WO2011110838A2 - Differentiation factor - Google Patents

Abstract

We disclose therapeutic agents that target p63 expressed by prostate cancer cells and/or prostate cancer stem/progenitor cells and including combination therapies useful in the treatment of prostate cancer.

Description

Differentiation Factor

The invention relates to therapeutic agents that target p63 expressed by prostate cancer cells and/or prostate cancer stem/progenitor cells.

Cancer is an abnormal disease state in which uncontrolled proliferation of one or more cell populations interferes with normal biological function. The proliferative changes are usually accompanied by other changes in cellular properties, including reversion to a less organised state. Cancer cells are typically referred to as "transformed". Transformed cells generally display several of the following properties: spherical morphology, expression of foetal antigens, growth-factor independence, lack of contact inhibition, anchorage-independence, and growth to high density. Cancer cells form tumours and are referred to as "primary" or "secondary" tumours. A primary tumour results in cancer cell growth in an organ in which the original transformed cell develops. A secondary tumour results from the escape of a cancer cell from a primary tumour and the establishment of a secondary tumour in another organ. The process is referred to as metastasis and this process may be aggressive, for example as in the case of hepatoma or lung cancer; or non aggressive, for example early prostate cancer. The concept of a cancer stem cell within a more differentiated tumour mass, as an aberrant form of normal differentiation, is now gaining acceptance over the current stochastic model of oncogenesis, in which all tumour cells are equivalent both in growth and tumour-initiating capacity [Hamburger AW, Salmon SE: Primary bioassay of human tumour stem cells. Science 1977, 197: 461463; Pardal R, Clarke MF, Morrison SJ: Applying the principles of stem cell biology to cancer. Nat. Rev. Cancer 2003, 3: 895902.] For example, in leukaemia, the ability to initiate new tumour growth resides in a rare phenotypically distinct subset of tumour cells [Bonnet D, Dick J.E. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat. Med. 1997, 3: 730737] which is defined by the expression of CD34+CD38 surface antigens and have been termed leukemic stem cells (LSC). Similar tumour-initiating cells have also been found in 'solid' cancers such as breast [AIHajj M, Wicha MS, BenitoHernandez A, Morrison SJ, Clarke MF: Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003, 100: 39833988], brain [Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD, Dirks PB: Identification of human brain tumour initiating cells. Nature 2004, 432: 396401 ], lung [Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I., Vogel S, Crowley D, Bronson RT, Jacks T: Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 2005, 121 : 823-835] colon [O'Brien CA, Pollett A, Gallinger S, Dick JE: A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 2007, 445: 1061 10; RicciVitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C, De Maria R: Identification and expansion of human colon cancer initiating cells. Nature 2007, 445: 1 1 1 1 15]; and gastric cancers [Houghton J, Stoicov C, Nomura S, Rogers AB, Carlson J, Li H, Cai X, Fox JG, Goldenring JR, Wang TC: Gastric cancer originating from bone marrow derived cells. Science 2004, 306: 15681571 ].

The p53 homologue p63, [also called KET, p51 A, p51 B, p40 and p73L] is expressed in selected normal epithelial cells and is highly expressed in embryonic ectoderm, and basal regenerative cells of many epithelial tissues in adult skin, breast, prostate and urothelium. Over expression is also observed in some squamous cell carcinomas suggesting an oncogenic function. p63 has sequence and structural homology to p53 leading to an assumption that p63 may have similar tumour suppressor functions. The human p63 gene encodes a polypeptide of 397 amino acids and has a conserved amino terminal transactivation domain, a DNA binding domain and a carboxy terminal oligomerization domain. However there are some significant differences between p63 and p53. The p63 gene has two promoters which when differentially expressed results in the production of two isoforms; one with and one without a transactivation domain. Some studies have attempted to investigate the correlation between p63 expression and disease, in particular cancer. For example Como et al [Clinical Cancer Research 8, 494- 501 , 2002] discloses the expression of p63 in normal and tumour tissue. The conclusion in Como et al is that p63 is expressed in basal cell and squamous cell carcinomas but not in adenocarcinomas including those of breast and prostate. Moreover, WO2007/037782 discloses a method for the treatment of prostate cancer comprising administering an inhibitor of Breast Cancer Resistance Protein [BCRP] to a patient. The cells that are targeted by the BCRP inhibitor are claimed to be prostate stem cells with a phenotype that is BCRP positive but negative for expression of androgen receptor, synaptophysin and p63.WO2007/037782 therefore claims to disclose a prostate stem cell therapy correlated with, amongst other things, a lack of expression of p63.

We disclose the association of p63 expression with prostate stem cells/progenitor cells and its function in the differentiation of prostate stem cells/progenitor cells and prostate cancer cells and including agents that interfere with the activity of p63. According to an aspect of the invention there is provided a pharmaceutical composition comprising an agent comprising an inhibitor of p63 expression or activity. In a preferred embodiment of the invention said p63 is an a isoform.

In a preferred embodiment of the invention said p63 a isoform is TAp63a.

In an alternative preferred embodiment of the invention said a isoform is ΔΝρ63α.

In a preferred embodiment of the invention said agent comprises an antisense RNA or an antisense oligonucleotide.

In a preferred embodiment of the invention said therapeutic agent is a small interfering RNA [siRNA].

A technique to specifically ablate gene function is through the introduction of double stranded RNA, also referred to as small inhibitory or interfering RNA (siRNA), into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA molecule. The siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The siRNA molecule is typically derived from exons of the gene which is to be ablated. The mechanism of RNA interference is being elucidated. Many organisms respond to the presence of double stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double stranded RNA activates a protein complex comprising RNase III which processes the double stranded RNA into smaller fragments (siRNAs, approximately 21 -29 nucleotides in length) which become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.

In a preferred embodiment of the invention said siRNA inhibits the expression of p63.

In a preferred embodiment of the invention said siRNA molecule is at least 18 base pairs in length. Preferably said siRNA molecule is between 18bp and 29bp in length. More preferably still said siRNA molecule is between 21 bp and 27bp in length. Preferably said siRNA molecule is about 21 bp in length. In a preferred embodiment of the invention said siRNA molecule is designed with reference to the nucleotide sequence as represented in Figure 1 [SEQ ID NO: 51 ].

In a preferred embodiment of the invention said siRNA comprises or consists of a sense nucleotide sequence selected from the group as represented in Table 1 as SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50, or combinations of said siRNA molecule.

In a preferred embodiment of the invention said siRNA is selected from the group:

Sense: GGUUGGCACUGAAUUCACGtt [SEQ ID NO: SEQ ID: NO 52;

Antisense: CGUGAAUUCAGUGCCAACCtg [SEQ ID NO: ID: NO 53]. In a preferred embodiment of the invention said antisense oligonucleotide or antisense RNA is designed with reference to the sense nucleotide sequence:

TTTCTTAGCGAGGTTGGGCTGTTCATCATGTCTGGACTATTTCACGACCCAGGGGC TGACCACCATCTATCAGATTGAGCATTACTCCATGGAT [SEQ ID NO: 55].

In a preferred embodiment of the invention said siRNA comprises or consists of a sense nucleotide sequence selected from the group as represented in Table 2 as SEQ ID NO: 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 80, 81 or 82, or combinations of said siRNA molecules.

