes or other enzymes in the biochemical pathways associated with drugs. For example, Candida albicans 5 1354022 {Candida albicans) (White, Antimicrob. Agents Chemother 41:1488-14) has been identified as a single point mutant of the ERG11 gene in a drug-resistant culture test for clinical steroids (a ζ ο 1 es). 94, 1997). It has also been reported in the literature that in the clinical culture process, five Λ gene mutations have been found to cause drug resistance in at least two species of Candida albicans (feet e// less ei a/·, FEBS Lett. 400:80-82,1 997 ).

However, in many cases, the cause of drug resistance was found to be due to a decrease in drug accumulation within drug-resistant cells (see, eg, Fanc/ert Bossche et al., Trends Microbiol. 2:393-400, 1 9 9). 4; Odds, J. Antimicrob. Chemother. 31: 463-471, 1993). Whether the cell reduces the amount of drug it ingests and/or increases the rate of elimination of the intracellular drug, it reduces the amount of drug accumulation in the cell.

Membrane transporter proteins or efflux pumps are associated with active drug elimination. These exclusion pumps are ubiquitous in bacteria-to-mammal cells (for a review of the information provided by Higgins, Annu. Rev. Cell Biol. 8:67- 1 1 3, 1 992). Eukaryotic cells are known to have two drug-related exclusion pumps, ATP binding cassette (ABC) transporters and major fac i 1 it at o rs (Marge r And Saier, Jr. Trends Biochem. Sci. 18:13-20, 1 9 9 3; Michaelis and Berkower, Cold Spring

Harbor Symp. Quant. Biol. 60:291-309, 1995). The ATP-binding region transport protein works by hydrolyzing ATP to obtain energy, while the main promoting protein operates through proton transfer. The literature shows that the exclusion of the pump in the excess expression cell helps the cell's potency (Kara baba) Et al., Antimicrob. Agents Chemother. 6 1354022 48:3064-3079, 2 0 0 4; Ma rger and Saier, Jr., Trends

Biochem. Sci. 18:1 3 -20, 1 993; Michaelis and B e r kow e r,

Cold Spring Harb. Symp.Quant. Biol. 60:29 1 -307, 1995). For example, the CD/?/ gene of Candida albicans encodes an ATP binding region to exclude the pump (/Vasad er fl/', Curr_Genet. 27:320-329, 1 995). If the gene is mutated, it will result in a decrease in the ATP-binding region's exclusion of pumping, which in turn increases the sensitivity of Candida albicans to beta-based drugs (Sanglard et al., Antimicrob. Agents Chemother. 40:23 00-23 05, 1 996). It has also been observed that overexpression of the CZ)iH gene contributes to the resistance of Candida albicans ei 〇/., Antimicrob. Agents Chemother. 42:2932-2937, 1 998; Yang and Lo,J Microbiol Immunol Infect 34:79 -86, 2001) The performance of such excluded pumps is regulated by cis and trans-regulators. For example, the literature reports that the AP-1 site and the Drug Responsive Element (DRE) on the CD//?/gene promoter are cis-regulatory sequences. Ei

Al., Mol. Microbiol. 43: 1197-1214, 2002; Puri et al., FEMS Microbiol. Lett. 180: 213-219, 1999). There is also literature suggesting that there are trans-regulatory factors in the cell (: £>/?/gene· (Well wrz·ei fl/., FEMS Microbiol. Lett. 180:213-21 9, 1999). If you can understand the correlation between the molecular mechanism and the genes in the process of regulating and eliminating the pump, it will help the design and development of future drugs. 7 1354022

SUMMARY OF THE INVENTION This document is based on the invention found by the inventors of the present invention to control the performance of the pump. In addition, the inventors of the present invention have also found that the current factor additionally participates in other message delivery paths that do not involve the exclusion of the pump. For example, the polynucleotide of one of the present invention has one or more spore generating sequences (MS E), or The expression factor can bind to a mid-range spore-forming sequence of a target polyacid to modulate the expression of the expression factor's own nucleotide or target polynucleotide. Thus, modulation of the activity and/or expression of a factor of the invention can have various effects on the cell, including inhibition of drug rejection, toxicity, and/or growth of the cell. Factors include transcription factors, translation factors, inhibitors, and exclusion of pumping factors. The present invention is directed to a method for inhibiting cell growth and development by inhibiting the activity or expression of a factor in a cell and further comprising contacting said cell with at least one drug. Another aspect of the present invention is to provide a method of inhibiting the growth of a cell by contacting a cell with at least one factor inhibitor, and the method comprises contacting the cell with at least one drug. In a preferred embodiment of the invention, the performance factor may be an exclusion of the pump performance factor and the performance factor agent may be an exclusion factor. Accordingly, there is also provided a method of increasing the activity of a drug by contacting the cell with at least one drug expelling agent and at least one drug. Another aspect of the present invention is to provide a method for inhibiting cell growth by inhibiting the expression of a pumping polynucleotide in a cell, and the nucleoside aggregation of the surface of the sample shows that the expression of the nucleoside is less than one. The invention of the invention inhibits the inhibition of the invention at least and the 8 1354022 method further comprises contacting the cells with at least one drug. The invention also provides a method of increasing the activity of a drug by inhibiting at least one of the cells from inhibiting the expression of the pumped polynucleotide and contacting the cell with at least one drug. Another method of inhibiting cell growth comprises inhibiting binding of at least one of the expression factors to a mid-range spore-forming sequence. The method further comprises contacting the cell with at least one drug.

The invention also provides a method of inhibiting a cytotoxicity by inhibiting the activity or expression of at least one expression factor. The method can comprise contacting the cell with at least one expression factor inhibitor, and more preferably contacting the cell with at least one drug.

The invention further provides a method of treating a patient suffering from a disease, disorder or infection. The above method comprises administering to the patient at least one effective amount of a performance factor inhibitor, and further comprising administering to the patient at least one effective dose of the drug. Another aspect of the present invention is to provide a pharmaceutical composition comprising at least one expression factor inhibitor, and more preferably at least one drug. The above pharmaceutical compositions may further comprise a pharmaceutically acceptable carrier. The invention further provides a composition for inhibiting cell growth, the composition comprising at least one expression factor inhibitor, and more preferably at least one drug. The present invention also provides a composition for inhibiting the toxicity of a microbial cell, comprising at least one expression factor inhibitor, and more preferably at least one anti-microbial agent. The invention further provides a method of screening for a polynucleotide that encodes a pump performance factor. The method consists of the following steps: one is excluded 9 1354022

The reporter gene controlled by the pump promoter is introduced into a host cell; a polynucleotide excluding the pump expression factor is implanted into the host cell; and the expression of the reporter gene is measured. This method can also be used to screen for pump expression factor polynucleotides in a genomic library or cDNA library. [Embodiment] The present invention provides a method for inhibiting the growth of a cell by inhibiting the activity or expression expressed by at least one of the cells. Expression factors include transcription factors, translation factors, inhibitory factors, and exclusion of pump performance. The present invention also provides a method for inhibiting cell growth by inhibiting at least one of the cells to exclude the expression of pump nucleotides and contacting the cells with at least one drug. Methods. These performance factors may affect the toxicity of the cells, and thus inhibiting the activity or performance of the epitope may inhibit cytotoxicity. Therefore, the present invention provides a method for inhibiting the activity of at least one expression factor in a cell or expressing the cytotoxicity. The toxicity of the cells can be obtained by contacting a cell with at least one of the epitope inhibitors and more contacting the cells with a drug. On the other hand, the above expression factors may affect cell growth by a mid-range spore-forming sequence. The mid-range spore formation sequence can regulate the expression of a polynucleotide of a performance factor and/or the performance of the target polynucleotide that regulates the factor. Accordingly, the present invention provides a method of inhibiting the binding of a performance factor to a mid-range spore-forming sequence for cell growth, and the method further comprises at least one candidate and a detector-based exclusion factor. Pu Ju is the result of a kind of inhibition of the effect of the inhibition of the drug by the inhibition of the drug 10 1354022 contact. In a preferred embodiment, the above cells may be plant cells 'bacterial cells, yeast cells or mammalian cells. In another preferred embodiment, the yeast cells are fungal cells and are selected from the group consisting of Candida species, Aspergillus species, and Cryptococcus ococc μ species. Candida can be selected from Candida albicans (C. a. rwsez), heat

In a group consisting of Candida (C. iro/j/ca/b) and Candida glabrata (C. 容/aftraia). The fungus genus may be Wipe sphaeroides (Wipe / wm / gfliws) or sorghum niger). Cryptococcus can be a new type of cryptococci (CV less prococcwj·eo_orman·?). It is also possible to use fungal cells known to those skilled in the art. Mammalian cells include cells of rodents, humans, non-human primates, equine, canine, feline, bovine subfamily, porcine, sheep, and rabbits.

In another preferred embodiment, the pumped polynucleotide is excluded from CDi?/, or a homolog or variant thereof. The performance of the excluded pump can be modulated by inhibiting the transcription and/or translation of the pumped polynucleotide. In a preferred embodiment, an exclusion of pump performance factor is utilized to modulate the performance of the excluded pumped polynucleotides. In a preferred embodiment, the pump performance factor is CaNdt80p. In yet another preferred embodiment, the exclusion of the pump performance factor is the elimination of the Regulator of Efflux Pump 1, REP 1 . The present invention therefore provides a method for inhibiting cell growth by inhibiting at least one activity or performance that excludes pump expression factors. Another aspect of the invention includes contacting the cells with at least one of the 13 1354022 exclusion pump expression factors, and further comprising contacting the cells with at least one drug. The above-described preferred embodiments and the technical terms used herein are for illustrative purposes only and are not intended to limit the invention. Other preferred embodiments that can be implemented in accordance with the present disclosure are also encompassed by the scope of the present invention.

In this context, the names of the polynucleotides are indicated in italics. The terms "polynucleotide", "nucleotide" and "nucleic acid" refer to DNA or RNA. Since the mutant polynucleotide is not indicated in the form of a small letter, the wild type polynucleotide is indicated in upper case to distinguish it. In addition, "Ca" as used herein refers to a gene homologous to S. cerevisiae (S1·) in Candida albicans.

Homolog. The protein in the text does not use italics and capitalizes the first letter of the protein name. Some protein names will be followed by a lowercase letter "p" to indicate that it is a protein molecule. The rules used to distinguish between a molecule that is a wild species or a mutant, a polynucleotide or a protein are well known to those skilled in the art. The present invention relates to the regulation of a expression factor or a homolog or variant thereof. In the context, "modulate" or "modulation" refers to increasing or decreasing the activity or performance of a performance factor. The term "activity" refers to a function or group of activities exhibited by a molecule, which may involve the binding reaction of a molecule to its respective target molecule, the polynucleotide of the molecule itself or a target polynucleotide. Inhibition or activation of transcription and/or translation. The expression "e X p r e s s i ο η" refers to the transcription and/or translation of a 13 1354022 polynucleotide or a protein.

"Inhibition" or "inhibiting" - refers to any phenotypic change in a cell that is reduced or stopped. For cell growth, "inhibition reaction" refers to reducing or stopping the growth rate of a cell. For example, reducing the growth rate of a microbial population. For example, the degree of inhibition reaction can be monitored based on the difference in turbidity of the liquid culture broth with or without the addition of an inhibitor. Alternatively, the inhibition reaction may be observed depending on the size of the colony in the area where the inhibitor is coated with or without the inhibitor. In addition, there are several other methods well known to those skilled in the art to monitor inhibition reactions. The "inhibitory response" exhibited by a polynucleotide refers to the reduction or cessation of transcription or translation of a polynucleotide. In the case of inhibitors or no inhibitors, methods such as Northern blot or Western blot can be used to detect the amount of mRNA or gene product for monitoring or detection. The inhibition reaction of the expression of the polynucleotide is measured.

The term "activation" or "activating" refers to the promotion or promotion of any phenotypic change in a cell. For cell growth, "activation reaction" refers to increasing the growth rate of cells or dividing cells, and monitoring such activation reactions can be carried out by referring to the above methods. The "activation reaction" exhibited by a polynucleotide means an increase or initiation of transcription or translation of a polynucleotide. In addition, methods such as those described above can also be employed to monitor or detect the activation reaction exhibited by the polynucleotide. "Microbe" or "microbial cell" refers to very small organic organisms that are usually observed under a microscope or when the microbes are clustered. "Microorganisms" or "micro 13 1354022 biological cells" include bacteria, algae, fungi and protozoa. "Microbial J or "Microbial Cell J" also includes organic organisms in a p〇lynucleate or single-cel丨ed state. The term "drug" is used for diagnosis, treatment, A compound that slows, treats, or prevents a disease or condition of a patient, and/or a compound that affects various functions or structures of the body or cells (other than food). In a preferred embodiment of the invention, the drug used inhibits cell growth.

