WO2011104334A1 - 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions - Google Patents

4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions Download PDF

Info

Publication number
WO2011104334A1
WO2011104334A1 PCT/EP2011/052806 EP2011052806W WO2011104334A1 WO 2011104334 A1 WO2011104334 A1 WO 2011104334A1 EP 2011052806 W EP2011052806 W EP 2011052806W WO 2011104334 A1 WO2011104334 A1 WO 2011104334A1
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
fluoro
yield
amino
trans
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2011/052806
Other languages
French (fr)
Inventor
Thorsten Lehmann-Lintz
Armin Heckel
Joerg Kley
Elke Langkopf
Norbert Redemann
Achim Sauer
Leo Thomas
Dieter Wiedenmayer
Matthias Austen
John Danilewicz
Martin Schneider
Kay Schreiter
Phillip Black
Wesley Blackaby
Ian Linney
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boehringer Ingelheim International GmbH
Original Assignee
Boehringer Ingelheim International GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43799684&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011104334(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to ES11707386.6T priority Critical patent/ES2547905T3/en
Priority to KR1020127022311A priority patent/KR20130008538A/en
Priority to CN2011800209882A priority patent/CN102858782A/en
Priority to BR112012021364A priority patent/BR112012021364A2/en
Priority to MX2012009735A priority patent/MX2012009735A/en
Priority to PH1/2012/501693A priority patent/PH12012501693A1/en
Priority to CA2791103A priority patent/CA2791103A1/en
Priority to EP11707386.6A priority patent/EP2539345B1/en
Priority to AU2011219758A priority patent/AU2011219758A1/en
Application filed by Boehringer Ingelheim International GmbH filed Critical Boehringer Ingelheim International GmbH
Priority to JP2012554346A priority patent/JP5575274B2/en
Priority to EA201201191A priority patent/EA201201191A1/en
Publication of WO2011104334A1 publication Critical patent/WO2011104334A1/en
Priority to IL221086A priority patent/IL221086A0/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives

Definitions

  • the present invention relates to thienopy midine compounds and to novel pharmaceutical compositions comprising thienopyhmidine compounds.
  • the present invention relates to the use of the thienopyhmidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 (Mnk1 a or MnK1 b) and/or Mnk2 (Mnk2a or Mnk2b) or further variants thereof.
  • Mnk1 Mnk1 a or MnK1 b
  • Mnk2 Mnk2a or Mnk2b
  • the present invention relates to the use of the thienopyhmidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or therapy of metabolic diseases, such as diabetes, hyperlipidemia and obesity, hematopoietic disorders, neurodegenerative diseases, kidney damage, inflammatory disorders, and cancer and their consecutive complications and disorders associated therewith.
  • metabolic diseases such as diabetes, hyperlipidemia and obesity, hematopoietic disorders, neurodegenerative diseases, kidney damage, inflammatory disorders, and cancer and their consecutive complications and disorders associated therewith.
  • Metabolic diseases are diseases caused by an abnormal metabolic process and may either be congenital due to an inherited enzyme abnormality or acquired due to a disease of an endocrine organ or failure of a metabolically important organ such as the liver or the pancreas.
  • the present invention is more particularly directed to the treatment and/or
  • Lipid disorders cover a group of conditions which cause abnormalities in the level and metabolism of plasma lipids and lipoproteins.
  • hyperlipidemias are of particular clinical relevance since they constitute an important risk factor for the development of atherosclerosis and subsequent vascular diseases such as coronary heart disease.
  • Diabetes mellitus is defined as a chronic hyperglycemia associated with resulting damages to organs and dysfunctions of metabolic processes. Depending on its etiology, one differentiates between several forms of diabetes, which are either due to an absolute (lacking or decreased insulin secretion) or to a relative lack of insulin. Diabetes mellitus Type I (IDDM, insulin-dependent diabetes mellitus) generally occurs in adolescents under 20 years of age. It is assumed to be of auto-immune etiology, leading to an insulitis with the subsequent destruction of the beta cells of the islets of Langerhans which are responsible for the insulin synthesis. In addition, in latent autoimmune diabetes in adults (LADA; Diabetes Care.
  • LADA latent autoimmune diabetes in adults
  • beta cells are being destroyed due to autoimmune attack.
  • the amount of insulin produced by the remaining pancreatic islet cells is too low, resulting in elevated blood glucose levels (hyperglycemia).
  • Diabetes mellitus Type II generally occurs at an older age. It is above all associated with a resistance to insulin in the liver and the skeletal muscles, but also with a defect of the islets of Langerhans. High blood glucose levels (and also high blood lipid levels) in turn lead to an impairment of beta cell function and to an increase in beta cell apoptosis.
  • Diabetes is a very disabling disease, because today's common anti-diabetic drugs do not control blood sugar levels well enough to completely prevent the occurrence of high and low blood sugar levels. Out of range blood sugar levels are toxic and cause long-term complications for example retinopathy, Tenopathy, neuropathy and peripheral vascular disease. There is also a host of related conditions, such as obesity, hypertension, heart disease and hyperlipidemia, for which persons with diabetes are substantially at risk.
  • diabetes cardiovascular diseases, hypertension, diabetes, hyperlipidemia and an increased mortality.
  • Diabetes (insulin resistance) and obesity are part of the "metabolic syndrome” which is defined as the linkage between several diseases (also referred to as syndrome X, insulin-resistance syndrome, or deadly quartet). These often occur in the same patients and are major risk factors for development of diabetes type II and cardiovascular disease. It has been suggested that the control of lipid levels and glucose levels is required to treat diabetes type II, heart disease, and other occurrences of metabolic syndrome (see e.g., Diabetes 48: 1836-1841 , 1999; JAMA 288: 2209-2716, 2002).
  • the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of metabolic diseases of the carbohydrate metabolism and their consecutive complications and disorders such as impaired glucose tolerance, diabetes (preferably diabetes type II), diabetic complications such as diabetic gangrene, diabetic arthropathy, diabetic osteopenia, diabetic glomerosclerosis, diabetic nephropathy, diabetic dermopathy, diabetic neuropathy, diabetic cataract and diabetic retinopathy, diabetic maculopathy, diabetic feet syndrome, diabetic coma with or without ketoacidosis, diabetic hyperosmolar coma, hypoglycemic coma, hyperglycemic coma, diabetic acidosis, diabetic ketoacidosis, intracapillary glomerulonephrosis, Kimmelstiel-Wilson syndrome, diabetic amyotrophy, diabetic autonomic neuropathy, diabetic
  • diabetes preferably diabetes type II
  • diabetic complications such as diabetic gangrene, diabetic arthropathy, diabetic
  • diabetes mononeuropathy, diabetic polyneuropathy, diabetic angiopathies, diabetic peripheral angiopathy, diabetic ulcer, diabetic arthropathy, or obesity in diabetes.
  • the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of metabolic diseases of the lipid metabolism (i.e. lipid disorders) and their consecutive complications and disorders such as hypercholesterolemia, familial hypercholesterolemia, Fredrickson's hyperlipoproteinemia, hyperbetalipoproteinemia, hyperlipidemia, low-density- lipoprotein-type [LDL] hyperlipoproteinemia, pure hyperglyceridemia, endogenous hyperglyceridemia, isolated hypercholesterolemia, isolated hypertroglyceridemia, cardiovascular diseases such as hypertension, ischemia, varicose veins, retinal vein occlusion, atherosclerosis, angina pectoris, myocardial infarction, stenocardia, pulmonary hypertension, congestive heart failure, glomerulopaty, tubulointestitial disorders, renal failure, angiostenosis, or cerebrovascular disorders, such as cerebral apoplexy.
  • metabolic diseases of the lipid metabolism i.e
  • the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of hematopoetic disorders and their consecutive complications and disorders such as acute myeloid leukemia (AML), Morbus Hodgkin, Non-Hodgkin's lymphoma; hematopoetic disease, acute non-lymphocytic leukemia (ANLL), myeloproliferative disease acute
  • APL acute myelomonocytic leukemia
  • ALMoL multiple myeloma
  • polycythemia vera lymphoma
  • ALL acute lymphocytic leukemia
  • CCL chronic lymphocytic leukemia
  • Wm's tumor Wilm's tumor, or Ewing's Sarcoma.
  • the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of cancer and consecutive complications and disorders such as cancer of the upper gastrointestinal tract, pancreatic carcinoma, breast cancer, colon cancer, ovarian carcinoma, cervix carcinoma, endometrial cancer, brain tumor, testicular cancer, laryngeal carcinoma, osteocarcinoma, prostatic cancer, retinoblastoma, liver carcinoma, lung cancer, neuroblastoma, renal carcinoma, thyroid carcinoma, esophageal cancer, soft tissue sarcoma, skin cancer, osteosarcoma, rhabdomyosarcoma, bladder cancer, metastatic cancer, cachexia, or pain.
  • cancer of the upper gastrointestinal tract pancreatic carcinoma, breast cancer, colon cancer, ovarian carcinoma, cervix carcinoma, endometrial cancer, brain tumor, testicular cancer, laryngeal carcinoma, osteocarcinoma, prostatic cancer, retinoblastoma, liver carcinoma, lung cancer, neuroblastoma, renal carcinoma,
  • Certain anti-cancer drugs such as cisplatin are linked to serious side effects such as nephrotoxicity or ototoxicity, which can be dose limiting. Activation of Mnks has been linked to these side effects.
  • the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of ear or kidney damage, in particular for the prevention or treatment of ear and kidney drug induced damage
  • the present invention relates to the use of thienopyrimidine compounds for the production of pharmaceutical compositions for the prophylaxis and/or therapy of cytokine related diseases.
  • Such diseases are i.a. inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, neurodegenerative diseases, allergies, or other conditions associated with proinflammatory cytokines.
  • Allergic and inflammatory diseases such as acute or chronic inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, asthma and septic shock and their consecutive complications and disorders associated therewith.
  • Inflammatory diseases like rheumatoid arthritis, inflammatory lung diseases like COPD, inflammatory bowel disease and psoriasis afflict one in three people in the course of their lives. Not only do those diseases impose immense health care costs, but also they are often crippling and debilitating.
  • inflammation is the unifying pathogenic process of these inflammatory diseases below, the current treatment approach is complex and is generally specific for any one disease. Many of the current therapies available today only treat the symptoms of the disease and not the underlying cause of inflammation.
  • compositions of the present invention are useful for the treatment and/or prophylaxis of inflammatory diseases and consecutive complications and disorders, such as chronic or acute inflammation, inflammation of the joints such as chronic inflammatory arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, Reiter's syndrome, rheumatoid traumatic arthritis, rubella arthritis, acute synovitis and gouty arthritis; inflammatory skin diseases such as sunburn, psoriasis, erythrodermic psoriasis, pustular psoriasis, eczema, dermatitis, acute or chronic graft formation, atopic dermatitis, contact dermatitis, urticaria and scleroderma; inflammation of the gastrointestinal tract such as inflammatory bowel disease, Crohn ' s disease and related conditions, ulcerative colitis, colitis, and diverticulitis; nephritis, urethritis
  • pericarditis rheumatic endocarditis, rheumatic myocarditis, rheumatic mitral valve disease, rheumatic aortic valve disease, prostatitis, prostatocystitis,
  • spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis;
  • Hashimoto ' s thyroiditis Kawasaki ' s disease, Raynaud ' s phenomenon, Sjogren ' s syndrome, neuroinflammatory disease, sepsis, conjunctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglottitis, bronchitis, pneumonitis, stomatitis, gingivitis, oesophagitis, gastritis, peritonitis, hepatitis, cholelithiasis, cholecystitis, glomerulonephritis, goodpasture ' s disease, crescentic glomerulonephritis, pancreatitis, endomyometritis, myometritis, metritis, cervicitis, endocervic
  • tuberculosis vaginitis, vulvitis, silicosis, sarcoidosis, pneumoconiosis, pyresis, inflammatory polyarthropathies, psoriatric arthropathies, intestinal fibrosis,
  • cytokines are also believed to be implicated in the production and development of various cardiovascular and cerebrovascular disorders such as congestive heart disease, myocardial infarction, the formation of atherosclerotic plaques, hypertension, platelet aggregation, angina, stroke, Alzheimer's disease, reperfusion injury, vascular injury including restenosis and peripheral vascular disease, and, for example, various disorders of bone metabolism such as
  • osteoporosis including senile and postmenopausal osteoporosis
  • Paget's disease including senile and postmenopausal osteoporosis
  • bone metastases including senile and postmenopausal osteoporosis
  • hypercalcaemia including hyperparathyroidism, osteosclerosis
  • osteoporosis and periodontitis and the abnormal changes in bone metabolism which may accompany rheumatoid arthritis and osteoarthritis.
  • Excessive cytokine production has also been implicated in mediating certain complications of bacterial, fungal and/or viral infections such as endotoxic shock, septic shock and toxic shock syndrome and in mediating certain complications of CNS surgery or injury such as neurotrauma and ischaemic stroke.
  • Excessive cytokine production has, moreover, been implicated in mediating or exacerbating the development of diseases involving cartilage or muscle resorption, pulmonary fibrosis, cirrhosis, renal fibrosis, the cachexia found in certain chronic diseases such as malignant disease and acquired immune deficiency syndrome (AIDS), tumour invasiveness and tumour metastasis and multiple sclerosis.
  • AIDS malignant disease and acquired immune deficiency syndrome
  • tumour invasiveness and tumour metastasis and multiple sclerosis.
  • the treatment and/or prophylaxis of these diseases are also contemplated by the present invention
  • inventive compositions may be used to treat inflammation
  • autoimmune diseases including, but not limited to, systemic lupus erythematosis, Addison's disease, autoimmune polyglandular disease (also known as autoimmune polyglandular syndrome), glomerulonephritis, rheumatoid arthritis scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, diabetes, autoimmune hemolytic anemia, glomerulonephritis, rheumatoid arthritis autoimmune neutropenia, thrombocytopenia, atopic dermatitis, chronic active hepatitis,
  • autoimmune diseases including, but not limited to, systemic lupus erythematosis, Addison's disease, autoimmune polyglandular disease (also known as autoimmune polyglandular syndrome), glomerulonephritis, rheumatoid arthritis scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, diabetes, autoimmune hemolytic anemia,
  • myasthenia gravis myasthenia gravis, multiple sclerosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, psoriasis, and graft vs. host disease.
  • compositions of the present invention may be used for the treatment and prevention of infectious diseases such as sepsis, septic shock, Shigellosis, and Helicobacter pylori and viral diseases including herpes simplex type 1 (HSV-1 ), herpes simplex type 2 (HSV-2), cytomegalovirus, Epstein-Barr, human immunodeficiency virus (HIV), acute hepatitis infection (including hepatitis A, hepatits B, and hepatitis C), HIV infection and CMV retinitis, AIDS or malignancy, malaria, mycobacterial infection and meningitis.
  • infectious diseases such as sepsis, septic shock, Shigellosis, and Helicobacter pylori and viral diseases including herpes simplex type 1 (HSV-1 ), herpes simplex type 2 (HSV-2), cytomegalovirus, Epstein-Barr, human immunodeficiency virus (HIV), acute hepatitis infection (including hepatitis
  • compositions of the present invention may also be used topically in the treatment or prophylaxis of topical disease states mediated by or exacerbated by excessive cytokine production, such as inflamed joints, eczema, psoriasis and other inflammatory skin conditions such as sunburn; inflammatory eye conditions including conjunctivitis; pyresis, pain and other conditions associated with inflammation.
  • cytokine production such as inflamed joints, eczema, psoriasis and other inflammatory skin conditions such as sunburn; inflammatory eye conditions including conjunctivitis; pyresis, pain and other conditions associated with inflammation.
  • Periodontal disease has also been implemented in cytokine production, both topically and systemically.
  • use of compositions of the present invention to control the inflammation associated with cytokine production in such peroral diseases such as gingivitis and periodontitis is another aspect of the present invention.
  • compositions of the present invention may also be used to treat or prevent neurodegenerative disease selected from Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, frontotemporal lobar dementia, spinocerebellar ataxia, dementia with Lewy bodies, cerebral ischemia or neurodegenerative disease caused by traumatic injury, glutamate neurotoxicity or hypoxia.
  • neurodegenerative disease selected from Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, frontotemporal lobar dementia, spinocerebellar ataxia, dementia with Lewy bodies, cerebral ischemia or neurodegenerative disease caused by traumatic injury, glutamate neurotoxicity or hypoxia.
  • compositions of the present invention may be used to treat or prevent a disease selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn ' s disease, ulcerative colitis, multiple sclerosis and asthma.
  • a disease selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn ' s disease, ulcerative colitis, multiple sclerosis and asthma.
  • Protein kinases are important enzymes involved in the regulation of many cellular functions.
  • the LK6-serine/threonine-kinase gene of Drosophila melanogaster was described as a short-lived kinase which can associate with microtubules (J. Cell Sci. 1997, 1 10(2): 209-219).
  • Genetic analysis in the development of the compound eye of Drosophila suggested a role in the modulation of the RAS signal pathway (Genetics 2000 156(3): 1219-1230).
  • the closest human homologues of Drosophila LK6-kinase are the MAP-kinase interacting kinase 2 (Mnk2, e.g.
  • Mnk2a and Mnk2b MAP-kinase interacting kinase 1
  • Mnk1 MAP-kinase interacting kinase 1
  • Mnk1 MAP-kinase interacting kinase 1
  • Mnks are mostly localized in the cytoplasm.
  • Mnks are phosphorylated by the p42 MAP kinases Erk1 and Erk2 and the p38-MAP kinases. This phosphorylation is triggered in a response to growth factors, phorbol esters and oncogenes such as Ras and Mos, and by stress signaling molecules and cytokines.
  • the phosphorylation of Mnk proteins stimulates their kinase activity towards eukaryotic initiation factor 4E (elF4E) (EMBO J.
  • elF4E eukaryotic initiation factor 4E
  • Mnk proteins There are different hypotheses describing the mode of the stimulation of the protein translation by Mnk proteins. Most publications describe a positive stimulatory effect on the cap-dependent protein translation upon activation of MAP kinase-interacting kinases. Thus, the activation of Mnk proteins can lead to an indirect stimulation or regulation of the protein translation, e.g. by the effect on the cytosolic phospholipase 2 alpha (BBA 1488:124-138, 2000).
  • WO 03/037362 discloses a link between human Mnk genes, particularly the variants of the human Mnk2 genes, and diseases which are associated with the regulation of body weight or thermogenesis. It is postulated that human Mnk genes, particularly the Mnk2 variants are involved in diseases such as e.g. metabolic diseases including obesity, eating disorders, cachexia, diabetes mellitus, hypertension, coronary heart disease, hypercholesterolemia, dyslipidemia, osteoarthritis, biliary stones, cancer of the genitals and sleep apnea, and in diseases connected with the ROS defense, such as e.g. diabetes mellitus and cancer.
  • diseases such as e.g. metabolic diseases including obesity, eating disorders, cachexia, diabetes mellitus, hypertension, coronary heart disease, hypercholesterolemia, dyslipidemia, osteoarthritis, biliary stones, cancer of the genitals and sleep apnea, and in diseases connected with the ROS defense, such as e.g.
  • WO 03/03762 moreover discloses the use of nucleic acid sequences of the MAP kinase-interacting kinase (Mnk) gene family and amino acid sequences encoding these and the use of these sequences or of effectors of Mnk nucleic acids or polypeptides, particularly Mnk inhibitors and activators in the diagnosis, prophylaxis or therapy of diseases associated with the regulation of body weight or thermogenesis.
  • WO 02/103361 describes the use of kinases 2a and 2b (Mnk2a and Mnk2b) interacting with the human MAP kinase in assays for the identification of
  • WO 02/103361 discloses also the prophylaxis and/or therapy of diseases associated with insulin resistance, by modulation of the expression or the activity of Mnk2a or Mnk2b.
  • Mnk2a or Mnk2b Apart from peptides, peptidomimetics, amino acids, amino acid analogues, polynucleotides, polynucleotide analogues, nucleotides and nucleotide analogues, 4-hydroxybenzoic acid methyl ester are described as a substance which binds the human Mnk2 protein.
  • Mnk1 demonstrating activation of Mnk1 by proinflammatory stimuli.
  • the cytokines TNFa and IL-1 ⁇ trigger the activation of Mnk1 in vitro (Fukunaga and Hunter, EMBO J 16(8): 1921 -1933, 1997) and induce the phosphorylation of the Mnk-specific substrate elF4E in vivo (Ueda et al ., Mol Cell Biol 24(15): 6539-6549, 2004).
  • LPS lipopolysaccharide
  • Mnk1 has been shown to be involved in regulating the production of proinflammatory cytokines. Mnk1 enhances expression of the chemokine RANTES (Nikolcheva et al., J Clin Invest 1 10, 1 19-126, 2002).
  • RANTES is a potent chemotractant of monocytes, eosinophils, basophiles and, natural killer cells. It activates and induces proliferation of T lymphocytes, mediates degranulation of basophils and induces the respiratory burst in eosinophils (Conti and DiGioacchino, Allergy Asthma Proc 22(3):133-7, 2001 )
  • the proposed mechanism is mediated by a regulatory AU-rich element (ARE) in the TNFa mRNA.
  • ARE regulatory AU-rich element
  • Buxade et al. demonstrate proteins binding and controlling ARE function to be phosphorylated by Mnk1 and Mnk2.
  • Mnk-mediated phosphorylation of the ARE-binding protein hnRNP A1 has been suggested to enhance translation of the TNFa mRNA.
  • TNFa is not the only cytokine regulated by an ARE.
  • AREs are also found in the transcripts of several interleukins, interferones and chemokines (Khabar, J Interf Cytokine Res 25: 1 -10, 2005).
  • the Mnk-mediated phosphorylation of ARE- binding proteins has thus the potential to control biosynthesis of cytokines in addition to that of TNFa.
  • Mnks as down stream targets of inflammatory signalling as well as mediators of the inflammatory response. Their involvement in the production of TNFa, RANTES, and potentially additional cytokines suggests inhibition of Mnks as strategy for anti-inflammatory therapeutic intervention.
  • Mnk1 and Mnk2 (including all splice forms) phosphorylate the translation factor elF4E on Serine 209.
  • Mnk1 /2 double knockout mice completely lack phosphorylation on Serine 209, indicating that Mnk kinase are the only kinases able to phosphorylate this site in vivo (Ueda et al ., Mol Cell Biol . 2004; 24(15):6539-49).
  • elF4E is
  • elF4E can act as an oncogene when assayed in standard assays for oncogenic activity (e.g. Ruggero et al., Nat Med. 2004 May;10(5):484-6). elF4E excerts its oncogenic activity by stimulating the translation of oncogenes such as c- myc and cyclinDI (Culjkovic et al ., J Cell Biol. 2006; 175(3):415-26), by increasing the expression of pro-survival factors such as MCP-1 (Wendel et al ., Genes Dev. 2007; 21 (24):3232-7) and by positively regulating pathways of drug resistance (Wendel et al., Nature 2004; 428(6980):332-7; Graff et el., Cancer Res. 2008;
  • CGP57380 and CGP052088 Inhibitors of Mnk have been described (cf. Mol. Cell. Biol. 21 , 5500, 2001 ; Mol Cell Biol Res Comm 3, 205, 2000; Genomics 69, 63, 2000).
  • CGP052088 is a staurosporine derivative having an IC 5 o of 70 nM for inhibition of in vitro kinase activity of Mnkl .
  • CGP57380 is a low molecular weight selective, non-cytotoxic inhibitor of Mnk2 (Mnk2a or Mnk2b) or of Mnkl :
  • Mnk2a or Mnk2b Mnk2a or Mnk2b
  • Mnkl Mnkl
  • the problem underlying the present invention is to provide potent and selective Mnkl and/or Mnk2 inhibitors which may effectively and safely be used for the treatment of metabolic diseases, inflammatory diseases, cancer, neurodegenerative diseases and their consecutive complication and disorders.
  • certain thienopyrimidine compounds are potent inhibitors of the kinase enzymes Mnkl and/or Mnk2 and/or variants thereof and as such may be useful in the prophylaxis and/or therapy of diseases which can be influenced by the inhibition of the kinase activity of Mnkl and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof.
  • the thienopyrimidine compounds of the present invention provide several advantages, namely, enhanced solubility, the possibility to form stable salts, improved metabolic stability, enhanced or retained activity in biochemical or cellular Mnk activity assays and enhanced or retained selectivity against other kinases.
  • thienopyrimidine compounds disclosed in WO 06/136402 and WO 07/1 15822 exhibit high activity in Mnk enzyme assays and extremely high selectivity, however they show a very low solubility and are in most cases metabolic unstable resulting in undesired pharmacokinetic properties.
  • compounds described in this application also show improved solubility, have strong inhibitory potency in biochemical and cellular assays and are highly selective, resulting in overall greatly improved pharmacological properties.
  • any alkyl moiety mentioned in this application may be straight-chained or branched.
  • Thienopyrimidine compounds of the present invention are compounds of the general formula (I):
  • X is CH or N
  • R 1 is a hydrogen or halogen atom
  • R 2 is C3-7 cycloalkyi group that is substituted with one or two substituents selected from oxo, halogen, C h alky!, hydroxy, Ci-3 alkoxy, Ci -4 alkoxy-carbonyl, amino and morpholinyl, wherein the hydrogen atoms of the amino group may optionally be
  • R 3 is a Ci-2 alkyl group
  • R 4 is a carboxy, Ci-3 alkoxy-carbonyl, aminocarbonyl, N-(Ci -4 alkyl)-aminocarbonyl or N,N-[di-(Ci -4 alkyl)]-aminocarbonyl group, wherein the aminocarbonyl group may be substituted with a Ci-3 akylsulfonyl, CN, OH, Ci-3 alkoxy, C 3-6 cycloalkyi, -CH 2 -C ⁇ C-CH 2 -NH 2 , -CH 2 -C ⁇ C-CH 2 -
  • Preferred compounds of formula (I) are those, wherein X, R 1 , R 2 and R 4 are as defined above and R 3 is methyl, or a tautomer, enantiomer, diastereomer or salt thereof.
  • One aspect of the invention concerns those compounds of formula (I), wherein R 2 to R 4 are as defined above and X is CH and
  • R 1 is a fluorine atom, or a tautomer, enantiomer, diastereomer or salt thereof.
  • Another aspect of the invention concerns those compounds of formula (I), wherein R 2 to R 4 are as defined above and X is N and
  • R 1 is a hydrogen atom, or a tautomer, enantiomer, diastereomer or salt thereof.
  • More preferred compounds of formula (I) are those, wherein X and R 1 to R 3 are as defined above, and
  • R 4 is carboxy, Ci-3 alkoxy-carbonyl, aminocarbonyl or N-(Ci-3 alkyl)-aminocarbonyl group, wherein the methyl moiety of the above-mentioned N-(methyl)-aminocarbonyl group may optionally be substituted with a piperidinyl, N-methyl-piperidinyl or morphoinyl group, each bound via a carbon atom, and wherein the ethyl resp.
  • propyl moiety of the above-mentioned N-(C2-3 alkyl)-aminocarbonyl group may optionally be terminally substituted with hydroxy, methoxy, amino, N-methyl- amino, ⁇ , ⁇ -dimethyl-amino, morpholino, imidazolyl, 4-methyl-piperazinyl, 1 - methyl-pyrrolidinyl, piperidinyl, pyrrolidinyl or 4-hydroxy-piperidino group, or a tautomer, enantiomer, diastereomer or salt thereof.
  • Even more preferred compounds of formula (I) are those, wherein
  • R 4 is aminocarbonyl or N-(Ci-3 alkyl)-aminocarbonyl group, wherein the methyl moiety of the above-mentioned N-(methyl)-aminocarbonyl group may optionally be substituted with a piperidinyl, N-methyl-piperidinyl or morpholinyl group, each bound via a carbon atom, and wherein the ethyl resp.