In a preferred embodiment of the invention said antisense oligonucleotide or siRNA includes modified nucleotides.

The term "modified" as used herein describes a nucleic acid molecule in which;

i) at least two of its nucleotides are covalently linked via a synthetic internucleoside linkage (i.e., a linkage other than a phosphodiester linkage between the 5' end of one nucleotide and the 3' end of another nucleotide). Alternatively or preferably said linkage may be the 5' end of one nucleotide linked to the 5' end of another nucleotide or the 3' end of one nucleotide with the 3' end of another nucleotide; and/or ii) a chemical group, such as cholesterol, not normally associated with nucleic acids has been covalently attached to the double stranded nucleic acid. iii) Preferred synthetic internucleoside linkages are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, phosphate triesters, acetamidates, peptides, and carboxymethyl esters.

The term "modified" also encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleotides may also include 2' substituted sugars such as 2'-0-methyl-; 2-O-alkyl; 2-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'- fluoro-; 2'-halo or 2;azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.

Modified nucleotides are known in the art and include, by example and not by way of limitation, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N6-methyladenine; 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil;5- carboxymethylaminomethyl-2-thiouracil; 5 carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; l-methyladenine; 1 -methylpseudouracil; 1 - methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3- methylcytosine; 5-methylcytosine; N6-methyladenine; 7-methylguanine; 5- methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; β-D-mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2 methylthio-N6-isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil, 2- thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5— oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil; 1 -methylguanine; 1 -methylcytosine. Modified double stranded nucleic acids also can include base analogs such as C-5 propyne modified bases (see Wagner et al., Nature Biotechnology 14:840-844, 1996).

In an alternative preferred embodiment of the invention said composition comprises an antisense oligonucleotide.

In a preferred embodiment of the invention said antisense oligonucleotide includes modified nucleotides. As used herein, the term "antisense oligonucleotide" or "antisense" describes an oligonucleotide that is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide, or modified oligodeoxyribonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an mRNA transcript of that gene and thereby, inhibits the transcription of that gene and/or the translation of that mRNA. The antisense molecules are designed so as to interfere with transcription or translation of a target gene upon hybridization with the target gene. Those skilled in the art will recognize that the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence.

It is preferred that the antisense oligonucleotide be constructed and arranged so as to bind selectively with the target under physiological conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions. In order to be sufficiently selective and potent for inhibition, such antisense oligonucleotides should comprise at least 7 (Wagner et al., Nature Biotechnology 14:840-844, 1996) and more preferably, at least 15 consecutive bases which are complementary to the target. Most preferably, the antisense oligonucleotides comprise a complementary sequence of 20-30 bases. Although oligonucleotides may be chosen which are antisense to any region of the gene or mRNA transcripts, in preferred embodiments the antisense oligonucleotides correspond to N-terminal or 5' upstream sites such as translation initiation, transcription initiation or promoter sites. In addition, 3'-untranslated regions may be targeted. The 3'- untranslated regions are known to contain cis acting sequences which act as binding sites for proteins involved in stabilising mRNA molecules. These cis acting sites often form hair-loop structures which function to bind said stabilising proteins. A well known example of this form of stability regulation is shown by histone mRNA's, the abundance of which is controlled, at least partially, post-transcriptionally.

The term "antisense oligonucleotides" is to be construed as materials manufactured either in vitro using conventional oligonucleotide synthesising methods which are well known in the art or oligonucleotides synthesised recombinantly using expression vector constructs.

In a further alternative preferred embodiment of the invention said composition comprises is a micro RNA.

Micro RNAs [micRNA] are small [21 -23nt] single stranded RNAs that are processed from longer precursor RNAs encoded by the genome of an organism and are wholly or partially complementary to mRNAs expressed by the organism and have the function to down regulate expression of genes that encode the mRNAs. Mechanistically micRNAs function in the same way as siRNA and use essentially the same enzymatic machinery. The mature ~22nt sequences are processed from phylogenetically conserved stem loop precursor RNAs of approximately 100nt which are themselves transcribed from larger genes (at least 600-750bp). An example of a micRNA that regulates expression of p63 is micRNA 203 which is known to down regulate p63 in differentiating skin epithelial cells, see Rui et al Nature 452, 225-229, 2008.

In a preferred embodiment of the invention said micRNA is micRNA 203; preferably said micRNA 203 is represented by the nucleic acid sequence in Figure 2 [SEQ ID NO: 54].

In an alternative preferred embodiment of the invention said pharmaceutical composition includes a carrier adapted to deliver said antisense RNA to a cell or tissue.

The delivery of antisense oligonucleotide, siRNA or shRNA is achieved using delivery vehicles known in the art. For example siRNA can be chemically modified and conjugated to a lipophilic cholesterol moiety at the 3' end of the sense strand. Cationic delivery systems can also be employed in the delivery of siRNA. These include cationic lipids and liposomes, cationic polymers, cationic dendrimers and cationic cell penetrating peptides. The cationic delivery vehicles have a common positive charge which facilitates complex formation with negatively charged siRNA. Commercially available examples of liposome based delivery vehicles include Lipofectin, RNAifect, Oligofectamine, Lipofectamine and TransIT TKO have been used in vitro. DOTAP (N [1 -(2, 3- dioleoyloxy)]-N, N, N-trimethyl ammonium propane) and Oligfectamine have been utilised in vivo. Other liposome based delivery vehicle includes solid nucleic acid lipid particles [SNALPs] which are also conjugated with polyethylene glycol. Peptide delivery vehicles have also been successful in delivering siRNA. Pegylated polyethyleneimine [PEI] comprising RGD peptides have been used to target siRNA to angiogenesis factors such as VEGF. Atelocollagen has been used in the delivery of siRNA to tumours in vivo. Delivery of siRNA has also been demonstrated using cyclodextrin polymers. A yet further example of a siRNA delivery vehicle are self assembled LPD nanoparticles which have been used to deliver to solid and metastatic tumours. LPD nanoparticles comprise cationic lipids combined with protamine which interacts with negatively charged siRNA. Pegylated versions of LPD nanoparticles are also known which have improved pharmacokinetics. Reviews of current delivery vehicles can be found in Molecular Pharmaceutics 2008 Vol 6[3] p651 -658; The AAPS Journal 2009 Vol 1 1 [4] p639; Pharmaceutical Research 2009, Vol 26[3] p657; and Nature Reviews 2009 Vol 8, p129.

In a preferred embodiment of the invention said composition includes a further agent that is not an agent that inhibits p63 expression or activity.

In a preferred embodiment of the invention said further agent is a chemotherapeutic agent. A general definition of "chemotherapeutic agent" is an agent that typical is a small chemical compound that kills cells in particular diseased cells, for example cancer cells. The agents can be divided with respect to their structure or mode of action. For example,chemotherapeutic agents include alkylating agents, anti-metabolites, anthracyclines, alkaloids, plant terpenoids and toposisomerase inhibitors. Chemotherapeutic agents typically produce their effects on cell division or DNA synthesis.

In a preferred embodiment of the invention said chemotherapeutic agent is an alkylating agent. Preferably said alkylating agent is selected from the group consisting of: cisplatin, carboplatin or oxaliplatin.

In a preferred embodiment of the invention said chemotherapuetic agent is an anti- metabolic drug.