Performance factors include transcription factors, translation factors, and inhibitors, and are not limited to the above categories. In a particularly preferred embodiment, the performance factor is the exclusion of the fruit performance factor. The term "effluxpump" is used to refer to a protein assembly that transports the cytoplasmic or cytoplasmic peripheral molecules to the extracellular domain by consuming energy. In a preferred embodiment of the invention, the resistance of the pump to the cells is excluded. Bacterial exclusion pumps involved in drug resistance include QacA, NorA (Bmr), Smr, AcrAB and MexAB-OprM (ZoWj, Trends Biochem. Sci. 1 9:1 1 9- 1 23, 1 994; Nikaido, Science

25^: 382-388, 1 9 9 4; Poole et al., J. Bacteriol. 175:7363-7372, 1 9 9 3; Okusu et al., J. Bacteriol. 178:3 06-3 08,1 996; Nikaido, J. Bacteriol. 1 7 8:5 85 3 -5 859, 1 996). Excluded pumps for eukaryotic cells include ATP-binding region transport proteins and major-promoting proteins (MF) (PF/z/ie ei a/., Clinical Microbiol. Reviews 11:382-402, 1998), also in human cells. Such transport proteins were found (see, e_g., Z/iman ei a/., Cell Mol Life Sci. 58:931-59, 2001). To date, at least 14 1354022 30 ATP-binding domain proteins have been found in S. cerevisiae, and they have been divided into 6 major families based on the sequence similarity of these ATP-binding region transport proteins. It is currently known that PZ) and 5, members of the three families play a drug-resistant role in different systems. It has been documented that members of the family are found in Candida albicans and these genes are named CDi?. In particular, CDi?/ and CZ)i?2' have been known to the public as two exclusion pumps involved in the resistance of Candida albicans to azoles (corporate "〇1^£/6/〇/.,0 ;111^.〇61161;· 27:320-329, 1995; Fling et al., Mol. Molec. Genet.

227:3 1 8-329, 1 99 1; Sangalrd et al., Antimicrob. Agents Chemother. 39:2378-2386, 1 9 9 5; Sanglard e t al.,

Antimicrob. Agents and Chemother. 40:2300-2305, 1 9 9 6; Sanglard et al., Microbiology 143:405-4 1 6, 1 997)° The main promoting protein family members involved in the resistance of Candida albicans include MD/? 7 and Fli/J, where MDR1 is also known as CaMDi?/, and earlier Bay|J is called BENr) (Fling et al., Mol. Molec. Genet. 227:3 1 8-329, 1 99 1; C a / a 6/* eiee ί a /., M icrobio 1 ogy 14 6 : 2 7 4 3 - 2 7 5 4, 2 0 0 0).

The invention also relates to the exclusion of pumped homologs or variants. In the text, the term "homolog" refers to the structure or process that exhibits similar functions in different organic organisms. For example, a homologue may exhibit functions similar to CZ)/?i, such as exhibiting the ability to exclude pumping. The polynucleotide of the CZ) i?7 homolog may have a similar primary or secondary structure to the polynucleotide of CDA7. And the nucleotide structure of the CZ)i?/homologous polynucleotide may be similar to the gene product structure of the CD polynucleotide. The term "variant" in the context refers to a day 15 1354022

Or a synthetic amino acid sequence whose amino acid sequence is substantially identical to the original exclusion pump but may be deleted, substituted or inserted with one or more amino acids, such that the variant has a different amino acid sequence than the original exclusion pump. A polynucleotide that excludes a pump variant refers to a natural or synthetic nucleotide sequence whose sequence is approximately identical to the original excluded pump polynucleotide sequence 'but may be deleted, replaced or inserted Or a plurality of nucleotides, such that the variant has a different nucleotide sequence than the original excluded pump polynucleotide. Excluding pump variants (or one that excludes pumped polynucleotide variants) may retain pumping activity or have higher exclusion pump activity than the original exclusion pump.

The term "similarity" and/or "identity" as used herein is used to describe the degree of correlation between two polynucleotide or polypeptide sequences. Generally, "consistency" refers to the sequence of two or more nucleotides or amino acids that are identical and are identical to each other. "Similarity" generally refers to a sequence that represents two or more nucleotides or amino acids that exactly coincide, and the nucleotides or amino acids that are compared to each other have similar chemical and/or physical properties if they are not identical. The GAP computer program version 6 as described by Devereux et al. can be used to compare sequences to determine sequence identity or similarity ratios 12:387, 1984), of which the GAP computer program version 6 can be derived from the University of Wisconsin genetic algorithm The University of Wisconsin Genetics Computer Group (UGGCG). The GAP program uses the arrangement method created by Needleman and Wunsch and modified by Smith and Waterman (J_Mo/· 5ίο/. 48:443, 16 1354022 1 970; Adv. Appl. Mar/z 2:482,1 98 1). Other conventional procedures can also be used to calculate the consistency or similarity between the two sequences. For the purposes of the present invention, variants or homologs that are excluded from pumping or exclusion of pumped polynucleotides are at least 20%, 30% or 40% identical in nucleotide or amino acid to the original excluded pump. Sex. The sequence used in the present invention has at least about 50%, 60%, 7%, and the original excluded pump,

80%, 90%, 915% and 98% nucleotide or amino acid identity. The present invention encompasses a variety of natural homologs or variants, and the present invention also relates to homologs or variants of expression factors.

"DNA binding domain" refers to a region of a protein, a peptide, a peptide or a polynucleotide that binds to a particular DNA sequence. For example, the DNA binding region of Ndt80p has been identified (Μο«eί 〇/·, PN AS 99 :1 404 1 -6, 2002). The DNA binding region of Ndt8 Op contains a length of about 32-kDa and has a beta-sandwich. The area of the beta-sandwich core. This beta-sandwich core has 7 beta-sheets and three short alpha-helice structures. As described below, it has been found that the DNA binding region of Ndt80p is similar to the DNA binding region of several proteins.

CaNdt80p is a Candida albicans homolog of the S. cerevisiae Ndt80p protein. Ndt80p is a meiosis specific transcription factor of S. cerevisiae (Chu e t al., Science 282: 699-705, 1 9 9 8; Chu and Her show i tz, Mol.

Cell 1: 685-696, 1998). Figure 1 compares the amino acid sequences of CaNdt80p and Ndt80p. The length of CaNdt80p is 592 amino acids, and the length of Ndt80p 17 1354022 is 672 amino acids. The first to 330th amino acids of the Ndt80p protein have been shown to be important for DNA binding, and two different regions that are important for DN A binding have been found in this region.

Ndt8Op protein number! To the 58th amino acid line involved in specific sequence discrimination

Sequence-specific recognition, while the 59th to 330th amino acid sequences contain a DNA binding region. The 223th to 572th amino acids of the CaNdt80p protein and the 3rd to 330th amino acid sequences of the Ndt80p protein have a 37.6% identity and a 57.9% similarity (dark gray region in Figure 1A), thus It can be assumed that this region of the CaNdt80p protein may also be involved in the binding of CaNdt80p protein to DNA. There is no similarity between the N-terminal sequence of the CaNdt80p protein and the C-terminal sequence of the Ndt8 Op protein (light black line in Figure 1A).

If the Ndt80p protein is analyzed, it may be helpful to explain the function of the CaNdt8Op protein based on the similarity between CaNdt80p and Ndt80p. The Ndt8Op protein activates the target gene by binding its DNA binding region to the mid-range spore-forming sequence (gNCRCAAAA/T) in a target polynucleotide (Chu and H er show itz, Mol. Cell 1:685- 696, 1 998;

Lamoureux et al., EMBO J. 21:572 1 -5732, 2002). The Ndt80p polynucleotide itself also contains a mid-range spore-forming sequence, and there have been reports that Ndt 8 Op may induce transcriptional regulation by its own mid-range spore-forming sequence, and induce its own molecular synthesis reaction (law owrewx ei β/ .EMBO J. 2 1:572 1 -5732, 2002) » When beer yeast is subjected to vegetative growth, the expression of Ndt80p is inhibited in cells (Xw et al., Mol. Cell Biol. 15:6572) -658 1, 1 995; Pak and is 1354022

Sega//, Mol. Cell Biol. 22:64 1 7-6429, 2002). Referring to Figure 6, the overexpression of #£>7^0 in S. cerevisiae or mutants does not alter its drug sensitivity. Interestingly, overexpression of polynucleotides reduces drug sensitivity. If the expression of the pumped polynucleotide is regulated by mutating the polynucleotide, the drug sensitivity of the cell is increased. And the promoter has three possible mid-range spore-forming sequences

(CRCAAA) 'The MSE sequence 歹 ij, J is located at the 2nd 70bp, 43rd bp and 83rd bp positions upstream from the translation start code ATG. CaWDrSO also contains a complete mid-range spore-producing sequence (gNCRCAAAA) at the 572 bp upstream from its translation initiation code (ATG), and has a 70 bp 'I22 bp and 461 bp positions upstream of the ATG. Three possible mid-range spore-forming sequences (CRCAAA). Figure 2 depicts the nucleotide sequence of CaWDrSO.

In addition to the above Ndt80p and CaNdt80p proteins, there are also from the red bread scale crassa) 'Dz'ceosie / z'wm discoideum, Caenorhabditis elegans, fruit (Droxo / 7 / ιί / α / we /awogiisier) and several human protein molecules of higher eukaryotic cells contain sequences similar to the DNA binding region of the Ndt80p protein (Mowiano et al., Proc. Natl. Acad. Sci. USA 99: 14041-14046, 2002) ). Furthermore, it has been found that a large number of human transcription factors Cllorf9 (A^'emer ei a/., Oncogene 20:6679-6688, 2001) containing a similar sequence of the DNA binding region of Ndt8Op are expressed in aggressive or metastatic tumors. If inhibited, it can be used with medium-range spores 19 1354022

The activity of a sequence-bound transcription factor may reduce growth. In addition, a variety of metastatic tumors are far more resistant than their therapeutic drugs, and a variety of drug-resistant, non-drug resistant parental cells are more aggressive. Cancer Drug Targets. 2:257-277, 2002). Therefore, it is possible to regulate the activity of transcription factors of human cells that exclude pumping performance of chemotherapeutic drugs. Therefore, the excluded pump expression factor of the present invention may be combined with a mid-range spore-forming sequence. The term "excluding pump expression factor" as used herein refers to a transcription factor, inhibitory factor or transcript that modulates the expression of a nucleotide. In a preferred embodiment, the exclusion of the pump expression factor is another preferred. In the embodiment, the pump performance factor is excluded as "Regularoe of Efflux Pump 1". A protein molecule that infers long acid is encoded in the sequence of the polynucleotide. Excessive performance and the performance of the genes of the five/5/polynuclear and AfD/Π promoters. The nucleotide sequence of the first:. The term "patient" as used herein refers to a human or non-human animal of any disease, condition or infection, a subject who is treated to benefit, including humans or treated non-human animals, including all domestic or In the preferred embodiment of the wild, the subject to be treated is preferably a subject who is suffering from cancer. Or inhibiting the cells of the primary cells of the cancer cells, compared with et °l, Curr. If this can be inhibited, it may increase the target factor of the target polynucleotide (efflux control-excluding the pump translation factor "this issue CaNdt80p. In the newly discovered degree of Candida albicans, the degree of 693 amino acids will increase with 3 figures showing i? 5? 7 animals with treatment or any non-human animals. The present treatment is treated with drugs or 20 1354022

The invention includes a method of inhibiting cell growth by inhibiting the activity or expression of at least one of the expression factors in a cell, and the method further comprises contacting the cell with at least one drug. More particularly, the present invention relates to a method for increasing the activity of a drug in a cell by inhibiting the activity or expression of at least one factor in a cell, and the method further comprises contacting the cell with the drug. Here, the term "enhancement or enhancement" refers to the effect of increasing the effect of the above-mentioned drugs on the cells. The effect of the drug can be detected as described above, depending on whether the cell growth rate is reduced or stopped, or depending on whether the recording or translation of a polynucleotide in the cell is increased or stopped. In a preferred embodiment of the present invention, the present invention comprises a method for inhibiting the growth of the true cell by inhibiting the activity or expression amount of at least one expression factor in the fungal cell, and the method further comprises contacting the fungal cell with one less An antifungal agent. In another preferred embodiment, the invention comprises a method of inhibiting the activity of an antifungal agent in the fungal cell by inhibiting the activity or amount of at least one of the expressions in a fungal cell, and the method further comprises: The cells are contacted with the antifungal agent. Here, the term "fungus or fungi" refers to a lower eukaryotic organic microorganism. Candida albicans produces yeast (yeast), pseudohyphae and hyphae. Part of the common flora, Candida albicans grows like the growth of budding yeast. The term "yeast" as used in this publication refers to a low-grade true-acting pair of long-acting bacteria to the case of a living mother's silk nucleus 21 1354022 organic microorganism, which has a single cell. The growth phase is classified into fungi based on cell structure, reproductive machinery, nucleic acid sequence similarity, or other properties used to classify organic microorganisms. The pseudohyphae and fungal silk patterns of yeast make it multi-cell filamentous colonies, and the ability to interact with yeast type and hyphae is closely related to the toxicity of Candida albicans. The true country includes Zygomyce/ei and Ascomycetes.