  • propyl moiety of the above-mentioned N-(C2-3 alkyl)-aminocarbonyl group may optionally be terminally substituted with hydroxy, methoxy, amino, N-methyl- amino, ⁇ , ⁇ -dimethyl-amino, morpholino, imidazolyl, 4-methyl-piperazinyl, 1 - methyl-pyrrolidinyl, piperidinyl, pyrrolidinyl or 4-hydroxy-piperidino group, or a tautomer, enantiomer, diastereomer or salt thereof.
  • Another set of more preferred compounds of formula (I) are those, wherein
  • R 1 , R 3 and R 4 are as defined above, and
  • R 2 is cyclopentyl substituted with one or two hydroxy or methoxy groups or with an amino, methylcarbonyl-amino, N-methyl-N-methylcarbonyl-amino group or wherein two adjacent carbon atoms are linked to each other via a -O-CH 2 -O- or -O-C(CH 3 ) 2 - O- group, or cyclohexyl substituted with one or two fluorine atoms or one or two hydroxy or methoxy groups or an oxo, Ci-3 alkoxy-carbonyl, morpholino, methyl-piperidinyl or an amino group, wherein the hydrogen atoms of the amino group my optionally independently be replaced with a methyl, methylcarbonyl, 2-methoxy-ethyl or methylsulfonyl group, or wherein two adjacent carbon atoms are linked to each other via-O-C(CH 3 ) 2 -O- group or wherein two hydrogen atoms attached to the same
  • R 2 is cyclohexyl substituted with one hydroxy or methoxy group, cyclopentyl substituted with one hydroxy, methoxy, methylcarbonyl-amino or N- methyl-N-methylcarbonyl-amino group or cyclopentyl, wherein two adjacent carbon atoms are linked to each other via a -O- CH 2 -O- group, or cyclobutyl substituted with a methylcarbonyl-amino or methylcarbonyl-N(methyl)- amino group, or a tautomer, enantiomer, diastereomer or salt thereof.
  • Particularly preferred are the following compounds of formula (I)
  • the potent inhibitory effect of the compounds of the invention may be determined by in vitro enzyme assays as described below in more detail.
  • the compounds of the present invention can be synthesized according to the following synthesis schemes:
  • Compounds of the general formula C can be synthesized by reaction of a compound A with the deprotonated alcohol B in appropriate solvents such as THF or DMF at a temperature between 0 °C and 150 °C.
  • the deprotonated form of B can be obtained by deprotonation with a base such as sodium hydride or lithium hexamethyldisilazane at a preferred temperature of 0 °C.
  • Hydrogenation of compound C in order to obtain a compound of the general formula D can be achieved by reacting C in the presence of hydrogen and a catalyst such as palladium or Raney nickel.
  • the hydrogen can be introduced as a gas or stem from a hydrogen source such as ammonium formate.
  • Compounds of the general formula C can be also obtained by Mitsunobu reaction of a compound with the general formula E with an alcohol B in the presence of triphenylphosphine and an dialkylazodicarboxylate such as diethylazodicarboxylate, diisopropylazodicarboxylate or di-tert.butylazodiacarboxylate in a solvent such as THF at temperatures between -10 °C and 80 °C, preferrably between 0 °C and 30 °C.
  • a solvent such as THF
  • a compound of the formula G can be synthesized by reaction of compound D with F preferably in the presence of an acid such as p-toluene sulfonic acid or hydrochloric acid in solvents such as dioxan at temperatures between 10 °C and 150 °C.
  • an acid such as p-toluene sulfonic acid or hydrochloric acid in solvents such as dioxan at temperatures between 10 °C and 150 °C.
  • Synthesis of a compound with the general formula H_ can be achieved by reaction of compound G_with a base such as sodium hydroxide or lithium hydroxide in solvents such as methanol, ethanol, THF and water or mixtures thereof, preferably in ethanol/THF or THF/water at temperatures between 10 °C and 100 °C.
  • a base such as sodium hydroxide or lithium hydroxide
  • solvents such as methanol, ethanol, THF and water or mixtures thereof, preferably in ethanol/THF or THF/water at temperatures between 10 °C and 100 °C.
  • a compound of the general formula J can be obtained by reaction of compound H with amines of the general formula ]_using amide coupling procedures employing reagents such as TBTU, HATU or EDC/ N-Hydroxysuccinimide in the presence or absence of bases such as diisopropylethylamine in solvents such as DMF or THF at temperatures between 0 °C and 120 °C preferably between 0 °C and 30 °C.
  • reagents such as TBTU, HATU or EDC/ N-Hydroxysuccinimide
  • bases such as diisopropylethylamine in solvents such as DMF or THF
  • Pharmaceutically acceptable salts of the compounds of the invention of formula (1 ) can be formed with numerous organic and inorganic acids and bases.
  • Exemplary acid addition salts including acetate, adipate, alginate, ascorbate, aspartate, benzoate, benzenesulfonate, bisulfate, borate, butyrate, citrate, camphorate, camphersulfonate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethane sulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethane sulfonate, lactate, maleate, methane sulfonate, 2-naphthalene sulfonate, nicotinate, nitrate, oxalate
  • Basic nitrogen-containing moieties can be quaternized with such agents as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chloride, bromide and iodide; dialkyl sulfates like dimethyl, diethyl, dibutyl, and diamyl sulfates, long-chain alkyl halides such as decyl, lauryl, myristyl and stearyl chloride, bromide and iodide, or aralkyl halides like benzyl and phenethyl bromides, or others. Water soluble or dispersible products are thereby obtained.
  • lower alkyl halides such as methyl, ethyl, propyl, and butyl chloride, bromide and iodide
  • dialkyl sulfates like dimethyl, diethyl, dibutyl, and diamyl sulfates
  • Pharmaceutically acceptable basic addition salts include but are not limited to cations based on the alkaline and alkaline earth metals such as sodium, lithium, potassium, calcium, magnesium, aluminum salts and the like, as well as non toxic ammonium quarternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine and the like.
  • amines useful for the formation of base addition salts include benzazethine, dicyclohexyl amine, hydrabine, N-methyl-D-glucamine, N-methyl-D-glucamide, t-butyl amine, diethylamine, ethylendiamine, ethanolamine, diethanolamine, piperazine and the like and salts with amino acids such as arginine, lysine, or the like.
  • a given chemical formula or name shall encompass tautomers and all stereo, optical and geometrical isomers (e.g. enantiomers, diastereomers, E/Z isomers etc ..) and racemates thereof as well as mixtures in different proportions of the separate enantiomers, mixtures of diastereomers, or mixtures of any of the foregoing forms where such isomers and enantiomers exist, as well as salts, including
  • the term "metabolite” refers to (i) a product of metabolism, including intermediate and products, (ii) any substance involved in metabolism (either as a product of metabolism or as necessary for metabolism), or (iii) any substance produced or used during metabolism. In particular it refers to the end product that remains after metabolism.
  • prodrug refers to (i) an inactive form of a drug that exerts its effects after metabolic processes within the body convert it to a usable or active form, or (ii) a substance that gives rise to a pharmacologically active metabolite, although not itself active (i.e. an inactive precursor).
  • prodrug or “prodrug derivative” mean a covalently-bonded derivative or carrier of the parent compound or active drug substance which undergoes at least some biotransformation prior to exhibiting its pharmacological effect(s).
  • prodrugs have metabolically cleavable groups and are rapidly transformed in vivo to yield the parent compound, for example, by hydrolysis in blood, and generally include esters and amide analogs of the parent compounds.
  • the prodrug is formulated with the objectives of improved chemical stability, improved patient acceptance and compliance, improved bioavailability, prolonged duration of action, improved organ selectivity, improved formulation (e.g., increased hydrosolubility), and/or decreased side effects (e.g., toxicity).
  • prodrugs themselves have weak or no biological activity and are stable under ordinary conditions. Prodrugs can be readily prepared from the parent compounds using methods known in the art, such as those described in A Textbook of Drug Design and Development,
  • pharmaceutically acceptable prodrug means a prodrug of a compound of the invention which is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible.
  • C3-10 cycloalkyl or “C3-8 cycloalkyl” refers to mono- or polycyclic carbocyclic alkyl substituent or group having 3 to 10 or 3 to 8 ring atoms respectively, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, cycloheptenyl, cycloheptadienyl, cycloheptatrienyl perhydrated naphthalene or indene, adamantyl or norbonanyl and the like.
  • Ci_s alkyl refers to a Ci_s, preferably Ci_4 straight or branched alkyl/alkoxy group such as methyl, ethyl, propyl (iso-, n-), butyl (iso-, n-, sec-, tert-), pentyl, hexyl, methoxy, ethoxy, propoxy (iso-, n-), butoxy (iso-, n-, sec-, tert-), pentoxy, hexoxy; moreover, the term "Ci_ 8 alkyl” also includes an alkyl group which may contain oxygen in the chain and may be substituted with halogen to form an ether or halogenated ether group.
  • C2-8 alkenyl by itself or as part of another group refers to a straight or branched alkenyl group of 2 to 8 carbons, preferably 2 to 6 carbons, in the normal chain, which include one or more double bonds in the normal chain, such as vinyl, 2- propenyl, 3-butenyl, 2-butenyl, 4-pentenyl, 3-pentenyl, 2-hexenyl, 3-hexenyl, 2- heptenyl, 3-heptenyl, 4-heptenyl, 3-octenyl .
  • heterocyclyl refers to monocyclic saturated or unsaturated heterocyclyl groups with 1 to 4 hetero atoms selected from N, S and O, with the remainder of the ring atoms being carbon atoms and having preferably a total number of ring atoms of 3 to 10, such as morpholino, piperazinyl, piperidinyl, pyridyl, pyrimidinyl, thiazolyl, indolyl, imidazolyl, oxadiazolyl, tetrazolyl, pyrazinyl, triazolyl, thiophenyl or furanyl .
  • heteroaryl refers to a mono- or bicyclic aromatic group with 1 to 4 hetero atoms selected from N, S and O, with the remainder of the ring atoms being carbon atoms and having preferably a total number of ring atoms of 5 to 10.
  • heteroaryl groups are such as benzofuranyl, furyl, thienyl, benzothienyl, thiazolyl, imidazolyl, oxazolyl, oxadiazolyl, thiadiazolyl, benzothiazolyl, triazolyl, tetrazolyl, isoxazolyl, isothiazolyl, pyrrolyl, pyranyl, tetrahydropyranyl, pyrazolyl, pyridyl, quinolinyl, isoquinolinyl, purinyl, carbazolyl, benzoxazolyl, benzamidazolyl, indolyl, isoindolyl, pyrazinyl, diazinyl, pyrazine, triazinyltriazine, tetrazinyl, tetrazolyl, benzothiophenyl, benzopyridyl and benzimidazoly
  • the present invention provides pharmaceutical compositions comprising a thienopyrimidine compound of the present invention and optionally a pharmaceutically acceptable carrier.
  • the pharmaceutical composition according to the present invention may further comprise an additional therapeutic agent.
  • the additional therapeutic agent is selected from antidiabetics like insulin, long and short acting insulin analogues, sulfonylureas, biguanides, DPP-IV inhibitors, SGLT2 inhibitors, 1 1 ⁇ -HSD inhibitors, glucokinase activators, AMPK activators, Glp- 1 receptor agonists, GIP receptor agonists, DGAT inhibitors, PPARgamma agonists, PPARdelta agonists, and other antidiabetics derived from thiazolidinediones, lipid lowering agents such as statines, fibrates, ion exchange resins nicotinic acid derivatives, or HMG-CoA reductase inhibitors, cardiovascular therapeutics such as
  • compositions are provided.
  • compositions wherein the additional therapeutic agent is selected from a histamine antagonist, a bradikinin antagonist, serotonin antagonist, leukotriene, an anti- asthmatic, an NSAID, an antipyretic, a corticosteroid, an antibiotic, an analgetic, a uricosuric agent, chemotherapeutic agent, an anti gout agent, a bronchodilator, a cyclooxygenase-2 inhibitor, a steroid, a 5-lipoxygenase inhibitor, an
  • immunosuppressive agent a leukotriene antagonist, a cytostatic agent, an
  • antineoplastic agent a mTor inhibitor, a Tyrosine kinase inhibitor, antibodies or fragments thereof against cytokines and soluble parts (fragments) of cytokine receptors.
  • cyclophosphamide ifosfamide, melphalan, bendamustine, uramustine, ThioTEPA, camptothecin, topotecan, irinotecan, rubitecan, etoposide, teniposide, cetuximab, panitumumab, trastuzumab, rituximab, tositumomab, alemtuzumab, bevacizumab, gemtuzumab, aminolevulinic acid, methyl aminolevulinate, porfimer sodium, verteporfin, axitinib, bosutinib, cediranib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, lestaurtinib, nilotinib, semaxanib, sorafenib, sunitinib, vandetanib, retinoids (a
  • temsirolimus antimetabolites such as cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, combinations such as ad amycin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides.
  • antimetabolites such as cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, combinations such as ad amycin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides.
  • clemastine diphenhydramine, dimenhydrinate, promethazine, cetirizine, astemizole,
  • valdecoxib parecoxib, celecoxib, propyphenazon, codein, oxapozin, dapson, prednisone, prednisolon, triamcinolone, dexibuprofen, dexamethasone, flunisolide, albuterol, salmeterol, terbutalin, theophylline, caffeine, naproxen, glucosamine sulfate, etanercept, ketoprofen, adalimumab, hyaluronic acid, indometacine, proglumetacine dimaleate, hydroxychloroquine, chloroquine, infliximab, etofenamate, auranofin, gold, [224R a ] ra diunn chloride, tiaprofenic acid, dexketoprofen(trometamol), cloprednol, sodium aurothiomalate aurothi
  • fluorcortolon diclofenac, efalizumab, idarubicin, doxorubicin, bleomycin, mitomycin, dactinomycin, daptomycin, cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, adriamydin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides, penicillamine, a hyaluronic acid preparation, arteparon, glucosamine, MTX, soluble fragments of the TNF-receptor (such as etanercept (Enbrel)) and antibodies against TNF (such as infliximab (Remicade), natalizumab (Tysabri) and adalimumab (Humira)).
  • TNF-receptor such as eta
  • the compounds of the invention and the additional therapeutic agent may be formulated in one single dosage form, or may be present in separate dosage forms and may be either administered concomitantly (i.e. at the same time) or sequentially.
  • compositions of the present invention may be in any form suitable for the intended method of administration.
  • the compounds of the present invention may be administered orally, parenterally, such as bronchopulmonary, subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, transdermally, transmucosally, subdurally, locally or topically via iontopheresis, sublingually, by inhalation spray, aerosol or rectally and the like in dosage unit formulations optionally comprising conventional
  • Excipients that may be used in the formulation of the pharmaceutical compositions of the present invention comprise carriers, vehicles, diluents, solvents such as monohydric alcohols such as ethanol, isopropanol and polyhydric alcohols such as glycols and edible oils such as soybean oil, coconut oil, olive oil, safflower oil cottonseed oil, oily esters such as ethyl oleate, isopropyl myristate; binders, adjuvants, solubilizers, thickening agents, stabilizers, disintergrants, glidants, lubricating agents, buffering agents, emulsifiers, wetting agents, suspending agents, sweetening agents, colorants, flavors, coating agents, preservatives, antioxidants, processing agents, drug delivery modifiers and enhancers such as calcium
  • phosphate magnesium state
  • talc monosaccharides, disaccharides, starch, gelatine, cellulose, methylcellulose, sodium carboxymethyl cellulose, dextrose, hydroxypropyl- ⁇ -cyclodextrin, polyvinylpyrrolidone, low melting waxes, ion exchange resins.
  • Dosage forms for oral administration include tablets, capsules, lozenges, pills, wafers, granules, oral liquids such as syrups, suspensions, solutions, emulsions, powder for reconstitution.
  • Dosage forms for parenteral administration include aqueous or olageous solutions or emulsions for infusion, aqueous or olageous solutions, suspensions or emulsions for injection pre-filled syringes, and/or powders for reconstitution.
  • Dosage forms for local/topical administration comprise insufflations, aerosols, metered aerosols, transdermal therapeutic systems, medicated patches, rectal suppositories, and/or ovula.
  • the amount of the compound of the present invention that may be combined with the excipients to formulate a single dosage form will vary upon the host treated and the particular mode of administration.
  • compositions of the invention can be produced in a manner known per se to the skilled person as described, for example, in Remington's
  • a thienopyrimidine compound of the present invention for the production of a pharmaceutical composition for inhibiting the activity of the kinase activity of Mnk1 or Mnk2 (Mnk2a, Mnk2b) or further variants thereof is provided, in particular for the prophylaxis or therapy of metabolic diseases, hematopoietic disorders, cancer and their consecutive complications and disorders. Whereby the prophylaxis and therapy of metabolic diseases of the carbohydrate and/or lipid metabolism is preferred.
  • Diseases of the invention that are influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or further variants thereof include diseases related to the regulation of metabolic diseases, such as obesity, eating disorders, cachexia, diabetes mellitus, metabolic syndrome, hypertension, coronary heart diseases, hypercholesterolemia, dyslipidemia, osteoarthritis, biliary stones and/or sleep apnea and diseases related to reactive oxygen compounds (ROS defense) such as diabetes mellitus, neurodegenerative diseases and cancer.
  • the pharmaceutical compositions of the invention are particularly useful for prophylaxis and treatment of obesity, diabetes mellitus and other metabolic diseases of the carbohydrate and lipid metabolism as stated above, in particular diabetes mellitus and obesity.
  • a thienopyrimidine compound for the production of a pharmaceutical composition for the prophylaxis or therapy of metabolic diseases is provided.
  • a thienopyrimidine compound of the invention for the production of a pharmaceutical composition for treating or preventing a cytokine mediated disorder such as an inflammatory disease is provided.
  • compositions of the invention are thus useful for the prophylaxis or therapy of inflammatory diseases, in particular chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, gouty arthritis; psoriasis, erythrodermic psoriasis, pustular psoriasis, inflammatory bowel disease, Crohn ' s disease and related conditions, ulcerative colitis, colitis, diverticulitis, nephritis, urethritis, salpingitis, oophoritis, endomyometritis, spondylitis, systemic lupus erythematosus and related disorders, multiple sclerosis, asthma, meningitis, myelitis, encephalomyelitis, encephalitis, phlebitis, thrombophlebitis, chronic obstructive disease (COPD), inflammatory lung disease,
  • prostatocystitis spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis; Hashimoto ' s thyroiditis, Kawasaki ' s disease, Raynaud ' s phenomenon, Sjogren ' s syndrome, neuroinflammatory disease, sepsis, conjubctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglo
  • endocervicitis exocervicitis
  • parametritis tuberculosis
  • vaginitis vaginitis
  • vulvitis vaginitis
  • silicosis silicosis
  • sarcoidosis pneumoconiosis
  • inflammatory polyarthropathies psoriatric
  • arthropathies intestinal fibrosis, bronchiectasis and enteropathic arthropathies.
  • compositions of the present invention are particularly useful for treating or preventing a disease selected from chronic or acute
  • inflammation chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn ' s disease, ulcerative colitis, multiple sclerosis and asthma.
  • a thienopynmidine compound for the production of a pharmaceutical composition for the prophylaxis or therapy of inflammatory diseases selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock Crohn ' s disease, ulcerative colitis, multiple sclerosis and asthma is provided.
  • a thienopynmidine compound of the invention for the production of a pharmaceutical composition for treating or preventing cancer, viral diseases or neurodegenerative diseases is provided.
  • a therapeutically effective dosage will generally be from about 1 to 2000 mg/day, preferably from about 10 to about 1000 mg/day, and most preferably from about 10 to about 500 mg/day, which may be administered in one or multiple doses. It will be appreciated, however, that specific dose level of the compounds of the invention for any particular patient will depend on a variety of factors such as age, sex, body weight, general health condition, diet, individual response of the patient to be treated time of administration, severity of the disease to be treated, the activity of particular compound applied, dosage form, mode of application and concomitant medication. The therapeutically effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgment of the ordinary clinician or physician. Kinase Fluorescence Polarization Assays
  • Assay principle Inhibitory potency of compounds against Mnk1 , Mnk2a and other kinases was assessed with assays based on a format known to those skilled in the art as the indirect (competitive) fluorescence polarization.
  • the assay detection system comprises a small fluorophore-labeled phospho-peptide (termed ligand) bound to a phospho-specific antibody.
  • the product generated by the kinase reaction competes with the ligand for antibody binding. Based on the larger molecular volume of the bound ligand, which results in a lower rotation rate in solution, its emitted light has a higher degree of polarization than the one from the free ligand.
  • Example 2a Mnk1 and Mnk2a in vitro kinase assay
  • human Mnk1 and human Mnk2a were expressed as GST fusion proteins in E. coli, purified to >80% homogeneity by glutathione affinity chromatography and activated in vitro with pre-activated ERK2.
  • the open reading frames of human Mnk1 and Mnk2a were amplified from cDNA using the forward/reverse primer pairs
  • SEQ ID NO: 1 5TTTAGGATCCGTATCTTCTCAAAAGTTGG /
  • SEQ ID NO: 2 5' CTGGGTCGACTCAGAGTGCTGTGGGCGG and
  • SEQ ID NO: 3 5'ACAGGGATCCGTGCAGAAGAAACCAGCC / SEQ ID NO: 4 5'GATGGTCGACTCAGGCGTGGTCTCCCACC
  • Tris(hydroxymethyl)aminomethane hydrochloride (Tris/HCI, Sigma, Germany, cat. no. T5941 ) pH 7.5, 300 mM sodium chloride (NaCI, Sigma, Germany, cat. no. S7653), 5% (w/v) glycerol (Sigma, Germany, cat. no. G5516), 3 mM DTT dithiotreitol (DTT, Sigma, Germany, cat. no. D9779)) per gram wet weight cell pellet. Lysates were prepared by disruption of cells with a sonifier and subsequent clearing by
  • the lysate was applied to a GSTPrep FF 16/10 column (Amersham, Sweden, cat. no. 17-5234-01 ) equilibrated with lysis buffer. Removal of unbound material was with 3 column volumes (CV) lysis buffer. Elution was with 2 CV of elution buffer (50 mM Tris/HCI pH 7.5, 300 mM NaCI, 5% (w/v) glycerol, 20 mM glutathione (Sigma, Germany, cat. no. G4251 )).
  • Peak fractions were pooled and the protein transferred into storage buffer (50 mM Tris/HCI pH 7.5, 200 mM NaCI, 0.1 mM ethylene glycol- bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA, Aldrich, Germany, cat. no. 23,453-2), 1 mM DTT, 10% (w/v) glycerol, 0.5 M sucrose (Sigma, Germany, cat. no. S0389) by gel filtration on a PD10 desalting column (Amersham, Sweden, cat. no. 17-0851 -01 ). Aliquots were shock frozen in liquid nitrogen and stored at -80°C.
  • storage buffer 50 mM Tris/HCI pH 7.5, 200 mM NaCI, 0.1 mM ethylene glycol- bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA, Aldrich, Germany
  • Activation of Mnk1 and Mnk2a was at a concentration of 2.5 ⁇ of either purified GST-Mnk1 or GST-Mnk2a by incubation with 150 nM pre-activated NHis-ERK2 (see ERK2 assay for preparation) and 50 ⁇ adenosine triphosphate (ATP, Sigma, cat. no. A2699) in a buffer comprising 20 mM N-(2-hydroxyethyl) piperazine-N'-(2- ethanesulfonic acid) (HEPES, Fluka, Germany, cat. no 54459)/potassium hydroxide (KOH, Roth, Germany, cat.
  • SUBSTRATE A carboxy-terminal amidated 12mer peptide with the sequence SEQ ID NO: 5 TATKSGSTTKNR,
  • LIGAND The peptide TATKSG-pS-TTKNR, containing an amidated carboxy- terminus and conjugated at the amino-terminus with the oxazine derived fluorophore depicted below was synthesized and used as ligand.
  • ANTIBODY SPF New Zealand White Rabbits have been immunized according to standard protocols with the peptide NH2-CTATKSG-pS-TTKNR-CONH2, coupled to keyhole limpet hemocyanin (KLH).
  • the immune globulin G (IgG) fraction was purified from serum of boosted animals by techniques known in the art. In brief, serum was subjected to protein A affinity chromatography. Eluted material was precipitated at 50% cold saturated ammonium sulfate, pellets dissolved and desalted. The resulting material was appropriate for use in below described assay without further antigen- specific purification.
  • ASSAY SETUP Inhibition of kinase activity of Mnk1 and Mnk2a was assessed with the same assay system, using pre-activated GST-Mnk1 or GST-Mnk2a, respectively.
  • the kinase reaction contains 30 ⁇ substrate peptide, 20 ⁇ ATP, 60 nM ligand and one of either 25 nM pre-activated Mnk1 or 2.5 nM pre-activated Mnk2a.
  • the reaction buffer conditions are 16 mM HEPES/KOH pH 7.4, 8 mM MgCI 2 , 0.4 mM DTT, 0.08 % (w/v) bovine serum albumin (BSA, Sigma, Germany, cat. no.
  • polyoxyethylene-sorbitan monolaureate Teween 20, Sigma, Germany, cat. no.
  • Mnk proteins can be assayed also by other in vitro kinase assay formats.
  • suitable kinase assays have been described in the literature in Knauf et al ., Mol Cell Biol. 2001 Aug;21 (16):5500-1 1 or in Scheper et al ., Mol Cell Biol . 2001 Feb;21 (3):743-54.
  • Mnk kinase assays can be performed such that a Mnk substrate such as a protein or a peptide, which may or may not include modifications as further described below, or others are phosphorylated by Mnk proteins having enzymatic activity in vitro.
  • the activity of a candidate agent can then be determined via its ability to decrease the enzymatic activity of the Mnk protein.
  • the kinase activity may be detected by change of the chemical, physical or immunological properties of the substrate due to phosphorylation.
  • the kinase substrate may have features, designed or endogenous, to facilitate its binding or detection in order to generate a signal that is suitable for the analysis of the substrates phosphorylation status.
  • kinase substrate may be linked to these or other features with a molecular spacer arm to avoid steric hindrance.
  • the kinase substrate may be labelled with a fluorophore.
  • the binding of the reagent to the labelled substrate in solution may be followed by the technique of fluorescence polarization as it is described in the literature.
  • a fluorescent tracer molecule may compete with the substrate for the analyte to detect kinase activity by a technique which is know to those skilled in the art as indirect fluorescence polarization.
  • radioactive gamma-ATP is used in the kinase reaction, and the effect of the test agent on the incorporation of radioactive phosphate in the test substrate is determined relative to control conditions.
  • Example MNK2 ICso [nM] Example MNK2 ICso .nM]
  • Diode array detection wavelength 210 - 420 nm
  • Diode array detection wavelength 210 - 420 nm
  • Solvent A H 2 O 0.1 % HCOOH
  • Solvent B Acetonitrile 0.1 % HCOOH
  • Solvents water with 0.1 % formic acid (A) and acetonitrile with 0.1 % formic acid (B)
  • Solvent A: H 2 O, 0.1 % TFA; B: methanol
  • Diode array detection wavelength 200 - 420 nm
  • Diode array detection wavelength 200 - 420 nm Mass: m/z 80 bis 800
  • Solvent A: HDO, 0.1% TFA B: methanol, 0.1 % TFA
  • Solvents A% H 2 O containing 0.1 % TFA; B% acetonitrile containing 0.1 % TFA
  • HATU (2-(7-aza-1 H-benzotriazole-1 -yl)-1 ,1 ,3,3-tetramethyluronium
  • DIAD diisopropyl azodicarboxylate
  • LiHMDS lithium hexymethyldisilazane
  • DIPEA diisopropylethyl amine
  • EDC 1 -ethyl-3-(3-dimethylaminopropyl)carbodiimid
  • the compound can be prepared analogously to XVIII, starting from (S,S)-4-fluoro-2- (2-Hydroxycyclohexyloxy)-anilin.