In a preferred embodiment of the invention said drug is a purine analogue. In an alternative preferred embodiment of the invention said drug is a pyrimidine analogue. Purine analogues are known in the art; for example thioguanine is used to treat acute leukaemia; fludarabine inhibits the function of DNA polymerases, DNA primases and DNA ligases and is specific for cell-cycle S-phase; pentostatin and cladribine are adenosine analogues and are effective against hairy cell leukaemias. A further example is mecrcaptopurine which is an adenine analogue. Pyrimidine analogues are similarly known in the art. For example, 5-fluorouracil (5-FU), floxuridine and cytosine arabinoside. 5-FU has been used for many years in the treatment of breast, colorectal cancer, pancreatic and other cancers. 5-FU can also been formed from the pro-drug capecitabine which is converted to 5-FU in the tumour. In a preferred embodiment of the invention said chemotherapeutic agent is 5- fluorouracil.

In a preferred embodiment of the invention said anti-metabolic drug is administered with leucovorin.

Leucovorin, also known as folinic acid, is administered as an adjuvant in cancer chemotherapy and which enhances the inhibitory effects of 5-FU on thymidylate synthase. In a further preferred embodiment of the invention said chemotherapeutic agent is an alkaloid; preferably said alkaloid is a vinca alkaloid, for example vincristine or vinblastine.

In a yet further preferred embodiment of the invention said chemotherapeutic agent is a terpenoid; preferably a taxane e.g. palitaxel.

The compositions of the invention are administered in effective amounts. An "effective amount" is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a particular disease, such as cancer, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods.

Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons. The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of a preparation according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining regression of a tumour, decrease of disease symptoms, modulation of apoptosis, etc.

The doses of the preparation according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.

Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration (e.g., intra-tumour) and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g. for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.

When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.

Compositions may be combined, if desired, with a pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term "carrier" in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.

The pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.

The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.

Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrup, elixir or an emulsion or as a gel. Compositions may be administered as aerosols and inhaled.

Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1 , 3-butane diol. Among the acceptable solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

According to a further aspect of the invention there is provided a method to treat prostate cancer comprising administering an effective amount of a composition according to the invention.

In a preferred method of the invention prostate cancer is secondary prostate cancer of the bone or lymph node. According to a further aspect of the invention there is provided a composition according to the invention for use in the treatment of prostate cancer. In a preferred embodiment of the invention prostate cancer is secondary prostate cancer of the bone or lymph node. According to a further aspect of the invention there is provided the use of a polypeptide encoded by a nucleic acid molecule comprising a nucleotide sequence as represented in Figure 1 for the identification of agents that modulate the activity of said polypeptide.

According to an aspect of the invention there is provided a screening method for the identification of an agent that inhibits the activity of a cancer cell gene expression product comprising:

i) providing a polypeptide encoded by a nucleic acid molecule comprising a nucleotide sequence as represented in Figure 1 ;

ii) providing at least one candidate agent to be tested;

iii) forming a preparation that is a combination of (i) and (ii) above; and iv) testing the effect of said agent on the activity of said polypeptide.

The polypeptide according to the invention may be expressed by a cancer stem cell or cell-line, for example a prostate cancer stem cell or cell-line and also including primary cells isolated from patients suffering from or suspected of suffering from cancer, for example prostate cancer.

According to a further aspect of the invention there is provided a modelling method to determine the association of an agent with a cancer cell gene expression product comprising:

i) providing computational means to perform a fitting operation between an agent and a polypeptide encoded by the nucleotide sequence in Figure 1 ; and

ii) analysing the results of said fitting operation to quantify the association between the agent and the polypeptide.

The rational design of binding entities for proteins is known in the art and there are a large number of computer programs that can be utilised in the modelling of 3- dimensional protein structures to determine the binding of chemical entities to functional regions of proteins and also to determine the effects of mutation on protein structure. This may be applied to binding entities and also to the binding sites for such entities. The computational design of proteins and/or protein ligands demands various computational analyses which are necessary to determine whether a molecule is sufficiently similar to the target protein or polypeptide. Such analyses may be carried out in current software applications, such as the Molecular Similarity application of QUANTA (Molecular Simulations Inc., Waltham, Mass.) version 3.3, and as described in the accompanying User's Guide, Volume 3 pages. 134-135. The Molecular Similarity application permits comparisons between different structures, different conformations of the same structure, and different parts of the same structure. Each structure is identified by a name. One structure is identified as the target (i.e., the fixed structure); all remaining structures are working structures (i.e. moving structures). When a rigid fitting method is used, the working structure is translated and rotated to obtain an optimum fit with the target structure.

The person skilled in the art may use one of several methods to screen chemical entities or fragments for their ability to associate with a target. The screening process may begin by visual inspection of the target on the computer screen, generated from a machine-readable storage medium. Selected fragments or chemical entities may then be positioned in a variety of orientations, or docked, within the binding pocket.

Useful programs to aid the person skilled in the art in connecting the individual chemical entities or fragments include: CAVEAT (P. A. Bartlett et al, "CAVEAT: A Program to Facilitate the Structure- Derived Design of Biologically Active Molecules". In Molecular Recognition in Chemical and Biological Problems", Special Pub., Royal Chem. Soc, 78, pp. 182-196 (1989)). CAVEAT is available from the University of California, Berkeley, California. 3D Database systems such as MACCS-3D (MDL Information Systems, San Leandro, California). This is reviewed in Y. C. Martin, "3D Database Searching in Drug Design", J. Med. Chem., 35, pp. 2145-2154 (1992); and HOOK (available from Molecular Simulations, Burlington, Mass.).

Once the agent has been optimally selected or designed, as described above, substitutions may then be made in some of its atoms or side groups in order to improve or modify its binding properties. Generally, initial substitutions are conservative, i.e., the replacement group will have approximately the same size, shape, hydrophobicity and charge as the original group. The computational analysis and design of molecules, as well as software and computer systems are described in US Patent No 5,978,740 which is included herein by reference. Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", means "including but not limited to", and is not intended to (and does not) exclude other moieties, additives, components, integers or steps.

Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

An embodiment of the invention will now be described by example only and with reference to the following figures: Figure 1 is the sense nucleotide sequence of human p63;

Figure 2 is the nucleotide sequence of human micro RNA 203 A unprocessed and B processed; Figure 3: Differential expression of p63 by microarray. Normalised expression values, in arbitrary units, are shown for; i) a231 high/CD133+ stem cells from cancer samples (blue), ii) a23"l high/CD133+ stem cells from BPH samples (red), iii) a23"l low/CD133- committed basal cells from cancer samples (green) and iv) a231 low/CD133- committed basal cells from BPH samples (purple);

Figure 4: p63 mRNA expression in prostate cell lines. mRNA expression level was determined by qRT-PCR in PNT2, P4E6 and PC3 prostate cell lines. Graph shows comparison between cell lines expressed relative to PNT2. All values are the mean ± standard error of three independent experiments; Figure 5: p63 protein expression in prostate cell lines. Flow cytometry analysis of PNT2