Basidiomycetes (Dewierowyceiei) and Oomycetes. Candida is one of the members of the Ascomycetes. It is known that Candida krusei (C., Candida tropicalis) has been isolated. , Candida glabrata (Caw heart "g/a6raia" 'spray acid Candida (CiZAii/fi/a with Portugal

Candida albicans/wdMniare) are the sources of Candida infections. Among them, Candida albicans is the most abundant and significant strain. It has been reported that in recent years there has been an increase in infections caused by non-white Candida species such as Candida glabrata and Candida krusei. Clin. Infect. Dis. 2 4:1 1 22- 1 1 28, 1997; Aisner et al., Am. J. Med. 61:23-28, 1976; Arif et al., J. Clin. Microbiol. 34:2205-2209,1 996). Other fungal species include the genus Fungi (ζί·ϊ; 7β"^/7/ωί species), Crypiococcw® spp, and other species well known to those skilled in the art. The term "antifungal agent" as used herein refers to a drug which inhibits the growth of fungi. The activity of the antifungal agent means that the drug substantially stops the growth of the fungal cell, but does not kill the fungal cell, or the drug can stop growing first and then kill the fungal cell. In order to counter the infection caused by the white fungus 22 1354022 and other fungi, the scientists are committed to the development of anti-bacterial agents and to find out the necessary components in the cell membrane and cell wall of fungal cells. Unlike bacteria, but identical to other eukaryotes, fungal cell membranes contain sterols, which are essential components for the survival of almost all fungal cells. Sterols are important for maintaining the fluidity and integrity of cell membranes and for maintaining the proper function of a variety of membrane-bound enzymes, while cell membrane integrity and fluidity, as well as membrane-bound enzymes, maintain proper function for cell growth and division. Extremely important awe/

FEMS Microbiol. Lett. 149:14 Bu 149, 1997). The main sterols in the fungal cell membrane are ergosterol and zymosterol, while in mammalian cell membranes it is cholesterol (cholesterol). Scientists have studied the differences in various sterol compositions in order to develop antifungal agents and have focused primarily on the development of antifungal agents that form complexes with fungal sterols but do not react with human sterols. These antifungal agents act to prevent puncture on the fungal cell membrane while maintaining the integrity of the human cell membrane.

The antifungal agents currently used are amphotericin B and nystatin, which is a polyene macrolide antibiotic. These drugs exhibit a higher affinity for ergosterol on the fungal cell membrane than cholesterol on mammalian cell membranes. These drugs are inserted into the cell membrane and form channels on the cell membrane, allowing intracellular components, especially potassium ions, to flow out of the cell through these channels' and thus destroy the proton gradient inside and outside the cell membrane (w Bossche et al. , Trends Microbiol. 23 1354022

2:393-400, 1994) °

Other antifungal agents such as allylamines, thiocarbamates, azoles and morpholines act on the biosynthesis of ergosterol. Hi, Br. J. Dermatol. 126 Suppl 39: 2-7, 1992). For example, oxaconazoles such as fluconazole, itraconazole, and ketoconazole bind to lanosterol demethylase and inhibit lanolin alcohol to f-based enzymes. active. Lanolinol demethylase is a cytochrome P-450 enzyme that typically converts 14-a-methyl-sterols to ergosterol. (5aag anrf Antimicrob. Agents Chemother. 32: 1-8, 1988; Hitchcock, Biochem. Soc. Trans. 19: 782-787, 1991). Other antifungal agents used to combat fungal infections include 5-fluorocytosine

(5-fluey to sine, 5-FC). The action of 5-fluorocytosine is to inhibit DN A

With RNA synthesis. The cytosine deaminase in the fungal cell converts the 5-fluorocell bite into a 5-fluorouracil (5-FU). Cytosine deaminase activity in mammalian cells is low' so 5-fluorocytosine exhibits lower toxicity in human mites. % Fluoride urinary tract will be converted to 5-fluorouridine (5_nu〇r〇uridilic acid), which will become 5-fluoro-triphosphate uracil when 5-fluorouridine is phosphorylated (5- fluoro-UTP) and synthesized in Rna. When RNA contains 5-fluoro-diphosphate uracil, it interferes with protein synthesis and inhibits fungal cell growth. 5-fluorouracil can also be converted to 5 • fluoro-deoxytriphosphate 24 1354022 uracil (5-fluoro-dUTP), which may inhibit the thymidilate synthase in the cell, while the chest bite bites Synthesis of an essential enzyme in the synthesis of DNA per fl). Clin. Microbiol Rev. 11:382-402, 1 998) ° For the discussion of antifungal agents, please refer to the literature, J. Antimicrob Chemother. 31: 463-47 1, 1 993, and Yang and Lo, J.

M i c r o b i o 1 I m m u n o 1 · I n f e c t · 3 4 : 7 9 - 8 6, 2 0 〇 1. The term "antifungal agent" as used herein refers to any one or more of the antifungal agents discussed above, and in addition to the above-mentioned antifungal agents, there is still an antibiotic known to those skilled in the art. Fungal agent.

The invention also relates to microbial cytotoxicity. The term "virulence" as used herein refers to the ability of a pathogen to produce infectious forms of various pathogens and their ability to infect and injure host cells. The toxicity of the microbial cells can be inhibited by inhibiting the activity or expression of a performance factor in a microbial cell. Therefore, the term "inhibiting v 1 ru ence" in the context of the present invention refers to the ability to reduce or stop a microbial cell infection, to injure a host cell, and to reduce or stop the microbial cell manufacturing from being infectious. The ability of pathogens. In another preferred embodiment of the invention, the growth of the cells can be inhibited by contacting one cell with at least one inhibitor of the pump expression factor. In a preferred embodiment, the method further comprises contacting the cell with at least one drug. The cell can also be inhibited by contacting one cell with at least one expression factor inhibitor to inhibit toxicity of the cell, and the method further comprises contacting the cell with at least one drug. In yet another preferred embodiment, one of the cells can be contacted to 25 1354022 to eliminate a pump expression factor inhibitor to increase the activity of a drug, and the method further comprises contacting the cell with at least one drug. In a particularly preferred embodiment, the above cells may be a fungal cell, and the above drug may be an antifungal agent.

"Expression factor inhibitor" means a substance that interferes with the activity or expression of a performance factor. Therefore, the expression factor inhibitor may interfere with the activity or expression of the target molecule such as the above-mentioned expression factor, and may also interfere with the binding between the above-mentioned expression factor and its target molecule, or interfere with the action of the cell to export a substance or compound to the extracellular, such as interference. The cells export an antifungal agent for extracellular action. Examples of performance factor inhibitors include, for example, antisense oligonucleotides, RNAi or interfering RNA 'chemicals, as well as various natural, synthetic or recombinant peptides, polysymmetry (polypeptide), protein, polysaccharides, small molecules or other compounds designed to reduce or inhibit the activity or expression of a performance factor. The antisense oligonucleotide can be specifically hybridized with one or more nucleic acid sequences encoding a expression factor. A performance factor inhibitor may inhibit the binding of a performance factor to its own polynucleotide, to a pumped polynucleotide, or to a mid-range spore-forming sequence on any of the target polynucleotides. Accordingly, the present invention also provides a method for inhibiting cell growth by inhibiting binding of a performance factor to a mid-range spore-forming sequence. A performance factor inhibitor in a preferred embodiment of the invention is an exclusion pump performance factor inhibitor. Here, "efflux pump expression factor inhibitor" is an activity or expression that inhibits the exclusion of a pumping expression factor by inhibiting the activity or performance of a pumping performance factor. substance. Therefore, the exclusion of the pump performance factor inhibitor may interfere with the action of substances such as antifungal agents or other compounds excreted from the cells.

"Antisense oligonucleotide" refers to a nucleic acid (DNA or RN A) that regulates a nucleic acid molecule that encodes a protein in sequence, thereby regulating the production of this protein. The purpose of regulating protein production is achieved by providing an antisense oligonucleotide that specifically reacts with one or more nucleic acids encoding a protein. Here, "target nucleic acid" and "nucleic acid encoding a protein" include DNA encoding a protein and RNA transcribed from the DNA (including pre-mRNA and mRNA). And the specific hybridization between the cDNA from the RNA and the target nucleic acid interferes with the normal operation of the target nucleic acid. The regulation of the function of the target nucleic acid by a compound which is specifically hybridized with a target nucleic acid is generally referred to as "antisense". DNA function can be interfered by interference such as DNA replication and/or transcription. And interference by interfering with all life functions of RNA, such as interfering with the action of RNA moving through the cell to the protein translation region, cleavage of RNA to form one or more mRNAs, and RNA- or RNA-promoted catalytic activity Purpose of RNA function "The technique of using antisense oligonucleotides is well known to those skilled in the art and can be referred to the following documents: oh ei a/., Mol. Cell 27 1354022

Biol. 8: 963-973, 1988; Anf os si et al., Proc. Natl. Acad. Sci. USA 86:3 3 79-3 3 83, 1 989; Wickstrom et al., Proc. Nat. Acad. Sci. USA 8 5:1 028- 1 032, 1 988, Higgins et al ; Proc. Nat. Acad. Sci. USA 90:990 1 -9905, 1993; Kitaj im a et al., Science 258:1792-1795 , 1992; Li et al., Clin. Cancer Res. 8:3 5 70-3 5 7 8, 2002; and Are« ei αΛ, Gut 51:529-535, 2002 °

The overall effect of such actions as interfering with the function of the target nucleic acid is the regulation of the expression of the polynucleotide. The term "modulation of the expression of the polynucleotide" in the context of the present invention refers to an increase or decrease in the performance of a polynucleotide. In a preferred embodiment of the invention, the antisense oligonucleotide is designed to be specific to a spRNA generating sequence on a expression factor polynucleotide or to a target polynucleotide of the expression factor. Sexual heterozygous reaction. The antisense oligonucleotide in another preferred embodiment of the present invention is a ribozyme which is a specific hybridization reaction with a target RNA and specifically cleaves the target RNA molecule. An antisense RNA molecule of a double acetaminophen backbone. The ribonuclease also catalyzes the cleavage of its own RNA or other target RNA. The antisense oligonucleotides used in the present invention can be produced by a conventional solid-phase synthesis technique which is convenient and standard. And synthetic equipment of the above technology is sold by several agents such as Applied Biosystems (Foster City, CA). There are other devices or methods that can be used to carry out the above-described synthetic reactions, and the actual synthesis of oligonucleotides is well known to those skilled in the art. It is important to understand that similar techniques can be used to prepare other species. 28 1354022

The nucleotide acid 'e.g., its phosphorothioates and alkylated derivatives (Zon, Pharm. Res. 5: 5 3 9-549, 198 8). It is also important to understand that a similar technology, commercially available modified nucleic acid and controlled-pore glass product (CGP) can be used to synthesize a fluorophore label, biotin modification or other type of modification. Nucleotides, such as cholesterol-modified oligonucleotides. And the commercially available modified puthic acid used may be a modified nucleotide such as biotin, flurescein, acridine or psoralen. An antisense oligonucleotide of the invention having a length of at least about 7 nucleotides, usually at least 12 nucleotides, more preferably at least 20 nucleotides, or even more than 50,000 nucleotides length. However, it is usually no more than about 5 nucleotides in length and preferably no more than about 35 nucleotides in length, wherein the length of the antisense oligonucleotide is inhibited by efficiency 'specificity, no cross reaction And other factors control. It has been mentioned in the literature that short nucleotides of about 7 to 8 lengths are effective and selective gene expression inhibitors (...gner

αΛ’ Nature Biotechnol. 14: 840-844, 1996). It is to be understood that various natural or non-natural oligomeric molecules are encompassed by the above teachings of the present invention. Various antisense molecules can be produced in vivo using a suitable vector having all or a portion of the target polynuclear acid sequence, wherein the antisense strand produced is an RNA molecule and the antisense RNA sequence will be associated with its target. The RN of the polynucleotide is complementary to 'and inhibits the product performance of the target polynucleotide. Antisense molecules can inhibit gene expression through a variety of different mechanisms, such as reducing mRNA production for translation, activating ribonuclease H (RNAse H), and causing steric 29 1354022 steric hindrance. Alternatively, all or a portion of the polynucleotide sequence of interest may be subjected to an in vitro transcription reaction using an appropriate vector to produce the above antisense molecule, and the antisense molecule produced is an RNA molecule. Use of SV 6 {S aim o ne 11 a typhimur ium bacterophage SP6), or E. coli T7 and Τ3 (£. eo/ί T7 and T3)

The child's vector with multiple polycloning sites upstream of the promoter to construct a plasmid for convenient synthesis of single-stranded RNA in vitro (Gree« ei a/·, Cell 32: 68 1,1 983 ;

Rosenberg, J. Mol. Bio. 1 53:503, 1981 ; D av anl ο o et al., Proc. Natl. Acad. Sci. USA 81 :203 5, 1 984 ; Tabor and Richardson, Proc. Natl. Acad Sci. USA 82:1 074, 1 985). The phage-encoded D-DNA-dependent RNA polymerases can specifically recognize their homologous promoters without using promoters recognized by other polymerases in the plastid, such as other species. Promoter of bacteriophage, bacteria or eukaryotic cells. Therefore, if a linearized pi amid is mixed and reacted with an appropriate DNA-dependent RN A polymerase and four rNTPs (ribonucleotide tripho sphates) in vitro, it will be selected from the plastid. The phage promoter begins the RNA synthesis reaction. In vitro transcription reactions can also be performed using a variety of conventional techniques, which are described in Sambrook et al., Mo/ecw/iir C/onZ Laboratory Manual, Vo Is 1-3 (2d ed. 1 989), Cold Spring Harbor Laboratory Press; Miligan et al., Nucl. Acids Res. 30 1354022 15.8783, 19 8 7 ; Milligan and Uhlenbeck, Meth. Enzymol. 180:51,1989. The above in vitro transcription reaction can also be carried out using a commercially available reagent combination such as Riboprobe® Transcription Systems, which is commercially available from pr〇rnega (Madison, WI).