  • the compound was prepared analogously to XX, starting from (S,S)-1 ,2- Cyclohexanediol.
  • Acetylchloride were added to a mixture of 1 .8 g trans- 3-(5-fluoro-2-nitro- phenoxy)-cyclobutylamine trifluoroacetate and 3.7 ml triethylamine in 30 ml methylene chloride and stirred for 2 hours at rt. The mixture was extracted two times with water. The organic phase was dried and concentrated. The residue was stirred with diethylether and filtrated. The residue was dried in a drying cabinet.
  • LiHMDS (1 M solution in THF; 5.0 ml) was added slowly to an ice/ethanol-cooled solution of 3-methoxy-cyclohexanol (7:3 mixture of cis- and trans-isomers; 601 mg) in THF (8 ml). Cooling was suspended after 5 minutes and the mixture was stirred for 15 minutes at room temperature before addition of 2,4-difluoro-1 -nitro-benzene (482 ⁇ ). After 4 h another 1 .5 ml of LiHMDS (1 M solution in THF) was added and the reaction mixture was stirred over night at room temperature. The reaction mixture was quenched by addition of hydrochloric acid (0.1 M), diluted with ethyl acetate, and filtered through celite.
  • hydrochloric acid 0.1 M
  • the compound was prepared as described under 111.1 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Pain & Pain Management (AREA)
  • Endocrinology (AREA)
  • Rheumatology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Emergency Medicine (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to novel thienopyrimidine compounds of general formula (I), pharmaceutical compositions comprising these compounds and their therapeutic use for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof.

Description

4 - [CYCLOALKYLOXY (HETERO) ARYLAMINO] THIENO [2 , 3 - D] PYRIMIDINES HAVING MNKl/ MNK2 INHIBITING ACTIVITY FOR PHARMACEUTICAL COMPOSITIONS
The present invention relates to thienopy midine compounds and to novel pharmaceutical compositions comprising thienopyhmidine compounds.
Moreover, the present invention relates to the use of the thienopyhmidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or treatment of diseases which can be influenced by the inhibition of the kinase activity of Mnk1 (Mnk1 a or MnK1 b) and/or Mnk2 (Mnk2a or Mnk2b) or further variants thereof. Particularly, the present invention relates to the use of the thienopyhmidine compounds of the invention for the production of pharmaceutical compositions for the prophylaxis and/or therapy of metabolic diseases, such as diabetes, hyperlipidemia and obesity, hematopoietic disorders, neurodegenerative diseases, kidney damage, inflammatory disorders, and cancer and their consecutive complications and disorders associated therewith.
Metabolic diseases are diseases caused by an abnormal metabolic process and may either be congenital due to an inherited enzyme abnormality or acquired due to a disease of an endocrine organ or failure of a metabolically important organ such as the liver or the pancreas.
The present invention is more particularly directed to the treatment and/or
prophylaxis of in particular metabolic diseases of the lipid and carbohydrate
metabolism and the consecutive complications and disorders associated therewith.
Lipid disorders cover a group of conditions which cause abnormalities in the level and metabolism of plasma lipids and lipoproteins. Thus, hyperlipidemias are of particular clinical relevance since they constitute an important risk factor for the development of atherosclerosis and subsequent vascular diseases such as coronary heart disease.
Diabetes mellitus is defined as a chronic hyperglycemia associated with resulting damages to organs and dysfunctions of metabolic processes. Depending on its etiology, one differentiates between several forms of diabetes, which are either due to an absolute (lacking or decreased insulin secretion) or to a relative lack of insulin. Diabetes mellitus Type I (IDDM, insulin-dependent diabetes mellitus) generally occurs in adolescents under 20 years of age. It is assumed to be of auto-immune etiology, leading to an insulitis with the subsequent destruction of the beta cells of the islets of Langerhans which are responsible for the insulin synthesis. In addition, in latent autoimmune diabetes in adults (LADA; Diabetes Care. 8: 1460-1467, 2001 ) beta cells are being destroyed due to autoimmune attack. The amount of insulin produced by the remaining pancreatic islet cells is too low, resulting in elevated blood glucose levels (hyperglycemia). Diabetes mellitus Type II generally occurs at an older age. It is above all associated with a resistance to insulin in the liver and the skeletal muscles, but also with a defect of the islets of Langerhans. High blood glucose levels (and also high blood lipid levels) in turn lead to an impairment of beta cell function and to an increase in beta cell apoptosis.
Diabetes is a very disabling disease, because today's common anti-diabetic drugs do not control blood sugar levels well enough to completely prevent the occurrence of high and low blood sugar levels. Out of range blood sugar levels are toxic and cause long-term complications for example retinopathy, Tenopathy, neuropathy and peripheral vascular disease. There is also a host of related conditions, such as obesity, hypertension, heart disease and hyperlipidemia, for which persons with diabetes are substantially at risk.
Obesity is associated with an increased risk of follow-up diseases such as
cardiovascular diseases, hypertension, diabetes, hyperlipidemia and an increased mortality. Diabetes (insulin resistance) and obesity are part of the "metabolic syndrome" which is defined as the linkage between several diseases (also referred to as syndrome X, insulin-resistance syndrome, or deadly quartet). These often occur in the same patients and are major risk factors for development of diabetes type II and cardiovascular disease. It has been suggested that the control of lipid levels and glucose levels is required to treat diabetes type II, heart disease, and other occurrences of metabolic syndrome (see e.g., Diabetes 48: 1836-1841 , 1999; JAMA 288: 2209-2716, 2002).
In one embodiment of the present invention the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of metabolic diseases of the carbohydrate metabolism and their consecutive complications and disorders such as impaired glucose tolerance, diabetes (preferably diabetes type II), diabetic complications such as diabetic gangrene, diabetic arthropathy, diabetic osteopenia, diabetic glomerosclerosis, diabetic nephropathy, diabetic dermopathy, diabetic neuropathy, diabetic cataract and diabetic retinopathy, diabetic maculopathy, diabetic feet syndrome, diabetic coma with or without ketoacidosis, diabetic hyperosmolar coma, hypoglycemic coma, hyperglycemic coma, diabetic acidosis, diabetic ketoacidosis, intracapillary glomerulonephrosis, Kimmelstiel-Wilson syndrome, diabetic amyotrophy, diabetic autonomic neuropathy, diabetic
mononeuropathy, diabetic polyneuropathy, diabetic angiopathies, diabetic peripheral angiopathy, diabetic ulcer, diabetic arthropathy, or obesity in diabetes.
In a further embodiment the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of metabolic diseases of the lipid metabolism (i.e. lipid disorders) and their consecutive complications and disorders such as hypercholesterolemia, familial hypercholesterolemia, Fredrickson's hyperlipoproteinemia, hyperbetalipoproteinemia, hyperlipidemia, low-density- lipoprotein-type [LDL] hyperlipoproteinemia, pure hyperglyceridemia, endogenous hyperglyceridemia, isolated hypercholesterolemia, isolated hypertroglyceridemia, cardiovascular diseases such as hypertension, ischemia, varicose veins, retinal vein occlusion, atherosclerosis, angina pectoris, myocardial infarction, stenocardia, pulmonary hypertension, congestive heart failure, glomerulopaty, tubulointestitial disorders, renal failure, angiostenosis, or cerebrovascular disorders, such as cerebral apoplexy.
In a further embodiment of the present invention the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of hematopoetic disorders and their consecutive complications and disorders such as acute myeloid leukemia (AML), Morbus Hodgkin, Non-Hodgkin's lymphoma; hematopoetic disease, acute non-lymphocytic leukemia (ANLL), myeloproliferative disease acute
promyelocytic leukemia (APL), acute myelomonocytic leukemia (AMMoL), multiple myeloma, polycythemia vera, lymphoma, acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CCL), Wilm's tumor, or Ewing's Sarcoma.
In a further embodiment of the present invention the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of cancer and consecutive complications and disorders such as cancer of the upper gastrointestinal tract, pancreatic carcinoma, breast cancer, colon cancer, ovarian carcinoma, cervix carcinoma, endometrial cancer, brain tumor, testicular cancer, laryngeal carcinoma, osteocarcinoma, prostatic cancer, retinoblastoma, liver carcinoma, lung cancer, neuroblastoma, renal carcinoma, thyroid carcinoma, esophageal cancer, soft tissue sarcoma, skin cancer, osteosarcoma, rhabdomyosarcoma, bladder cancer, metastatic cancer, cachexia, or pain.
Certain anti-cancer drugs such as cisplatin are linked to serious side effects such as nephrotoxicity or ototoxicity, which can be dose limiting. Activation of Mnks has been linked to these side effects. In a further embodiment of the present invention, the compounds and compositions of the present invention are useful for the treatment and/or prophylaxis of ear or kidney damage, in particular for the prevention or treatment of ear and kidney drug induced damage Furthermore, the present invention relates to the use of thienopyrimidine compounds for the production of pharmaceutical compositions for the prophylaxis and/or therapy of cytokine related diseases.
Such diseases are i.a. inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, neurodegenerative diseases, allergies, or other conditions associated with proinflammatory cytokines. Allergic and inflammatory diseases such as acute or chronic inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, asthma and septic shock and their consecutive complications and disorders associated therewith.
Inflammatory diseases like rheumatoid arthritis, inflammatory lung diseases like COPD, inflammatory bowel disease and psoriasis afflict one in three people in the course of their lives. Not only do those diseases impose immense health care costs, but also they are often crippling and debilitating.
Although inflammation is the unifying pathogenic process of these inflammatory diseases below, the current treatment approach is complex and is generally specific for any one disease. Many of the current therapies available today only treat the symptoms of the disease and not the underlying cause of inflammation.
The compositions of the present invention are useful for the treatment and/or prophylaxis of inflammatory diseases and consecutive complications and disorders, such as chronic or acute inflammation, inflammation of the joints such as chronic inflammatory arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, Reiter's syndrome, rheumatoid traumatic arthritis, rubella arthritis, acute synovitis and gouty arthritis; inflammatory skin diseases such as sunburn, psoriasis, erythrodermic psoriasis, pustular psoriasis, eczema, dermatitis, acute or chronic graft formation, atopic dermatitis, contact dermatitis, urticaria and scleroderma; inflammation of the gastrointestinal tract such as inflammatory bowel disease, Crohn's disease and related conditions, ulcerative colitis, colitis, and diverticulitis; nephritis, urethritis, salpingitis, oophoritis, endomyometritis, spondylitis, systemic lupus erythematosus and related disorders, multiple sclerosis, asthma, meningitis, myelitis, encephalomyelitis, encephalitis, phlebitis, thrombophlebitis, respiratory diseases such as asthma, bronchitis, chronic obstructive pulmonary disease (COPD), inflammatory lung disease and adult respiratory distress syndrome, and allergic rhinitis; endocarditis, osteomyelitis, rheumatic fever, rheumatic
pericarditis, rheumatic endocarditis, rheumatic myocarditis, rheumatic mitral valve disease, rheumatic aortic valve disease, prostatitis, prostatocystitis,
spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis;
Hashimoto's thyroiditis, Kawasaki's disease, Raynaud's phenomenon, Sjogren's syndrome, neuroinflammatory disease, sepsis, conjunctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglottitis, bronchitis, pneumonitis, stomatitis, gingivitis, oesophagitis, gastritis, peritonitis, hepatitis, cholelithiasis, cholecystitis, glomerulonephritis, goodpasture's disease, crescentic glomerulonephritis, pancreatitis, endomyometritis, myometritis, metritis, cervicitis, endocervicitis, exocervicitis, parametritis,
tuberculosis, vaginitis, vulvitis, silicosis, sarcoidosis, pneumoconiosis, pyresis, inflammatory polyarthropathies, psoriatric arthropathies, intestinal fibrosis,
bronchiectasis and enteropathic arthropathies.
Moreover, cytokines are also believed to be implicated in the production and development of various cardiovascular and cerebrovascular disorders such as congestive heart disease, myocardial infarction, the formation of atherosclerotic plaques, hypertension, platelet aggregation, angina, stroke, Alzheimer's disease, reperfusion injury, vascular injury including restenosis and peripheral vascular disease, and, for example, various disorders of bone metabolism such as
osteoporosis (including senile and postmenopausal osteoporosis), Paget's disease, bone metastases, hypercalcaemia, hyperparathyroidism, osteosclerosis,
osteoporosis and periodontitis, and the abnormal changes in bone metabolism which may accompany rheumatoid arthritis and osteoarthritis.
Excessive cytokine production has also been implicated in mediating certain complications of bacterial, fungal and/or viral infections such as endotoxic shock, septic shock and toxic shock syndrome and in mediating certain complications of CNS surgery or injury such as neurotrauma and ischaemic stroke. Excessive cytokine production has, moreover, been implicated in mediating or exacerbating the development of diseases involving cartilage or muscle resorption, pulmonary fibrosis, cirrhosis, renal fibrosis, the cachexia found in certain chronic diseases such as malignant disease and acquired immune deficiency syndrome (AIDS), tumour invasiveness and tumour metastasis and multiple sclerosis. The treatment and/or prophylaxis of these diseases are also contemplated by the present invention
Additionally, the inventive compositions may be used to treat inflammation
associated with autoimmune diseases including, but not limited to, systemic lupus erythematosis, Addison's disease, autoimmune polyglandular disease (also known as autoimmune polyglandular syndrome), glomerulonephritis, rheumatoid arthritis scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, diabetes, autoimmune hemolytic anemia, glomerulonephritis, rheumatoid arthritis autoimmune neutropenia, thrombocytopenia, atopic dermatitis, chronic active hepatitis,
myasthenia gravis, multiple sclerosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, psoriasis, and graft vs. host disease.
In a further embodiment the compositions of the present invention may be used for the treatment and prevention of infectious diseases such as sepsis, septic shock, Shigellosis, and Helicobacter pylori and viral diseases including herpes simplex type 1 (HSV-1 ), herpes simplex type 2 (HSV-2), cytomegalovirus, Epstein-Barr, human immunodeficiency virus (HIV), acute hepatitis infection (including hepatitis A, hepatits B, and hepatitis C), HIV infection and CMV retinitis, AIDS or malignancy, malaria, mycobacterial infection and meningitis. These also include viral infections, by influenza virus, varicella-zoster virus (VZV), Epstein-Barr virus, human herpesvirus-6 (HHV-6), human herpesvirus-7 (HHV-7), human herpesvirus-8 (HHV-8), Poxvirus, Vacciniavirus, Monkeypoxvirus, pseudorabies and rhinotracheitis. The compositions of the present invention may also be used topically in the treatment or prophylaxis of topical disease states mediated by or exacerbated by excessive cytokine production, such as inflamed joints, eczema, psoriasis and other inflammatory skin conditions such as sunburn; inflammatory eye conditions including conjunctivitis; pyresis, pain and other conditions associated with inflammation.
Periodontal disease has also been implemented in cytokine production, both topically and systemically. Hence, use of compositions of the present invention to control the inflammation associated with cytokine production in such peroral diseases such as gingivitis and periodontitis is another aspect of the present invention.
Finally, the compositions of the present invention may also be used to treat or prevent neurodegenerative disease selected from Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, frontotemporal lobar dementia, spinocerebellar ataxia, dementia with Lewy bodies, cerebral ischemia or neurodegenerative disease caused by traumatic injury, glutamate neurotoxicity or hypoxia.
In a preferred embodiment the compositions of the present invention may be used to treat or prevent a disease selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn 's disease, ulcerative colitis, multiple sclerosis and asthma.
Protein kinases are important enzymes involved in the regulation of many cellular functions. The LK6-serine/threonine-kinase gene of Drosophila melanogaster was described as a short-lived kinase which can associate with microtubules (J. Cell Sci. 1997, 1 10(2): 209-219). Genetic analysis in the development of the compound eye of Drosophila suggested a role in the modulation of the RAS signal pathway (Genetics 2000 156(3): 1219-1230). The closest human homologues of Drosophila LK6-kinase are the MAP-kinase interacting kinase 2 (Mnk2, e.g. the variants Mnk2a and Mnk2b) and MAP-kinase interacting kinase 1 (Mnk1 ) and variants thereof. These kinases are mostly localized in the cytoplasm. Mnks are phosphorylated by the p42 MAP kinases Erk1 and Erk2 and the p38-MAP kinases. This phosphorylation is triggered in a response to growth factors, phorbol esters and oncogenes such as Ras and Mos, and by stress signaling molecules and cytokines. The phosphorylation of Mnk proteins stimulates their kinase activity towards eukaryotic initiation factor 4E (elF4E) (EMBO J. 16: 1909-1920, 1997; Mol Cell Biol 19, 1871 -1880, 1990; Mol Cell Biol 21 , 743-754, 2001 ). Simultaneous disruption of both, the Mnk1 and Mnk2 gene in mice diminishes basal and stimulated elF4E phosphorylation (Mol Cell Biol 24, 6539-6549, 2004). Phosphorylation of elF4E results in a regulation of the protein translation (Mol Cell Biol 22: 5500-551 1 , 2001 ).
There are different hypotheses describing the mode of the stimulation of the protein translation by Mnk proteins. Most publications describe a positive stimulatory effect on the cap-dependent protein translation upon activation of MAP kinase-interacting kinases. Thus, the activation of Mnk proteins can lead to an indirect stimulation or regulation of the protein translation, e.g. by the effect on the cytosolic phospholipase 2 alpha (BBA 1488:124-138, 2000).
WO 03/037362 discloses a link between human Mnk genes, particularly the variants of the human Mnk2 genes, and diseases which are associated with the regulation of body weight or thermogenesis. It is postulated that human Mnk genes, particularly the Mnk2 variants are involved in diseases such as e.g. metabolic diseases including obesity, eating disorders, cachexia, diabetes mellitus, hypertension, coronary heart disease, hypercholesterolemia, dyslipidemia, osteoarthritis, biliary stones, cancer of the genitals and sleep apnea, and in diseases connected with the ROS defense, such as e.g. diabetes mellitus and cancer. WO 03/03762 moreover discloses the use of nucleic acid sequences of the MAP kinase-interacting kinase (Mnk) gene family and amino acid sequences encoding these and the use of these sequences or of effectors of Mnk nucleic acids or polypeptides, particularly Mnk inhibitors and activators in the diagnosis, prophylaxis or therapy of diseases associated with the regulation of body weight or thermogenesis. WO 02/103361 describes the use of kinases 2a and 2b (Mnk2a and Mnk2b) interacting with the human MAP kinase in assays for the identification of
pharmacologically active ingredients, particularly useful for the treatment of diabetes mellitus type 2. Moreover, WO 02/103361 discloses also the prophylaxis and/or therapy of diseases associated with insulin resistance, by modulation of the expression or the activity of Mnk2a or Mnk2b. Apart from peptides, peptidomimetics, amino acids, amino acid analogues, polynucleotides, polynucleotide analogues, nucleotides and nucleotide analogues, 4-hydroxybenzoic acid methyl ester are described as a substance which binds the human Mnk2 protein.
First evidence for a role of Mnks in inflammation was provided by studies
demonstrating activation of Mnk1 by proinflammatory stimuli. The cytokines TNFa and IL-1 β trigger the activation of Mnk1 in vitro (Fukunaga and Hunter, EMBO J 16(8): 1921 -1933, 1997) and induce the phosphorylation of the Mnk-specific substrate elF4E in vivo (Ueda et al ., Mol Cell Biol 24(15): 6539-6549, 2004). In addition, administration of lipopolysaccharide (LPS), a potent stimulant of the inflammatory response, induces activation of Mnk1 and Mnk2 in mice, concomitant with a phosphorylation of their substrate elF4E (Ueda et al ., Mol Cell Biol 24(15): 6539-6549, 2004).
Furthermore, Mnk1 has been shown to be involved in regulating the production of proinflammatory cytokines. Mnk1 enhances expression of the chemokine RANTES (Nikolcheva et al., J Clin Invest 1 10, 1 19-126, 2002). RANTES is a potent chemotractant of monocytes, eosinophils, basophiles and, natural killer cells. It activates and induces proliferation of T lymphocytes, mediates degranulation of basophils and induces the respiratory burst in eosinophils (Conti and DiGioacchino, Allergy Asthma Proc 22(3):133-7, 2001 )
WO 2005/00385 and Buxade et al ., Immunity 23: 177-189, August 2005 both disclose a link between Mnks and the control of TNFa biosynthesis. The proposed mechanism is mediated by a regulatory AU-rich element (ARE) in the TNFa mRNA. Buxade et al. demonstrate proteins binding and controlling ARE function to be phosphorylated by Mnk1 and Mnk2. Specifically Mnk-mediated phosphorylation of the ARE-binding protein hnRNP A1 has been suggested to enhance translation of the TNFa mRNA. TNFa is not the only cytokine regulated by an ARE. Functional AREs are also found in the transcripts of several interleukins, interferones and chemokines (Khabar, J Interf Cytokine Res 25: 1 -10, 2005). The Mnk-mediated phosphorylation of ARE- binding proteins has thus the potential to control biosynthesis of cytokines in addition to that of TNFa.
Current evidence demonstrates Mnks as down stream targets of inflammatory signalling as well as mediators of the inflammatory response. Their involvement in the production of TNFa, RANTES, and potentially additional cytokines suggests inhibition of Mnks as strategy for anti-inflammatory therapeutic intervention.
Mnk1 and Mnk2 (including all splice forms) phosphorylate the translation factor elF4E on Serine 209. Mnk1 /2 double knockout mice completely lack phosphorylation on Serine 209, indicating that Mnk kinase are the only kinases able to phosphorylate this site in vivo (Ueda et al ., Mol Cell Biol . 2004; 24(15):6539-49). elF4E is
overexpressed in a wide range of human malignancies, and high elF4E expression is frequently associated with more aggressive disease and poor prognosis.
Furthermore, elF4E can act as an oncogene when assayed in standard assays for oncogenic activity (e.g. Ruggero et al., Nat Med. 2004 May;10(5):484-6). elF4E excerts its oncogenic activity by stimulating the translation of oncogenes such as c- myc and cyclinDI (Culjkovic et al ., J Cell Biol. 2006; 175(3):415-26), by increasing the expression of pro-survival factors such as MCP-1 (Wendel et al ., Genes Dev. 2007; 21 (24):3232-7) and by positively regulating pathways of drug resistance (Wendel et al., Nature 2004; 428(6980):332-7; Graff et el., Cancer Res. 2008;
68(3):631 -4; De Benedetti and Graff, Oncogene 2004; 23(18):3189-99; Barnhart and Simon, J Clin Invest. 2007; 1 17(9):2385-8). Suppression of elF4E expression by antisense oligonucleotides has shown promise in preclinical experiments with human tumor cells (Graff et al ., J Clin Invest. 2007; 1 17(9):2638-48). It has been shown that phosphorylation on Ser209 is strictly required for the oncogenic activity of elF4E in vitro and in vivo (Topisirovic et al ., Cancer Res. 2004; 64(23):8639-42; Wendel et al ., Genes Dev. 2007; 21 (24):3232-7). Thus, inhibition of Mnkl and Mnk2 is expected to have beneficial effects in human malignancies.
Inhibitors of Mnk (referred to as CGP57380 and CGP052088) have been described (cf. Mol. Cell. Biol. 21 , 5500, 2001 ; Mol Cell Biol Res Comm 3, 205, 2000; Genomics 69, 63, 2000). CGP052088 is a staurosporine derivative having an IC5o of 70 nM for inhibition of in vitro kinase activity of Mnkl . CGP57380 is a low molecular weight selective, non-cytotoxic inhibitor of Mnk2 (Mnk2a or Mnk2b) or of Mnkl : The addition of CGP57380 to cell culture cells, transfected with Mnk2 (Mnk2a or Mnk2b) or Mnkl showed a strong reduction of phosphorylated elF4E.
Further inhibitors of Mnk have been described. See for example Applicants patent applications WO 06/066937, describing pyrazolopyrimidine compounds, WO
06/136402 describing certain thienopyrimidine compounds, WO 07/1 15822 describing further thienopyrimidine compounds with modified core ring, and WO 08/006547 describing pyrrolopyrimidines as inhibitors of Mnk kinases.
The problem underlying the present invention is to provide potent and selective Mnkl and/or Mnk2 inhibitors which may effectively and safely be used for the treatment of metabolic diseases, inflammatory diseases, cancer, neurodegenerative diseases and their consecutive complication and disorders.
It has now been surprisingly found that certain thienopyrimidine compounds are potent inhibitors of the kinase enzymes Mnkl and/or Mnk2 and/or variants thereof and as such may be useful in the prophylaxis and/or therapy of diseases which can be influenced by the inhibition of the kinase activity of Mnkl and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof.
In contrast to the thienopyrimidine compounds known in the art, for example, the compoonds disclosed in the Applicants patent applications WO 06/136402 and WO 2007/1 15822, the thienopyrimidine compounds of the present invention provide several advantages, namely, enhanced solubility, the possibility to form stable salts, improved metabolic stability, enhanced or retained activity in biochemical or cellular Mnk activity assays and enhanced or retained selectivity against other kinases.
The thienopyrimidine compounds disclosed in WO 06/136402 and WO 07/1 15822 exhibit high activity in Mnk enzyme assays and extremely high selectivity, however they show a very low solubility and are in most cases metabolic unstable resulting in undesired pharmacokinetic properties.
It has been surprisingly found that by the introduction of a polar group at the R4- position in the compounds of general formula (I) below leads to surprising substantial metabolic stabilization, rendering the thienopyrimidines of the present invention useful for in vivo pharmacological applications.
Moreover, compounds described in this application also show improved solubility, have strong inhibitory potency in biochemical and cellular assays and are highly selective, resulting in overall greatly improved pharmacological properties.
If not specified otherwise, any alkyl moiety mentioned in this application may be straight-chained or branched.
Thienopyrimidine compounds of the present invention are compounds of the general formula (I):
Figure imgf000015_0001
wherein
X is CH or N R1 is a hydrogen or halogen atom,
R2 is C3-7 cycloalkyi group that is substituted with one or two substituents selected from oxo, halogen, Ch alky!, hydroxy, Ci-3 alkoxy, Ci-4 alkoxy-carbonyl, amino and morpholinyl, wherein the hydrogen atoms of the amino group may optionally be
independently replaced by a Ch alky!, Ci-3 alkoxy-(CH2)m-, Ci-4 alkoxy- carbonyl, Ci-3 alkylsulfonyl, Ci-3 alkyl-carbonyl, C3-6-cycloalkyl-carbonyl or piperidinyl group, wherein m is 2 or 3 and wherein the piperidinyl group may optionally be substituted by a methyl group, wherein two substituents, which are attached to the same carbon atom, together may form a -O-(CH2)2-O- group, and wherein two substituents, which are attached to two adjacent carbon atoms, together may form a -O-CH2-O- or -O-C(CH3)2-O- group,
R3 is a Ci-2 alkyl group and
R4 is a carboxy, Ci-3 alkoxy-carbonyl, aminocarbonyl, N-(Ci-4 alkyl)-aminocarbonyl or N,N-[di-(Ci-4 alkyl)]-aminocarbonyl group, wherein the aminocarbonyl group may be substituted with a Ci-3 akylsulfonyl, CN, OH, Ci-3 alkoxy, C3-6 cycloalkyi, -CH2-C≡C-CH2-NH2, -CH2-C≡C-CH2-
NH(Ci-3 alkyl) or -CH2-C≡C-CH2-N(Ci-3 alkyl)2 group or with a piperidinyl or pyrrolidinyl group bound via a carbon atom, and wherein the alkyl moieties of the above-mentioned N-(Ci-4 alkyl)-amino- carbonyl and N,N-[di-(Ci-4 alkyl)]-aminocarbonyl groups may optionally be substituted with an aminocarbonyl, N-(Ci-3 alkyl)-aminocarbonyl or N,N-[di- (Ci-3 alkyl)]-aminocarbonyl group or with a pyrrolidinyl, oxazolyl, imidazolyl, piperidinyl or morpholinyl group, each bound via a carbon atom, or, from position 2 of an ethyl, propyl or butyl moiety onwards, with a OH, CN, Ci-3 alkoxy, amino, N-(Ci-3 alkyl)-amino, N,N-[di-(Ci-3 alkyl)]-amino, Ci-5 alkyloxy- carbonyl-amino, morpholino, piperidino, piperazino or imidazolyl group, wherein each of the above-mentioned cycloalkyl, pyrrolidinyl, oxazolyl, piperidinyl, morpholinyl, piperazinyl and imidazolyl groups may be substituted with a methyl, amino , hydroxy group or Ci-3 alkoxy, or a tautomer, enantiomer, diastereomer or salt thereof.