(A) , P4E6 (B) and PC3 (C) prostate cancer cells stained with antibodies against p63. Figure shows a representative image for each cell type; Figure 6: Cellular localisation of p63 in prostate epithelial cell lines. Subcellular localisation of the p63 protein was determined by immunofluorescence in a range of prostate epithelial cell lines. P63 expression is shown in green, cells were also counterstained with DAPI (blue); Figure 7: p63 mRNA expression in primary prostate epithelial cells. mRNA expression level was determined by qRT-PCR in a2pi low, a231 hi/CD133- and a231 h/CD133+ populations of primary prostate epithelial cells . Graph shows expression in cancer samples relative to BPH samples. All values are the mean ± standard error of three independent experiments on three different patient samples;

Figure 8: p63 protein expression in primary prostate epithelia. Flow cytometry analysis of benign prostate epithelia (A) and prostate cancer (B) cells stained with antibodies against p63. Figure shows a representative image for each cell type; Figure 9: Expression and localisation of p63 in selected populations of primary prostate epithelia. Isolated populations of committed basal cells (a231 low/CD133-), progenitor cells (a231 high/CD133-) and stem cells (a231 high/CD133+) from benign (A) and cancer

(B) samples were stained using an antibody against p63 (green) and counter stained with DAPI (blue). Secondary only shows staining in the absence of primary antibody as a negative control;

Figure 10: Effects on p63 mRNA levels after transfection of primary prostate samples using Oligofectamine and p63 si-RNA. Figure shows effects of p63 si-RNA on mRNA levels in benign prostate epithelia (A) and prostate cancer (B). Cell images show phenotypic changes to the cells 72 hours post transfection and graphs illustrate the level of knockdown achieved;

Figure 1 1 : Effects on p63 protein levels after transfection of benign prostate and prostate cancer samples using Oligofectamine and p63 si-RNA. The blot images (A) illustrate levels of p63 (top) and loading controls (bottom). Graphs in B and C show levels of p63 normalised to loading control and expressed relative to negative transfected cells for benign prostate epithelia and prostate cancer respectively; Figure 12: Cell Proliferation in response to p63 si-RNA. Cell proliferation was measured by WST assay in primary prostate epithelial cultures transfected for 72h with nonspecific si-RNA (Negative) or p63 specific si-RNA. Proliferation is expressed relative to non-specific si-RNA for each patient derived culture. All values are mean ± standard deviation of triplicate measurements;

Figure 13: Schematic illustration of the different populations identified in cell death assays. The assay recognises four distinct but continuous populations: annexinV- /DAPI- (viable), annexinV+/DAPI- (early apoptotic), annexinV+/DAPI+ (late apoptotic) and annexinV-/DAPI+ (necrotic);

Figure 14: Effect on cell death in response to p63 si-RNA. Apoptosis was measured by annexin V expression (FITC) and necrosis was measured by uptake of DAPI (violet) 72h post transfection with non-specific negative si-RNA or p63 specific si-RNA. Results from representative benign prostate (A) and prostate cancer (B) experiments are shown. The plots illustrate results for negative si-RNA treated progenitor cells (i), p63 si-RNA treated progenitor cells (ii), negative si-RNA treated stem cells (iii) and p63 si-RNA treated stem cells (iv);

Figure 15: Differentiation of cells in response to p63 si-RNA. Differentiation was measured by changes in PAP expression and morphological changes were observed in primary prostate epithelial cultures transfected for 72h with non-specific si-RNA (Negative) or p63 specific si-RNA. The graphs show percentage PAP positive cells in benign prostate (A) and prostate cancer (B) and percentage CD133+ cells in benign prostate (C) and prostate cancer (D). Representative images of benign prostate cells treated with Negative (E) and p63 specific (F) si-RNAs and prostate cancer cells treated with Negative (G) and p63 specific (H) si-RNA are shown.

Figure 16: Effect of p63 si-RNA on colony forming efficiency Colony forming efficiency was measured in primary benign prostate epithelial cultures (A) and primary prostate cancer cells (B) transfected for 72h with non-specific si-RNA (Negative) or p63 specific si-RNA. The graphs show percentage colony forming efficiency in stem cells (i) and progenitor cells (ii). Representative images (iii) of untreated cells and cells treated with negative and p63 specific si-RNAs are also shown. Figure 17 A and Figure 17B: Effect of p63 on in vivo tumour formation and survival rates Tumour volume was measured using digital calipers every two days (A) and tumour incidence (B) and survival proportions (C) were calculated. Graphs show the mean tumour volume ± SEM. (n=10 mice per group).

Figure 18 Expression of p63 isoforms in cell lines. RT-PCR was carried out to determine which isoforms of p63 were present in cell lines with human reference samples included as controls. Gel images (A) show where bands were observed and the table (B) summarises the results with - representing a negative result, + representing positive expression and +/- representing weak expression.

Figure 19 Expression of p63 isoforms in primary samples. RT-PCR was carried out to determine which isoforms of p63 were present in primary BPH and prostate cancer samples. Gel images (A) show where bands were observed and the table (B) summarises the results with - representing a negative result, + representing positive expression and +/- representing weak expression

Materials and Methods

Cell Culture

Prostate cell lines were maintained under standard culture conditions in a humidified incubator at 37^<C in 5%C0₂. PNT2 cells were maintained in RPMI 1640 media with the addition of 10% foetal calf serum (FCS; PAA Laboratories Ltd. Yeovil, UK) and 1 % L- Glutamine (Invitrogen, Paisley, UK). PC3 cells were maintained in HAMS F12 supplemented with 7% foetal calf serum and 1 % L-Glutamine and P4E6 cells were grown in keratinocyte serum free medium with bovine pituitary extract, epidermal growth factor (EGF), 2% FCS and 1 % L-Glutamine. Primary stem cell derived cultures were maintained in complete keratinocyte growth medium [keratinocyte serum-free medium with epidermal growth factor (EGF) and bovine pituitary extract; Invitrogen, Paisley, Scotland]. The medium was also supplemented with 2 ng/mL of leukaemia inhibitory factor (LIF; Sigma, Poole, United Kingdom), 2 ng/mL of stem cell factor (Sigma), and 100 ng/mL of cholera toxin (Sigma). Microarray gene expression profiling

Expression profiling studies have been described previously (Birnie et al, 2008). Briefly, RNA was extracted from selected populations of a231 high/CD133+ and a231 low/CD133- primary prostate epithelial cells from malignant and non-malignant cultures. Gene expression profiling was carried out using Affymetrix HGU133plus2 microarrays. RNA samples were labelled, hybridised to the array and scanned according to the manufacturer's standard protocols. The gene expression profiles of a231 high/CD133+ and a231 low/CD133+ prostate cancer cells were compared with profiles from a23"l high/CD133+ and a23"l low/CD133- prostate epithelial cells to identify differentially expressed genes. qRT-PCR

Reverse transcription was carried out on 50ng of fractionated cell RNA to generate cDNA. Real Time PCR was carried out using the Taqman gene expression system (Applied Biosystems, Warrington, UK) according to the manufacturer's protocol with the exception that a reduced total reaction volume of 10μΙ was used. All reactions were carried out in triplicate in 96-well PCR plates on an ABI Prism 7300 sequence detection system (Applied Biosystems). Standard thermal cycling conditions included a hot start of 2 minutes at 50 °C, 10 minutes at 95 ^<C, followed by 40 cycles of: 95 ^<C 15 s, 60 °C for 1 minute. Data analysis was carried out using ABI SDS software and Microsoft Excel. GAPDH and RPLPO were used as endogenous control genes and all expression values normalised to the mean of these two genes. For basic expression measurement values were expressed as the ratio of test gene Ct values:mean control Ct value, results are the mean of three independent experiments. For the measurement of RNA knockdown by si- RNA differential RNA expression in response to si-RNA was calculated by the AACt method.