Here, the term "RNAij" or "interfering RNA" refers to an RNA that is partially similar to a target nucleic acid molecule and partially double-stranded or completely double-stranded. When RNAi enters a cell, it induces a cellular action that causes the same or the degradation of endogenous double-stranded RNA (dsRNA) and single-stranded RNA (ssRNA) as the RNAi sequence. Thus, the overall effect of RNAi on the function of a target nucleic acid molecule is to reduce or inhibit the performance of the target gene product (such as a protein or ribonuclease). The general content can be found in the literature Cell 107:415-418, 2001; no«,

Nature 418: 244-251, 2002. For the purposes of the present invention, an RNAi molecule can be designed to effect an effect on any part of the sequence of a target nucleic acid molecule', e.g., to cause RNAi to attack a ribonuclease. In a preferred embodiment, the target site for RNAi targeting may comprise a performance factor polynucleotide or a mid-range spore-forming sequence on the target polynucleotide of the expression factor. Therefore, the RNAi of the present invention can reduce or inhibit the expression of the expression factor and/or the expression factor of the target. A general method of making and using RNAi has been disclosed in U.S. Patent No. 5,506,5,5,9. In a preferred embodiment, the RNAi used contains a nucleotide sequence that is 100% identical to the partial sequence of the polynucleotide of interest, eg, RNAi is completely identical to the partial sequence containing the gene encoding the pumping expression factor. the same. In another preferred embodiment, the RNAi used and the target polynuclear 31 1354022

The partial sequence of the nucleotide has a consistency of greater than 90%. In still another preferred embodiment, the consistency of the RN A i used with the partial sequence of the target polynucleotide is greater than 80%, 70%, 600%, or 50%. Sequence alignment and alignment algorithms can be used to obtain optimal sequence identity, and the Smith-Waterman algorithm can be performed using preset parameters such as BESTFIT software and the Genetic Algorithms Center of the University of Wisconsin, USA. The percentage difference between the nucleotide sequences is calculated, and the above-described operations can also be performed using other conventional methods. The above nucleotide sequences are at least about 25, 50, 100, 200, 300 or 400 base pairs in length. The above RNAi may comprise one or more polynucleotides and may be in the nucleoside or glucosamine backbone of the RNAi.

Various modifications are made on the bond). The double-stranded RNAi can be composed of single self-complementary RNA strands or two RN A complement each other. Double-stranded RNA can be formed either extracellularly or intracellularly. Moreover, the RN A does not need to be polyadenylate (that is, without adding polyA tail), and does not need to be translated into a polypeptide by a cell translation system. RNA can be synthesized in vitro or in vivo using the methods for producing antisense oligonucleotides described above. Alternatively, RNA can be synthesized manually or automatically using chemical or enzymatic methods. The expression factor inhibitor of the present invention includes various chemicals which can reduce or inhibit the activity or expression of the expression factor in the fine moon package, and natural, recombinant or synthetic peptides, polypeptides, proteins, polysaccharides, small molecules and Other compounds. The above-mentioned performance factor inhibitor may be caused by interference such as a performance factor 32 1354022

Activating or expressing a pathway to reduce or inhibit the activity of the expression factor. The expression factor inhibitor of the present invention may also reduce or inhibit the expression or activity of the polynucleotide or protein regulated by the expression factor, wherein the expression factor is regulated by direct binding to the polynucleotide or protein. Polynucleotide or protein. For example, in accordance with a preferred embodiment of the invention, the performance factor inhibitor can bind to a mid-spore-producing sequence that excludes a pump gene or excludes a pump expression factor gene. The exclusion pump performance factor inhibitor may be similar to the mid-range spore-producing sequence excluding the pump expression factor such that the exclusion pump expression factor inhibitor binds to the mid-range spore-forming sequence on the excluded pump gene, but The performance of the excluded pump gene is not activated. In another preferred embodiment, the performance factor inhibitor prevents the phosphorylation or dephosphorylation of the expression factor.

Further, peptides, polypeptides and proteins which inhibit the activity or expression of a performance factor can be prepared according to a conventional method. For example, a phage peptide display library is used to express a large number of peptides, and an in vitro method is used to select a specific binding force for the expression factor from the peptides, or to suppress the activity of the expression factors. Peptide. Phage display techniques can be used to represent peptides of various random or selective random sequences. Various phage display methods and methods for preparing different peptides are well known to those skilled in the art. For example, L a d n e r et al. (U.S. Patent No. 5,222,409) describes the preparation of various binding peptides on the surface of phage. Ladner et al. describe several phage vectors used to prepare a phage display library, as well as several methods for screening possible binding peptides and binding peptides that produce random peptides or selective mutations. Selection of in vitro phage expression libraries is typically performed using target molecules that have been purified 33 1354022. The phage which binds to the target molecule are collected, and the collected phage are individually cultured to detect the peptide expressed in each phage. Similarly, Smith and Scott were also in the literature 2 1 7:228-2 5 7,1 993,

And Science 249:3 86-390, 1 990 describe methods for the preparation of phage peptide peptide expression libraries, vectors and methods for expressing various peptides (WO 91/0 7141 and WO 91/0 7149). In various peptide preparation methods, phage display technology is highly efficient, for example, when the phage display technology is performed in conjunction with the coding sub-mutation method, a peptide of random sequence or a random variation or a specific variation peptide can be produced (please See U.S. Patent No. 5,264,563). These and other conventional methods can be used to create phage display libraries for in vitro screening and identification of peptides, polypeptides or proteins that bind to a performance factor. Or separating from the natural source, various peptides, polypeptides, proteins, polysaccharides or other similar functional molecules capable of binding to a performance factor or inhibiting the activity of a performance factor, and then performing some treatment on the molecules (eg, peptide digestion), or by conventional techniques familiar to those skilled in the art, such as solid phase synthesis, recombinant gene expression, and the like (see, for example, Sambrook et al., Mo/ecw/ar). Cloning: A Laboratory Manual, Vols 1-3 (2d ed. 1989), Cold Spring Harbor Laboratory Press, etc.). Automated peptide synthesis can be performed using equipment manufactured by manufacturers such as Applied Biosystems (Foster City, California), and an automated peptide synthesis method has been established. It is also possible to produce recombinant protein 34 in a prokaryotic cell such as a yeast, an insect cell or a mammalian cell, or a prokaryotic cell such as a bacteriophage or a bacterium, or to replace it with ij ------ - Protein, or using known cell-free z*« v/iro systems to make proteins.

The peptide, polymorph or protein which binds to or inhibits the activity of a performance factor binds to a non-homologous peptide to form a fusion protein. A non-homologous peptide can be attached to the amino terminus (N-terminus), the carboxyl terminus (C-terminus) of the above peptide, polypeptide or protein, or both ends. Several non-homologous peptides are also present in the above fusion protein as needed. Alternatively, the peptides, polypeptides or proteins may be ligated to several identical non-cologous peptides, for example, one at the N-terminus or at the C-terminus. Some non-homologous proteins increase the half-life of the fusion peptide, polypeptide or protein, thereby increasing the therapeutic effect of these fusion molecules in vivo (see U.S. Patent Nos. 5,876,969 and 5,565,335). Other performance factor inhibitors can also be screened for the ability of various chemical substances and natural, recombinant or synthetic peptides, polypeptides, proteins or polysaccharides to inhibit the activity or expression of a performance factor.

The expression factor can be screened by introducing a reporter gene controlled by a promoter of the target polynucleotide and a candidate expression factor polynucleotide in a host cell, and detecting the expression of the reporter gene. Such performance factors are expected to bind to the polynucleotide of interest and to modulate the expression of the polynucleotide of interest. In a preferred embodiment of the invention, the host cell is a fungal host cell. In another preferred embodiment, the gene of interest is , and the promoter is a promoter that excludes the pump gene. A "reporter gene" comprises any polynucleotide encoding a detectable product in sequence. The reporter gene is operably linked to a primordial 35 1354022

Mover. "Operably linked" refers to a reporter gene that is ligated to a promoter that allows RNA polymerase to bind to a regulatory region and transcribe the nucleotide sequence of the reporter gene. Commonly used reporter genes include polynucleic acid such as dot-galactosidase, green fluorescent protein (GFP), and neomycin-resistance. At the same time, methods for reporting these reported gene products are well known to those skilled in the art. The methods of the invention can be used to screen for inhibitors and activators that control gene expression. An expression vector can be constructed to contain one or more nucleic acid sequences encoding a reporter gene, a performance factor or a performance factor inhibitor. For example, a suitable expression vector constructed can include: an origin of replication (ori) for autologous replication in a host cell, one or more selective markers, and a limited number of available restriction enzyme sites. Address, the ability to have a high number of copies, and one or more powerful promoters. Expression vectors can be derived from a variety of sources, such as viruses, plastids, or higher organic microbial cells such as yeast and mammalian cells.

The vector of the present invention can be placed in a test tube for in vitro performance factor activity assay. A expression factor inhibitor such as an antisense oligonucleotide, RNAi, and a polynucleotide encoding a peptide, a polypeptide or a protein can also be introduced into a host cell through a performance vector. The method of introducing the expression vector comprises a viral infection method or a non-viral infection method, or using other methods described herein or techniques familiar to those skilled in the art, wherein non-viral infection methods such as lipofection, coordination The sub-DNA conjugate method and the naked DNA direct injection method can be referred to the U.S. Patent No. 6,140,484. 36 1354022

Various polynucleotides can also be screened to find polynucleotides having one or more mid-range spore generating sequences. The S. cerevisiae gene and the Candida albicans-like gene CaNDT80 can find a sequence of mid-range spore formation. Therefore, the mid-range cuddling sequence may play an important role in the drug-susceptibility and cytotoxicity of the machine. It is also possible to identify molecules that may be used for treatment by identifying whether other polynucleotides have a mid-range sporulation sequence. Polynucleotide screening can be performed using a bulk gene bank or cDNA library taken from the cells. Those skilled in the art are familiar with methods for preparing bulk gene libraries or cDNA libraries. When the number of polynucleotides, proteins, or small molecules to be screened is large, bioinformatics can be used to greatly increase the efficiency of screening, or DNA microarray wafers can be used to screen for polynucleotides containing mid-range spore-forming sequences. Microarray wafers can also be used to screen for proteins that bind to polynucleotides containing mid-range spore-forming sequences. For information on DNA microarray wafers, refer to the following documents, eg Γαίσ/7 e/ a/., Science 289:1757-1760, 2000 'Reichert et al., Anal. Chem. 72:6025-6029, 2000, Lockhart Et al., Nature 405: 827-836, 2000, The Chipping Forecast, Nature Genetics 2: Supp., Jan. 1999. The expression factor inhibitor herein refers to those substances which interfere with the operation of a polynucleotide molecule containing a medium-range spore-forming sequence. The invention also relates to treating a patient or benefiting a patient by administering at least one effective amount of a performance factor inhibitor. The patient may also be administered at least one effective dose of the drug, and the performance factor inhibitor may be used simultaneously or sequentially when the drug is used. Here, "effective amount" means an effective inhibition of the performance of a polynucleic acid in a patient. 37 1354022

Dosage to reduce the activity of a polynucleotide or protein, thereby alleviating symptoms, eliminating microbial infections in a patient, or inhibiting cell growth. The invention also provides compositions for practicing the methods of the invention. The energy can comprise at least one performance factor inhibitor. In another preferred embodiment the composition may comprise at least one performance factor inhibitor and at least one drug may be an antimicrobial or antifungal agent. The present invention can be used in combination with other pharmaceutically active compounds. The following methods are illustrative and are not intended to limit the invention. The oral composition may be used alone or in combination with suitable additives, powders, granules or capsules, for example, conventional additives such as lactose, corn maize starch or horse yam starch may be used together, or as a vegetarian, cellulose derivative, gum arabic Corn starch or gelatin is also a disintegrating agent such as corn starch, horse starch or carboxymethyl cellulose, or a lubricant such as magnesium talcate. Thinners, demulsifying agents, preservatives and fragrances may also be added if necessary. The compositions of the present invention may comprise a physiologically acceptable carrier, as desired, which may be a variety of solvents commonly used in animals or humans. Typically these carriers are physiologically acceptable materials, i.e., which affect the biological activity of the composition. Such carriers can be distilled water, physiological saline, Ringer's solution, dextrose solution, and Hank's salt solution. In addition, carrier molecules such as i (p r e 〇 g 1 y c a n s) may also be included in the composition. In a particular example, the carrier and the patient are long. The composition can be, for example, the substance. The pharmaceutical composition and the auxiliary agent are only made into a lozenitol, a crystalline fiber adhesive, and the carrier (sodium powder, hard fat granule, wet carrier and non-toxic component, some carrier non-phosphate slow sugar solution) Balanced prion protein molecules include 38 1354022 glycosaminoglycans, such as heparin sulfate, hyaluronic acid, keratin-sulfate, 4- Chondroitin 4-sulfate, chondroitin 6-sulfate, heparin sulfate and dermatin sulfate, perlecan and pentane In addition, the compositions of the present invention may contain other adjuvants, adjuvants or non-toxic, non-therapeutic and non-immune stabilizers and the like.