Preferred compounds of formula (I) are those, wherein X, R1, R2 and R4 are as defined above and R3 is methyl, or a tautomer, enantiomer, diastereomer or salt thereof.
One aspect of the invention concerns those compounds of formula (I), wherein R2 to R4 are as defined above and X is CH and
R1 is a fluorine atom, or a tautomer, enantiomer, diastereomer or salt thereof.
Another aspect of the invention concerns those compounds of formula (I), wherein R2 to R4 are as defined above and X is N and
R1 is a hydrogen atom, or a tautomer, enantiomer, diastereomer or salt thereof.
More preferred compounds of formula (I) are those, wherein X and R1 to R3 are as defined above, and
R4 is carboxy, Ci-3 alkoxy-carbonyl, aminocarbonyl or N-(Ci-3 alkyl)-aminocarbonyl group, wherein the methyl moiety of the above-mentioned N-(methyl)-aminocarbonyl group may optionally be substituted with a piperidinyl, N-methyl-piperidinyl or morphoinyl group, each bound via a carbon atom, and wherein the ethyl resp. propyl moiety of the above-mentioned N-(C2-3 alkyl)-aminocarbonyl group may optionally be terminally substituted with hydroxy, methoxy, amino, N-methyl- amino, Ν,Ν-dimethyl-amino, morpholino, imidazolyl, 4-methyl-piperazinyl, 1 - methyl-pyrrolidinyl, piperidinyl, pyrrolidinyl or 4-hydroxy-piperidino group, or a tautomer, enantiomer, diastereomer or salt thereof. Even more preferred compounds of formula (I) are those, wherein
X and R1 to R3 are as defined as above, and R4 is aminocarbonyl or N-(Ci-3 alkyl)-aminocarbonyl group, wherein the methyl moiety of the above-mentioned N-(methyl)-aminocarbonyl group may optionally be substituted with a piperidinyl, N-methyl-piperidinyl or morpholinyl group, each bound via a carbon atom, and wherein the ethyl resp. propyl moiety of the above-mentioned N-(C2-3 alkyl)-aminocarbonyl group may optionally be terminally substituted with hydroxy, methoxy, amino, N-methyl- amino, Ν,Ν-dimethyl-amino, morpholino, imidazolyl, 4-methyl-piperazinyl, 1 - methyl-pyrrolidinyl, piperidinyl, pyrrolidinyl or 4-hydroxy-piperidino group, or a tautomer, enantiomer, diastereomer or salt thereof.
Another set of more preferred compounds of formula (I) are those, wherein
X, R1, R3 and R4 are as defined above, and
R2 is cyclopentyl substituted with one or two hydroxy or methoxy groups or with an amino, methylcarbonyl-amino, N-methyl-N-methylcarbonyl-amino group or wherein two adjacent carbon atoms are linked to each other via a -O-CH2-O- or -O-C(CH3)2- O- group, or cyclohexyl substituted with one or two fluorine atoms or one or two hydroxy or methoxy groups or an oxo, Ci-3 alkoxy-carbonyl, morpholino, methyl-piperidinyl or an amino group, wherein the hydrogen atoms of the amino group my optionally independently be replaced with a methyl, methylcarbonyl, 2-methoxy-ethyl or methylsulfonyl group, or wherein two adjacent carbon atoms are linked to each other via-O-C(CH3)2-O- group or wherein two hydrogen atoms attached to the same carbon atom are replaced by a -O-(CH2)2-O- group, or a tautomer, enantiomer, diastereomer or salt thereof, particularly those compounds of formula (I), wherein
X, R1, R3 and R4 are as defined as above, and R2 is cyclohexyl substituted with one hydroxy or methoxy group, cyclopentyl substituted with one hydroxy, methoxy, methylcarbonyl-amino or N- methyl-N-methylcarbonyl-amino group or cyclopentyl, wherein two adjacent carbon atoms are linked to each other via a -O- CH2-O- group, or cyclobutyl substituted with a methylcarbonyl-amino or methylcarbonyl-N(methyl)- amino group, or a tautomer, enantiomer, diastereomer or salt thereof. Particularly preferred are the following compounds of formula (I)
Figure imgf000020_0001
Figure imgf000021_0001
Typical methods of preparing the compounds of the invention are described below in the experimental section.
The potent inhibitory effect of the compounds of the invention may be determined by in vitro enzyme assays as described below in more detail.
The compounds of the present invention can be synthesized according to the following synthesis schemes:
Figure imgf000022_0001
Figure imgf000022_0002
D
Compounds of the general formula C can be synthesized by reaction of a compound A with the deprotonated alcohol B in appropriate solvents such as THF or DMF at a temperature between 0 °C and 150 °C. The deprotonated form of B can be obtained by deprotonation with a base such as sodium hydride or lithium hexamethyldisilazane at a preferred temperature of 0 °C. Hydrogenation of compound C in order to obtain a compound of the general formula D can be achieved by reacting C in the presence of hydrogen and a catalyst such as palladium or Raney nickel. The hydrogen can be introduced as a gas or stem from a hydrogen source such as ammonium formate.
Figure imgf000023_0001
Compounds of the general formula C can be also obtained by Mitsunobu reaction of a compound with the general formula E with an alcohol B in the presence of triphenylphosphine and an dialkylazodicarboxylate such as diethylazodicarboxylate, diisopropylazodicarboxylate or di-tert.butylazodiacarboxylate in a solvent such as THF at temperatures between -10 °C and 80 °C, preferrably between 0 °C and 30 °C.
Figure imgf000023_0002
Figure imgf000023_0003
A compound of the formula G can be synthesized by reaction of compound D with F preferably in the presence of an acid such as p-toluene sulfonic acid or hydrochloric acid in solvents such as dioxan at temperatures between 10 °C and 150 °C.
Synthesis of a compound with the general formula H_can be achieved by reaction of compound G_with a base such as sodium hydroxide or lithium hydroxide in solvents such as methanol, ethanol, THF and water or mixtures thereof, preferably in ethanol/THF or THF/water at temperatures between 10 °C and 100 °C. A compound of the general formula J can be obtained by reaction of compound H with amines of the general formula ]_using amide coupling procedures employing reagents such as TBTU, HATU or EDC/ N-Hydroxysuccinimide in the presence or absence of bases such as diisopropylethylamine in solvents such as DMF or THF at temperatures between 0 °C and 120 °C preferably between 0 °C and 30 °C.
Pharmaceutically acceptable salts of the compounds of the invention of formula (1 ) can be formed with numerous organic and inorganic acids and bases. Exemplary acid addition salts including acetate, adipate, alginate, ascorbate, aspartate, benzoate, benzenesulfonate, bisulfate, borate, butyrate, citrate, camphorate, camphersulfonate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethane sulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethane sulfonate, lactate, maleate, methane sulfonate, 2-naphthalene sulfonate, nicotinate, nitrate, oxalate, pamoate, pectinate, persulfate, 3-phenyl sulfonate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, sulfonate, tartrate, thiocyanate, toluene sulfonate such as tosylate, undecanoate, or the like.
Basic nitrogen-containing moieties can be quaternized with such agents as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chloride, bromide and iodide; dialkyl sulfates like dimethyl, diethyl, dibutyl, and diamyl sulfates, long-chain alkyl halides such as decyl, lauryl, myristyl and stearyl chloride, bromide and iodide, or aralkyl halides like benzyl and phenethyl bromides, or others. Water soluble or dispersible products are thereby obtained.
Pharmaceutically acceptable basic addition salts include but are not limited to cations based on the alkaline and alkaline earth metals such as sodium, lithium, potassium, calcium, magnesium, aluminum salts and the like, as well as non toxic ammonium quarternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine and the like. Other representative amines useful for the formation of base addition salts include benzazethine, dicyclohexyl amine, hydrabine, N-methyl-D-glucamine, N-methyl-D-glucamide, t-butyl amine, diethylamine, ethylendiamine, ethanolamine, diethanolamine, piperazine and the like and salts with amino acids such as arginine, lysine, or the like.
Unless specifically indicated, throughout the specification and the appended claims, a given chemical formula or name shall encompass tautomers and all stereo, optical and geometrical isomers (e.g. enantiomers, diastereomers, E/Z isomers etc ..) and racemates thereof as well as mixtures in different proportions of the separate enantiomers, mixtures of diastereomers, or mixtures of any of the foregoing forms where such isomers and enantiomers exist, as well as salts, including
pharmaceutically acceptable salts thereof and solvates thereof such as for instance hydrates including solvates of the free compounds or solvates of a salt of the compound.
As used herein the term "metabolite" refers to (i) a product of metabolism, including intermediate and products, (ii) any substance involved in metabolism (either as a product of metabolism or as necessary for metabolism), or (iii) any substance produced or used during metabolism. In particular it refers to the end product that remains after metabolism. As used herein the term "prodrug" refers to (i) an inactive form of a drug that exerts its effects after metabolic processes within the body convert it to a usable or active form, or (ii) a substance that gives rise to a pharmacologically active metabolite, although not itself active (i.e. an inactive precursor). The terms "prodrug" or "prodrug derivative" mean a covalently-bonded derivative or carrier of the parent compound or active drug substance which undergoes at least some biotransformation prior to exhibiting its pharmacological effect(s). In general, such prodrugs have metabolically cleavable groups and are rapidly transformed in vivo to yield the parent compound, for example, by hydrolysis in blood, and generally include esters and amide analogs of the parent compounds. The prodrug is formulated with the objectives of improved chemical stability, improved patient acceptance and compliance, improved bioavailability, prolonged duration of action, improved organ selectivity, improved formulation (e.g., increased hydrosolubility), and/or decreased side effects (e.g., toxicity). In general, prodrugs themselves have weak or no biological activity and are stable under ordinary conditions. Prodrugs can be readily prepared from the parent compounds using methods known in the art, such as those described in A Textbook of Drug Design and Development,
Krogsgaard-Larsen and H. Bundgaard (eds.), Gordon & Breach, 1991 , particularly Chapter 5: "Design and Applications of Prodrugs"; Design of Prodrugs, H. Bundgaard (ed.), Elsevier, 1985; Prodrugs: Topical and Ocular Drug Delivery, K.B. Sloan (ed.), Marcel Dekker, 1998; Methods in Enzvmology, K. Widder et al. (eds.), Vol. 42, Academic Press, 1985, particularly pp. 309-396; Burger's Medicinal Chemistry and Drug Discovery, 5th Ed., M. Wolff (ed.), John Wiley & Sons, 1995, particularly Vol. 1 and pp. 172-178 and pp. 949-982; Pro-Drugs as Novel Delivery Systems, T. Higuchi and V. Stella (eds.), Am. Chem. Soc, 1975; Bioreversible Carriers in Drug Design, E.B. Roche (ed.), Elsevier, 1987, each of which is incorporated herein by reference in their entireties.
The term "pharmaceutically acceptable prodrug" as used herein means a prodrug of a compound of the invention which is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible.
As used herein the term "C3-10 cycloalkyl" or "C3-8 cycloalkyl" refers to mono- or polycyclic carbocyclic alkyl substituent or group having 3 to 10 or 3 to 8 ring atoms respectively, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, cycloheptenyl, cycloheptadienyl, cycloheptatrienyl perhydrated naphthalene or indene, adamantyl or norbonanyl and the like.
The term "Ci_s alkyl" as used herein alone or in combination with other terms such as in alkoxy refers to a Ci_s, preferably Ci_4 straight or branched alkyl/alkoxy group such as methyl, ethyl, propyl (iso-, n-), butyl (iso-, n-, sec-, tert-), pentyl, hexyl, methoxy, ethoxy, propoxy (iso-, n-), butoxy (iso-, n-, sec-, tert-), pentoxy, hexoxy; moreover, the term "Ci_8 alkyl" also includes an alkyl group which may contain oxygen in the chain and may be substituted with halogen to form an ether or halogenated ether group.
Any hydrogen atom, particularly in an alkyl, alkoxy or alkenyl group may be replaced by a fluorine atom. The term "C2-8 alkenyl" by itself or as part of another group refers to a straight or branched alkenyl group of 2 to 8 carbons, preferably 2 to 6 carbons, in the normal chain, which include one or more double bonds in the normal chain, such as vinyl, 2- propenyl, 3-butenyl, 2-butenyl, 4-pentenyl, 3-pentenyl, 2-hexenyl, 3-hexenyl, 2- heptenyl, 3-heptenyl, 4-heptenyl, 3-octenyl .
The term "heterocyclyl" refers to monocyclic saturated or unsaturated heterocyclyl groups with 1 to 4 hetero atoms selected from N, S and O, with the remainder of the ring atoms being carbon atoms and having preferably a total number of ring atoms of 3 to 10, such as morpholino, piperazinyl, piperidinyl, pyridyl, pyrimidinyl, thiazolyl, indolyl, imidazolyl, oxadiazolyl, tetrazolyl, pyrazinyl, triazolyl, thiophenyl or furanyl .
The term "heteroaryl" refers to a mono- or bicyclic aromatic group with 1 to 4 hetero atoms selected from N, S and O, with the remainder of the ring atoms being carbon atoms and having preferably a total number of ring atoms of 5 to 10. Examples without limitation of heteroaryl groups are such as benzofuranyl, furyl, thienyl, benzothienyl, thiazolyl, imidazolyl, oxazolyl, oxadiazolyl, thiadiazolyl, benzothiazolyl, triazolyl, tetrazolyl, isoxazolyl, isothiazolyl, pyrrolyl, pyranyl, tetrahydropyranyl, pyrazolyl, pyridyl, quinolinyl, isoquinolinyl, purinyl, carbazolyl, benzoxazolyl, benzamidazolyl, indolyl, isoindolyl, pyrazinyl, diazinyl, pyrazine, triazinyltriazine, tetrazinyl, tetrazolyl, benzothiophenyl, benzopyridyl and benzimidazolyl . In a further aspect the present invention provides pharmaceutical compositions comprising a thienopyrimidine compound of the present invention and optionally a pharmaceutically acceptable carrier. The pharmaceutical composition according to the present invention may further comprise an additional therapeutic agent. Particularly preferred are compositions, wherein the additional therapeutic agent is selected from antidiabetics like insulin, long and short acting insulin analogues, sulfonylureas, biguanides, DPP-IV inhibitors, SGLT2 inhibitors, 1 1 β-HSD inhibitors, glucokinase activators, AMPK activators, Glp- 1 receptor agonists, GIP receptor agonists, DGAT inhibitors, PPARgamma agonists, PPARdelta agonists, and other antidiabetics derived from thiazolidinediones, lipid lowering agents such as statines, fibrates, ion exchange resins nicotinic acid derivatives, or HMG-CoA reductase inhibitors, cardiovascular therapeutics such as nitrates, antihypertensiva such as β-blockers, ACE inhibitors, Ca-channel blockers, angiotensin II receptor antagonists, diuretics, thrombocyte aggregation inhibitors, or antineoplastic agents such as alkaloids, alkylating agents, antibiotics, or
antimetabolites, or anti-obesity agents. Further preferred compositions are
compositions wherein the additional therapeutic agent is selected from a histamine antagonist, a bradikinin antagonist, serotonin antagonist, leukotriene, an anti- asthmatic, an NSAID, an antipyretic, a corticosteroid, an antibiotic, an analgetic, a uricosuric agent, chemotherapeutic agent, an anti gout agent, a bronchodilator, a cyclooxygenase-2 inhibitor, a steroid, a 5-lipoxygenase inhibitor, an
immunosuppressive agent, a leukotriene antagonist, a cytostatic agent, an
antineoplastic agent, a mTor inhibitor, a Tyrosine kinase inhibitor, antibodies or fragments thereof against cytokines and soluble parts (fragments) of cytokine receptors.
More particularly preferred are compounds such as human NPH insulin, human lente or ultralente insulin, insulin Lispro, insulin Aspart, insulin Glulisine, insulin detemir or insulin Glargine, metformin, phenformin, acarbose, miglitol, voglibose, pioglitazone, rosiglizatone, rivoglitazone, aleglitazar, alogliptin, saxagliptin, sitagliptin, vildagliptin, exenatide, liraglutide, albiglutide, pramlintide, carbutamide, chlorpropamide, glibenclamide (glyburide), gliclazide, glimepiride, glipizide, gliquidone, tolazamide, tolbutamide, atenolol, bisoprolol, metoprolol, esmolol, celiprolol, talinolol, oxprenolol, pindolol, propanolol, bupropanolol, penbutolol, mepindolol, sotalol, certeolol, nadolol, carvedilol, nifedipin, nitrendipin, amlodipin, nicardipin, nisoldipin, diltiazem, enalapril, verapamil, gallopamil, quinapril, captopril, lisinopril, benazepril, ramipril, peridopril, fosinopril, trandolapril, irbesatan, losartan, valsartan, telmisartan, eprosartan, olmesartan, hydrochlorothiazide, piretanid, chlorotalidone, mefruside, furosemide, bendroflumethiazid, triamterene, dehydralazine, acetylsalicylic acid, tirofiban-HCI, dipyramidol, triclopidin, iloprost-trometanol, eptifibatide, clopidogrel, piratecam, abciximab, trapidil, simvastatine, bezafibrate, fenofibrate, gemfibrozil, etofyllin, clofibrate, etofibrate, fluvastatine, lovastatine, pravastatin, colestyramide, colestipol- HCI, xantinol nicotinat, inositol nicotinat, acipimox, nebivolol, glycerolnitrate, isosorbide mononitrate, isosorbide dinitrate, pentaerythrityl tetranitrate, indapamide, cilazepril, urapidil, eprosartan, nilvadipin, metoprolol, doxazosin, molsidormin, moxaverin, acebutolol, prazosine, trapidil, clonidine, vinca alkaloids and analogues such as vinblastin, vincristin, vindesin, vinorelbin, podophyllotoxine derivatives, etoposid, teniposid, alkylating agents, nitroso ureas, N-lost analogues,
cycloplonphamid, estamustin, melphalan, ifosfamid, mitoxantron, idarubicin, doxorubicin, bleomycin, mitomycin, dactinomycin, daptomycin, docetaxel, paclitaxel, carboplatin, cisplatin, oxaliplatin, BBR3464, satraplatin, busulfan, treosulfan, procarbazine, dacarbazine, temozolomide, chlorambucil, chlormethine,
cyclophosphamide, ifosfamide, melphalan, bendamustine, uramustine, ThioTEPA, camptothecin, topotecan, irinotecan, rubitecan, etoposide, teniposide, cetuximab, panitumumab, trastuzumab, rituximab, tositumomab, alemtuzumab, bevacizumab, gemtuzumab, aminolevulinic acid, methyl aminolevulinate, porfimer sodium, verteporfin, axitinib, bosutinib, cediranib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, lestaurtinib, nilotinib, semaxanib, sorafenib, sunitinib, vandetanib, retinoids (alitretinoin, tretinoin), altretamine, amsacrine, anagrelide, arsenic trioxide, asparaginase (pegaspargase), bexarotene, bortezomib, denileukin diftitox, estramustine, ixabepilone, masoprocol, mitotane, testolactone, tipifarnib, abetimus, deforolimus, everolimus, gusperimus, pimecrolimus, sirolimus, tacrolimus,
temsirolimus, antimetabolites such as cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, combinations such as ad amycin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides.
Other particularly preferred compounds are compounds such as clemastine, diphenhydramine, dimenhydrinate, promethazine, cetirizine, astemizole,
levocabastine, loratidine, terfenadine, acetylsalicylic acid, sodoum salicylate, salsalate, diflunisal, salicylsalicylic acid, mesalazine, sulfasalazine, osalazine, acetaminophen, indomethacin, sulindac, etodolac, tolmetin, ketorolac,
bethamethason, budesonide, chromoglycinic acid, dimeticone, simeticone, domperidone, metoclopramid, acemetacine, oxaceprol, ibuprofen, naproxen, ketoprofen, flubriprofen, fenoprofen, oxaprozin, mefenamic acid, meclofenamic acid, pheylbutazone, oxyphenbutazone, azapropazone, nimesulide, metamizole, leflunamide, eforicoxib, lonazolac, misoprostol, paracetamol, aceclofenac,
valdecoxib, parecoxib, celecoxib, propyphenazon, codein, oxapozin, dapson, prednisone, prednisolon, triamcinolone, dexibuprofen, dexamethasone, flunisolide, albuterol, salmeterol, terbutalin, theophylline, caffeine, naproxen, glucosamine sulfate, etanercept, ketoprofen, adalimumab, hyaluronic acid, indometacine, proglumetacine dimaleate, hydroxychloroquine, chloroquine, infliximab, etofenamate, auranofin, gold, [224Ra]radiunn chloride, tiaprofenic acid, dexketoprofen(trometamol), cloprednol, sodium aurothiomalate aurothioglucose, colchicine, allopurinol, probenecid, sulfinpyrazone, benzbromarone, carbamazepine, lornoxicam,
fluorcortolon, diclofenac, efalizumab, idarubicin, doxorubicin, bleomycin, mitomycin, dactinomycin, daptomycin, cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, adriamydin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides, penicillamine, a hyaluronic acid preparation, arteparon, glucosamine, MTX, soluble fragments of the TNF-receptor (such as etanercept (Enbrel)) and antibodies against TNF (such as infliximab (Remicade), natalizumab (Tysabri) and adalimumab (Humira)). It will be appreciated by the person of ordinary skill in the art that the compounds of the invention and the additional therapeutic agent may be formulated in one single dosage form, or may be present in separate dosage forms and may be either administered concomitantly (i.e. at the same time) or sequentially.
The pharmaceutical compositions of the present invention may be in any form suitable for the intended method of administration.
The compounds of the present invention may be administered orally, parenterally, such as bronchopulmonary, subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, transdermally, transmucosally, subdurally, locally or topically via iontopheresis, sublingually, by inhalation spray, aerosol or rectally and the like in dosage unit formulations optionally comprising conventional
pharmaceutically acceptable excipients.
Excipients that may be used in the formulation of the pharmaceutical compositions of the present invention comprise carriers, vehicles, diluents, solvents such as monohydric alcohols such as ethanol, isopropanol and polyhydric alcohols such as glycols and edible oils such as soybean oil, coconut oil, olive oil, safflower oil cottonseed oil, oily esters such as ethyl oleate, isopropyl myristate; binders, adjuvants, solubilizers, thickening agents, stabilizers, disintergrants, glidants, lubricating agents, buffering agents, emulsifiers, wetting agents, suspending agents, sweetening agents, colorants, flavors, coating agents, preservatives, antioxidants, processing agents, drug delivery modifiers and enhancers such as calcium
phosphate, magnesium state, talc, monosaccharides, disaccharides, starch, gelatine, cellulose, methylcellulose, sodium carboxymethyl cellulose, dextrose, hydroxypropyl- β-cyclodextrin, polyvinylpyrrolidone, low melting waxes, ion exchange resins.
Other suitable pharmaceutically acceptable excipients are described in Remington's Pharmaceutical Sciences, 15th Ed., Mack Publishing Co., New Jersey (1991 ). Dosage forms for oral administration include tablets, capsules, lozenges, pills, wafers, granules, oral liquids such as syrups, suspensions, solutions, emulsions, powder for reconstitution. Dosage forms for parenteral administration include aqueous or olageous solutions or emulsions for infusion, aqueous or olageous solutions, suspensions or emulsions for injection pre-filled syringes, and/or powders for reconstitution.
Dosage forms for local/topical administration comprise insufflations, aerosols, metered aerosols, transdermal therapeutic systems, medicated patches, rectal suppositories, and/or ovula. The amount of the compound of the present invention that may be combined with the excipients to formulate a single dosage form will vary upon the host treated and the particular mode of administration.
The pharmaceutical compositions of the invention can be produced in a manner known per se to the skilled person as described, for example, in Remington's
Pharmaceutical Sciences, 15th Ed., Mack Publishing Co., New Jersey (1991 ).
In a further aspect of the invention the use of a thienopyrimidine compound of the present invention for the production of a pharmaceutical composition for inhibiting the activity of the kinase activity of Mnk1 or Mnk2 (Mnk2a, Mnk2b) or further variants thereof is provided, in particular for the prophylaxis or therapy of metabolic diseases, hematopoietic disorders, cancer and their consecutive complications and disorders. Whereby the prophylaxis and therapy of metabolic diseases of the carbohydrate and/or lipid metabolism is preferred.
Diseases of the invention that are influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or further variants thereof include diseases related to the regulation of metabolic diseases, such as obesity, eating disorders, cachexia, diabetes mellitus, metabolic syndrome, hypertension, coronary heart diseases, hypercholesterolemia, dyslipidemia, osteoarthritis, biliary stones and/or sleep apnea and diseases related to reactive oxygen compounds (ROS defense) such as diabetes mellitus, neurodegenerative diseases and cancer. The pharmaceutical compositions of the invention are particularly useful for prophylaxis and treatment of obesity, diabetes mellitus and other metabolic diseases of the carbohydrate and lipid metabolism as stated above, in particular diabetes mellitus and obesity.
Thus in a more preferred embodiment of this invention the use of a thienopyrimidine compound for the production of a pharmaceutical composition for the prophylaxis or therapy of metabolic diseases is provided.
In yet a further aspect of the invention the use of a thienopyrimidine compound of the invention for the production of a pharmaceutical composition for treating or preventing a cytokine mediated disorder such as an inflammatory disease is provided.
The pharmaceutical compositions of the invention are thus useful for the prophylaxis or therapy of inflammatory diseases, in particular chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, gouty arthritis; psoriasis, erythrodermic psoriasis, pustular psoriasis, inflammatory bowel disease, Crohn's disease and related conditions, ulcerative colitis, colitis, diverticulitis, nephritis, urethritis, salpingitis, oophoritis, endomyometritis, spondylitis, systemic lupus erythematosus and related disorders, multiple sclerosis, asthma, meningitis, myelitis, encephalomyelitis, encephalitis, phlebitis, thrombophlebitis, chronic obstructive disease (COPD), inflammatory lung disease, allergic rhinitis, endocarditis, osteomyelitis, rheumatic fever, rheumatic pericarditis, rheumatic endocarditis, rheumatic myocarditis, rheumatic mitral valve disease, rheumatic aortic valve disease, prostatitis,
prostatocystitis, spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis; Hashimoto's thyroiditis, Kawasaki's disease, Raynaud's phenomenon, Sjogren's syndrome, neuroinflammatory disease, sepsis, conjubctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglottitis, bronchitis, pneumonitis, stomatitis, gingivitis, oesophagitis, gastritis, peritonitis, hepatitis, cholelithiasis, cholecystitis, glomerulonephritis, goodpasture's disease, crescentic glomerulonephritis, pancreatitis, dermatitis, endomyometritis, myometritis, metritis, cervicitis,
endocervicitis, exocervicitis, parametritis, tuberculosis, vaginitis, vulvitis, silicosis, sarcoidosis, pneumoconiosis, inflammatory polyarthropathies, psoriatric
arthropathies, intestinal fibrosis, bronchiectasis and enteropathic arthropathies.