Immunofluorescence

Cells were seeded onto multiwell glass slides and incubated at 37^<C prior to fixation. Cell lines were incubated for 72 hours, primary cells were incubated for 1 -2 hours for a231 high/CD133+ cells or 18-24 hours in the case of a231 high/CD133- and a231 low/CD133- cells. For staining primary cells slides were pre-coated with 5μg/cm2 Collagen-I prior to seeding cells to slides. Following incubation cells were fixed in 10% PFA, permeabilised in 70% ethanol and blocked with 20% normal goat serum (NGS) for 1 hour at room temperature. Cells were stained with polyclonal anti-p63 (clone 4A4, M7247, Dako, Cambridge, UK) at 1 :25 in 20% NGS overnight at 4°C. Subsequently, cells were washed in TBS and labelled with anti-mouse-Alexa488 (invitrogen, Paisley, UK) for ^"I hour at room temperature. Finally, cells were counterstained with DAPI and mounted in DAKO fluorescence mounting medium (Dako UK Ltd, Cambridgeshire, UK).

Fluorescence Activated Cell Sorting (FACS)

p63 protein expression was measured in prostate epithelial cells by staining with an antibody against p63 and analysing by flow cytometry. In primary epithelial cultures p63 expression was measured simultaneously in CD133+ stem cells and CD133- progenitor cells by co-staining with anti-p63 and an antibody against CD133. Cells were trypsinised and washed in MACS buffer (2mM EDTA, 0.5% FCS, PBS) then incubated with CD133- APC antibody (clone 293C3, Miltenyi Biotec, Bergisch, Gladbach, Germany) for 10 minutes with agitation in the fridge. Cells were rinsed with MACS buffer then incubated with goat polyclonal anti-p63 (AF1916, R&D Systems, Oxford, UK) in 0.5% Saponin for 1 hour. Following incubation, cells were washed and secondary antibody (anti-goat- Alexa488, Invitrogen, Paisley, UK) applied for 20 minutes. Finally, cells were rinsed in MACS buffer then resuspended in PBS. Samples were analysed on a DakoCytomation CyAn ADP instrument (Dako UK Ltd, Cambridgeshire, UK). FACS results were analysed with Summit Software, v4.3 (Dako UK Ltd, Cambridgeshire, UK). Gates were set to remove debris and doublets based on forward/side scatter and pulse width, respectively.

Western blot

Protein knockdown after treatment with si-RNA was measured using western blot using the Novex NuPAGE and western blot system (Invitrogen, Paisley, UK). Briefly, lysates were diluted to set volume in dH20, LDS sample buffer (4x) added to a final concentration of 1 x, reducing agent (10x) added to a final concentration of 1 x and samples boiled for 10 minutes @ 70°C before Microfuging briefly, loading onto on to the gel and running, using MOPS buffer, at 200V for 50 minutes or until the bands reached the foot of the gel. Gels were blotted onto PVDF membrane in transfer buffer containing 12mM Tris, 96mM Glycine, 20% Methanol and dH20 to 1 L @ 25v for 3 hours on ice. Membranes were labelled using a WesternDot kit (Invitrogen, Paisley, UK) following manufacturer's instructions.

Transfectlon of prostate epithelial cells with sl-RNA

We initially surveyed a number of transfection reagents to identify those which gave the highest transfection efficiency in a range of cell lines and primary cells. We found Nanofectin (PAA Laboratories Ltd. Yeovil, UK) to be most effective in PNT2 and PC3 cells, whereas Oligofectamine (Invitrogen, Paisley, UK) was more effective in P4E6 cells and primary cultures. In each case cells were seeded and transfected according to the manufacturer's protocols then incubated for 72 hours before being assayed for RNA knockdown by qRT-PCR, cell proliferation by WST, apoptosis, differentiation or clonogenicity. Cell Proliferation

After treatment with si-RNA for 72 hours cell proliferation was measured using a WST assay. Briefly, cells were treated for 72 hours with si-RNA in triplicate in standard tissue culture media. The media was removed and replaced with a 1 :10 dilution of WST-1 reagent in tissue culture media according to the manufacturer's instructions (Roche, Burgess Hill, UK). Cells were subsequently incubated for four hours at 37^<C then the absorbance read at 450nM on a Fluostar Optima plate reader (BMG Labtech). Results are expressed as relative absorbance with respect to cells transfected with non-specific si-RNA after background substraction.

Apoptosis

After treatment with si-RNA for 72 hours cells were imaged then cell death was investigated using an apoptosis assay. Cells were washed in MACS buffer (2mM EDTA, 0.5% FCS, PBS) then incubated with CD133-APC antibody for 10 minutes with agitation in the fridge (clone 293C3, Miltenyi Biotec, Bergisch Gladbach, Germany). The cells were then rinsed with MACS buffer and incubated with Annexin-V-FITC (Roche, Hertfordshire, UK) for 15 minutes at room temperature. Finally, cells were washed and resuspended in Annexin-V incubation buffer (10mM HEPES/NaOH pH 7.4, 140mM NaCI, 5mM CaCI2) containing DAPI at 1 :10000 concentration for 10 minutes prior to analysis by flow cytometry. Data was collected using a DakoCytomation CyAn ADP instrument (Dako UK Ltd, Cambridgeshire, UK). FACS results were analysed with Summit Software, v4.3 (Dako UK Ltd, Cambridgeshire, UK).

Differentiation

After 72 hours treatment with si-RNA cells were imaged and the effects on cellular morphology were measured using a differentiation assay. Briefly, cells were trypsinised, pelleted, washed in buffer containing 1 ml FCS, 4ml EDTA 100mM pH 8.0 and 195ml 1 x PBS and pelleted again. Cell were incubated in CD133 antibody (clone 293C3, Miltenyi Biotec) for 10 minutes with agitation in the fridge then washed again before incubation with PAP antibody (ab9381 , Abeam) in 0.5% saponin for 1 hour in the fridge. Following incubation, cells were washed and incubated in secondary antibody (anti- rabbit alexa488, invitrogen, Paisley, UK) for 20 minutes in the fridge. After a final wash cells were resuspended in PBS and data acquired as for the apoptosis assay. Gates were set to remove debris and doublets based on forward/side scatter and pulse width, respectively. This assay measures two independent parameters simultaneously. The first is the percentage of CD133+ stem cells in the population. This measures whether a test compound causes a change in the proportion of stem cells in the population. The second parameter is the percentage of PAP+ cells in the population to determine whether a test compound causes a shift from a primitive early basal phenotype to a late basal/early luminal phenotype. These results are presented relative to vehicle control for each test compound, i.e. the ratio of the percentage

Colony forming assay

After treatment with si-RNA for 72 hours, cells with high expression of α2β1 integrin were selected by rapid adhesion to collagen- 1. A magnetic cell sorting protocol was then used to separate a231 -high/CD133- progenitor cells from a231 -high/CD133+ stem cells according to the manufacturer's instructions (CD133 Microbead Kit, Miltenyi Biotec). Cells were then plated at 100-500 cells/well (depending on recovery from the selection) on collagen-l coated 6-well plates in the presence of inactivated feeder cells. Medium was changed every 2-3 days, with feeders added as needed. Colony formation was monitored throughout and the endpoint was determined based on the observed proliferation of the vehicle treated control cells for up to 14 days in the case of CD133- cells. CD133+ cells were monitored for up to 21 days due to the lag time associated with stem cells before colony initiation. Colony forming efficiency was calculated as the number of colonies >32 cells divided by the number of cells initially plated x 100.