The carrier of the present invention can be dissolved, suspended or emulsified in a physiologically acceptable carrier for injection. The carrier used includes various sterilizing liquids such as water, oils and glycerol, and may or may not be added. Add an surfactant. The oil to be used may be various petroleum derivatives, animal or vegetable fats or synthetic oils such as peanut oil, soybean oil and mineral oil. Glycerols include propylene glycol and polyethylene glycol. The composition may also contain conventional additives such as solubilizers, isotonic agents, suspending agents.

(suspending agents), emulsifying agents, stabilizers, and preservatives. The compositions of the present invention may also be prepared in a sustained release dosage form, such as a dosage form prepared to be administered by injection, implantation or by osmotic pump delivery, for the purpose of sustained release of the active ingredient. The composition of the present invention can be prepared into a spray type composition for administration by inhalation into the lungs. The compositions of the present invention may be incorporated into, for example, dichlorodifluoromethane, nitrogen, and other compression propulsions 39 1354022

Used in combination with the agent. The composition of the present invention can be utilized by various convenient methods including, for example, parenteral injection, and can be administered locally or systemically. At the same time, the combination of the present invention is used, such as oral, buccal, gastrointestinal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal, intraspinal, intranasal, gastric, intramuscular, and subcutaneous. Things. After administration, the ingredients may be distributed throughout the body, or by topical or in vivo administration, with an implant that retains the active ingredient in the implanted area, allowing the active action to be applied to the localized area. A variety of single-dose forms for oral or rectal administration, such as a syrup, a lozenge, a suspension liquid, and the like, may be provided, wherein a predetermined amount of the composition is contained in various dosage units such as one teaspoon, one serving spoon, and one suppository. The compositions of the invention may be included in a single dosage form for injection or intravenous drip administration, and may be dissolved in sterile water, general physiological water, or other pharmaceutically acceptable carrier. use. A person skilled in the art can readily adjust the agent of the present invention depending on the action of the particular composition, the degree of severity, and the sensitivity of the patient to side effects. Further, some of the specific compositions of the present invention may be more effective than other compositions. The skilled artisan can determine the dosage for a particular composition according to various methods, for example, using conventional methods to measure the physiological efficacy of a given composition relative to the composition, and adjusting the composition according to the results. Or the contents described in the other contents, it is necessary to understand that the quantity, composition, reaction conditions and other numbers used in the present application are approximate values. Therefore, unless otherwise indicated, the above-mentioned number of the present application can be used to be dermally permeable, active or toxic, such as a sugar bond or the same salt. The power is made to make another difference. Some of the data are approximated according to the number of reference numerals, and can be changed according to the properties of the present invention. Finally, the equivalents are covered by the scope of the patent application in this case, so the data parameters should be interpreted according to the technology used and the output data. Although the above-described data ranges and parameters of the present invention are approximate, the data of the specific preferred embodiments of the present invention have been described as accurately as possible. However, since each test has its standard deviation, some data values must contain partial error values.

All technical or scientific terms used herein have the same meaning as commonly understood by those skilled in the art, unless otherwise defined. The exemplary methods and materials described herein are merely illustrative of the invention, and various methods and materials similar or equivalent to those described herein may be used to practice the invention.

All publications mentioned in the present specification are hereby incorporated by reference in their entirety to the extent of the disclosure of the disclosure of In addition, the publications referred to herein merely disclose prior art prior to the filing date of the present invention, and nothing in the present invention claims that the present invention is later than the prior art. Furthermore, the date of publication of the literature provided in the text may not be the actual disclosure period, so it needs to be confirmed separately. It is to be understood that the singular terms "a", "and" and "the" are used in the singular and state. Thus, for example, the term "an antimicrobial agent" in the text contains several antimicrobial agents, and the term "a fungus cell (afunga丨ce 1丨)" contains one or more fungal cells and Other equals known to the skilled artisan. 41 1354022 The methods, techniques, and/or procedures (generally referred to as methods) used to practice the present invention are not limited to the methods of the specific preferred embodiments described in the specification, and any conventional method that achieves the same objectives is the present invention. Covered. In addition, some of the methods are described in the specific content of the specification, and the methods are not intended to limit the invention. The following preferred embodiments are intended to illustrate the invention and not to limit the invention.

Preferred Embodiment 1 1 Construct a Leu2+ 矣 鞞 鞞 鞞 construct a expression vector containing the /czcZ gene and a promoter, and the /flcZ gene will express cold-galactosidase (β-ga丨actosidase or β-ga dip) Less er αΛ, Gene 45:299-310, 1986) is used as a reporter gene, and the /acZ gene is under the control of a promoter, so that the expression vector can be used to monitor/promoter performance.

A population of about 1.2 kb in the somatic gene of Candida albicans SC5314 strain and the number of DNA fragments containing the translation start code ATG and the promoter were amplified by polymerase chain reaction. The above PCR fragment was prepared using the primers HJL21 [5, d (TTTCCCGGGGGATCCTCGTTACTCAA) l and the bow | sub-HJL22 (5, dfCCCAAGCTTGCATAATTTTTTTCTTTTTGACCT). And the above two primers respectively introduce a 5, a terminal, and a 3, a contiguous restriction enzyme site (the sequence indicating the bottom line) on the PCR fragment, and insert the obtained PCR fragment into the ΥΙΡ3 63 plastid 42 1354022

Zwal and Ζ/?_«ίΠΙΙ between the two restriction enzyme sites, so that the PCR fragment containing the promoter can be ligated to the /flcZ gene in accordance with the coding rules, and the LOB42 plastid is produced.

Use the primer HJL44 (5, d(TTTTCCCGGOCAGCAGTTTA GAAGCAAT)) and the primer HJL45 (5, drCCCCCCCGGGTGATTTG TCTTAACATT) to amplify the DNA from 37 bp to 1 648 bp of the gene.

Fragment. The DNA fragment of the 乂Z)£3 gene was inserted into the Xwal site in the LOB42 plastid in a manner opposite to the fusion gene to construct the LOB43 plastid. The LOB43 plastid was linearized by the restriction enzyme to cleave the LOB43 plastid starter code ATG downstream of the 3rd 3 7bp, and then the linear LOB43 plastid was transformed into the Saccharomyces cerevisiae 10560-2B strain. (Refer to Figure 4). Through the homologous recombination, the fusion gene on the LOB43 plastid is inserted into the locus on the chromosome of the cell, and the Leu2 + transformant (trsformant) is produced and labeled as SLO 1. The wild-type gene line on the YIp363 plastid is used as a screening marker.

PREFERRED EMBODIMENT 2 A white rosé gene bank was constructed and screened using a roten yeast vector having a COpy number to construct a Candida albicans gene library μ a/·, Science 266: 1 723- 1 726,1 994). This somatic gene pool was transformed to SL01 strain X using standard techniques according to the method described in the preferred embodiment 1. The 2μ-ί/7Μ5 control vector was transformed into the SL〇1 strain to produce the control group 43 1354022 strain SL02. The /acZ gene was used as a reporter gene to monitor the activity of the £/promoter and to detect the activity of β-galactosidase (β-gal) by using the above filter paper analysis and/or liquid analysis. Protocols in Molecular Biology, 2, pp. 3.6.2-3.6.5. John Wiley & Sons, New York, NY, 1997; Mosch et al., 93:53 52-53 56,1 996).

The gene bank transformed strain (about 500 colonies per 15 mm of culture dish) was grown for 3 days, and then the filter paper was overlaid on the agar resin culture so that the colonies were replicated on the filter paper. URA+ colonies with elevated cold-gal activity on the filter paper were selected for further screening compared to control groups containing only 2 kernels _3 control vector. Removal of the genoplasts in a colony cell, if its galactosidase activity returns to a basal level, indicates that the colony has a candidate plastid of a CD/?/gene trans-regulatory factor. The above cells were separately grown in YPD medium for two days to remove the gene bank plastids in the candidate colony cells. Then compare these with liquid analysis

The galactosidase activity of the colonies and the candidate colonies of the gene bank plastids were selected. About 24,000 different gene bank transformation strains were prepared by the above method, and the number of the Candida albicans gene sequences contained was about three times that of the Candida albicans gene. And among the 74 candidate strains screened out at the first time, 16 strains showed elevated galactosidase activity in the second filter paper screening test. Among the 16 candidate strains, 5 of them had higher galactose activity than other candidate strains, and further analysis was carried out on the 5 candidate strains. Among the five candidate strains, two strains were judged 44 1354022

Mutations occur on the chromosomes because they still exhibit the same intensity of galactosidase activity after removal of the gene library in the two candidate strains. In contrast, when the gene bank plastids of the other three candidate strains were removed, the β-galactosidase activity was reduced to a basal level. Among the three candidate strains, the plastids contained in the two strains were identical, and the plastid was designated as LOB 44, and the URA + candidate strain containing the LOB44 plastid was designated as SL03. Analysis of the LOB44 plastid revealed that it contained an insertion sequence of about 5 kb in length, which contained two complete open reading frames (ORFs), one of which was the open reading frame of CaNdt80p. The other is the open reading area of or f6.1265. 〇Γ f6.1265 may be a short protein of 106 amino acids in length. A 2.8 kb gene fragment was extracted from the body gene of Candida albicans SC5314 to construct a LOB45 plastid and compared with the same fragment in the LOB44 plastid. In the construction method, the Candida albicans gene in the SC5314 strain was amplified by the primers HJL72 (5'd(CGG_GATCC.TTGTGGCGATTTTCACTTTC)) and HJL73(5, d(CCGGATCCTCAATGGGGGTGGATTGA')) to construct the LOB45 plastid. And the two primers HJL72 and HJL73 will create a restriction enzyme address (the sequence indicating the bottom line) on the amplified gene fragment for colonization. The amplified DNA fragment sequence is from the 578 bp upstream of the start code of the gene to the 479 bp downstream of the termination code TAA. After the amplified DNA fragment is cleaved by a restriction enzyme, the DNA fragment is inserted into a position on the pRS426 vector to produce a LOB45 plastid (Christianson et al., Gene 110: 119-122, 45 1354022).

1992) The LOB44 plastid was transformed into the SL01 strain and labeled as SL05 strain. The SL03 strain was tested by quantitative liquid analysis; S-galactosidase activity (refer to Fig. 5). The results showed that the cold-galactosidase activity of the SL03 strain (B straight) was six times that of the control group SL02 strain (A straight). When the LOB44 plastid in the SL03 strain was removed (C straight), the galactosidase activity of the SL0 3 strain was reduced to a basal level (see a straight). The introduction of the LOB44 plastid into the parental SL01 strain again restored the cold-galactosidase activity of the SL〇 1 strain to the previous intensity (Ref. D). In addition, the cold-galactosidase activity of the SL05 strain having the LOB45 plastid was equivalent to that exhibited by the SL03 strain. These results show that the genes are closely related to the increase in the 泠-galactosidase activity of the inserted gene in S. cerevisiae.

Excessive protein (CaNdt80p) reduces drug susceptibility. Etest antifungal test strips (AB BIODISK, Solna, Sweden) were used to compare the effects of excess performance of CaNdt80p and its S. cerevisiae analog Ndt80p on drug sensitivity. Ei α/·, J. Antimicrob. Chemother. 47:521-526, 2 0 0 1; Chang et al., J. Clin.