As already stated above, the compositions of the present invention are particularly useful for treating or preventing a disease selected from chronic or acute
inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn's disease, ulcerative colitis, multiple sclerosis and asthma.
Thus, in a more preferred embodiment of this invention the use of a thienopynmidine compound for the production of a pharmaceutical composition for the prophylaxis or therapy of inflammatory diseases selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock Crohn's disease, ulcerative colitis, multiple sclerosis and asthma is provided.
In yet a further aspect of the invention the use of a thienopynmidine compound of the invention for the production of a pharmaceutical composition for treating or preventing cancer, viral diseases or neurodegenerative diseases is provided.
For the purpose of the present invention, a therapeutically effective dosage will generally be from about 1 to 2000 mg/day, preferably from about 10 to about 1000 mg/day, and most preferably from about 10 to about 500 mg/day, which may be administered in one or multiple doses. It will be appreciated, however, that specific dose level of the compounds of the invention for any particular patient will depend on a variety of factors such as age, sex, body weight, general health condition, diet, individual response of the patient to be treated time of administration, severity of the disease to be treated, the activity of particular compound applied, dosage form, mode of application and concomitant medication. The therapeutically effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgment of the ordinary clinician or physician. Kinase Fluorescence Polarization Assays
Assay principle: Inhibitory potency of compounds against Mnk1 , Mnk2a and other kinases was assessed with assays based on a format known to those skilled in the art as the indirect (competitive) fluorescence polarization. The assay detection system comprises a small fluorophore-labeled phospho-peptide (termed ligand) bound to a phospho-specific antibody. The product generated by the kinase reaction competes with the ligand for antibody binding. Based on the larger molecular volume of the bound ligand, which results in a lower rotation rate in solution, its emitted light has a higher degree of polarization than the one from the free ligand.
Description of the specific homogenous kinase assay
Example 2a. Mnk1 and Mnk2a in vitro kinase assay
As a source of enzyme, human Mnk1 and human Mnk2a were expressed as GST fusion proteins in E. coli, purified to >80% homogeneity by glutathione affinity chromatography and activated in vitro with pre-activated ERK2. In brief, the open reading frames of human Mnk1 and Mnk2a were amplified from cDNA using the forward/reverse primer pairs
SEQ ID NO: 1 5TTTAGGATCCGTATCTTCTCAAAAGTTGG /
SEQ ID NO: 2 5' CTGGGTCGACTCAGAGTGCTGTGGGCGG and
SEQ ID NO: 3 5'ACAGGGATCCGTGCAGAAGAAACCAGCC / SEQ ID NO: 4 5'GATGGTCGACTCAGGCGTGGTCTCCCACC
(utilized restriction sites underlined), respectively, and cloned into the BamHI and Sail sites of the vector pGEX-4T1 (Amersham, Sweden, cat. no. 27-4580-01 ). These constructs allow prokaryotic expression of Mnk1 or Mnk2a as fusion protein with a N-terminal glutathione S-transferase (GST) tag, referred to as GST-Mnk1 or GST- Mnk2a. The following expression and purification procedure was identical for GST- Mnk1 and GST-Mnk2a, referring in general to GST-Mnk, when not distinguishing between the two isoforms. Expression of GST-Mnk was in E. coli BL21 (Merck Biosciences, Germany, cat. no. 69449). Cells were grown in LB-Bouillon (Merck, Germany, cat. no. 1 .10285) supplemented with 100 g/ml ampicillin (Sigma,
Germany, cat. no. A9518) at 37°C. When the culture had reached a density corresponding to an A6oo of 0.8, an equal volume of ice cold LB/ampicillin was added, the culture transferred to 25°C and induced for 4 h with 1 mM isopropyl
thiogalactoside (IPTG, Roth, Germany, cat. no. 2316.4). Cells harvested by centrifugation were resuspended in 10 ml lysis buffer (50 mM
tris(hydroxymethyl)aminomethane hydrochloride (Tris/HCI, Sigma, Germany, cat. no. T5941 ) pH 7.5, 300 mM sodium chloride (NaCI, Sigma, Germany, cat. no. S7653), 5% (w/v) glycerol (Sigma, Germany, cat. no. G5516), 3 mM DTT dithiotreitol (DTT, Sigma, Germany, cat. no. D9779)) per gram wet weight cell pellet. Lysates were prepared by disruption of cells with a sonifier and subsequent clearing by
centrifugation at 38000 g for 45 min at 4°C.
The lysate was applied to a GSTPrep FF 16/10 column (Amersham, Sweden, cat. no. 17-5234-01 ) equilibrated with lysis buffer. Removal of unbound material was with 3 column volumes (CV) lysis buffer. Elution was with 2 CV of elution buffer (50 mM Tris/HCI pH 7.5, 300 mM NaCI, 5% (w/v) glycerol, 20 mM glutathione (Sigma, Germany, cat. no. G4251 )). Peak fractions were pooled and the protein transferred into storage buffer (50 mM Tris/HCI pH 7.5, 200 mM NaCI, 0.1 mM ethylene glycol- bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA, Aldrich, Germany, cat. no. 23,453-2), 1 mM DTT, 10% (w/v) glycerol, 0.5 M sucrose (Sigma, Germany, cat. no. S0389) by gel filtration on a PD10 desalting column (Amersham, Sweden, cat. no. 17-0851 -01 ). Aliquots were shock frozen in liquid nitrogen and stored at -80°C.
Activation of Mnk1 and Mnk2a was at a concentration of 2.5 μΜ of either purified GST-Mnk1 or GST-Mnk2a by incubation with 150 nM pre-activated NHis-ERK2 (see ERK2 assay for preparation) and 50 μΜ adenosine triphosphate (ATP, Sigma, cat. no. A2699) in a buffer comprising 20 mM N-(2-hydroxyethyl) piperazine-N'-(2- ethanesulfonic acid) (HEPES, Fluka, Germany, cat. no 54459)/potassium hydroxide (KOH, Roth, Germany, cat. no 6751 .1 ) pH 7.4, 10 mM magnesium chloride (MgCI2, Sigma, Germany, cat. no. M2670), 0.25 mM DTT, 0.05% (w/v) polyoxyethylene 20 stearylether (Brij 78, Sigma, Germany, cat. no. P4019) (HMDB buffer) for 45 min at 30°C. After the incubation, the preparation was aliquoted into single-use samples, shock frozen in liquid nitrogen, stored at -80°C and utilized for Mnk1 or Mnk2a kinase assays as detailed below. The presence of activating kinase has been tested to not interfere with the Mnk activity assay.
SUBSTRATE: A carboxy-terminal amidated 12mer peptide with the sequence SEQ ID NO: 5 TATKSGSTTKNR,
derived from the amino acid sequence around serine 209 of the eukaryotic translation initiation factor 4E (elF4E) has been synthesized and purified by high performance liquid chromatography (HPLC) to >95% (Thermo, Germany). The serine residue phosphorylated by Mnk kinases is underlined.
LIGAND: The peptide TATKSG-pS-TTKNR, containing an amidated carboxy- terminus and conjugated at the amino-terminus with the oxazine derived fluorophore depicted below was synthesized and used as ligand.
Figure imgf000038_0001
ANTIBODY: SPF New Zealand White Rabbits have been immunized according to standard protocols with the peptide NH2-CTATKSG-pS-TTKNR-CONH2, coupled to keyhole limpet hemocyanin (KLH). The immune globulin G (IgG) fraction was purified from serum of boosted animals by techniques known in the art. In brief, serum was subjected to protein A affinity chromatography. Eluted material was precipitated at 50% cold saturated ammonium sulfate, pellets dissolved and desalted. The resulting material was appropriate for use in below described assay without further antigen- specific purification.
ASSAY SETUP: Inhibition of kinase activity of Mnk1 and Mnk2a was assessed with the same assay system, using pre-activated GST-Mnk1 or GST-Mnk2a, respectively. The kinase reaction contains 30 μΜ substrate peptide, 20 μΜ ATP, 60 nM ligand and one of either 25 nM pre-activated Mnk1 or 2.5 nM pre-activated Mnk2a. The reaction buffer conditions are 16 mM HEPES/KOH pH 7.4, 8 mM MgCI2, 0.4 mM DTT, 0.08 % (w/v) bovine serum albumin (BSA, Sigma, Germany, cat. no. A3059), 0.008% (w/v) Pluronic F127 (Sigma, Germany, cat. no. P2443), 3% (v/v) DMSO (Applichem, Germany, cat. no. A3006). The kinase reaction is at 30°C for 40 min. The kinase reaction is terminated by addition of 0.67 reaction volumes of 1 μΜ antibody in 20 mM HEPES/KOH pH 7.4, 50 mM ethylenediaminetetraacetic acid, disodium salt (EDTA, Sigma, Germany, cat. no. E5134), 0.5 mM DTT, 0.05% (w/v)
polyoxyethylene-sorbitan monolaureate (Tween 20, Sigma, Germany, cat. no.
P7949). After 1 h equilibration time at room temperature, samples are subjected to fluorescence polarization measurement. The fluorescence polarization readout was generated on an Analyst AD multimode reader (Molecular Devices, Sunnyvale, CA, USA) equipped with a DLRP650 dichroic mirror (Omega Opticals, Brattleboro, VT, USA, cat. no. XF2035), a 630AF50 band pass filter (Omega Opticals, Brattleboro, VT, USA, cat. no. XF1069) on the excitation and a 695AF55 band pass filter on the emission side (Omega Opticals, Brattleboro, VT, USA, cat. no. XF3076). The activity of Mnk proteins can be assayed also by other in vitro kinase assay formats. For example, suitable kinase assays have been described in the literature in Knauf et al ., Mol Cell Biol. 2001 Aug;21 (16):5500-1 1 or in Scheper et al ., Mol Cell Biol . 2001 Feb;21 (3):743-54. In general, Mnk kinase assays can be performed such that a Mnk substrate such as a protein or a peptide, which may or may not include modifications as further described below, or others are phosphorylated by Mnk proteins having enzymatic activity in vitro. The activity of a candidate agent can then be determined via its ability to decrease the enzymatic activity of the Mnk protein. The kinase activity may be detected by change of the chemical, physical or immunological properties of the substrate due to phosphorylation. In one example, the kinase substrate may have features, designed or endogenous, to facilitate its binding or detection in order to generate a signal that is suitable for the analysis of the substrates phosphorylation status. These features may be, but are not limited to, a biotin molecule or derivative thereof, a glutathione-S-transferase moiety, a moiety of six or more consecutive histidine residues, an amino acid sequence or hapten to function as an epitope tag, a fluorochrome, an enzyme or enzyme fragment. The kinase substrate may be linked to these or other features with a molecular spacer arm to avoid steric hindrance.
In another example the kinase substrate may be labelled with a fluorophore. The binding of the reagent to the labelled substrate in solution may be followed by the technique of fluorescence polarization as it is described in the literature. In a variation of this example, a fluorescent tracer molecule may compete with the substrate for the analyte to detect kinase activity by a technique which is know to those skilled in the art as indirect fluorescence polarization.
In yet another example, radioactive gamma-ATP is used in the kinase reaction, and the effect of the test agent on the incorporation of radioactive phosphate in the test substrate is determined relative to control conditions.
It has been shown that the compounds of the invention exhibit low IC50 values in in vitro biological screening assays as described in example 2a for inhibition of Mnk 1 and/or Mnk 2 kinase activity. The following table contains the test results for exemplary compounds.
Figure imgf000040_0001
Figure imgf000041_0001
Example | MNK2 IC50 [nM] Example MNK2 IC50 [nM]
148 49 192 21
149 65 193 43
150 1 1 194 14
151 36 195 19
152 1 1 196 17
153 9 197 1
154 12 198 10
155 9 199 15
156 13 200 17
157 9 201 16
158 4 202 46
159 16 203 62
160 6 204 5
161 17 205 10
162 10 206 13
163 9 207 9
164 16 208 14
165 8 209 20
166 1 1 210 22
167 21 21 1 8
168 20 212 8
169 17 213 74
170 19 214 9
171 43 215 49
172 16 216 53
173 14 217 130
174 10 218 38
175 9 219 12
176 21 220 390
177 18 221 10
178 16 222 41
179 30 223 18
180 16 224 8
181 21 225 6
182 15 226 10
183 23 227 12
184 38 228 1 139
185 17 229 7
186 20 230 4
187 21 231 14
188 20 232 6
189 28 233 19
190 30 234 32
191 25 235 6 Example MNK2 ICso [nM] Example MNK2 ICso .nM]
236 16 279 1 1
237 25 280 9
238 31 281 66
239 15 282 1 1
240 13 283 6
241 49 284 10
242 5 285 9
242 4 286 4
243 9 287 5
244 2 288 19
245 39 289 2
246 65 290 8
247 139 291 19
248 10 292 46
249 6 293 377
250 19 294 183
251 20 295 95
252 18
253 19
254 1 1
255 14
256 1286
257 141
258 1 10
259 346
260 255
261 175
262 23
263 175
264 42
265 54
266 15
267 10
268 14
269 24
270 58
271 12
272 33
273 4
274 5
275 10
276 12
277 13
278 7 Examples
The HPLC data provided in the examples described below were obtained as follows:
Method A:
Waters ZQ2000; Waters 1515 Pumpe, Waters PDA 996 Detektor, Waters 2747 Injektor
Mobile Phase: A Wasser + 0,1 % formic acid
B Acetonitrile + 0,1 % formic acid
Gradient:
time in min %A %B Flow rate in
mL/min
0.00 95.0 5.0 1 .00
0.10 95.0 5.0 1 .00
3.10 2.00 98.00 1 .00
4.50 2.00 98.00 1 .00
5.00 95.0 5.0 1 .00 stationary phase: X-terra MS C18 2,5 μιτι 4,6 mm x 30 mm
column temperature approximately 25°C
Diode array detection wavelength: 210 - 420 nm
Mass m/z 80 bis 800
Mode of ionisation: ESI positiv
Methode B
Waters ZQ2000; Waters 1515 Pumpe, Waters PDA 996 Detektor, Waters 2747 Injektor
Mobile Phase: A Wasser + 0,1 % formic acid
B acetonitrile + 0,1 % formic acid
Gradient:
time in min %A %B Flow rate in
mL/min 0.00 95.0 5.0 1 .00
0.10 95.0 5.0 1 .00
3.10 2.00 98.00 1 .00
4.50 2.00 98.00 1 .00
5.00 95.0 5.0 1 .00 stationary phase: X-terra MS C18 2,5 μηη 4,6 mm x 30 mm
column temperature approximately 25°C
Diode array detection wavelength: 210 - 420 nm
Mass: m/z 80 bis 800
Mode of ionisationt: ESI positiv und negativ im Switchmodus
Method C
Merck Cromolith Speed ROD; RP18e; 4.6x50mm
Flow Rate: 1 .5 mL/min
Solvent A: H2O 0.1 % HCOOH; Solvent B: Acetonitrile 0.1 % HCOOH
Gradient:
time
0,00: 10%B;
4.50: 90%B;
5.00: 90%B;
5.50: 10%B
Method D:
Column: Merck Cromolith Speed ROD, RP18e, 4.6x50mm
Flow Rate: 1 .5 ml/min
Solvents: water with 0.1 % formic acid (A) and acetonitrile with 0.1 % formic acid (B)
Gradient: Time (min) A (%) B (%)
0.00 90 10
4.50 10 90
5.00 10 90
5.50 90 10 Agilent 1 100, MS G1956, quaternary pump, DAD 190-400 nm Fragmentor 70, Gain EMV 1 .0, mass range 100 - 1000
Method E
Column: Waters Sunfire C18, 4.6x50mm, 3.5μηη
Flow rate: 2 ml/min
Solvents: A= H2O, 0.1 % TFA; B= methanol
Gradient:
Time:
0,00: 80%A;
1 ,70: 0%A;
2,50: 0%A;
2,60: 80%A
column temperature 60°C
Method F
Column: Waters Sunfire C18, 4.6x50mm, 3.5μηη
Flow rate: 1 .5 ml/min
Solvents: A= H2O, 0.1 % TFA; B= methanol
Gradient:
Time:
0,00: 95%A;
1 ,30: 0%A;
2,50: 0%A;
2,60: 95%A
column temperature 40°C
Method G
Column: XBridge C18
Flow rate: 1 ml/min
Solvents: A= H2O, 0.032% NH4OH; B= methanol
Gradient: time
0,00 95%A;
2,00 0%A;
2,50 0%A;
2,60 95%A
column temperature 60°C
Method H
Column: Waters XBridge C18; 3.0x30mm 2.5μηη Flow Rate: 1 .50
Solvent: H2O 0.1 % NH3
Gradient:
0.00: 10%B;
2.20: 100%B;
2.40: 100%B; 2.60:10%B; 2.80:10%B;
column temperature 40°C
Method I
Column: Waters Sunfire C18; 4.6x50mm, 3.5μηη Flow rate: 2 ml/min
Solvent: A: H2O, 0.1 % TFA; B: methanol
Gradient:
0,00: 80%A;
1 ,70:0%A;
2,50: 0%A;
2,60: 80%A
column temperature 60°C Method J
Column: Waters XBridge C18; 4.6x30mm 2.5μηη Flow Rate: 3.1
Solvent: H2O 0.1 % trifluoroacetic acid Gradient:
0.00: 10%B;
1 .50: 100%B;
1 .70: 100%B; 1 .85: 10%B; 2.00: 10%B;
column temperature approximately 50°C
Method K
Column: Waters ZQ2000; Waters 1515 Pumpe, Waters PDA 996 Detektor, Waters 2747 Injektor
Mobile phase: A Water + 0,1 % formic acid
B acetonitrile + 0,1 % formic acid
Gradient:
Time in min %A %B Flow rate in mL/min
Time in min %A %B Flow rate in mL/min
0.00 95.0 5.0 1 .5
2.00 0.0 100 1 .5
2.50 0.0 100 1 .5
2.60 95.0 5.0 1 .5
Stationary Phase: X-terra ' M MS C18 2,5 μηη 4,6 mm x 30 mm
column temperature approximately 25°C
Diode array detection wavelength: 200 - 420 nm
Mass: m/z 80 bis 800
Mode of ionisation: ESI positiv Method L
Waters ZQ2000; Waters 1515 Pumpe, Waters PDA 996 Detektor, Waters 2747 Injektor
Column: X-terra™ MS C18 2,5 μηη 4,6 mm x 30 mm
Mobile Phase: A Water + 0,1 % formic acid
B Acetonitril + 0,1 % formic acid
Gradient: timet in min %A %B Flow rate in mL/min
0.00 95.0 5.0 1.5
2.00 0.0 100 1.5
2.50 0.0 100 1.5
2.60 95.0 5.0 1.5
Column temperature approximately.25°C
Diode array detection wavelength: 200 - 420 nm Mass: m/z 80 bis 800
Mode of ionisation: ESI positiv/negativ
Method M
Column: XBridge C18; 3 x 30mm , 2.5 μηη
Flow Rate: 2.2 ml/min
Solvent: A: HDO, 0.1% TFA B: methanol, 0.1 % TFA
Gradient:
0.0: 95 % A
0.30: 95% A
1.50: 0%A
1.55: 0%A
1.65: 0%A
column temperature 60°C
Method N
Column: XBridge 18; 4.6 x 30mm , 2.5 μηη
Flow Rate: 4-3 ml nin
Solvent: A: HDO, .1% TFA B: methanol, 0.1 % TFA Gradient:
0.0: 95 % A Flow: 4 ml/min
0.05: 95% A Flow: 3 ml/min
2.05: 0%A Flow: 3 ml/min
2.10: 0%A Flow: 4ml/min 2.35: 0%A Flow:4ml/min
colunnn temperature 60°C
Method X:
Colunnn: Ascentis Express, C18, 2.1 x50 mm, 2.7 μιτι
Solvents: A% H2O containing 0.1 % TFA; B% acetonitrile containing 0.1 % TFA
Gradient:
Time A% B% Flow in ml/min
0.00 95.0 5.0 1 .050
1 .00 5.0 95.0 1 .050
1 .25 5.0 95.0 1 .050
1 .30 95.0 5.0 1 .050
Column Temperature (°C) 65.0
Abbreviations:
HATU: (2-(7-aza-1 H-benzotriazole-1 -yl)-1 ,1 ,3,3-tetramethyluronium
hexaflurophosphate)
TBTU: 2-(1 H-Benzotriazol-1 -yl)-1 ,1 ,3,3-tetramethyluroniumtetrafluorborat
THF: tetrahydrofuran
EtOH: ethanol
MeOH: methanol
DCM: methylene chloride
DMF: N,N-dimethylformamide
EtOAc: ethyl acetate
HCI: hydrochloric acid
t-BuOH: tert.butanol
DTAD: Di-ter-butyl azodicarboxylate
DEAD: diethyl azodicarboxylate
DIAD: diisopropyl azodicarboxylate
LiHMDS: lithium hexymethyldisilazane
DIPEA: diisopropylethyl amine EDC: 1 -ethyl-3-(3-dimethylaminopropyl)carbodiimid
TFA: trifluoro acetic acid
TEA: triethylamine
brine: saturated sodium chloride solution in water
rt: room temperature
min: minute
Intermediate I
Figure imgf000051_0001
racemic
1.1 . 2-(Cyclohex-2-enylox -4-fluoro-1 -nitro-benzene
Figure imgf000051_0002
1 .89 ml DEAD were added to an ice-cooled solution of the 1 .57 g 5-Fluoro-2-nitro- phenol, 1 .18 ml 2-cyclohexenol and 3.15 g tnphenylphosphin in methylene chloride. The reaction mixture was stirred and allowed to warm to rt overnight. The solvent was removed in vacuo. Purification is achieved by silica gel column chromatography with iso-hexane/ EtOAc (gradient: 100% i-hexane --> 10:1 i-hexane/EtOAc).
Yield: 1 .9 g UL
Figure imgf000051_0003
relative stereochemistry A solution of 1 .85 g 2-(Cyclohex-2-enyloxy)-4-fluoro-1 -nitro-benzene in 5ml t-butanol was added to an ice-cooled, pre-mixed solution of 10.9 g AD-mix-alpha in 80 ml t- BuOH/water (1 :1 ). The reaction mixture was stirred at this temperature for 1 hour and at rt overnight. The reaction mixture was cooled in ice-water and sodium
metabisulfite (1 1 ,7g) was added. After 10 minutes the coolant was removed and the mixure stirred at rt for 1 hour. After that the mixture was extracted with EtOAc. The organic phase was washed with brine and evaporated.
Yield: 2.15 g 1.3.
Figure imgf000052_0001
relative stereochemistry
Prepared analogously to example III.2 from 2.1 1 g compound 1.2.
Yield: 1 .59 g
Intermediate II
racemic trans-3-(2-Amino-5-fluoro-phenoxy)-cyclohexanol
Figure imgf000052_0002
(3-Benzyloxy-phenoxy)-terf-butyl-dimethyl-silane
Figure imgf000052_0003
43.459 ml terf-butyl-chloro-dimethyl-silane were added at rt to a solution of 17 g imidazole and 25 g 3-benzyloxy-phenol in 400 ml THF. After 3 hours water was added to the reaction mixture and the mixture was then extracted with methylene chloride. The organic phase was extracted three times with water, dried over sodium sulfate and concentrated in vacuo. The residue was solved in methylene chloride and filtered over Alox (neutral) and concentrated.
Yield: 37 g
retention time (HPLC): 4.15 min (method A)
ESI mass spectrum: m/z = 315 (M+H)+
II.2. 3-(fe/f-Butyl-dimethyl-silanyloxy)-cvclohexanol
Figure imgf000053_0001
A mixture of 37.6 g (3-benzyloxy-phenoxy)-te/t-butyl-dimethyl-silane and 3.8 g of Nishimura's catalyst in 200 ml of ethanol was hydrogenated at rt unter 50 psi for 6 hours. The reaction mixture was filtered and the filtrate concentrated.
Yield: 26.48 g
ESI mass spectrum: m/z = 231 (M+H)+
11.3. racemic e/t-Butyl-[cis-3-(5-fluoro-2-nitro-phenoxy)-cvclohexyloxy1- dimethyl-silane and racemic fe/f-Butyl-[trans-3-(5-fluoro-2-nitro-phenoxy)- cvclohexylox -dimethyl-silane
Figure imgf000053_0002
15.21 1 ml DIAD were added to a solution of 20.1 18 g triphenylphosphine in 300 ml THF and stirred for 30 min at rt. 9.272 g 5-fluoro-2-nitrophenol were added
portionwise and the resulting reaction mixture was stirred for 30 minutes. After that time 17 g 3-(terf-butyl-dimethyl-silanyloxy)-cyclohexanol were added and the mixture was stirred for 18 hours. An additional solution from triphenylphosphine and DIAD in THF was added to the mixture and the mixture was stirred for 2 hours. The reaction mixture was poured in water and then extracted with methylene chloride. The organic phase was extracted three times with water, dried over sodium sulfate and
concentrated in vacuo. Petrolether was added the residue and the mixture was filtered. The filtrate was concentrated. Purification is achieved by silica gel column chromatography with cyclohexane/ methylene chloride (gradient: 90:10 to 75:25). racemic e/t-Butyl-[cis-3-(5-fluoro-2-nitro-phenoxy)-cvclohexyloxy1-dimethyl-silane
Yield: 2.6 g
retention time (HPLC): 4.10 min (method B)
ESI mass spectrum: m/z = 370 (M+H)+ racemic e/t-Butyl-[trans-3-(5-fluoro-2-nitro-phenoxy)-cvclohexyloxy1-dimethyl-silane
Yield: 5.7 g
retention time (HPLC): 4.17 min (method B)
ESI mass spectrum: m/z = 370 (M+H)+
II.4. 2-[trans-3-( e/t-Butyl-dimethyl-silanyloxy)-cvclohexyloxy1-4-fluoro- phenylamine
Figure imgf000054_0001
A mixture of 9.2 g racemic terf-Butyl-[trans-3-(5-fluoro-2-nitro-phenoxy)- cyclohexyloxy]-dimethyl-silane and 0.92 g of Raney Nickel in 200 ml of methanol was hydrogenated at rt unter 50 psi for 6 hours. The reaction mixture was filtered and the filtrate concentrated.
Yield: 8.1 g
ESI mass spectrum: m/z = 340 (M+H)+
II.5. racemic trans-3-(2-Amino-5-fluoro-phenoxy)-cvclohexanol
Figure imgf000055_0001
A solution of 8.1 g 2-[trans-3-(fe/t-butyl-dinnethyl-silanyloxy)-cyclohexyloxy]-4-fluoro- phenylamine in 50 ml of HCI in ethanol (1 .25 M) was stirred for 1 hour at rt. Sodium hydroxide solution (1 N) was then added to the reaction mixture resulting in a basic pH. This mixture was extracted with methylene chloride. The organic phase was dried over sodium sulfate, filtered and concentrated.