In vivo Effect of p63 Knockdown

PC3 cells were plated at 4x10⁶ per 150cm³ tissue culture flasks and left overnight to adhere. Cells were treated with either p63 siRNA, a scrambled control siRNA, or were untransfected and left for 72 hours. Cells were trypsinised and washed, then re- suspended in media and counted. Cells were centrifuged and re-suspended at 1 x10^s cells per 100μΙ matrigel (BD Matrigel™ Basement Membrane Matrix). Cells were administered subcutaneously into the rear flank of BALB/c Nude under anaesthetic, with ten mice per treatment group. Formation of a bulla indicated satisfactory injection. Thereafter, tumours were measured every two days in terms of length (L), width (W), and height (H) and their volumes calculated according to the formula LxWxHxO.5236. Animals were culled when the tumour reached a size of no more than 1 .5cm, or if the animal showed any signs of distress. Isoform Analysis of p63

Reverse transcription was carried out on 500ng of fractionated cell RNA to generate cDNA. Non quantitative PCR was carried out using Go Taq enzyme (Applied Biosystems, Warrington, UK). Thermal cycling conditions included a hot start at 94°C for 30s followed by isoform specific PCR conditions for each primer set. TAp63 (forward primer GTCCCAGAGCACACAGACAA, reverse primer GAGGAGCCGTTCTGAATCTG) and ΔΝρ63 (forward primer CTGGAAAACAATGCCCAGAC, reverse primer GGGTGATGGAGAGAGAGCAT): 40 cycles at 94 °C for 30s, 57 °C for 40s, and 72 ^<C for 30s. p63a (forward primer GAGGTTGGGCTGTTCATCAT, reverse primer AGGAGATGAGAAGGGGAGGA) and ρ63β (forward primer

AACGCCCTCACTCCTACAAC, reverse primer CAG ACTTGCCAG ATCCTG A) : 2 cycles at 94 ^<C for 30s, 57°C for 40s, and 72°C for 30s, followed by 38 cycles at 94 °C for 30s, 55 ^<C for 40s, and 72 ^<C for 30s. ρ63γ (forward primer ACG AAG ATCCCCAG ATG ATG , reverse primer GCTCCACAAGCTCATTCCTG): 2 cycles at 94 °C for 30s, 57 ^<C for 40s, and 72^<C for 30s; 2 cycles at 94^<C for 30s, 55°C for 40s, and 72 ^<C for 30s and 36 cycles of 94 °C for 30s, 53°C for 40s, and 72°C for 30s. GAPDH was chosen as an endogenous expression RT-PCR standard and was amplified using the conditions described for TAp63 and ΔΝρ63. 5μΙ of each RT-PCR product was analysed on a 1 .5% agarose gel.

Example 1

The generation of a cancer stem cell gene expression signature using whole genome microarray analysis has been reported previously (Birnie et al 2008). The normalised expression data from these experiments was used to assess levels of p63 expression in a231 low/CD133- committed basal cells and a231 high/CD133+ stem cells from both benign prostate epithelia and prostate cancer samples. (Figure 3).

These data show that p63 is expressed at relatively high levels in stem cells and committed basal cells from both benign and malignant samples. The initial microarray analysis was carried out on cells that had been briefly cultured in conditions that favour the growth of basal cells. The observation that high levels of p63 expression are retained in two populations of cells with malignant origin is consistent with the existence of a minor population of p63+ basal cells in prostate cancer This suggests that targeting p63 may be a method of hitting the stem cells which are the driving force of tumour formation, recurrence and metastasis. Example 2

Expression of p63 mRNA in cell lines representing benign prostate epithelium (PNT2), early stage prostate cancer (P4E6) and advanced metastatic prostate cancer (PC3) was investigated. Analysis of p63 expression by qRT-PCR showed that mRNA levels were similar in PNT2 and PC3 and slightly higher in P4E6 (Figure 4).

Expression of p63 protein was initially characterised in cell lines by flow cytometry and cellular localisation was investigated by immunofluorescence. p63 was detected in -98% of cells in PNT2, -92% in P4E6 and -94% in PC3 cells by flow cytometry. Median fluorescence intensity values showed that the level of p63 expression was similar in PNT2 and PC3 cells but that expression in P4E6 cells was higher than in the other two cell lines (Figure 5). This was consistent with the mRNA expression observed by qRT- PCR and with the fluorescence intensity observed in each cell line by immunofluorescence (Figure 6). In PNT2 and PC3 cells p63 was localised in the cytoplasm with some punctate spots in the nucleus, however the protein was localised in the nucleus in P4E6 cells (Figure 6).

Example 3

Analysis of primary cultures of prostate epithelial cells gave similar results to those observed in cell lines for both RNA and protein expression. qRT-PCR experiments were carried out to investigate expression of p63 mRNA in a231 low/CD133- committed basal, a231 high/CD133- progenitor and a231 high/CD133+ stem cell populations of benign prostate epithelia and prostate cancer samples (Figure 7). The results showed that there was no significant difference between benign prostate epithelia and prostate cancer in any of the three populations which is consistent with the expression results derived from microarray analysis.

Example 4

The p63 protein was detected in 90% of benign cells and 86% of malignant epithelial cells by flow cytometry (Figure 8). Median fluorescence intensity showed that benign prostate epithelial cells had much more intense staining than prostate cancer cells. These results differ from the RNA result in which there is no significant difference between expression levels in benign prostate cells and those in prostate cancer. In the a231 low/CD133- committed basal and a231 high/CD133- progenitor cell populations of benign samples immunofluorescence staining was observed in both the nucleus and the cytoplasm, however p63 was localised almost exclusively to the nucleus in a231 high/CD133+ stem cells. In the cancer samples staining was restricted to the nucleus in both a231 high/CD133- progenitor cells and a231 high/CD133+ stem cells (Figure 9). Cytoplasmic staining represents inactive protein and nuclear staining represents active protein so this data suggests that the p63 protein is more active in the a231 high populations. Example 5

Having shown that p63 mRNA is expressed in both benign prostate epithelia and prostate cancer samples it was necessary to inhibit the expression in order to investigate the effects of p63 on cell fate. p63 mRNA expression was reduced by 40-50% in benign prostate epithelia and by 60-70% in prostate cancer. Representative examples show 45% and 62% inhibition respectively (Figure 10) following transfection with a p63 specific si-RNA. Figure 10 also illustrates a visible effect on the phenotype of both benign and cancer cells that was observed after treatment with p63 si-RNA. Cells were larger and more elongated and formed looser colonies. These effects were reproducible in multiple patient samples.