Microbiol 39: 1328-1333, 2001). The Ndt80p protein of S. cerevisiae is a meiosis specific transcription factor (C/jw et al., Science 282: 699-705, 1 9 9 8; Chu and Herskowitz, Mol. Cell 1:685 -696, 1 998). The Ndt 8 Op protein is self-regulated and the target gene is activated by the mid-46 1354022 spore-producing sequence (MSE··gNCRCAAAA/T) on its target molecule (Chu and Herskowitz, Mol. Cell 1:685-696, 1 998). Moreover, in the process of asexual reproduction, the performance of the #£>7^0 gene was suppressed. α/·, Mol. Cell Biol. 15:6572-658 1,1 995; Pak and Segall, Mol. Cell Biol. 22:64 1 7-6429, 2002).

First, several colonies were picked from the SD plate which had been cultured overnight, and uniformly mixed, and then transferred to a 0.85 % sodium carbonate solution to obtain a suspension having a cell concentration of 5 x 106 cells/ml. Take a sterilized cotton swab. After picking up the suspension for inoculation, use a cotton swab dipped in bacteria to evenly draw a line on the surface of the whole acacia. After the SD culture dish completely absorbed the excess water, an E test drug test piece (AB B10DISK, Solna, Sweden) was placed on the above culture dish. After the culture dish was placed in a soil at 30 ° C for three days, the cell growth was photographed. The Etest drug test strips used were used to test the sensitivity of cells to ketoconazole (0·002-3 2 μg/m 1 ) and fluconazole (0.0 1 6-2 5 6 pg/ml). Drug sensitivity is judged based on whether or not an antibacterial area is produced around the antifungal test piece. The degree of drug sensitivity is judged based on the size of the annular antibacterial region. The tested strains were as follows: Nt80/NDT80 wild-type S. cerevisiae (2) designated by the 2p-UJiA3 vector and CEN-LEU2 plastid (marked as SL016 strain, Christianson et al., Gene 110: 119-122, 1992; Sikor ski And /f/eier, Genetics 122:19-27, 1989, and refer to the straight line of Figure 6), accepting vector-transformed ndt80/ndt80 homozygous mutants (labeled SL014 strain, and refer to ilndt80/ in Figure 6) Ndt80 2pvector" straight), accept 2 μ-URA 3 - ND:T8 0 plastid 47 1354022 (LOB46) transformation of the heart-type zygote mutant (labeled SL013 strain, and refer to Figure 6 straight), and accept 2μ-ί//^3-〇3Λί£) Γδ0 plastid (LOB44) transformation of the «heart suppression / « heart suppression homozygous mutated mutant (labeled SL015 strain, and refer to Figure 6 "/7 heart 50 / «心占0 2 0-€^#£»7'<^" goes straight).

The polymerase chain reaction is used to amplify the I ί/2 DNA fragment in the PRS 307 plastid (SMowH and //ze, er, Genetics 1 22:1 9-27,1 9 89). The 5D-untranslated region (UTR) and the 3'-end non-translated region of the WDTSO gene are approximately 65 bp in length, and the DNA fragment is used to prepare the "heart ^/«心50 isoform zygomycetes" Mutant species. The above DNA fragment was transformed into S. cerevisiae 1 0 5 6 0 - 2 B strain (ra A/iJ.'/ZiiiG wraJ-5·? to produce ηί/Μ0._.·Ι£:ί/2 strain, And mark it as SL06 (M/ra «ciίS0.. ..Z£ 2 /π'·ϊ3 .··· ΛίsG wra3 -52 /e w2: ··do z_?C?J. Then make S LΟ6

The strain was mated with 10560-5B Housen (MAT a trpl::hisG ura3-52 /ew_2 ::3⁄4/·?(?), and the SL07 strain (MX ndt80:: LEU2 /η·5·/.. ·Λζ·5·〇Μ, α3-·5_2 /ew2··.. WsG), SL08 strain (ΜΑ T a ndt8 0:: LEU2 trp 1:: hisG ur a 3 -5 2 leu2:; hisG) ' SLO 9 strains (Λ/Α ra ir/»·/.../2/5G wraJ-52 /ewU/eG) and SLO 10 strains (MAT α,/ii5i .· .·Λί·ϊ6, ur a 3 - 5 2, /e .·.. Λ !··? G). The SL07 strain is mated with the SL08 strain to produce the diploid strain SLOl 1 {MAT&/MAT a ndt80:: LEU2/ ndt80: :LEU2 Μ ^·α3-·5·2/ΐί,β3-·52 /ew2:.. DG//ew2···· ft z.sG). The SL09 strain was further paired with the SLO10 strain to produce a diploid strain 48 1354022 SLO 1 2 (ΜΑΤ&/ΜΑ Τα ura3-52/ura3-52 leu2:: hisG/leu2:: Z/bG). The PCR fragment containing the gene and having a length of about 3.6 kb was dropped into the 2 μ- URA3 vector (ρΚ·8426) ((Γ/ι/·ί·5/ί·α«·ϊ0« et al., Gene 110) : 119-122, 1 992), to produce the plastid, and labeled as LOB46. The plastid (LOB46), respectively

The plastids (pRS426) and 2\i-URA3-CaNDT80 plastids (LOB44) were transformed into SL011 strains to produce SL013, SL014 and SL015 strains. And 2μ·ί/ϋΑ3 plastid (pRS426) and 2\i-HIS3 plastid (pRS315, ί Λ 〇/* j Α: ί α ndefer, Genies 1 2 2 : 1 9 - 2 7,1 9 8 9) - The same transformation into the SL012 strain to obtain the SL016 strain. As shown in Figure 6, the mutant of the WDrSO gene (ndt80/ndt80 2μ NDT80) gene of the S. cerevisiae is overexpressed.

(/7 A 5 0/«heart 5 0 2μ vector), neither change its sensitivity to drugs" and this result is inactivated with Ndt80p protein during meiosis of diploid cells of S. cerevisiae The facts are in line. Conversely, overexpression of the CaNDT80 gene reduced the drug sensitivity of S. cerevisiae to ketoconazole (compare NDT80/NDT80 and ndt80/ndt80 2 μ CaNDT80~ in Figure 6). In another experiment, a strain containing a LOB44 plastid containing a gene was tested for Etest. Figure 7 shows that excessive expression of the CaiV£»r<?i? gene reduces the sensitivity of S. cerevisiae to fluconazole and ketoconazole compared to strains containing only control vectors. When the cells overexpress the CaTVDrSO gene, the minimum inhibitory concentration (MIC) of fluconazole increases from 24 pg/ml to 64 pg/ml (see Figure 49 1354022 7B). Similarly, when the cells overexpressed the gene, the minimum inhibitory concentration of meconazole was increased from 6 pg/ml to 32 pg/ml or more (see Figure 7d). The strain containing the LOB45 plastid is more sensitive to antifungal agents than the strain containing the LOB44 plastid. The above experimental data suggest that the CaNdt80p protein of Candida albicans can activate these genes involved in the drug sensitivity of the beer yeast. Preferred embodiment 4

Inactivation of CaNDT80 improves drug septic activity Prepare homozygous mutants and test their drug sensitivity to antifungal agents. Constructing a homozygous zygote according to the conventional gene disruption method

^ ft {Wilson et al., Yeast 16: 65-70, 2 0 0 0; Gerami-Nejad et al., Yeast 18: 859-864, 2001; Wilson et al., J Bacteriol. 181:1868-1874, 199 9), and its genetic architecture is shown in Figure 8. The pDDB57 and pGFP-Zi?G4 plastids containing the URA3-dpI 200 segment were used as the templating strands in the polymerase-locking reaction to construct the heterozygous mutant and the homozygous mutant of CaNDT80, respectively. ΡΠ/sow ei i?/·, Yeast 16: 65-70, 2000). The obtained polymerase-binding reaction product contains a GF cadaver-/G4 gene segment, and each of the two ends of the fragment has a CfliV£>7^0 similar region of about 70 bp, and the polymerase chain reaction product is obtained. Transition to BWP17 strain ur a 3 A :: Ximm 4 3 4 his 1:: hisG/his J :: hisG ar g 4:: hi s G /

To exclude a segment from the gene from the 283 bp downstream of the transfer initiation code ATG 50 1354022 to the 3 59 bp downstream of the translation termination code. The transgenic strain is ARG+ and is labeled as strain YL0131

CaNDT80/Candt80: :GFP]RG4), which is the difference between CaiVD Γ5 0 gene

Type zygote mutant. The polymerase chain reaction product containing the C/h J-run 7200 gene fragment and having a similar region of about 70 bp in length at both ends of the fragment was transformed into the YL0131 strain to eliminate the other half of the genome. The gene, which excludes the segment from the translation of the (^#£>7^0 gene from the first 〇15 downstream of the octopus to the first 48 bp upstream of the translation termination code. The resulting Cani/iSO/ The Ca«xin 50 homozygous mutant is indicated as the YL0132 strain. The YL0133 strain is a promoter that is disrupted.

Candt80/Candt80 homozygous mutant. Is a pTTtetR-ZZ/Si fragment that is decomposed by dccl restriction enzymes (d ccl-digested pTltetR-HIS 1 , Nakayama e t al., Infect. Immun.

68:6712-6719, 2000) Inserted the YL0132 strain of £# (97 promoter to produce the YL0133 strain. 彳/ wrflJzi··..乂imw extraction 3岑his 1:: hisG/his 1:: hisG arg4: : hisG/ arg4: :hisG

Candt80: :GFP-ARG4/Candt80:: URA3-dpi 2 00 EN01/enolp::tetR-HISl) The YL0137 strain was prepared to restore one of the CaWDrSO genes of the homozygous mutant YL0132. A DNA fragment containing the wild-type gene was excised from the LOB45 plastid by restriction enzymes, and the DNA fragment was inserted into the pGEM-//7S7 vector to produce pGEM-HISl-CaNDT80 plastid and labeled as LOB49 ( Whon 51 1354022 "α/·, J. Bacteriol. 181:1868-1874, 1999). Subsequently, the restriction enzyme was used to cut the LOB49 plastid from the im-restricted enzyme site on its promoter, and then the linear LOB49 plastid was transformed into the YL0132 strain to construct the strain YL0137.

URA3A:: λ imm434 his l: :hisG/his 1:: hisG

Arg4:: his G/arg 4:: his G

Candt80: :GFP-ARG 4/Candt80:: URA -dp 12 00::

CaNDT80: :HIS1.

Candida albicans SC5314 (wild species), YL0133 strain (Ca«cardiogenic zygote mutant) and YL0137 strain (recovering one of the genes YL0133 strain) were contained at 30 °C

Or grow in culture medium containing 100 pg/ml 0 m. (miconazole, Sigma) for 1 hour. Subsequently, reverse transcription polymerase chain reaction (RT-PCR) was used to detect mRNA production of TEF3 (internal control) and CaNDT80 gene in each of the above strains. Figure 9 shows the CD;?/ and mRNA expression of each strain, and the data in the figure are normalized with the wild strain and mRNA data» The 2-4 and 11-13 straight lines show the YL0133 strain ( mRNA expression of homozygous mutants, 5-7 and 14-16 showed direct mRNA expression of YL0137 strain (post-rescue mutant), and lines 8-10 and 17-19 showed wild species SC5314 The amount of mRNA expression of the strain. The 2nd, 5th, 8th, 1st, 14th, and 1st straight lines are the Russian test results of the mRNA expression of the gene (internal control group); the 3rd, 6th, 9th, 1st, 1st, 5th, and 18th straight behaviors Detection of the mRNA expression of the gene; and 4, 7, 1 〇, 52 1354022

1 3, 1 6 and 1 9 straight is the detection result of the mRNA expression. As expected, CaNDT80 mRNA could not be detected in homozygous mutants (Figs. 4 and 13 are straight). In contrast to the performance of similar genes in Alcoholic yeast, it was found that mRNA expression was detected during asexual reproduction of wild strains (see Figure 9, straight lines 10 and 19). The mRNA expression of the mutant species after rescue was lower than that of the wild strain, but higher than that of the homozygous mutant strain (see Fig. 9, lines 7 and 16). And compare the mRNA profiles of each strain that received or was not treated with miconazole. In the homozygous mutant strain, the amount of mRNA encoding the CD/?/ gene excluding the pump was decreased (compare the 3rd and 9th straight lines in Fig. 9 and compare the 1st and 1st straight lines). This result shows that the performance of the CaWDrSO gene enhances the performance of the excluded pump. Since the mRNA of the gene can still be detected in the homozygous mutant (refer to paragraphs 3 and 12 of Figure 9), (7 proteins may be only one of the factors controlling the expression of the gene. In addition, use The LC FastStartDNA Master SYBR Green I reagent set (Cat-No. 2239264, Roche, Germany) in the LightCycler reagent also yielded consistent results for hot-start hot-start PCR. |J Take Candida albicans SC5314 (wild species), YL0133 (〇: heart 50/<^«心50 homozygous mutated mutant) and 丫[〇137 (restore one of them (:///)7 01^〇13 of the ^0 gene 3) Three strains were tested for £1651 to detect the drug susceptibility of the strains to the five drugs. Five antifungal test strips used (AB BIODISK, Solna, Sweden) ) respectively, the concentration of 53 is 0.002.u

Pg/ml amphotericin b (AP), 〇·〇〇2_32 μ§/ιη1 5-fluorocytosine & (FC), 0.016-256 pg/ml fluconazole (FL), 0.002-32 μ〇/ηΊΐ of itraconazole (IT) and 0.002-32 Mg/ml of ketocon spray (ΚΕ)β to grow the poisonous worms in the SD culture dish for one night' and the culture dish The upper windows were mixed and transferred to a sodium chloride solution having a concentration of 0 · 8 5 % to form a suspension of fine _ a absorbance of 5 Μ 06 cells/ml. Take the smashed cotton swab and take _ & Λ 1乍 as the inoculation source and use cotton with liquid

Stick in a SDiit矣 « . The surface of the acacia gel is evenly twisted on the surface. I will train too much water people

After the absorption of the king, five different Etest drugs were placed on each training class to test the month of H. Subsequently, the cultures were allowed to grow in an environment of 35 ° C for two days and then photographed 4 ¥. The dish was sensitive to the growth of each strain. Antifungal test strips The bacteriostatic areas around the boundaries indicate the sensitivity of various strains to the drug! ± and determine the sensitivity of the strain to the drug based on the size of the zone of inhibition.