Yield: 5.2 g
ESI mass spectrum: m/z = 226 (M+H)+
Intermediate III
2-(1 ,4-Dioxa-spiro[4.5]dec-8-yloxy)-4-fluoro-phenylamin
Figure imgf000055_0002
111.1 . (8-(5-Fluoro-2-nitro- henoxy)-1 ,4-dioxa-spiro[4.51decane
Figure imgf000055_0003
63 ml LiHMDS (1 M in THF) were added dropwise to a stirred solution of 10 g 1 ,4- dioxa-spiro[4.5]decan-8-ol in THF (60ml) at 0°C and the reaction stirred for 30min. A solution of 2,4-difluor-1 -nitro-benzene in THF (20ml) was than added over 5 min and the reaction warmed to rt and stirred for 16h. The reaction was quenched with sat. ammoniumchloride solution and adjusted to pH 7 with 2N HCI. The solvent was removed under vacuum and the residue portioned between EtOAc (200ml) and water (100ml). The organic layer was separated and the aqueous phase washed with EtOAc (2x50ml). The combined organic phases were washed with brine (50ml) and separated. The organic phase was evaporated to give a solid that was used without further purification. Yield: 14.47g
III.2. 2-(1 ,4-Dioxa-spiro[4.51dec-8-yloxy)-4-fluoro-phenylannine
Figure imgf000056_0001
0.446 g Pd/C (5%) were added to a mixture of 4.46 g (8-(5-fluoro-2-nitro-phenoxy)- 1 ,4-dioxa-spiro[4.5]decane and 4.03 g ammonium formate in 50 ml anhydrous methanol at rt. The reaction was initiated by gentle warming. The reaction was allowed to cool and stirred for a further 0,5 hours. The suspension was filtered through celite and washed with methanol. The combined organics were concentrated in vacuo and the residue triturated from diethylether. The solids were filtered and the filtrate collected and concentrated in vacuo to yield a solid.
Yield: 3.95 g
Intermediate IV
Trans-/V-[4-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-methanesulfonamide
Figure imgf000056_0002
IV.1 . 4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-carbamic acid fe/f-butyl ester
Figure imgf000056_0003
1 .2 g sodium hydride were added to an ice cooled solution of 2.15 g trans-(4- hydroxy-cyclohexyl)-carbamic acid terf-butyl ester in 50 ml DMF. After 1 hour 1 .64 ml 2,4-difluoronitrobenzene were added and the mixture was stirred at this temperature for 1 hour. The coolant was removed and the reaction mixture was stirred for 4 hours. The mixture was diluted with EtOAc and washed with water and brine two times. The mixture was dried over magnesium sulfate, filtered and the filtrate was evaporated. Purification is achieved by silica gel column chromatography with iso-hexane/ EtOAc (gradient: 100% iso-hexane -> 5:1 iso-hexane : EtOAc -> 3:1 iso-hexane : EtOAc ). The residue was triturated with diethylether.
Yield: 1 .19 g
IV.2. trans-4-(5-Fluoro-2-nitro-phenoxy)-cvclohexylamine hydrochloride
Figure imgf000057_0001
10 ml of a soltution of HCI in dioxane (4 M) were added to 1 .19 g trans-[4-(5-fluoro-2- nitro-phenoxy)-cyclohexyl]-carbamic acid terf-butyl ester in methylene chloride. The mixture is stirred for 3 hours and 2 ml of HCI in dioxane (4 M) were added. The reaction mixture was stirred for 1 hour and concentrated in vacuo.
Yield: 1 .09 g
IV.3. trans-A/-[4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methanesulfonamide
Figure imgf000057_0002
120 μΙ methansulfonyl chloride were added to an ice cooled suspension of 300 mg trans-4-(5-fluoro-2-nitro-phenoxy)-cyclohexylamine hydrochloride and 431 μΙ triethylamine in 5 ml methylene chloride. The reaction mixture was allowed to warm up slowly to rt over night. Then the mixture was diluted with methylene chloride and washed with 10% potassium hydrogen sulfate. The mixture was filtered through a hydrophobic frit and evaporated. The residue was triturated with ether. Yield: 0.227g
IV.4. trans-Ay-[4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-methanesulfonamide
Figure imgf000058_0001
Prepared analogously to example III.2 from 0.218 g trans-A/-[4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-methanesulfonamide.
Yield: 0.170g
Intermediate V
trans-A/-[4-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-A/-methyl-methanesulfonamide
Figure imgf000058_0002
V.1 trans-[4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl-carbamic acid fe/f-butyl ester
Figure imgf000058_0003
Prepared analogously to example 111.1 from 1 .1 1 ml 2,4-difluoronitrobenzene and 1 .56 g trans-(4-hydroxy-cyclohexyl)-methyl-carbamic acid terf-butyl ester.
Yield: 2.25 g
V.2. trans- [4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl-amine hydrochloride
Figure imgf000059_0001
Prepared analogously to example IV.2 from 2.2 g trans-[4-(5-Fluoro-2-nitro-phenoxy) cyclohexyl]-methyl-carbamic acid terf-butyl ester.
Yield: 1 .41 g
V.3. trans- A/-[4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-/\/-methyl- methanesulfonamide
Figure imgf000059_0002
Prepared analogously to example IV.3 from 0.305 g trans- [4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-methyl-amine hydrochloride and methanesulfonyl chloride. Yield: 0.331 g
V.4. trans-A/-[4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-/\/-methyl- methanesulfonamide
Figure imgf000059_0003
Prepared analogously to example III.2 from 0.329 g trans- A/-[4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-/V-methyl-methanesulfonamide.
Yield: 0.083 g
Intermediate VI
trans-/V-[4-(2-Amino-5-fluoro- henoxy)-cyclohexyl]-acetamide
Figure imgf000059_0004
VI.1 . trans-A/-[4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-acetamide
Figure imgf000060_0001
166 μΙ acetic anhydride were added to a mixture of 0.341 g trans-4-(5-fluoro-2-nitro- phenoxy)-cyclohexylamine hydrochloride and 327 μΙ triethylamine in 5 ml methylene chloride. The reaction mixture was stirred at rt overnight. The mixture was diluted with methylene chloride and 10% aq. potassium hydrogensulfate and 10% aq. potassium carbonate. Then the mixture was passed through a hydrophobic frit and the solvent was evaporated.
Yield: 0.325 g VI.1 trans-A/-[4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-acetamide
Figure imgf000060_0002
Prepared analogously to example III.2 from 0.15 g trans-/V-[4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-acetamide.
Yield: 0.14 g
Intermediate VII
trans-/V-[4-(2-Amino-5-fluoro- henoxy)-cyclohexyl]-/V-methyl-acetamide
Figure imgf000060_0003
VII.1 . trans- A/-[4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-/\/-methyl-acetamide
Figure imgf000060_0004
Prepared analogously to example VI.1 from 0.305 g trans- [4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-methyl-amine hydrochloride and acetic acid anhydride. Yield 0.329 g
VII.2. trans-/V-[4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-/V-methyl-acetamide
Figure imgf000061_0001
Prepared analogously to example III.2 from 0.305 g trans- A/-[4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-/V-methyl-acetamide.
Yield: 0.14 g
Intermediate VIII
Cis-/V-[4-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-/V-methyl-methanesulfonamide
Figure imgf000061_0002
VIII.1 . Benzoic acid 4-cis-( e/t-butoxycarbonyl-methyl-amino)-cvclohexyl ester
Figure imgf000061_0003
1 .74 ml DEAD were added dropwise to a cooled (cold water) solution of 1 .69 g trans- (4-hydroxy-cyclohexyl)-methyl-carbamic acid terf-butyl ester, 1 .35 g benzoic acid and 2.9 g Triphenylphosphine in 20 ml THF. After 10mins the coolant was removed and the reaction mixture was stirred for 2 hours. Then the mixture was diluted with methylene chloride and washed with 10% aq. potassium carbonate solution. The organic was passed through a hydrophobic frit and evaporated. Purification is achieved by silica gel column chromatography with iso-hexane/ EtOAc (gradient: 100% iso-hexane -> 5:1 iso-hexane).
Yield: 1 .32 g VI 11.2. cis-(4-Hvdroxy-cvclohexyl)-nnethyl-carbannic acid fe/f-butyl ester
Figure imgf000062_0001
0.807 g potassium carbonate were added to a solution of 1 .3 g cis-benzoic acid 4- (terf-butoxycarbonyl-methyl-amino)-cyclohexyl ester in 10 ml methanol . The reaction mixture was stirred at rt overnight. 2 ml sodium hydroxide solution (2M) were added and the mixture was stirred for 4 hours. After that time the mixture was diluted with EtOAc and washed with water and brine. The organic phase was passed through a hydrophobic frit and the solvent was evaporated. Purification was achieved by silica gel column chromatography (gradient: 100% i-hex. --> 100% methylene chloride --> 20:1 methylene chloride/methanol).
Yield: 0.876 g
VI 11.3. [cis-4- 5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl-carbamic acid tert- butyl ester
Figure imgf000062_0002
Prepared analogously to example 111.1 from 500 μΙ 2,4-difluoronitrobenzene and 0.876 g cis-(4-hydroxy-cyclohexyl)-methyl-carbamic acid terf-butyl ester.
Yield: 0.709 g VI 11.4. cis-4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl-amine
hydrochloride
Figure imgf000062_0003
Prepared analogously to example IV.2 from 0.698 g [cis-4-(5-fluoro-2-nitro-phenoxy)- cyclohexyl]-methyl-carbamic acid terf-butyl ester. Yield: 0.51 1 g
VIII.5. A/-[cis-4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-A/-nnethyl- methanesulfonamide
Figure imgf000063_0001
Prepared analogously to example IV.3 from 0.252 g [cis-4-(5-fluoro-2-nitro-phenoxy)- cyclohexyl]-methyl-amine hydrochloride and methanesulfonyl chloride.
Yield: 0.296 g V.4. cis-A/-[4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-A/-methyl- methanesulfonamide
Figure imgf000063_0002
Prepared analogously to example III.2 from 0.259 g A/-[cis-4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-A/-methyl-methanesulfonamide.
Yield: 0.226 g
Intermediate IX
A/-[cis-4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-A/-methyl-acetamide
Figure imgf000063_0003
IX.1 . A/-[cis-4-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-A/-methyl-acetamide
Figure imgf000063_0004
Prepared analogously to example VI.1 from 0.252 g [cis-4-(5-fluoro-2-nitro-phenoxy)- cyclohexyl]-methyl-amine hydrochloride and acetic acid anhydride.
Yield: 0.259 g IX.2. A/-[cis-4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-/\/-methyl-acetamide
Figure imgf000064_0001
Prepared analogously to example III.2 from 0.259 g A/-[cis-4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-/V-methyl-acetamide.
Yield: 0.226 g
Intermediate X
[trans-4-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-methyl-carbamic acid methyl ester
X.1 . [trans-4-(2-Nitro-5-fluoro-phenoxy)-cvclohexyl1-methyl-carbamic acid methyl ester
Figure imgf000064_0002
129 μΙ methyl chloroformate were added to an ice-cooled mixture of 0.305 g [trans-4- (5-fluoro-2-nitro-phenoxy)-cyclohexyl]-methyl-amine hydrochloride and 417 μΙ triethylamine in 5 ml methylene chloride. After 10 minutes the coolant was removed and the mixture was stirred at rt overnight. Then the reaction mixture was diluted with methylene chloride and washed with 10% aq. potassiumhydrogen sulfate solution and 10% aq. potassium carbonate solution. The organic phase was passed through a hydrophobic frit.
Yield: 0.295 g
X.2. [trans-4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-methyl-carbamic acid methyl ester
Figure imgf000065_0001
Prepared analogously to example III.2 from 0.292 g trans-4-(2-Nitro-5-fl
phenoxy)-cyclohexyl]-methyl-carbamic acid methyl ester
Yield: 0.248 g
Intermediate XI
XI.1 . [trans-4-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-methyl-carbamic acid tert-butyl ester
Figure imgf000065_0002
Prepared analogously to example III.2 from 1 .42 g [trans-4-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-methyl-carbamic acid terf-butyl ester
Yield: 1 .4 g
Intermediate XII
Racemic A/-[trans-2-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-A/-methyl- methanesulfonamide
Figure imgf000065_0003
relative stereochemistry
XII.1 . racemic (trans-2-Hydroxy-cvclohexyl)-carbamic acid fe/f-butyl ester
I
Figure imgf000065_0004
relative stereochemistry
A solution of 3.64 g di-tert-butyldicarbonate in 5 ml methylene chloride was added to a solution of 3.02 g racemic trans-2-aminocyclohexanol and 4.2 ml triethylamine in 40 ml methylene chloride. After completion of the reaction methylene chloride was added and the mixture was washed with 10% au potassium hydrogensulfate solution. The organic phase was passed through a hydrophobic frit and concentrated.
Yield: 3.62 g
XII.2. racemic trans-2-Methylamino-cvclohexanol
Figure imgf000066_0001
relative stereochemistry
3.51 g racemic trans-(2-hydroxy-cyclohexyl)-carbamic acid terf-butyl ester were added to a suspension of 3.09 g lithim aluminium hydride in THF. The reaction mixture was heated at reflux over night. After that time subsequentely 3.1 ml water, 3.1 ml sodium hydroxide solution (2M) and 3.1 ml water were added. The mixture was then stirred for 45 minutes and then filtered through celite. The celite was washed with EtOAc. The solvent was evaporated.
Yield: 1 .9 g XII.3. racemic trans- (2-Hvdroxy-cvclohexyl)-methyl-carbamic acid fe/f-butyl ester
Figure imgf000066_0002
relative stereochemistry
Prepared analogously to XI 1.1 from 1 .9 g racemic trans-2-Methylamino-cyclohexanol . Yield: 3.49 g XII.4. racemic [trans-2-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl- carbamic acid fe/f-butyl ester
Figure imgf000067_0001
relative stereochemistry
Prepared analogously to 111.1 from 0.33 ml 2,4-difluoro-nitrobenzene and 0.687 g racemic trans- (2-hydroxy-cyclohexyl)-methyl-carbamic acid terf-butyl ester.
Yield: 0.844 g
XII.5. racemic [[trans-2-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl-amine hydrochloride
Figure imgf000067_0002
relative stereochemistry
Prepared analogously to IV.2 from 0.84 g racemic [trans-2-(5-fluoro-2-nitro-phenoxy)- cyclohexyl]-methyl-carbamic acid terf-butyl ester.
Yield: 0.621 g
XII.6. racemic A/-[trans-2-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-A/-methyl- methanesulfonamide
Figure imgf000067_0003
relative stereochemistry Prepared analogously to IV.3 from 0.29 g racemic trans- [[trans-2-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-methyl-amine hydrochloride.
Yield: 0.283 g XII.7. racemic A/-[trans-2-(5-fluoro-2-amino-phenoxy)-cvclohexyl1-/\/-methyl- methanesulfonamid
Figure imgf000068_0001
relative stereochemistry
Prepared analogously to III.2 from 0.274 g racemic A/-[trans-2-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-/V-methyl-methanesulfonamide.
Yield: 0.265 g
Intermediate XIII
Racemic A/-[trans-2-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-/V-methyl-acetamide
Figure imgf000068_0002
relative stereochemistry
XIII.1 racemic A/-[trans-2-(2-nitro-5-fluoro-phenoxy)-cvclohexyl1-/\/-methyl- acetamide
Figure imgf000068_0003
Prepared analogously to VI.1 from 0.29 g racemic [[trans-2-(5-fluoro-2-nitro- phenoxy)-cyclohexyl]-methyl-amine hydrochloride and acetic acid anhydride. Yield: 0.289 g
XIII.2. racemic Trans- /V-[2-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-/V-methyl- acetamide
Figure imgf000069_0001
relative stereochemistry
Prepared analogously to III.2 from 0.285 g racemic A/-[trans-2-(2-nitro-5-fluoro- phenoxy)-cyclohexyl]-/V-methyl-acetamide
Yield: 0.25 g
Intermediate XIV
A/-[trans-4-(2-Amino-5-fluoro- henoxy)-cyclohexyl]-2,2,2-thfluoro-acetamide
Figure imgf000069_0002
XIV.1 A/-rtrans-4-(2-Nitro-5-fluoro-phenoxy)-cvclohexyl1-2,2,2-trifluoro- acetamide
Figure imgf000069_0003
A reaction mixture of 0.071 g trans-4-(5-fluoro-2-nitro-phenoxv)-cvclohexylamine hydrochlorid, 0.05 g ethyltrifluoroacetate and 0.075 g triethylamine in 2 ml methanol was stirred overnight. The mixture was concentrated and partitioned between 5 ml EtOAc and 5 ml water. The organic phase was washed with water, HCI solution (2M) and water. The organic phase was dried and the solvent evaporated.
Yield: 0.079 g XIV.2 A/-rtrans-4-(2-Nitro-5-fluoro-phenoxy)-cvclohexyl1-2,2,2-trifluoro- acetamide
Figure imgf000070_0001
Prepared analogously to III.2 from 0.075 g A/-[trans-4-(2-nitro-5-fluoro-phenoxy)- cyclohexyl]-2,2,2-trifluoro-acetamide.
Yield: 0.05 g
Intermediate XV
[3-(2-Amino-5-fluoro-phenoxy)-cyclohexyl]-methyl-carbamic acid terf-butyl ester
Figure imgf000070_0002
XV.1 (3-Hvdroxy-cvclohexyl)-carbamic acid fe/f-butyl ester
Figure imgf000070_0003
Prepared analogously to XI 1.1 from 1 .357 g 3-amino-cyclohexanol .
Yield: 0.933 g
XV.2 3-Methylamino-cyclohexanol
Figure imgf000070_0004
Prepared analogously to XII.2 from 0.933 g (3-hydroxy-cyclohexyl)-carbamic acid terf-butyl ester.
Yield: 0.203 g
XV.3 (3-Hvdroxy-cvclohexyl)-methyl-carbamic acid fe/f-butyl ester.
Figure imgf000071_0001
Prepared analogously to XI 1.1 from 0.268 g 3-methylamino-cyclohexanol.
Yield: 0.277 g XV .4 [3-(5-Fluoro-2-nitro-phenoxy)-cvclohexyl1-methyl-carbamic acid tert- butyl ester
Figure imgf000071_0002
Prepared analogously to 111.1 from 81 μΙ 2,4-difluoronitrobenzene and 0.17 g (3- hydroxy-cyclohexyl)-methyl-carbamic acid terf-butyl ester.
Yield: 0.14 g
XV.5 [3-(2-Amino-5-fluoro-phenoxy)-cvclohexyl1-methyl-carbamic acid tert- butyl ester
Figure imgf000071_0003
Prepared analogously to III.2 from 0.175 g [3-(5-fluoro-2-nitro-phenoxy)-cyclohexyl]- methyl-carbamic acid te/t-butyl ester
Yield: 0.14 g
Intermediate XVI.
Racemic cis-4-Fluoro-2-(2-methoxy-cyclohexyloxy)-phenylamine
Figure imgf000072_0001
relative stereochemistry
XVI .1 cis--4-Fluoro-2-(2-methoxy-cvclohexyloxy)-1 -nitro-benzene
Figure imgf000072_0002
2.36 ml DEAD were added to an ice-cooled solution of thel .57 g 5-fluoro-2- nitrophenol, 1 .95 ml 2-methoxycyclohexanol and 3.93 g triphenylphosphine in 30 ml THF. The reaction mixture was allowed to warm to rt overnight. The mixture was stirred additonal 48 hours. Then the reaction mixture was diluted with methylene chloride and washed with 10% aq. potassium carbonate solution. The organic phase was passed through a hydrophobic frit and evaporated. Purification was achieved by silica gel column chromatography (solvents 0:1 iso-hexane: EtOAc).
Top spot: 186mg, : racemic trans-4-Fluoro-2-(2-methoxy-cyclohexyloxy)-1 -nitrobenzene
1 H-NMR: 7.89 -7.85 (1 H, m); 6.94-6.91 (1 H,m); 6.71 -6.66 (1 H, m); 4.24- 4.19 (1 H,m); 3.40-3.34 (4H,m); 2.14-1 .26 (8H, m)
Mixed spot: 380mg
1 ,7:1 mixture of isomers
Bottom spot: 474mg: racemic cis-4-Fluoro-2-(2-methoxy-cyclohexyloxy)-1 -nitrobenzene
1 H-NMR: 7.92-7.88 (1 H, m); 6.91 -6.87 (1 H, m); 6.69-6.66 (1 H, m);
4.66-4.65 (1 H, m); 3.44-3.38 (4H, m); 2.10-1 .31 (8H, m)
XVI .2 racemic cis-4-Fluoro-2-(2-methoxy-cvclohexyloxy)-phenylamine
Figure imgf000073_0001
Prepared analogously to III.2 from 0.47 g cis-4-fluoro-2-(2-methoxy-cyclohexyloxy)-1 - nitro-benzene.
Yield: 0.373 g
Intermediate XVII.
Racemic trans-4-Fluoro-2-(2-methoxy-cyclohexyloxy)-phenylamine
Figure imgf000073_0002
Prepared analogously to 111.2 from 1 .25 g trans-4-fluoro-2-(2-methoxy-cyclohexyloxy)- 1 -nitro-benzene.
Yield: 1 .09 g
Intermediate XVIII
(Rf?)-4-Fluoro-2-(2-Methoxycvclohexyloxy)-anilin
Chiral
Figure imgf000073_0003
(Rf?)-4-Fluoro-2-(2-Methoxycvclohexyloxy)-nitrobenzene
Figure imgf000074_0001
To (R,R)-4-fluoro-2-(2-hydroxycyclohexyloxy)-nitrobenzene (0.200 g) dissolved in methylene chloride (10.0 ml) was added trimethyloxonium tetrafluoroborate (0.348 g). The mixture was stirred overnight at rt. Water was added; the organic phase was separated and evaporated to dryness to yield a brownish oil.
Yield: 207 mg
ESI mass spectrum: m/z = 270 (M+H)+
XVIII.2 (Rf?)-4-Fluoro-2-(2-Methoxycvclohexyloxy)-anilin
Chiral
Figure imgf000074_0002
(R,R)-4-fluoro-2-(2-methoxycyclohexyloxy)-nitrobenzene (0.18 g) in methanol (20.0 ml) was hydrogenated under 50 psi hydrogen for 20 h at rt using palladium on charcoal (5%) (40 mg) as catalyst. The catalyst was filtered off; the resulting solution was evaporated to dryness to yield an oil.
Yield: 300 mg
ESI mass spectrum: m/z = 240 (M+H)+
Intermediate XIX
(S,S)-4-Fluoro-2-(2-Methoxycvclohexyloxy)-anilin Chiral
Figure imgf000075_0001
The compound can be prepared analogously to XVIII, starting from (S,S)-4-fluoro-2- (2-Hydroxycyclohexyloxy)-anilin.
Intermediate XX
( f?)-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)-anilin
Chiral
Figure imgf000075_0002
XX.1 (Rf?)-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)-nitrobenzene
Figure imgf000075_0003
2,4-Difluoronitrobenzene (1 .89 ml), (7R2R)-1 ,2-cycloxexanediol (2.00 g), and lithium bis(trimethylsilyl)amide (1 mol/l solution in THF; 17.2 ml) in THF (20.0 ml) were stirred overnight at rt. The solvent was removed in vacuo; the residue was taken up in ethyl acetate. The solution was extracted once with hydrochloric acid (1 mol/l) and twice with NaOH solution (1 mol/l), dried with magnesium sulphate, filtered and evaporated to dryness. The residue was purified by column chromatography (silica; methylene chloride / methanol 100:0 => 97:3) to yield yellowish oil which crystallized upon storage. Yield: 2.00 g
ESI mass spectrum: m/z = 256 (M+H)+
( f?)-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)-anilin
Chiral
Figure imgf000076_0001
(R,R)-4-Fluoro-2-(2-hydroxycyclohexyloxy)-nitrobenzene (1 .99 g) in methanol (20.0 ml) was hydrogenated under 50 psi hydrogen for 5 h at rt using palladium on charcoal (5%) (200 mg) as catalyst. The catalyst was filtered off; the resulting solution was evaporated to dryness to yield an oil.
Yield: 1 .70 g
ESI mass spectrum: m/z = 226 (M+H)+
Intermediate XXI
(S,S)-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)-anilin
Chiral
Figure imgf000076_0002
The compound was prepared analogously to XX, starting from (S,S)-1 ,2- Cyclohexanediol.
ESI mass spectrum: m/z = 226 (M+H)+ Intermediates XXII
Pure enantiomers of cis-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)-nitrobenzene XXII.1 racemic cis-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)-nitrobenzene
Figure imgf000077_0001
To 2,4-Difluoronitrobenzene (0.549 ml) and cis-1 ,2-cyclohexanediol (0.581 g) in THF (10.0 ml), cooled with an ice-bath, was added lithium bis(trimethylsilyl)amide (1 mol/l solution in THF; 5.00 ml). The mixture was stirred overnight at rt, and then
evaporated to dryness. The residue was taken up in ethyl acetate, extracted once with hydrochloric acid (1 mol/l) and twice with NaOH solution (1 mol/l), dried with magnesium sulphate, filtered and evaporated to dryness. The residue was purified by column chromatography (silica; methylene chloride / methanol 100:0 => 97:3) to yield a yellowish oil .
Yield: 455 mg
ESI mass spectrum: m/z = 256 (M+H)+
XXII.2 Pure enantiomers of cis-4-Fluoro-2-(2-Hvdroxycvclohexyloxy)- nitrobenzene
Figure imgf000077_0002
The racemic mixture of XXII.1 was separated into the enantiomers by chiral SFC chromatography:
Column: Daicel ADH; 250 mm x 4.6 mm
Mobile phase: CO2 / 2-Propanol 75:25 (with addition of 0.2% Diethyl amine) XXI l-A:
ESI mass spectrum: m/z = 522 (M+H)+
Figure imgf000078_0001
XXII-B:
ESI mass spectrum: m/z = 522 (M+H)+
Rt (HPLC): 3.04 min
Absolute stereochemistry of the isomers was not determined and therefore cannot be assigned.
XXII.3 Pure enantiomere of cis-4-fluoro-2-(2-hvdroxycvclohexyloxy)-anilin from the XXII-A intermediate (2 min retention time)
Chiral
Figure imgf000078_0002
Prepared analogously to XX.2 from 0.5 g cis-4-fluoro-2-(2-hydroxycyclohexyloxy)- nitrobenzene (cpd. XXII-A, 2 min retention time).
XXI 1.4 Pure enantiomere of cis-4-fluoro-2-(2-hvdroxycvclohexyloxy)-anilin from the XXII-B intermediate (3.04 min retention time)
Chiral
Figure imgf000078_0003
Prepared analogously to XX.2 from 0.5 g cis-4-fluoro-2-(2-hydroxycyclohexyloxy)- nitrobenzene (cpd. XXII-B, 3.04 min retention time).
Intermediate XXIV
trans-4-(3-Amino-pyhdin-2-yloxy)-c clohexanol
Figure imgf000078_0004
XXIV.1 trans-4-(3-nitr -pyridin-2-yloxy)-cvclohexanol
Figure imgf000079_0001
Prepared analogously to 111.1 from 4.054 g 2-fluoro-3-nitropyridine and 2.26 g trans- 1 ,4-cyclohexanediol .
Yield: 0.29 g
XXIV2 trans-4-(3-Amino-pyridin-2-yloxy)-cvclohexanol
Figure imgf000079_0002
A mixture of 0.29 g trans-4-(3-nitro-pyridin-2-yloxy)-cyclohexanol and 0.05 g Raney nickel in 50 ml methanol was hydrogenated at 5 bar and rt for 4.5 hours. The reaction mixture was filtered and the filtrate concentrated.
Yield: 0.203 g
ESI mass spectrum: m/z = 209 (M+H)+
Intermediates XXV
4-Fluoro-2-(trans-4-methoxycvclohexyloxy)-anilin and 4-Fluoro-2-(cis-4- methoxycvclohexyloxy)-anilin
Figure imgf000079_0003
XXV.1 . 4-Methoxycyclohexanol (mixture of cis and trans isomers)
Figure imgf000080_0001
4-Methoxyphenol (100 g) in ethanol (759 ml) was hydrogenated under 50 psi hydrogen using Nishimura catalyst (10.0 g) at rt for 4.5 h. The catalyst was filtered off; the solvent was removed in vacuo to yield the desired product as 95% pure yellowish liquid.