Example 6

The effect of p63 specific si-RNA on expression of p63 at the protein level was also investigated in benign prostate epithelia and prostate cancer. Cells were transfected with the si-RNA, lysed at 72 hours post transfection and run on a western blot (Figure 1 1 A). Results showed that p63 protein expression was reduced by -40% in benign prostate epithelia (Figure 1 1 B) and by -50% in prostate cancer samples (Figure 1 1 C).

Example 7 WST assays were carried out to investigate the effects of p63 on cell proliferation. Primary prostate epithelial cells were transfected with non-specific si-RNA or si-RNA specific for p63 and assayed 72 hours after transfection. The assay is based on the metabolism of WST-1 by viable cells, which induces a colour change, the intensity of which directly correlates with viable cell number. Inhibition of p63 mRNA expression had no significant effects on proliferation in either benign prostate epithelial cells or primary prostate cancer cells (Figure 12). These results suggest that the morphological changes observed by microscopy after si-RNA transfection are caused by other processes such as apoptosis or differentiation. Example 8

FACS based apoptosis assays were carried out to investigate the effects of treatment with p63 si-RNA on cell death. Primary prostate epithelial cells were transfected with non-specific si-RNA or si-RNA specific for p63 and assayed 72 hours after transfection. AnnexinV binding was used as a marker for the early stages of apoptosis. DAPI uptake was used as an indicator of compromised integrity of the surface membrane which is a feature of several mechanisms of cell death. The combination of these markers allow the identification of four distinct but continuous populations by FACS as illustrated in figure 13. Si-RNA treatment did not affect overall viability in benign prostate samples. However, the committed basal population did show an increase in the percentaqe of necrotic cells (annexinV-/DAPI+) and a corresponding decrease in late apoptotic cells (annexinV+/DAPI+) relative to cells treated with a non-specific si-RNA (Figure 14A). In prostate cancer samples the effect of p63 si-RNA differed between patients. Stem cell viability was increased slightly in two of three samples but decreased in the third, there was no effect on the number of viable committed cells. Necrosis was increased in both committed and stem cell populations in prostate cancer samples (Figure 14B).

Example 9 FACS based differentiation assays were carried out to investigate the effects of treatment with p63 si-RNA on epithelial cell differentiation. This assay determines whether inhibition of p63 by si-RNA induces differentiation of the cells, eliminating self renewal potential and making the cells susceptible to conventional chemotherapy and/or androgen-deprivation therapy. Expression of prostatic acid phosphatase (PAP) is a marker for late basal/early luminal differentiation. This marker can be used in combination with the stem cell marker CD133 to identify distinct epithelial populations. The percentage of CD133-/PAP+ cells increased by an average of 2.53 fold, from 1 .87% to 4.73% in the three benign prostate samples (Figure 15, A; p = 0.3029) and by an average of 2.88 fold, from 2.33% to 6.72% in the four prostate cancer samples (Figure 15B; p = 0.0861 ), indicative of an increase in the late basal/early luminal population. The differences in PAP expression were not statistically significant (p > 0.05) between negative and p63 si-RNA treated cells but visual assessment indicates that p63 si-RNA has some phenotypic effect as there was an obvious difference in morphology of cells treated with p63 si-RNA compared to those treated with non-specific si-RNA (Figure 15, E-H). In addition, there was also an increase in the percentage of stem cells: an average of 1 .67 fold in the benign prostate samples (not significant; p = 0.0572) and a significant increase of 1 .63 fold in the prostate cancer samples (p = 0.0154).

Example 10 Clonogenic recovery assays were carried out to determine the ability of cancer stem cells treated with p63 si-RNA to subsequently form colonies. a231 high/CD133- progenitor and a231 high/CD133+ stem cell populations were assayed separately with results given as percent colony forming efficiency calculated as follows: (no. of colonies > 32 / no. of cells plated) x 100. This is illustrated in Figure 16A and 16B. Example 11

The effect of p63 inhibition on the ability to form tumours in vivo was determined by siRNA pre-treatment of PC3 cells, which were then injected into BALB/c Nude mice. Tumour growth was monitored every two days (Figure 17A, 17B). It was shown that mice given untransfected PC3 cells formed large tumours rapidly as expected, with 100% of mice in the group forming tumours. All mice in this group had to be culled by day 30 post initiation, having reached maximum tumour size allowed. Mice injected with PC3 cells treated with scrambled control siRNA formed tumours in 100% of the mice. These tumours were smaller and took longer to form than the untransfected group, suggesting that siRNA treatment may be affecting tumour growth. All mice in this group were culled by day 42 post initiation. In contrast, pre-treatment of PC3 cells with p63 siRNA caused a significant decrease in the size and formation of tumours, with only 20% of mice forming small tumours. p63 siRNA pre-treatment of PC3 cells caused a significant increase in survival proportion compared to both untransfected and scrambled siRNA pre-treated cells, as shown by Kaplan-Meier survival curves. Median survival for untransfected, scrambled siRNA and p63 were 28 days, 39 days and undefined respectively.

Example 12

PNT2 cells do not express any of the p63 isoforms tested. P4E6 cells express all isoforms tested and PC3 cells express mainly ΔΝρ63 and p63a isoforms with weak bands for Tap63 and ρ63β; Figure 18. All primary samples express ΔΝ, a and β isoforms of p63 with occasional weaker expression of TA and γ isoforms in some samples. There is no difference in the expression of the different isoforms between BPH and prostate cancer; Figure 19. Table 1