The homozygous mutant has increased sensitivity to fluconazole 'ketoconazole and 5-fluorocytosine (compare the first 〇A and 10B plots). In addition, compared to wild-type strains with two CflWDrSO genes, the rescued strain YLqu? with only one gene is more sensitive to fluconazole (compare Figures 10A and 10C) to show the dose effect of the gene ( The dosage of the acacia powder showed that either the mutation of one of the genes or the gene caused the Candida albicans to be more sensitive to the antifungal agent Fluconazole and voriconazole. Homozygous mutants are derived from Sang/ard et al. at Amtimicrob. Agents 54 1354022

Chemother. 40·· 2300-2305, 1996 Method construction as described in the literature. SD medium containing 25 gg/ml fluconazole and lpg/ml voriconazole dimethylsulfoxide (DMSO) was then prepared. Candida albicans cells were grown in SD medium containing no drug but containing dimethyl amide as a control group. The cells of Candida albicans were diluted to a bacterial solution with a D 6 00 value of 2 (ie, a cell concentration of approximately 2×1 07), and 0.5 μΐ of the above using a replica element (Oxoid Inc., Canada) The bacterial solution was spotted on a petri dish containing fluconazole (25 pg/ml) or voriconine (1 pg/ml). The above bacterial solution was subjected to a series of 10-fold dilutions (e.g., diluted from 104 cells to 10 cells), and spotted on a petri dish in the same manner.

As shown in Figure 11, cells at every point on the culture dish can grow normally without drug (Figure 1 1). Mutant species were compared to wild-type strains (wt) and rescued strains (only one wild species CaNDT80 gene) against I Kang saliva and voricon. Sitting on both is more sensitive. In addition, mutant strains are more sensitive to fungal agents than Ca «Heart/Can heart mutant strains. As shown in Figures 1 1 B and 1 1 C, when the cell concentration is about 103 and 102, the number of cells grown on the culture i containing the two drugs is less than that of the Cani/iSO/Cani/iSO cells. The number of growths in the culture of the drug. Preferred Embodiment 5 The homologous zygote mutant does not have a preference. Candida albicans and Saccharomyces cerevisiae can be changed from a yeast cell to a filamentous form, and the filamentous body is usually a pseudo-mycelium or a fungal filament. 55 1354022

The form of the body exists (i〇 fl/., Cell 90: 939-949s 1 997). The yeast transformation is regulated by regulatory proteins including Stel2p and Phdlp (Lo et al., Cell 90: 939-949, 1997). The Candida homologous proteins of Stel2p and Phdlp are Cphlp and Efglp, respectively, and there have been reports that Cph 1 p and Efglp are two Candida homologous proteins that regulate the transformation (Lo et al., Cell 9 0:.9) 3 9-949, 1 997) » A homozygous mutation at the locus of Cphlp and Efglp (丨oci) causes Candida to lock into the yeast form and is in a mouse model. It is non-toxic ([〇ei d., Cell 90: 939-949, 1997). Same test

The toxicity of Candt80/Candt80 homozygous mutants in germ tube formation and mouse models. The Candt80/Candt80 homozygous mutant Candida was cultured in YPD medium containing 10% horse serum at 37 °C for 2 hours, and then observed under a microscopic microscope. As shown in Fig. 12, it was found that under the above test conditions, the mutant could not form a germinated tube and a fungal filament.

The wild species of CflWDrSO/CfliVDrSO can form germinated tubes and fungal filaments. Furthermore, the wild type CaNDT80 gene can be added to the cells to rescue the mutant species to form germinating tubes and fungal filaments. Thus, the gene was involved in the transformation process of Candida from yeast to fungal filaments. The mutants were also tested in a mouse model according to the method described in fl/., Cell 90: 939-949, 1997. Toxicity. BALB/c mice (Charles River Laboratories, Wilmington, MA) were injected with 〇·1 m 1 of Candida species to be tested by their tail veins (1 x 1 〇 6 56 1354022 months Θ ει修 (more) Wu page

Cells) and the number of surviving mice was followed daily to test for cytotoxicity. As shown in Figure 13, the number of mice injected with wild Candida was less than 40% of the original number after one day of injection, indicating that the wild species Candida (ca from the lethal toxicity. In contrast, the injection of Candt80/ The survival rate of the mice of the Candt80 mutant species after η days was 1%.

This preferred embodiment has been shown to be associated with the toxicity of Candida and may be used as a treatment for Candida infection. Preferred embodiment 6

Constructing and cultivating five plastids containing different lengths/promoter in the staining 整 of the whole 黾 cells, the ΜΙ>Λ7 promoters in these plastids are counted from the starting position to the upstream Fragments of about 300, 600, 900, 1200, and 2700 base pairs in length. The number of different lengths from £> and / promoter fragments is amplified by polymerase chain reaction (PCR) using different primers in the array. The oligonucleotide HJL305, a reverse primer, was used in all reactions and its sequence was 5' - AACCC AAGCTTGr. A TTGTGAAGTTCTATGT - 3 . The inverted primer HJL305 has a /ihrflll restriction enzyme position, and the sequence of the primer is complementary to the sequence of the AfD/J/promoter from the +4 to -15 position, wherein the A definition of the translation start position ATG t is defined. Is +1. The forward primers used in the amplification reaction of each promoter fragment are shown below: LHL3 (complementary to the promoter-310 to -293 sequence): 57 3,1354022

55 - CGCGGATCCACCAATTAATCACAACGG -

LHL2 (complementary to the sequence of MD and / promoter -644 to -627): 5' - GCGGGATCCTCATGTAACCTTGCAATC - 3' LHL1 (complementary to the sequence of promoter _966 to -947): 5' CGCGGATCCCTTAGACTTACTTATATCCG -3, HJL3 1 (with The sequence of promoter -1242 to -1224 is complementary): 55 - CGCGGATCCGGCTTGCTAAACATTATCA - 3' HJL29 (complementary to the sequence of MD and i promoters 2ό9ό to -2073): 55 - CGCGGATCCAGAGAATCCAGAAAAGAG - 3, the number of amplified promoter fragments is The in-frame insertion/acZ fusion plastids ΥΕρ3 63 and ΥΙρ363 in accordance with the coding principle, the /flcZ fusion plastid contains the wild species gene as a screening marker {Myers et al., Gene 45:299-3 1 0, 1 986). YEp363 plastids can replicate themselves in E. coli and yeast. The YIp3 63 plastid is suitable for integration of the above plastid sequence into the chromosome of the yeast host (Myeri ei a Gene 45: 299-3 1 0, 1 986). A plastid containing a length of 2700 base pair promoter fragment was integrated into the five J site of S. cerevisiae by homologous recombination. First, the following oligonucleotides and polymerases are used to describe the bacterium chain.

58 1354022 Lock reaction to amplify part of the gene, the oligonucleotide used is as follows: HJL44 (complementary to the sequence of +547 to +565 in the gene): 5, TTTCCGGGCAGCATTTAGAΑΡΓ Α AT - 3, HLJ45 (+2143 with the gene) Complementary to + 2170): 5' - CCCCCCCG^_GTGATTTGTCTTAACATT - 3,

A DNA fragment of the gene of i.6 kb in length was inserted into the MDi?/p-/acZ plastid containing the AfDi?/promoter of 27 00 base pairs to obtain an integrated plastid. The plastid is then introduced into the Saccharomyces cerevisiae cell and inserted into the site of the yeast host chromosome. Preferred Example 7 Screening CZ^/gene and Regulatory Factor Φ The Candida albicans gene bank prepared according to the preferred embodiment 2 was transformed into a Saccharomyces cerevisiae cell containing CD; These genes that activate /flcZ expression are colonized. According to the above steps, two candidate genes were identified, named as: £:/^ (Fig. 3) and (:αΛ^Γ5 0 (Fig. 2), where /?£ household/full name excludes pump regulatory factors l (regulat〇r 〇f efflux pump 1). The two candidate genes were subsequently tested according to the preferred embodiment 2, compared to the cold-galactosidase activity of the control group, household/through CZ)/?7 The promoter increased the cold-galactosidase activity by a factor of 6 and the excess of the table 59 1354022 and the corpse/can also increase the/5-galactosidase activity by a factor of 6 via MDi®/starter. Similarly, compared with the control group, Ca/V'DrSO can increase the /3-galactosidase activity by 6-fold through the CZ)J?7 promoter, but it cannot be improved by MDi?/promoter; 5-galactoside Enzyme activity. It was also found that overexpression of CaNDT80 gene reduced the drug sensitivity of S. cerevisiae to fluconazole and ketoconazole, and the results were consistent with the observation/exclusion of the results of pumping fluconazole and ketoconazole.

The contents of this specification can be understood from the references cited in the specification, and the cited documents are fully incorporated by reference. The description provides several preferred embodiments in accordance with the present invention as exemplary, and is not intended to limit the invention. It will be apparent to those skilled in the art that the present invention is intended to cover various other preferred embodiments. The actual scope and spirit of the invention are defined by the scope of the appended patent application. [Simple description of the map]

Figures 1A and 1B show the results of comparison of the amino acid sequences of CaNdt80p (SEQ ID NO: 1) and N d t 8 0 p (S E Q ID Ν Ο : 2). Figures 2A and 2B show the nucleotide sequence of CaiVDrSO (SEQ ID NO: 3). It shows a complete mid-range spore-forming sequence (MSE) on the 5th 72th base pair upstream of the start coding (+ 1). Figures 3A and 3B show the nucleotide sequence of /?P/(SEQ ID NO: 4). 60 1354022 Figure 4 shows the integration of the LOB43 plastid containing the CD/?7 promoter fusion gene into the J£) £J locus of S. cerevisiae. The horizontal arrow indicates the direction of transcription from the /promoter. Figure 5 is a bar graph showing the relative activity of p-galactosidase of each S. cerevisiae strain. Each S. cerevisiae strain is (A) the control group of the transformation 2\i-URA3 vector (labeled as SL02 strain), (B) Transformation

Plastid (LOB44) (labeled SL03 strain), (〇SL03 Saccharomyces cerevisiae (labeled SL04 strain) removed, and (D) re-transformed LOB44 plastid to SL03 with LOB44 plastid removed In S. cerevisiae (labeled SL05 strain). Figure 6 shows the Etest test results (AB BIODISK, Solna, Sweden) to show the antifungal agents of each strain, fluconazole (FL) (bottom) and ketoconazole (KE) ) (bottom) sensitivity. The strains tested were

Wild-type brewer's yeast (WDrSWDrSO), transforming 2μ-ί//Μ3 control vector of 12-heart 50/«heart^ homozygous zygote mutant 哞 wine yeast (π heart suppression 2μ-vector), transformation 2μ-plastid Homozygous mutated mutant Saccharomyces cerevisiae / «Heart suppressor 2μ-Α^Γ<?ί?), and transformed 2\i-URA3-CaNDT80 plastid homozygous mutant S. cerevisiae (/(10) / «Heart (10) 2p-CaNDT80).