Yield: 1 14 g
EXI mass spectrum: m/z = 131 (M+H)+
XXV.2 4-Fluoro-2-(trans-4-methoxycvclohexyloxy)-anilin
and 4-Fluoro-2-(cis-4-methoxycvclohexyloxy)-anilin
Figure imgf000080_0002
To a cooled (water bath, approx. 10 °C) solution of 5-fluoro-2-nitrophenol (18.9.g) and 4-methoxycylohexanol (19.0 g) in THF (250 ml) were simultaneously added under magnetic stirring di-tert-butyl azodicarboxylate (41 .0 g) and triphenyl phosphine (47.0 g). The mixture was stirred for further 2 h at rt and palladium on charcoal 10% (1 .90 g) was added. The mixture was hydrogenated at rt under 50 psi Hydrogen for 20 h. The catalyst was filtered off. The resulting solution was diluted with DCM and extracted twice with hydrochloric acid (1 mol/l). The combined aqueous phases were alkalified with NaOH solution (4 mol/l) and extracted twice with methylene chloride. The combined organic layers were dried with sodium sulphate, filtered and concentrated in vacuo. The resulting mixture was subjected to column chromatography (silica; methylene chloride/ ethyl acetate 9:1 ) yielding both isomers as separate fractions.
4-fluoro-2-(trans-4-methoxycvclohexyloxy)-anilin
Yield: 3.10 g ESI mass spectrum: m/z = 240 (M+H)+
4-Fluoro-2-(cis-4-methoxycvclohexyloxy)-anilin
Yield: 2.00 g
ESI mass spectrum: m/z = 240 (M+H)+
Intermediates XXVI
4-Fluoro-2-(cis-4-Hvdroxycvclohexyloxy)-anilin and trans-4-Fluoro-2-(trans-4- Hvdroxycvclohexyloxy)-anilin
Figure imgf000081_0001
XXVI .1 4-Fluoro-2-(cis/trans-4-Hvdroxycvclohexyloxy)-nitrobenzene
To a solution of 1 ,4-cyclohexanediol (100 g) in THF (1000 ml) was added NaH (60% in mineral oil; 38.5 g). The mixture was refluxed for 1 h. 2,4-difluoronitrobenzene (48.0 ml) was added drop wise during 1 h. The mixture was refluxed for further 2 d, concentrated in vacuo, taken up in water and extracted several times with methylene chloride. The combined organic layers were washed with brine, dried with
magnesium sulphate, filtered and concentrated in vacuo. The residue was subject to column chromatography (silica; methylene chloride/ methanol 100:0 => 98:2; UV detection at 220 nm) furnishing the mixture of isomers as a brownish oil.
Yield: 49.2 g
ESI mass spectrum: m/z = 273 (M+NH4)+
Separation into 4-fluoro-2-(cis-4-Hvdroxycvclohexyloxy)-nitrobenzene and 4-Fluoro-2-(trans-4-Hvdroxycvclohexyloxy)-nitrobenzene
Figure imgf000082_0001
The cis/trans mixture from XXVI.1 was separated into the isomers by SFC chromatography:
Column: Daicel OJH 250 mm x 4.6 mm
Mobile phase: CO2/ Methanol 85:15 (with addition of 0.2% Diethyl am Eluting first: cis isomer; eluting second: trans isomer
XXVI .2 4-Fluoro-2-(cis-4-Hvdroxycvclohexyloxy)-anilin
Figure imgf000082_0002
4-Fluoro-2-(cis-4-hydroxycyclohexyloxy)-nitrobenzene (2.00 g) in methanol (15.0 was hydrogenated under 50 psi hydrogen using palladium on charcoal (5%) as catalyst (300 mg) at RT for 2 h. The catalyst was filtered off; the solvent was removed in vacuo to yield the desired product as 95% pure oil.
Yield: 1 .96 g
ESI mass spectrum: m/z = 226 (M+H)+
Intermediate XXVII 4-Fluoro-2-(trans-4-hvdroxycvclohexyloxy)-anilin
Figure imgf000082_0003
Prepared analogously to XXVI.3 from 2.26 g 4-Fluoro-2-(trans-4- hydroxycyclohexyloxy)-nitrobenzene.
Yield: 2 g ESI mass spectrum: m/z = 226 (M+H)+ Intermediate XXVIII
All cis-5-(2-Amino- -fluoro-phenoxy)-cyclohexane-1 ,3-diol
XXVIII.1
Figure imgf000083_0001
Isomer XXVI 11 A IsomerXXVI 11 B
Prepared analogously to 111.1 from 1 ml 2,4-difluoro-nitrobenzene and 3.965 g cyclohexane-1 ,3,5-triol
IsomerXXVI 11 A: 0.6 g
ESI mass spectrum: m/z = 272 (M+H)+
Rf (silica gel): methylene chloride/methanol= 9:1 : 0.41
IsomerXXVI 11 B: 0.43 g
ESI mass spectrum: m/z = 272 (M+H)+
Rf (silica gel), (methylene chloride/methanol= 9:1 ): 0.42
Figure imgf000083_0002
Prepared analogously to XXIV.2 from 0.6 g Isomer XXVIII A.
Yield: 0.58 g Intermediate XXIX
Figure imgf000084_0001
Prepared analogously to XXIV.2 from 0.43 g Isomer XXVIII B.
Yield: 0.4 g
Intermediate XXX
All cis- 2-(3,5-Dimethoxy-cyclohexyloxy)-4-fluoro-phenylamine
Figure imgf000084_0002
XXX .1 all cis-2-(3 -Dimethoxy-cvclohexyloxy)-4-fluoro-1 -nitro-benzene
Figure imgf000084_0003
Prepared analogously to 111.1 from 2.193 ml 2,4-difluoro-nitrobenzene and 3.2 g all cis-1 ,3,5-trimethoxy-cyclohexane.
Yield: 2.8 g
ESI mass spectrum: m/z = 300 (M+H)+
Figure imgf000084_0004
Prepared analogously to XXIV.2 from 2 g all cis-2-(3,5-Dimethoxy-cyclohexyloxy)-4- fluoro-1 -nitro-benzene. Yield: 1 .8 g
Intermediate XXXI
2-(4,4-Dimethyl-cyclohexyloxy -4-fluoro-phenylamine
XXXI.1 2-(4,4-Dimethyl-cvclohexyloxy)-4-fluoro-1 -nitro-benzene
Figure imgf000085_0002
Prepared analogously to 111.1 from 2 ml 2,4-difluoro-nitrobenzene and 2.339 g 4,4- dimethyl-cyclohexanol.
Yield: 4.1 g
ESI mass spectrum: m/z = 285 (M+NH4)+
Figure imgf000085_0003
Prepared analogously to XXIV.2 from 4.1 g 2-(4,4-Dimethyl-cyclohexyloxy)-4-fl
1 - nitro-benzene
Yield: 3.2 g
ESI mass spectrum: m/z = 238 (M+H)+
Rf (silica gel), (methylene chloride/methanol= 30:1 ): 0.42
Intermediate XXXII
2- (4,4-Difluoro-cyclohexyloxy)-4-fluoro-phenylamine
Figure imgf000086_0001
XXXI 1.1 4,4-difluoro-cvclohexanecarboxylic acid methoxy-methyl-amide
Figure imgf000086_0002
2.78 g HATU were added to a solution of 1 g 4,4-difluoro-cyclohexanecarboxylic acid and 1 .3 ml diisopropylethlyamine in 10 ml anhydrous DMF at 0°C. The reaction was stirred at 0°C for 0,5 hours when 0.891 g 0,/V-Dimethyl-hydroxylamine hydrochloride were added. The reaction was allowed to warm to rt overnight. The solution was concentrated in vacuo by co- evaporation with toluene (3x) and filtered. The filtrate was concentrated in vacuo. Purification was achieved by silica gel column
chromatography (solvent: 5:1 ->3:1 petroleum ether/ EtOAc).
Yield: 0.582 g
XXXI 1.2 1 -(4,4-difluoro-cvclohexyl)-ethanone
Figure imgf000086_0003
2 ml methyl lithium (1 M in diethylether) were added into a solution of 0.593 g 4,4- difluoro-cyclohexanecarboxylic acid methoxy-methyl-amide in anhydrous 5 mlTHF at 0°C. The reaction was allowed to warm to rt overnight.The reaction was quenched with sat. ammonium chloride soltution (~50ml) and diluted with sat. sodium
hydrogencarbonate solution (25ml). The aqueous layer was extracted with
diethylether (3x50ml) and the combined organic phases were dried over sodium sulfate, filtered and concentrated in vacuo. Purification was achieved by silica gel column chromatography (solvent: 5:1 -> 1 :1 petroleum/ether (40-60).
Yield: 0.262 g XXXI 1.3 4,4-difluorocvclohexanol
Figure imgf000087_0001
0.361 g meta-chloro-perbenzoic acid were added into a solution of 0.262 g 1 -(4,4- difluoro-cyclohexyl)-ethanone in 5 ml chloroform. The reaction was stirred at rt for 2 hours when TLC indicated consumption of the 1 -(4,4-difluoro-cyclohexyl)-ethanone. The solution was poured into saturated sodium hydrogencarbonate solution and extracted with chloroform (3x 50ml). The combined organic phases were passed through a phase separator concentrated in vacuo. The crude product was
resuspended in methanol (5ml) and 10% aq. potassium carbonate solution. (5ml) and stirred at rt over a weekend. The solution was diluted with chloroform (25ml) and sat. sodium hydrogencarbonate solution. The organic phases were separated and the aqueous phase was extracted with methylene chloride (3x 25ml). The combined organic phases were passed through a phase- separator, concentrated in vacuo. Purification was achieved by silica gel column chromatography (solvent: 100%-> 1 :1 petroleum ether/ diethylether).
Yield: 0.105 g
XXXI 1.4 2-(4,4-Difluoro-cvclohexyloxy)-4-fluoro-1 -nitro-benzene
Figure imgf000087_0002
0.213 g DTAD was added into a solution of 5-fluoro-2-nitro-phenol, 0.105 g 4,4- difluorocyclohexanol, 0.25 g triphenylphospine in 2 ml of anhydrous methylene chloride at rt. The reaction mixture was stirred at rt overnight when TLC analysis indicated the consumption of the 5-Fluoro-2-nitro-phenol . The reaction mixture was diluted with methylene chloride (50ml) and washed with 10% potassium carbonate solution. The aqueous layer was extracted with methylene chloride (2x 25ml) and the combined organics washed with sodium hydrogecarbonate solution (25ml). The organic layer was passed through a phase separator and concentrated in vacuo. Purification was achieved by silica gel column chromatography (solvent: 100%-> 1 :1 iso-hexane/ EtOAc).
Yield: 0.141 g XXXI 1.5 2-(4,4-Difluoro-c clohex lox -4-fluoro-phenylamine
Figure imgf000088_0001
Prepared analogously to III.2 from 0.141 g 2-(4,4-difluoro-cyclohexyloxy)-4-fluoro-1 - nitro-benzene.
Yield: 0.08 g
Intermediate XXXIII
Racemic 2-(trans-3-Methoxy-cyclohexyloxy)-pyridin-3-ylamine
Figure imgf000088_0002
XXXIII.1 3-Methoxycvclohexanol
Figure imgf000088_0003
Prepared analogously to 11.2 from 25 g 3-methoxyphenol.
Yield: 25.5 g
ESI mass spectrum: m/z = 131 (M+H)+
XXXI 11.2 racemic 2-(cis-3-Methoxy-cvclohexyloxy)-3-nitro-pyridine and racemic 2-(trans-3-Methoxy-cvclohexyloxy)-3-nitro-pyhdine
Figure imgf000089_0001
Prepared analogously to 111.1 from 5.1 g 2-fluoro-3-nitropyridine and 5 g 3- methoxycyclohexanol. Purification was achieved by silica gel column
chromatography (solvent: petrolether/EtOAc=70:30 for 20 minutes and within 20 minutes to 50:50).
Racemic 2-(trans-3-Methoxy-cvclohexyloxy)-3-nitro-pyridine eluidinq first:
Yield: 1.6 g
retention time (HPLC): 3.77 min (method C)
ESI mass spectrum: m/z = 253 (M+H)+
Racemic 2-(cis-3-Methoxy-cvclohexyloxy)-3-nitro-pyridine eluidinq second
Yield: 5.82 g
retention time (HPLC): 3.65 min (method C)
ESI mass spectrum: m/z = 253 (M+H)+
Figure imgf000089_0002
Prepared analogously to III.2 from 1 .59 g racemic 2-(trans-3-methoxy- cyclohexyloxy)-3-nitro-pyridine
Yield: 1 .1 1 g
Intermediate XXXIV
Racemic 2-(cis-3-Methoxy-cyclohexyloxy)-pyridin-3-ylamine
Figure imgf000090_0001
Prepared analogously to III.2 from 5.8 g racemic 2-(cis-3-Methoxy-cyclohexyloxy)-3 nitro-pyridine
Yield: 4.32 g
Intermediate XXXV
A/-[trans-3-(2-Amino-5-fluor -phenoxy)-cyclobutyl]-acetamide
Figure imgf000090_0002
XXXV.1 . [trans-3-(5-fluoro-2-nitro-phenoxy)-cvclobutyl1-carbamic acid tert- butyl ester
Figure imgf000090_0003
Prepared analogously to XVI.1 from 2.3 g trans- (3-Hydroxy-cyclobutyl)-carbamic acid terf-butyl ester, 1 .6 g 5-fluoro-2-nitrophenol and 2.423 mlDIAD.
Yield: 2.8 g
ESI mass spectrum: m/z = 327 (M+H)+
XXXV.2 trans- 3-(5-Fluoro-2-nitro-phenoxy)-cvclobutylamine
trifluoroacetate
Figure imgf000090_0004
14 ml trifluoroacetic acid were added to a mixture of 2.8 g [trans-3-(5-fluoro-2-nitro- phenoxy)-cyclobutyl]-carbamic acid terf-butyl ester in 100 ml methylene chloride at 0 °C. The mixture was stirred then for 2 hours at rt and afterwards concentrated. The residue was stirred with diisopropylether and filtered.
Yield: 2.85 g
ESI mass spectrum: m/z = 227 (M+H)+
XXXV.3 A/-[trans-3-(5-Fluoro-2-nitro-phenoxy)-cvclobutyl1-acetamide trifluoroacetate
Figure imgf000091_0001
450 μΙ Acetylchloride were added to a mixture of 1 .8 g trans- 3-(5-fluoro-2-nitro- phenoxy)-cyclobutylamine trifluoroacetate and 3.7 ml triethylamine in 30 ml methylene chloride and stirred for 2 hours at rt. The mixture was extracted two times with water. The organic phase was dried and concentrated. The residue was stirred with diethylether and filtrated. The residue was dried in a drying cabinet.
Yield: 1 .4 g
ESI mass spectrum: m/z = 269 (M+H)+
XXXV.4 A/-[tran -3-(2-Amino-5-fluoro-phenoxy)-cvclobutyl1-acetamide
Figure imgf000091_0002
Prepared analogously to XXIV.2 from 1 .4 g A/-[trans-3-(5-Fluoro-2-nitro-phenoxy)- cyclobutyl]-acetamide
Yield: 1 .55 g
ESI mass spectrum: m/z = 239 (M+H)+
Intermediate XXXVI
Figure imgf000092_0001
relative stereochemistry
XXXVI.1 . 2-(Cvclopent-3-enyloxy)-4-fluoro-1 -nitro-benzene
Figure imgf000092_0002
Prepared analogously to XVI.1 from 1 g cyclopentenol, 1 .57 g 5-fluoro-2-nitrophenol and 1 .89 ml DEAD.
Yield: 2.1 1 g
XXXVI.2 3-(5-Fluoro-2-nitro-phenoxy)-6-oxa-bicvclo[3.1 .Olhexane
Figure imgf000092_0003
2.95 g meta chloroperbenzoic acid were added to an ice-cooled solution of 2.05 g 2- (cyclopent-3-enyloxy)-4-fluoro-1 -nitro-benzene in 45 ml methylene chloride. The reaction mixture was allowed to warm to rt overnight. Then the reaction mxiture was diluted with methylene chloride and washed with 10% aq. potassium carbonate solution (2x). The organic phases were passed through a hydrophobic frit and the solvent was evaporated.
33:1 ratio of epoxide isomers.
Yield: 2.31 g XXXVI .3
Figure imgf000093_0001
relative stereochemistry
2.2 g 3-(5-Fluoro-2-nitro-phenoxy)-6-oxa-bicyclo[3.1 .0]hexane were heated at reflux in 0,2M H2SO4/THF for 5 hours and then stirred overnight. The solvent was then removed in vacuo and the residue extracted with methylene chloride (2x). The combined organic phases were washed with 10% aq. potassium carbonate solution and evaporated. Purification was achieved by silica gel column chromatography (solvent: 100% iso-hexane -> 100% methylene chloride-> 25:1 methylene chloride/MeOH).
Yield: 1 .61 g
XXXVI .4
Figure imgf000093_0002
relative stereochemistry
Prepared analogously to 111.2 from 1 .6 g XXXVI.3.
Yield: 1 .04 g
Intermediate XXXVII
[(1 S,3S)-3-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1-carbamic acid fe/f-butyl ester
Figure imgf000093_0003
XXXVII.1 (1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)-cvclopentyl1-carbamic acid tert- butyl ester
Figure imgf000094_0001
2.57 g sodium hydride (55%) were added to mixture of 9.862 g ((1 S,3S)-3-hydroxy- cyclopentyl)-carbamic acid terf-butyl ester in 100 ml THF at 0 °C and stirred at rt for 30 minutes. 5.372 ml 2,4-difluoro-nitrobenzene were added and the reaction mixture was refluxed for 6 hours. After cooling to rt the reaction mixture was extracted with water and methylene chloride. The organic phase was dried and concentrated. Purification was achieved by silica gel column chromatography (solvent: methylene chloride).
Yield: 6.79 g
ESI mass spectrum: m/z = 341 (M+H)+
XXXVI 1.2 [(1 S,3S)-3-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1-carbamic acid fe/f-butyl ester
Figure imgf000094_0002
Prepared analogously to XXIV.2 from 1 .64 g [(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)- cyclopentyl]-carbamic acid terf-butyl ester.
Yield: 1 .49 g
ESI mass spectrum: m/z = 31 1 (M+H)+
Intermediate XXXVIII
A/-[(1 S,3S)-3-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1-/\/-methyl-acetamide
Figure imgf000095_0001
XXXVI 11.1 r(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)-cvclopentyl1-methyl- carbamic acid fe/f-butyl ester
Figure imgf000095_0002
7.1 ml (1 M in THF) LiHMDS were added at 0 UC to a mixture of 2 g (1 S,3S)-3-(5- fluoro-2-nitro-phenoxy)-cyclopentyl]-carbamic acid terf-butyl ester in 60 ml THF. The reaction mixture was stirred for 30 minutes at rt. Then 398 μΙ methyl iodide were added and the reaction mixture was stirred at rt overnight. Then the mixture was concentrated and extracted with water/methylene chloride. The organic phase was dried and concentrated. Purification was achieved by silica gel column
chromatography (solvent: methylene chloride/methanol/aq. ammonia solution= 90:10:1 ).
Yield: 1 .34 g
ESI mass spectrum: m/z = 355 (M+H)+
XXXVI 11.1 [(1 S,3S)-3-(5-Fluoro-2-nitro-phenoxy)-cvclopentyl1-methyl-amine
Figure imgf000095_0003
Prepared analogously to XXXV.2 from 1 .34 g [(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)- cyclopentyl]-methyl-carbamic acid terf-butyl ester. Yield: 1 .203 g
ESI mass spectrum: m/z = 255 (M+H)+
XXXVI 11.3 A/-r(1 S,3S)-3-(5-Fluoro-2-nitro-phenoxy)-cvclopentyl1-A/-methyl- acetamide
Figure imgf000096_0001
Prepared analogously to XXXV.3 from 0.703 g [(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)- cyclopentyl]-methyl-amine trifluoroacetae and acetyl chloride.
Yield: 0.588 g
ESI mass spectrum: m/z = 297 (M+H)+
XXXVI 11.4 A/-r(1 S,3S)-3-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1-A/-methyl- acetamide
Figure imgf000096_0002
Prepared analogously to XXIV.2 from 0.58 g [(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy) cyclopentyl]-methyl-carbamic acid terf-butyl ester.
Yield: 0.52 g
ESI mass spectrum: m/z = 267 (M+H)+
Intermediate XXXIX
Cis/trans-4-(3-Amino-pyridin-2-ylox -cyclohexanol
Figure imgf000096_0003
XXXIX.1 Cis/trans-4-(3-nitro-pyridin-2-yloxy)-cvclohexanol
Figure imgf000097_0001
Prepared analogously to 111.1 from 3.6 g 2-fluoro-3-nitropyridine and 2.9 g 1 ,4- cyclohexanediol.
Yield: 1 .6 g
XXXIX.2 Cis/trans-4-(3-Amino-pyridin-2-yloxy)-cvclohexanol
Figure imgf000097_0002
Prepared analogously to III.2 from 1 .6 g cis/trans-4-(3-nitro-pyridin-2-yloxy)- cyclohexanol.
Yield: 1 .53 g
Intermediate XXXX
cis-4-Fluoro-2-(3-methoxy-cvclohexyloxy)-phenylamine
Figure imgf000097_0003
XXXX . cis/trans- 3-Methoxy-cyclohexanol
Figure imgf000097_0004
A mixture of cis- and trans-4-methoxy-cyclohexanol (7:3) was prepared by
hydrogentaion of 3-methoxy-phenol in methanol at room temperature in the presence of Nishimuras catalyst.
XXXX.2. 4-Fluoro-2-(cis-3-methoxy-cvclohexyloxy)-1 -nitro-benzene
Figure imgf000098_0001
LiHMDS (1 M solution in THF; 5.0 ml) was added slowly to an ice/ethanol-cooled solution of 3-methoxy-cyclohexanol (7:3 mixture of cis- and trans-isomers; 601 mg) in THF (8 ml). Cooling was suspended after 5 minutes and the mixture was stirred for 15 minutes at room temperature before addition of 2,4-difluoro-1 -nitro-benzene (482 μΙ). After 4 h another 1 .5 ml of LiHMDS (1 M solution in THF) was added and the reaction mixture was stirred over night at room temperature. The reaction mixture was quenched by addition of hydrochloric acid (0.1 M), diluted with ethyl acetate, and filtered through celite. The organic layer was washed with brine, dried over MgSO4 and concentrated in vacuo. The residue was submitted to column chromatography (silica gel, cyclohexane/ethyl acetate 85:15) to give the cis-isomer (650 mg) and the trans-isomer (230 mg).
Yield: 650 mg (55 %)
MS (ESI+): 270 (M+H+)
HPLC (Method D): Rt 3.89 min
XXXX.3.4-Fluoro-2-(cis- 3-methoxy-cvclohexyloxy)-phenylamine
Figure imgf000098_0002
Ammonium formate (738 mg) was added to a suspension of 4-fluoro-2-(cis-3- methoxy-cyclohexyloxy)-1 -nitro-benzene (630 mg) and 10 % palladium on charcoal (70 mg) in methanol (10 ml) at room temperature and the mixture was heated to reflux for 30 min until LCMS indicated complete conversion of the starting material . The mixture was diluted with dichloromethane (50 ml) and water (20 ml), filtered through celite, and the filtercake was washed with dichloromethane (20 ml). The organic layer was dried over MgSO4 and concentrated in vacuo. The residue was submitted to column chromatography (silica gel, cyclohexane/ethyl acetate 70:30) to give the desired product.
Yield: 440 mg (79 %)
MS (ESI+): 240 (M+H+)
HPLC (Method D): Rt 2.21 min
Intermediate XXXXI
trans-4-Fluoro-2-(3-methoxy-cvclohexyloxy)-phenylamine
Figure imgf000099_0001
XXXXI.1 . 4-Fluoro-2-(trans-3-methoxy-cvclohexyloxy)-1 -nitro-benzene
Figure imgf000099_0002
The compound was prepared as described under XXXX.2.
Yield: 230 mg (19 %)
MS (ESI+): 270 (M+H+)
HPLC (Method D): Rt 3.99 min
XXXXI.2. 4-Fluoro-2-(trans-3-methoxy-cvclohexyloxy)-phenylamine
Figure imgf000099_0003
The compound was prepared from 4-fluoro-2-(trans-3-methoxy-cyclohexyloxy)-1 - nitro-benzene (2.07 g) as described for the cis-isomer under XXXX.3. Yield: 1 .94 g (96 %)
MS (ESI+): 240 (M+H+)
HPLC (Method D): Rt 2.24 min Intermediate XXXXII
cis-2-(3-methoxy-cvclohexyloxy)-pyridin-3-ylamine
Figure imgf000100_0001
XXXXII.1 . 2-(cis-3-methoxy-cvclohexyloxy)-3-nitro-pyridine
Figure imgf000100_0002
LiHMDS (1 M solution in THF; 40.0 ml) was added slowly to an ice/ethanol-cooled solution of cis/trans-4-methoxy-cyclohexanol (5.00 g) in THF (10 ml). Cooling was suspended after the addtiton was complete and the mixture was stirred for 15 minutes at room temperature. A solution of 2-fluoro-3-nitro-pyridine (5.10 g) in THF (10 ml) was added slowly while the temperature was maintained below 24 °C. The reaction mixture was stirred for 2 h at room temperature, neutralized by addition of hydrochloric acid (1 M), and extracted with ethyl acetate. The combined organic extracts were washed with brine, dried over MgSO4 and concentrated in vacuo. The residue was submitted to column chromatography (silica gel, petrol ether/ethyl acetate 70:30□ 50:50) to give the cis-isomer (5.82 g) and the trans-isomer (1 .60 g). Yield: 5.82 g (64 %)
MS (ESI+): 253 (M+H+)
HPLC (Method D): Rt 3.65 min XXXXII.2. 2-(cis-3-methoxy-cvclohexyloxy)-pyridin-3-ylamine
Figure imgf000101_0001
Ammonium formate (7.25 g) was added to a suspension of 2-(cis-3-methoxy- cyclohexyloxy)-3-nitro-pyridine (5.80 g) and 10 % palladium on charcoal (400 mg) in methanol (40 ml) at room temperature and the mixture was heated to reflux for 30 min until LCMS indicated complete conversion of the starting material. The mixture was diluted with dichloromethane (100 ml) and water (40 ml), filtered through celite, and the filtercake was washed with dichloromethane (30 ml). The organic layer was dried over MgSO4 and concentrated in vacuo. The residue was submitted to column chromatography (silica gel, petrol ether/ethyl acetate 70:30) to give the desired product.
Yield: 4.32 g (85 %)
MS (ESI+): 223 (M+H+)
HPLC (Method D): Rt 2.36 min
Intermediate XXXXIII
2-(trans-3-methoxy-cvclohexyloxy)-pyridin-3-ylamine
Figure imgf000101_0002
XXXXIII.1 . 2-(trans-3-methoxy-cvclohexyloxy)-3-nitro-pyridine
Figure imgf000102_0001
The compound was prepared as described under 111.1 .
Yield: 1 .60 g (18 %)
MS (ESI+): 253 (M+H+)
HPLC (Method D): Rt 3.77 min
XXXXIII.2. trans-2-(3-methoxy-cvclohexyloxy)-pyridin-3-ylamine
Figure imgf000102_0002
The compound was prepared from 2-(trans-3-methoxy-cyclohexyloxy)-3-nitro- pyridine (1 .59 g) as described for the cis-isomer under III.2.
Yield: 1 .1 1 g (79 %)
MS (ESI+): 223 (M+H+)
HPLC (Method D): Rt 2.36 min Intermediate XXXXIV
4-Fluoro-2-((1 S,2S)-2-methoxy-cyclohexyloxy)-phenylamine
Figure imgf000102_0003
XXXXIV.1 . 4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-1 -nitro-benzene
Figure imgf000103_0001
Prepared analogously to 111.1 from 926 μΙ 2,4-difluor-nitrobenzene and 1 g(1 S,2S)-2- methoxycyclohexanol .