Sense Strand Sequence Start Pos GC % Score

ID

1 CCACTGAACTGAAGAAACT 443 42 87

2 ATGAAATGCTGTTGAAGAT 1091 32 86

3 GTGAATTCAACGAGGGACA 611 47 85

4 CGACAGTCTTGTACAATTT 758 37 85

5 CTGCCAAATTGCAAAGACA 465 42 82

6 GGAAACCAGAGATGGGCAA 840 53 82

7 ACACAGACCACGCGCAGAA 263 58 81

8 TCAAAGAGTCCCTGGAACT 1109 47 80

9 ATGAAGATAGCATCAGAAA 923 32 79

10 CAGATGATGAACTGTTATA 1046 32 79

1 1 GCATGGACCAGCAGATTCA 215 53 78

12 TCACGACAGTCTTGTACAA 755 42 78

13 CGTCAGAACACACATGGTA 994 47 78

14 CTTATGAAATGCTGTTGAA 1088 32 78

15 CCTCAGCACACAATTGAAA 1141 42 78

16 CGTACAGGCAACAGCAACA 1 160 53 78

17 GGGATGAACCGCCGTCCAA 802 63 77

18 GAAGATAGCATCAGAAAGC 925 42 77

19 CCCTGGAACTCATGCAGTA 1118 53 77

20 CATCACAGGAAGACAGAGT 696 47 76

21 CCGTGAGACTTATGAAATG 1080 42 76

22 TATGAAATGCTGTTGAAGA 1090 32 76

23 GAAATGCTGTTGAAGATCA 1093 37 76

24 GATCAAAGAGTCCCTGGAA 1107 47 76

25 GCACACAATTGAAACGTAC 1146 42 76

26 GAAGAAACTCTACTGCCAA 453 42 75

27 AATCATTGTTACTCTGGAA 825 32 75

28 GGCCGTGAGACTTATGAAA 1078 47 75

29 AGCACTTACTTCAGAAACA 1 190 37 75

30 ACGACAGTCTTGTACAATT 757 37 74

31 GCCCAGGAAGAGACAGGAA 899 58 74

32 GAAGATCCCATCACAGGAA 688 47 73

33 CAAAGAACGGTGATGGTAC 962 47 73

34 CAATTGAAACGTACAGGCA 1 151 42 73

35 ATTGAAACGTACAGGCAAC 1 153 42 73

36 ATTCAACGAGGGACAGATT 615 42 72

37 TCACAGGAAGACAGAGTGT 698 47 72

38 GCATCAGAAAGCAGCAAGT 932 47 72

39 AATTGAAACGTACAGGCAA 1 152 37 72

40 GATGAACCGCCGTCCAATT 804 53 71

41 CAGCAAGTTTCGGACAGTA 943 47 71

42 ACAAAGAACGGTGATGGTA 961 42 71

43 GAACGGTGATGGTACGAAG 966 53 71

44 ACACATGGTATCCAGATGA 1003 42 71

45 CATGGTATCCAGATGACAT 1006 42 71

46 CTGTTATACTTACCAGTGA 1057 37 71

47 GCCGTGAGACTTATGAAAT 1079 42 71

48 CAAGTTTCGGACAGTACAA 946 42 70

49 GTTTCGGACAGTACAAAGA 949 42 70

50 GTCAGAACACACATGGTAT 995 42 70

INCORPORATED BY REFERENCE (RULE 20.6) Table 2

INCORPORATED BY REFERENCE (RULE 20.6)

Claims

Claims

1 A pharmaceutical composition comprising an agent comprising an inhibitor of p63 expression or activity.

2. A composition according to claim 1 wherein p63 is an a isoform.

3. A composition according to claim 2 wherein p63 a isoform is TAp63a.

4. A composition according to claim 2 wherein said a isoform is ΔΝρ63α.

5. A composition according to any of claims 1 -4 wherein said agent comprises an antisense RNA or an antisense oligonucleotide.

6. A composition according to claim 5 wherein said agent is a small interfering RNA [siRNA].

7. A composition according to claim 5 or 6 wherein said siRNA molecule or antisense oligonucleotide is at least 18 base pairs in length.

8. A composition according to claim 7 wherein said siRNA molecule or antisense oligonucleotide is between 18bp and 29bp in length.

9. A composition according to any of claims 5-8 wherein said siRNA or antisense oligonucleotide is designed with reference to the sense nucleotide sequence as represented in Figure 1 .

10. A composition according to any of claims 9 wherein said siRNA or antisense oligounucleotide comprises or consists of a sense nucleotide sequence selected from the group as represented in Table 1 as SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50, or combinations of said siRNA molecule or antisense oligonucleotide.

1 1 A composition according to claim 9 wherein said siRNA is represented by the nucleic acid sequences selected from the group consisting of:

Sense: GGUUGGCACUGAAUUCACGtt;

Antisense: CGUGAAUUCAGUGCCAACCtg.

12. A composition according to any of claims 2-8 wherein said antisense oligonucleotide or antisense RNA is designed with reference to the sense nucleotide sequence:TTTCTTAGCGAGGTTGGGCTGTTCATCATGTCTGGACTATTTCACGACCC AGGGGCTGACCACCATCTATCAGATTGAGCATTACTCCATGGAT [SEQ ID NO: 55].

13. A composition according to claim 12 wherein said siRNA comprises or consists of a sense nucleotide sequence selected from the group as represented in Table 2 as SEQ ID NO: 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 80, 81 or 82, or combinations of said siRNA molecules.

14. A composition according to any of claims 2-7 wherein said siRNA or antisense oligonucleotide includes modified nucleotides.

15. A composition according to claim 1 wherein said composition comprises is a micro RNA.

16. A composition according to claim 15 wherein said micRNA is micRNA 203.

17. A composition according to claim 16 wherein said micRNA 203 is represented by the nucleotide sequence in Figure 2.

18. A composition according to any of claims 1 -18 wherein said pharmaceutical composition includes a carrier adapted to deliver said antisense RNA to a cell or tissue.

19. A composition according to any of claims 1 -18 wherein said composition includes a further agent that is not an agent that inhibits p63 expression or activity.

20. A composition according to claim 19 wherein said further agent is a chemotherapeutic agent.

21 . A composition according to claim 20 wherein said chemotherapeutic agent is an alkylating agent.

22. A composition according to claim 21 wherein said alkylating agent is selected from the group consisting of: cisplatin, carboplatin or oxaliplatin.

23. A composition according to claim 22 wherein said chemotherapeutic agent is an anti-metabolic drug.

24. A composition according to claim 23 wherein said drug is a purine analogue.

25. A composition according to claim 23 wherein said drug is a pyrimidine analogue.

26. A composition according to claim 24 wherein said chemotherapeutic agent is 5- fluorouracil.

27. A composition according to any of claims 23-26 wherein said anti-metabolic drug is administered with leucovorin.

28. A composition according to claim 20 wherein said chemotherapeutic agent is an alkaloid.

29. A composition according to claim 28 wherein preferably said alkaloid is vincristine or vinblastine.

30. A composition according to claim 20 wherein said chemotherapeutic agent is a terpenoid.

31 . A composition according to claim 30 wherein said terpenoid is a taxane.

32. A method to treat prostate cancer comprising administering an effective amount of an agent comprised in a composition according to any of claims 1 -31 .

33. A method according to claim 28 wherein prostate cancer is secondary prostate cancer of the bone or lymph node.

34. A composition according to any of claims 1 -31 for use in the treatment of prostate cancer.

35. Use according to claim 34 wherein prostate cancer is secondary prostate cancer of the bone or lymph node.

36. An siRNA molecule comprising or consisting of a sense nucleotide sequence selected from the group as represented in Table 1 as SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 1 2, 13, 14, 15, 1 6, 17, 1 8, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50, or combinations of said siRNA molecule.

37. An antisense oligonucleotide or antisense RNA which is designed with reference to the sense nucleotide sequence:

TTTCTTAGCGAGGTTGGGCTGTTCATCATGTCTGGACTATTTCACGACCCAGGGGCTGACCA CCATCTATCAGATTGAGCATTACTCCATGGAT [SEQ ID NO: 55].

38. An antisense RNA according to claim 37 wherein said antisense RNA is part of a siRNA wherein said siRNA comprises or consists of a sense nucleotide sequence selected from the group as represented in Table 2 as SEQ ID NO: 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 80, 81 or 82, or combinations of said siRNA molecules.

39 The use of a polypeptide encoded by a nucleic acid molecule comprising a nucleotide sequence as represented in Figure 1 for the identification of agents that modulate the activity of said polypeptide.

40 A screening method for the identification of an agent that inhibits the activity of a cancer cell gene expression product comprising:

i) providing a polypeptide encoded by a nucleic acid molecule comprising a nucleotide sequence as represented in Figure 1 ;

ϋ) providing at least one candidate agent to be tested;

iii) forming a preparation that is a combination of (i) and (ii) above; and iv) testing the effect of said agent on the activity of said polypeptide. 41 A modelling method to determine the association of an agent with a cancer cell gene expression product comprising:

i) providing computational means to perform a fitting operation between an agent and a polypeptide encoded by the nucleotide sequence in Figure 1 ; and

ii) analysing the results of said fitting operation to quantify the association between the agent and the polypeptide.