Figure 7 shows the sensitivity of the S. cerevisiae with 2μ control vector or 2μ LOB44 plastid to antifungal agents. The 7th and 7th Β diagrams are the susceptibility test results of two S. cerevisiae to fluconazole (FL). , 7C and 7D 61 1354022 The plot is the result of the sensitivity test of two brewer's yeast against ketoconazole (KE). Figure 8 shows the genetic structure of a null mutation. It was shown that the two CaNDT80 gene replicas (blank portions) were replaced by the GFP-ARG4 gene fragment (solid part) and the URA3-dpl 200-based cassette (slashed part).

Fig. 9 shows the results of agarose gel electrophoresis of the reverse transcription polymerase chain reaction product of various S. cerevisiae strains. The 11-19 straight lines in the figure show the RT-PCR products of S. cerevisiae treated with miconazole (Sigma), and the 2-1 0 straight line shows the RT-PCR product of S. cerevisiae without miconazole treatment. 1st direct behavior standard molecular weight marker (Invitrogen's lkbDNA ladder); 2-4 straight and 11-13 straight behavior CtfnA (10) (YL0133) homozygous mutant strain; 5-7 straight and 14-16 straight behavior Candt80 /Candt80::CaNDT80 (YL0137) strain; 8-10 straight and 17-19 straight behavior CfliVDr50/CaA^r50 (SC5314) wild strain. 2'5, 8, 11, 14 and 17 straight behavior test results of 7^/^1111?^8 (as internal control); 3, 6, 9, 12, 15 and 18 straight behavior CD7U mRNA Test results; and 4, 7, 1 , 13, 16 and 19 straight behaviors (^///) 7^01111^8 test results" Figure 10 shows each strain for amphotericin B (AP) , 5-Fluorocytosine (FC), fluconazole (FL), itraconazole (IT) and ketoconazole (KE) five antifungal agents E test (AB BIODISK, Solna, Sweden) drug sensitivity The result of the test. The tested strains were Candida albicans (A) wild species CaNDT80/CaNDT80 (SC5314), (B) homozygous mutant (YL0133), and (C) wild type CaNDT80 62 1354022 gene homozygous mutation Species (YLO 137). Figure 11 is a photograph of Candida albicans showing wild species Candida albicans SC5314(wt), cdrl/cdrl homozygous mutant

OSY^4Z(cdrl/cdrl) 'Candt80/Candt80 homozygous mutant YLOlZ3(Candt80/Candt80)' and Candt80/Candi80 post-rescue strain YL01 37 were added (A) without drug, (B) 25 pg/ Cell growth of ml fluconazole, and (C) addition of 1 pg/ml voriconazole to the culture dish. Fig. 12 is a photograph showing the formation test of the Candida albicans strain (wild species), the Can heart fungus species (the homozygous mutant species), and the germination tube formation after the rescue. Figure 13 is a graph showing the survival of mice inoculated with CaNDT80ICaNDT80 wild species and homozygous mutants respectively. The toxicity of Candida albicans in vivo in a mouse model has been demonstrated.

[Simplified description of component symbol] 63

Claims (1)

1354022 _____ Announcement 10, the scope of the patent application: 1. A method for inhibiting the growth of a cell in vitro, comprising at least an inhibitory pump expression factor for inhibiting the cell, wherein the exclusion of the pump expression factor can be combined with a target polynucleoside Acid mid-spore generation sequence (MSE) binding. 2. The method of claim 1, wherein the CaNDT 80 is capable of regulating an exclusion pump selected from the group consisting of CDJU, CDR2, MDJiJ. 3. The method of claim 1, wherein the cell line is selected from the group consisting of bacterial cells, sputum cells, and yeast cells. 4. The method of claim 3, wherein the sputum cell line is selected from the group consisting of Candida species, Aspergillus sp. /·//«" species, Cryptococcus (〇) Less piococcwi1 species) and its mixture. 5. The method of claim 4, wherein the Candida is selected from the group consisting of Candida albicans (c·α/6ζ·caws), Candida krusei/fcrwie/), Candida tropicalis ( C., Candida glabrata (C·g/Wraia) and a mixture thereof. 64 (S ) 1354022 6. A method for inhibiting the growth of a cell outside of the living's method, the method comprising at least inhibiting the run The performance or activity of the five households. 7. The method described in the third paragraph of the patent application 'the five/> 7 can adjust the performance of a excluded pump'. The excluded pump is selected from CDR1' CDR2 '7?/ is formed in the group. 8. The method of claim 6, wherein the cell line is selected from the group consisting of bacterial cells, sputum cells, and yeast cells. 9. The method of claim 8, wherein the sputum cell line is selected from the group consisting of Candida species, the fungus species, the genus Cryptococcus (Pmcoccw·? species), and mixtures thereof Among the groups formed. 10. The method of claim 9, wherein the Candida is selected from the group consisting of Candida albicans (C. hwid, C. iropicfl/b), Candida glabrata (C. commissariat and its mixture) 11. A composition for inhibiting cell growth, the composition comprising at least one inhibitory pump expression factor inhibitor, wherein the exclusion of pump expression factor inhibition The antisense DMA, antisense RNA or interfering RNA [mi]' 65 1354022 of the 剂ίΐΛ^ΓδΟ and the exclusion of the pump expression factor inhibitor inhibits the mid-range sporulation sequence (MSE) of a target polynucleotide 12. The composition of claim 11, wherein the exclusion of the pump performance factor modulates a performance of the excluded pump, the excluded pump being selected from the group consisting of . 13. The composition of claim 11, further comprising at least one drug. 14. The composition of claim 11, wherein the cell line is selected from the group consisting of bacterial cells, sputum cells, and yeast cells. 15. The composition of claim 14, wherein the sputum cell line is selected from the group consisting of Candida species, the genus Aspergillus species, Oypiococcw® species, and mixtures thereof. The composition of the group of claim 16, wherein the Candida species is selected from the group consisting of Candida albicans (C. a. rwiez_) , Candida tropicalis (C. "o/n'cfl/ίί), Candida glabrata (C. and a mixture thereof). 66 1354022 17. A composition for inhibiting cell growth, the composition Included is at least one exclusion of a pump performance factor inhibitor, wherein the exclusion of a pump expression factor inhibitor line and a five-family/antisense DNA, antisense RNA or interfering RNA that inhibits the performance or activity of the genus. 18. The composition of claim 17, wherein: and the household 7 is capable of regulating the performance of an excluded pump, the excluded pump is selected from the group consisting of CDRJ, CDR2, and MDR1. . 19. A method of increasing the activity of a drug in a cell in vitro, the method comprising at least: a. inhibiting the performance or activity of a pump-expressing factor that is capable of interacting with a target polynucleotide The mid-range spore-forming sequence is combined, wherein the exclusion pump exhibits a Western-like CaNDT80, b. inhibiting the expression of at least one of the excluded polynucleotides in a cell; c. contacting the cell with at least one drug; and d. increasing the activity of the drug. 20. The method of claim 19, wherein the draining of the pumping polynucleotide is selected from the group consisting of /. 67 C S ) 1354022 21. The method of claim 19, wherein the cell line is selected from the group consisting of bacterial cells, sputum cells, and yeast. 22. The method of claim 21, wherein the bacterial cell line is selected from the group consisting of a species of the genus Cryptococcus and a mixture of Cryptococci. 23. The method of claim 22, wherein the genus of the genus is from Candida albicans (C. α/δ/caw), i (C·^rMiei·), and tropical bacterium (C. Iropica/ίί), smooth and its mixture. 24. The method of claim 19, wherein the method of the invention is a fungicide, and wherein the antifungal agent is a pharmaceutical method in a booster cell, the method comprises at least: a The performance or activity of the household 7; b • inhibition of at least one of the cells to exclude the pumping of the polychlorinated; C · contacting the cell with at least one drug; and wherein the fine i consists of the tortuous fungus species) and Among the thoughts, Candida albicans candida (C., of which the drug is active. Table 68 of the active 5-glycoside) <S) 1354022 d. Increase the activity of the drug. 26. The method of claim 25, wherein the draining of the pumping polynucleotide is selected from the group consisting of. 27. A method of screening a cell encoding a polynucleotide having a pump expression factor, the method comprising at least: a. introducing a reporter gene under the control of a pump-inducing promoter into a host cell, wherein The exclusion pump promoter is selected from a promoter of CDR1, CDR2 or MDRI, b. a candidate exclusion pump expression factor polynucleotide is introduced into the host cell of step (a); and c. detection The performance of the reported gene. 28. The method of claim 27, wherein the host cell line is selected from the group consisting of a bacterial cell, a sputum cell, a yeast cell, and a mammal cell. 29. The method of claim 28, wherein the yeast host cell is a yeast species. 30. Use of CaNDT80-derived I DNA, antisense RNA or interfering RNA to prepare a medicament for the treatment of a disease or infected patient 69 1354022, wherein the antisense DNA, antisense RNA or interfering RNA inhibits energy The use of a medium-range spore-producing sequence (MS E) of a target polynucleotide to eliminate the use of a pump expression factor. 31. The use of claim 30, wherein the infection is a bacterial infection, a fungal infection or a yeast infection. 32. The use according to claim 31, wherein the cell line causing the fungal infection is selected from the group consisting of Candida (Ca «Mountain' heart species), H. genus (Hergi/Zws species), Cryptococcus Genus (CV less piococcws species) and its mixture. 33. The use of claim 32, wherein the Candida is selected from the group consisting of Candida albicans (C. α/Zu'ca^O, Candida krusei (C. ArrwseO, Candida tropicalis) (c· wopfca/fj·), Candida glabrata (c. and its mixture). 34. The use according to claim 30, wherein the exclusion factor is CaA^7^0[m2], which can regulate the performance of a pump exclusion. CD/?/, in the group formed. 35. An antisense DNA, antisense RNA or interfering RNA using ugly P1 for the preparation of a medicament for treating a diseased or infected patient, wherein the regulation can exclude the performance of the pump, and the The drug can inhibit the performance or activity of i? 36. The use of claim 16, wherein the exclusion pump is selected from the group consisting of and . 37. A pharmaceutical composition comprising at least one inhibitory pump expression factor inhibitor, wherein the exclusion pump expression factor inhibitor is CflWDr other antisense DNA, antisense RNA or interfering RNA, capable of inhibiting binding to a target A pharmaceutical composition according to the third aspect of the invention, wherein the exclusion of the pump performance factor is a regulatable pump Performance, the exclusion of the pump is selected from and constructed 39. The pharmaceutical composition of claim 37, further comprising at least one drug. The pharmaceutical composition of claim 3, 3, 8 or 39, further comprising a pharmaceutically acceptable carrier. 71 S 1354022 4 41. A pharmaceutical composition comprising at least one inhibitor of a fruit-producing factor inhibitor, wherein the anti-sense DNA, antisense RNA or interfering RNA that inhibits a pump expression factor inhibitor is capable of inhibiting expression Or active. 42. The pharmaceutical composition of claim 41, further comprising a pharmaceutically acceptable carrier. 43. A method of inhibiting growth of a cell in vitro, the method comprising, at least: a. inhibiting binding to a mid-range spore-forming sequence; and b. inhibiting growth of a cell. 44. The method of claim 43, wherein the cell line is selected from the group consisting of bacterial cells, fungal cells, and yeast cells. 45. The method of claim 44, wherein the fungal cell line is selected from the group consisting of a Candida species, a Fungus species, Cspecies, and mixtures thereof. . 46. The method of claim 45, wherein the genus 72 1354022 is derived from Candida albicans (C., C. Arwsei, Candida tropicalis (C. 47. The method of claim 41, wherein the mid-range spore-producing sequence (MSE) is derived from a polynucleotide, Polydecanoic acid is selected from the group consisting of CaNDT80 and CDRJ' CDR2 anti-MDRJ. 48. The method of claim 43, further comprising contacting the cell with at least one drug. 49. A method of inhibiting a cytotoxicity in vitro, the method comprising at least: a. contacting the cell with at least one inhibitor of a pump expression factor; b. inhibiting the toxicity of a cell; wherein the exclusion of the pump expression factor inhibitor is CaNDT80, antisense DNA, antisense RNA or interfering RNA, the inhibition of which can bind to a target polynucleotide mid-range spore-forming sequence Excluding the pump performance factor 50. The method of claim 49, wherein the pump performance factor CflWD 7^0 is excluded, which can regulate the performance of a pump exclusion, 73 1354022 * The pump is excluded It is selected from the group consisting of and. 5 1. The method of claim 49, further comprising contacting the microbial cell with at least one drug. 52. The method of claim 49, wherein the microbial cell line is selected from the group consisting of bacterial cells, fungal cells, and yeast cells. 53. The method of claim 52, wherein the fungal cell line is selected from the group consisting of Cawi/ii/a species, /spergi/Zw·? species, Cryptococcus It is a group of genus (small piococcw?? species) and mixtures thereof. 54. The method of claim 53, wherein the Candida is selected from the group consisting of Candida albicans (C. a/6 i caw), Candida krusei (C. 々rwsez), and the tropics Candida (C., Candida glabrata (C_ and its mixture). 74 (S)