Yield: 1 .34 g
XXXXIV.2. 4-Fluoro-2-((1 S,2S)-2-methoxv-cvclohexvloxv)-phenvlamine
Figure imgf000103_0002
Prepared analogously to III.2 from 0.142 g trans-4-Fluoro-2-(2-methoxy- cyclohexyloxy)-1 -nitro-benzene.
Yield: 0.1 15 g
Intermediate XXXXV
Figure imgf000103_0003
relative stereochemistry
XXXXV.1 .
Figure imgf000103_0004
relative stereochemistry AD-mix-alpha (19.60 g) was added to t-butanol (70.0 ml) and water (70.0 ml). The mixture was cooled to 0°C and 2-(cyclopent-3-enyloxy)-4-fluoro-1 -nitrobenzene (3.14 g) was added. After 2 h the mixture was allowed to warm to room temperature overnight then recooled at 0°C and sodium metabisulfite (22 g) was added. After 15 min the reaction mixture was stirred at room temperature for 1 h and extracted with EtOAc. The combined organic extracts were concentrated. To the residue was added 2,2-dimethoxypropane (25.0 ml) and p-toluene sulfonic acid (270 mg) and the mixture was heated at reflux for 1 h. The reaction mixture was diluted with EtOAc and washed with 10% aq. K2CO3 and brine. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue was purified by
chromatography to give the desired product.
Yield: 1 .77 g
XXXXV.2.
Figure imgf000104_0001
relative stereochemistry
Prepared analogously to III.2 from 0.458 g compound XXXXV.1
Yield: 382 mg
Intermediate XXXXVI
Figure imgf000104_0002
relative stereochemistry
XXXXVI .1 . H
Figure imgf000105_0001
relative stereochemistry
To compound XXXXV:1 (521 mg) in THF (5.0 ml) was added 2 M aq. HCI. The reaction mixture was heated to reflux for 1 .5 h, then concentrated in vacuo to give the desired product.
Yield: 438 mg
XXXXVI.2.
Figure imgf000105_0002
relative stereochemisty
Compound XXXXVI.1 (438 mg) and tetra-n-butylammonium bromide (55 mg) in 46/48% aq. sodium hydroxide (7.0 ml) and dibromomethane (7.0 ml) were stirred at 60°C for 2 h. The reaction mixture was diluted with methylene chloride and water. The layers were separated and the aqueous layer was extracted with methylene chloride. The combined organics were passed through a hydrophobic frit and concentrated in vacuo. The residue was purified by chromatography to yield the desired product.
Yield: 100 mg
XXXXVI.3.
Figure imgf000106_0001
relative stereochemistry
Compound XXXXVI.2 (100 mg), ammonium formate (1 17 mg) and Pd/C (20 mg) in methanol (2.0 ml) were heated at reflux for 40 min. The reaction mixture was allowed to cool, filtered through a pad of celite and the filtercake was washed with methylene chlorideThe filtrate was concentrated. The residue was suspended in methylene chloride, passed through a hydrophobic frit and concentrated in vacuo to give the desired product.
Yield: 124 mg Intermediate XXXXVII
XXXXVII.1 .
Figure imgf000106_0002
AD-mix-alpha (19.60 g) was added to t-butanol (70.0 ml) and water (70.0 ml). The mixture was cooled to 0°C and 2-(cyclopent-3-enyloxy)-4-fluoro-1 -nitrobenzene (3.14 g) was added. After 2 h the mixture was allowed to warm to room temperature overnight then recooled at 0°C and sodium metabisulfite (22 g) was added. After 15 min the reaction mixture was stirred at room temperature for 1 h and extracted with EtOAc. The combined organic extracts were concentrated. To the residue was added 2,2-dimethoxypropane (25.0 ml) and p-toluenesulfonic acid (270 mg) and the mixture was heated at reflux for 1 h. The reaction mixture was diluted with EtOAc and washed with 10% aq. K2CO3 and brine. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue was purified by
chromatography to give the desired product.
Yield: 2.04 g
XXXXVII.2.
Figure imgf000107_0001
relative stereochemistry
2 M aq. HCI (7.0 ml) was added to compound XXXXVII.1 (695 mg) in THF (7.0 ml) and the mixture was heated at reflux. After 1 .5 h the reaction mixture was concentrated in vacuo. The residue was partitioned between EtOAc and water. The organic layer was passed through a hydrophobic frit and concentrated in vacuo to yield the desired product.
Yield: 521 mg
XXXXVII.3.
Figure imgf000107_0002
relative stereochemistry
Sodium hydride (240mg, 60%) was added at 0°C to a mixture of compound
XXXXVII.2 (514 mg) and iodomethane (380 μΙ) in DMF (10.0 ml). The reaction mixture was allowed to warm to room temperature overnight, diluted with EtOAc and washed with water and brine. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The crude was triturated with hexane to yield the desired product.
Yield: 430 mg XXXXVII.4.
Figure imgf000108_0001
Prepared analogously to III.2 from compound XXXXVII.3 (430 mg).
Yield: 365 mg Intermediate XXXXVIII
XXXXVIII.1 .
Figure imgf000108_0002
ochemistry
Compound XXXXVII.2 (500 mg) and tetra-n-butylammonium bromide (63 mg) in 46% aq. sodium hydroxide (7.0 ml) and dibromomethane (7.0 ml) were stirred at 60°C for 2 h. The reaction mixture was allowed to cool and filtered. The filtrate was separated. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The crude was purified by chromatography to yield the desired product.
Yield: 178 mg XXXXVIII.2.
Figure imgf000109_0001
stereochemistry Prepared analogously to III.2 from compound XXXXVIII.1 (166 mg). Yield: 141 mg
Intermediate XXXXIX
Figure imgf000109_0002
stereochemistry Prepared analogously to III.2 from compound XXXXVII.1 (458 mg) Yield: 391 mg
Intermediate XXXXX
Chiral
Figure imgf000109_0003
XXXXX.1 . 2-(Cvclopent-2-enyloxy)-4-fluoro-1 -nitrobenzene
Figure imgf000110_0001
To a mixture of 5-fluoro-2-nitrophenol (1 ,48 g), 2-cyclopenten-1 -ol (662 mg) and triphenylphosphine (2.47 g) in THF (25.0 ml) diethylazodicarboxylate (1 .48 ml) was added at 0°C After stirring at room temperature overnight the reaction mixture was diluted with methylene chloride and washed with 10% aq. KHSO4. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue was purified by chromatography to give the desired product.
Yield: 1 .25 g
Figure imgf000110_0002
AD-mix-alpha (7.57 g) was added to t-butanol (20.0 ml) and water (25.0 ml) and stirred for 10 min. The mixture was cooled to 0°C and 2-(cyclopent-2-enyloxy)-4- fluoro-1 -nitrobenzene (1 .21 g) was added. After stirring at room temperature overnight the mixture was recooled at 0°C and sodium metabisulfite (8.13 g) was added. After 10 min the reaction mixture was stirred at room temperature for 1 h and extracted with EtOAc. The combined organic extracts were washed with brine passed through a hydrophobic frit and concentrated in vacuo to yield the desired product.
XXXXX.3.
Figure imgf000111_0001
compound XXXXX.3.1 compound XXXXX.3.2
To 3-(5-fluoro-2-nitrophenoxy)cyclopentane-1 ,2-diol (1 .40 g) in 2,2- dimethoxypropane (5.0 ml) was added p-toluenesulfonic acid (103 mg) and the mixture was heated at reflux for 1 h. The reaction mixture was diluted with DCM and 10% aq. K2CO3, passed through a hydrophobic frit and concentrated in vacuo. The residue was purified by chromatography (silica gel; solvent: 100% iso-hexane --> iso- hexane/EtOAc (5:1 ), the compound XXXXX.3.1 eluiding first.
Yield: 1 .31 g
XXXXX.4.
Figure imgf000111_0002
Prepared analogously to III.2. from compound XXXXX.3.1 (595 mg).
Yield: 515 mg
Intermediate XXXXXI
Chiral
Figure imgf000111_0003
Prepared analogously to III.2 from compound XXXXX.3.2 (106 mg).
Yield: 91 mg Intermediate XXXXXII
racemic cis-2-(2-amino-5-fluorophenoxy)cvclopentanol
Figure imgf000112_0001
XXXXXII.1 racemic cis-2-(5-fluoro-2-nitro henoxy)cvclopentanol
Figure imgf000112_0002
Prepared analogously to III.1 from cis-1 ,2-cyclopentandiol (1 .0 g) and 1 .28 ml 2,4- difluoronitrobenzene.
Yield: 1 .34 g XXXXXII.2 racemic cis-2-(2-amino-5-fluorophenoxy)cvclopentanol
Chiral
Figure imgf000112_0003
Prepared analogously to III.2 from racemic cis-2-(5-fluoro-2- nitrophenoxy)cyclopentanol (2.36 g).
Yield: 388 mg
Intermediate XXXXXIII
3-(2-amino-5-fluorophenoxy)cvclopentanol
XXXXXIII.1 . 3-(5-fluoro-2-nitrophenoxy)cvclopentanol
Figure imgf000113_0001
Di-tert-butyl azodicarboxylate was added at 0°C to a mixture of 1 ,3-cyclopentandiol (1 .02 g), 5-fluoro-2-nitrophenol (0.79 g) and triphenylphosphine (1 .97 g) in THF (15.0 ml). After stirring at room temperature over weekend the mixture was treated with 2 M aq. HCI (20.0 ml) and refluxed for 30 min. The reaction mixture was diluted with methylene chloride. The layers were separated. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The crude was purified by chromatography to yield the desired product.
Yield: 1 .10 g
Figure imgf000113_0002
Prepared analogously to III.2 from 3-(5-fluoro-2-nitrophenoxy)cyclopentanol (1 .09 g). Yield: 868 mg
Intermediate XXXXXIV
racemic cis- 2-(2-Amino-5-fluoro- henoxy)-cyclohexanol
Figure imgf000113_0003
relative stereochemistry
XXXXXIV.1 racemic cis- 2-(5-Fluoro-2-nitro-phenoxy)-cvclohexanol
Figure imgf000114_0001
relative stereochemistry
Prepared analogously to III.1 from cis-1 ,2-cyclohexandiol (1 .0 g) and 0.94 ml 2,4- difluoronitrobenzene.
Yield: 1 .34 g
XXXXXIV.2 racemic cis-2-(2-Amino-5-fluoro-phenoxy)-cvclohexanol
Figure imgf000114_0002
relative stereochemistry
Prepared analogously to III.2 from racemic cis- 2-(5-fluoro-2-nitro-phenoxy) cyclohexanol cyclopentanol (2.198 g).
Yield: 627 mg
Intermediate XXXXXVI 3-(2-Amino-5-fluoro-phenoxy)-cvclohexanol
Figure imgf000114_0003
XXXXXVI .1 3-(5-Fluoro-2-nitro-phenoxy)-cvclohexanol
Figure imgf000114_0004
Prepared analogously to XVI.1 from -1 ,3-cyclohexandiol (2.32.0 g) and 1 .57 5-fl 2-nitrophenol. Yield: 0.952 g
XXXXXIV.2 3-(2-Amino-5-fluoro-phenoxy)-cvclohexanol
Figure imgf000115_0001
Prepared analogously to III.2 from 3-(5-fluoro-2-nitro-phenoxy)-cyclohexanol (0.945 g)-
Yield: 487 mg
Intermediate XXXXXVII 4-Fluoro-2- trans-4-methoxy-cvclohexyloxy)-phenylamine
Figure imgf000115_0002
XXXXXVII.1 4-Fluoro-2-(trans-4-methox -cvclohexyloxy)-1 -nitro-benzene
Figure imgf000115_0003
0.6 g sodium hydride (60%) were added to a cooled solution (~7°C) of 2.55 g 4- fluoro-2-(trans-4-hydroxy-cyclohexyloxy)-1 -nitro-benzene and iodomethane in 30 ml DMF. The mixture was allowed to warm to rt overnight, diluted with EtOAc and washed with water and brine (3x). The organic phase was dried (MgSO4), passed through a hydrophobic frit and evaporated. The residue was purified by flash column chromatography (silica gel, 100% i-hexane --> 7:1 i-hexane:EtOAc). XXXXXVII.2 4-Fluoro-2-(trans-4-methox -cvclohexvloxv)-phenylamine
Figure imgf000115_0004
Prepared analogously to III.2 from 1 .81 g 4-Fluoro-2-(trans-4-methoxy- cyclohexyloxy)-1 -nitro-benzene. Yield: XXXXXVIII
Figure imgf000116_0001
XXXXXVIII.1 4- Methoxycvclohexanol
Figure imgf000116_0002
A mixture of 100 g 4-methoxyphenol and Nishimura's catalyst in 750 ml ethanol were hydrogenated (50 psi hydrogen) at room temperature for 4.5 hours. The mixture was filtered and the filtrate was concentrated.
Yield: 1 14 g
ESI mass spectrum: m/z = 131 (M+H)+
XXXXXVIII .2 4-Fluoro-2-(cis-4-methoxy-cvclohexyloxy)-phenylamine and 4-
Fluoro-2-(trans-4-methox -cvclohexyloxy)-phenylamine
Figure imgf000116_0003
A mixture of 18.9 g 2-nitro-5-fluorophenol and 19 g 4-methoxycyclohexanol in 250 ml THF were placed in a water bath with cold water. 41 g DTAD and 47 g
triphenylphosphine were added simultanously. The reaction mixture was stirred for 2 hours at room temperature. 1 .9 g Pd/C (10%) were added and the reaction mixture hydrogenated (50 psi hydrogen) at room temperature for 20 hours. The mixture was filtered and concentrated. Methylene chloride was added to the residue and the mixture was extracted two times with HCI (2M). The water phase were adjusted to basic pH by addition of aq. sodium hydroxide solution (4M) and extracted two times with methylene chloride. The combined organic phases were dried over sodium sulfate, filterd and concentrated. Purification was achiedved by column
chromatographie on silica (eluent: methylene chloride/EtOAc= 9:1 ).
4-Fluoro-2-(cis-4-methoxy-cvclohexyloxy)-phenylamine
Yield: 2 g ESI mass spectrum: m/z = 240 (M+H)+
4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamine
Yield: 3.8 g
ESI mass spectrum: m/z = 240 (M+H)+
Intermediate XXXXXIX
4-(3-Amino-pyridin-2-yloxy)-cyclohexanol
Figure imgf000117_0001
XXXXXIX.1 4-(3-Nitro-pyridin-2-yloxy)-cvclohexanol
Figure imgf000117_0002
Prepared analogously to 111.1 from 3.6 g 2-fluoro-3-nitropyridine and 2.9 g 1 ,4- cyclohexanediol
Yield: 3 g
XXXXXIX.2 4-(3-Amino-pyridin-2- loxy)-cvclohexanol
Figure imgf000117_0003
Prepared analogously to III.2 from 1 .6 g 4-(3-Nitro-pyridin-2-yloxy)-cyclohexanol Yield: 1 .53 g
Intermediate XXXXXX trans-4- 3-Amino-pyridin-2-yloxy)-cvclohexanol
Figure imgf000117_0004
XXXXXX.1 trans-4-(3-Nitro-pyridin-2-yloxy)-cvclohexanol
Figure imgf000118_0001
Prepared analogously to 111.1 from 4.054 g 2-fluoro-3-nitropyridine and 2.266 g trans- 1 ,4-cyclohexanediol
Yield: 0.298 g
XXXXXX.2 trans-4-(3-Amino-pyridin-2- loxy)-cvclohexanol
Figure imgf000118_0002
Prepared analogously to XXIV.2 from 0.29 g trans-4-(3-Nitro-pyridin-2-yloxy)- cyclohexanol
Yield: 0.203 g
ESI mass spectrum: m/z = 209 (M+H)+
Intermediate XXXXXXI
Figure imgf000118_0003
XXXXXXI.1 . 2-(cvclopent-3-enyloxy)-4-fluoro-1 -nitrobenzene
Figure imgf000118_0004
To a mixture of 5-fluoro-2-nitrophenol (1 .57g), 2-cyclopentenol (1 .00 g) and triphenylphosphine (3.15 g) in methylene chloride (30.0 ml) was added at 0°C diethylazodicarboxylate (1 .89 ml). After stirring at room temperature overnight the reaction mixture was concentrated in vacuo. The residue was purified by
chromatography to give the desired product. Yield: 2.1 1 g
XXXXXXI.2. 3-(5-fluoro-2-nitrophenoxy)-6-oxabicvclor3.1 .01hexane
Figure imgf000119_0001
To 2-(cyclopent-3-enyloxy)-4-fluoro-1 -nitrobenzene (2.05 g) in methylene chloride (45.0 ml) at 0°C was added 3-chloroperoxybenzoic acid (2.95 g) and the mixture was allowed to warm to room temperature overnight. The reaction mixture was diluted with methylene chloride and washed with 10% aq. K2CO3. The organic layer was passed through a hydrophobic frit and solvent evaporated to give the desired product.
Yield: 2.31 g
XXXXXXI.3.
Figure imgf000119_0002
relative stereochemistry
3-(5-fluoro-2-nitrophenoxy)-6-oxabicyclo[3.1 .0]hexane (2.20 g) was heated in 0.2 M sulphuric acid (50.0 ml) and THF (50.0 ml) for 5 h. After stirring at room temperature overnight the reaction mixture was concentrated in vacuo. The residue was extracted with methylene chloride . The combined organic extracts were washed with 10% aq.
K2CO3 and concentrated in vacuo. The residue was purified by chromatography to give the desired product.
Yield: 1 .61 g XXXXXXI.4.
Figure imgf000120_0001
relative stereochemistry
Compound XXXXXXI.3 (1 .60 g), ammonium formate (1 .96 g) and Pd/C (0.30 g) in methanol (30.0 ml) were heated at reflux for 1 h. The reaction mixture was filtered through a pad of celite and the filtercake was washed with DCM. The filtrate was concentrated in vacuo and the residue was purified by chromatography to give the desired product.
Yield: 1 .04 g
Intermediate XXXXXXII
A/-[(1 S,3S)-3-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1-acetamide
Figure imgf000120_0002
XXXXXXII.1 (1 S,3S)-3-(5-Fluoro-2-nitro-phenoxy)-cvclopentylamine trifluoroacetate
Figure imgf000120_0003
To [(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)-cyclopentyl]-carbamic acid terf-butyl ester, cpd. XXXVII.1 (2.13 g) in DCM (150 ml) was added at 0°C TFA (10 ml) and stirred at rt overnight. The reaction mixture was concentrated at rt and triturated with diisopropyl ether to give the desired compound.
Yield: 1 .80 g
ESI mass spectrum: m/z = 241 (M+H)+ XXXXXXII.2 A/-r(1 S,3S)-3-(5-Fluoro-2-nitro-phenoxy)-cvclopentyl1-acetamide
Figure imgf000121_0001
Acetyl chloride (360 μΙ) was added at 0°C to a mixture of (1 S,3S)-3-(5-fluoro-2-nitro- phenoxy)-cyclopentylamine trifluoroacetate (1 .80 g) and DIPEA (4.4 ml) in methylene chloride (150 ml) and stirred at rt for 1 hour. The reaction mixture was diluted with water and the organic layer was dried and concentrated. The crude was triturated with diisopropyl ether to give the desired product.
Yield: 1 .40 g
ESI mass spectrum: m/z = 283 (M+H)+
XXXXXXII.3 A/-r(1 S,3S)-3-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1-acetamide
Figure imgf000121_0002
A mixture of A/-[(1 S,3S)-3-(5-fluoro-2-nitro-phenoxy)-cyclopentyl]-acetamide (1 .45 g) and Raney Ni (200 mg) in MeOH (150 ml) was stirred at rt overnight under hydrogen atmosphere (5 bar). The catalyst was removed by filtration and the filtrate was concentrated to give the desired product.
Yield: 1 .89 g (65% pure)
ESI mass spectrum: m/z = 253 (M+H)+
Intermediate XXXXXXIII
[4-(3-Amino-pyridin-2-yloxy)cvclohexyl1-carbamic acid tert-butyl ester
Figure imgf000122_0001
A mixture of 7.8 g [4-(3-nitro-pyridin-2-yloxy)cyclohexyl]-carbamic acid tert-butyl ester and 0.8 g raney nickel in 100 ml methanol was hydrogenated at rt under 50 psi overnight. The reaction mixture was filtered and the filtrate concentrated.
Yield: 6.9 g
ESI mass spectrum: m/z = 308 (M+H)D
Intermediate XXXXXXIV
(1 S.2S) [2-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1- carbamic acid tert-butyl ester
Figure imgf000122_0002
XXXXXXIV.1 (1 S,2S)r2-(5-Fluoro-2-nitro-phenoxy)-cvclopentyl1-carbamic acid tert- butyl ester
Chiral
Figure imgf000122_0003
(1 S,2S)-trans-N-boc-2-aminocyclopentanol was dissolved in 50 ml THF and cooled to 10°C. To the reaction mixture were added 32.2 ml LiHMDS 1 M in THF. After 1 hour 2.72 ml 2,4-difluoronitrobenzol were added and the mixture was stirred at rt overnight. Then the mixture was poured in water and extracted with ethylacetate. The organic layer was washed with water, dried and concentrated in vacuo.
Yield: 9.0 g
ESI mass spectrum: m/z = 341 (M+H) D
XXXXXXIV.2 (1 S.2S) r2-(2-Amino-5-fluoro-phenoxy)-cvclopentyl1- carbamic acid tert-butyl ester
Figure imgf000123_0001
Prepared analogously to example III.2 from 9.0 g £1 S,2S)[2-(5-fluoro-2-nitro- phenoxy)-cyclopentyl]-carbamic acid tert-butyl ester( compound XXXXXXIV.1 ) Yield: 8.0 g
ESI mass spectrum: m/z = 31 1 (M+H) D
XXXXXXIV.3 ( 1 S.2S) 4-r2-(2-tert-Butoxycarbonylamino-cvclopentyloxy)-4-fluoro- phenylaminol-5-methyl thieno[2,3-dlpyrimidine-6-carboxylic acid methyl ester
Figure imgf000123_0002
A reaction mixture of 2.0 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 2.5 g intermediate XXXXXXIV.2 and 0.283 g p-toluenesulfonic acid in 20 ml Dioxan was heated at 1 10°C in the microwave for 1 hour. The reaction mixture was diluted with MeOH and filtered. The filtrate was washed with
dioxane/MeOH. The residue was triturated with diisopropylether. XXXXXXIV.4 ( 1 S.2S) 4-r2-(2-tert-Butoxycarbonylamino-cvclopentyloxy)-4-fluoro- phenylaminol-5-methyl thieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000124_0001
A mixture of 2.4 g (1 S,2S) 4-[2-(2-tert-butoxycarbonylamino-cyclopentyloxy)-4-fluoro- phenylamino]-5-methyl thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester and 20ml 1 M sodium hydroxide solution in 50 ml MeOH was stirred at rt overnight. To the reaction mixture was added 20 ml 1 M hydrochloric acid until a pH range of 2-3 was reached. The mixture was diluted with water and filtrated. The solid was dried in vacuo at 50°C.
Yield: 2.2 g
ESI mass spectrum: m/z = 503 (M+H)D
XXXXXXIV.5 (1 S.2S) (2-(2- (6-Carbamoyl-5-methyl-thienor2,3-dlpyhmidin-4- ylamino)-5-fluoro-phenoxy1-cvclopentyl)-carbamic acid tert-butyl ester
Figure imgf000124_0002
Prepared analogously to example 1 .4 from 2.20 g (1 S,2S) 4-[2-(2-tert- butoxycarbonylamino-cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl thieno[2,3- d]pyrimidine-6-carboxylic acid ( compound XXXXXXIV.4) and ammonia.
Yield: 2.1 g ESI mass spectrum: m/z = 502 (M+H) D
XXXXXXIV.6 (1 S.2S) 4-r2-(2-Amino-cvclopentyloxy)-4-fluoro-phenylamino1-5-methyl thieno[2,3-dlpyrimidine-6-carboxylic acid amide
Chiral
Figure imgf000125_0001
A reaction mixture of 2.1 g 1 S,2S) {2-(2- (6-carbamoyl-5-methyl-thieno[2,3- d]pyrimidin-4-ylamino)-5-fluoro-phenoxy]-cyclopentyl}-carbamic acid tert-butyl ester, and 1 .24 ml trifluoroacetic acid in 50 ml DCM was stirred for 3 days at 46°C.
The mixture was concentrated, diluted with toluenel and concentrated. The residue was extracted with DCM and water, whereby the water layer had the pH range of 10.
The organic layer was dried and concentrated in vacuo. The residue was purified by chromatography.
Yield: 0.5 g
ESI mass spectrum: m/z = 402 (M+H) D
End compounds
Example 1
Figure imgf000125_0002
1 .1
Figure imgf000126_0001
relative stereochemistry A reaction mixture of 0.265 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester, 0.265 g intermdiate I and 0.02 g p-toluenesulfonic acid in 3 ml dioxane were heated at 1 10°C for 8 hours.
Then aq. ammonium hydroxide solution (3M) was added. The mixuture was filtered and the solid washed with water and diethly ether. The solid was dried in vacuo at 50°C for 3h and at rt over weekend.
Yield: 0.385 g
1 .2
Figure imgf000126_0002
relative stereochemistry
0.385 g compound 1 .1 , 0.016 g p-toluenesulfonic acid and 1 ml 2,2- dimethoxypropane in 1 ml DMF were heated at 80°C for 45 minutes. Then the reaction mixture was diluted with EtOAc and washed with 10% aq. potassium carbonate solution and brine (2x). The organic phase was passed through a hydrophobic frit and evaporated. The residue triturated with diethylether.
Yield: 0.306 g
1 .3
Figure imgf000127_0001
relative stereochemistry
1 .6 ml sodium hydroxide solution (2M) were added to a mixture of 0.306 g compound 1 .2. in 6 ml EtOH/THF (1 :1 ). The reaction mixture was stirred at rt for 45 minutes and at reflux for 40 minutes. Then the solvent was removed in vacuo and the residue suspended in water, aqu. hydrochloric acid solution (2M) was added. The mixture was filtered and the solid washed with water. The solid was suspended in ethanol and the mixture then concentrated. This was repeated twice.
Yield: 0.274 g 1 .4
Figure imgf000127_0002
relative stereochemistry 0.256 g HATU were added to an ice-cooled solution of 0.265 g compound 1 .3 and 1 17 μΙ DIPEA in 3 ml DMF. After 30 minutes at this temperature 1 .5 ml of a solution of ammonia in methanol (7 mol/l) were added. The mixture was allowed to warm to rt overnight. DMF was evaparated in vacuo and the residue was evaporated from toluene (3x). The residue was suspended in methanol and heated to reflux. The reaction mixture was filtered, the solid washed with diethylether and dried.
Yield: 0.185 g
ESI mass spectrum: m/z = 473 (M+H)+ Rt (HPLC): 1 .42 min (method X)
Example 2
Figure imgf000128_0001
relative stereochemistry A mixture of 0.155 g compound 1 .4 and 2 ml aq. hydrochloric acid solution (2M) in 2 ml THF were heated at reflux for 20 minutes. The reaction mixture was filtered at rt. The solid was washed with water and diethylether and dried in vacuo over
phosphorous pentoxide.
Yield: 0.1 10 g
ESI mass spectrum: m/z = 433 (M+H)+
Rt (HPLC): 1 .23 min (method X)
Example 3
4-[4-Fluoro-2-(trans-4-methanesulfonylamino-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000128_0002
3.1 . 4-[4-Fluoro-2-(trans-4-methanesulfonylamino-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid methyl ester
Figure imgf000129_0001
Prepared analogously to 1 .1 from intermediate IV (0.16 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.129 g).
Yield: 0.223 g
3.2. 4-[4-Fluoro-2-(trans-4-methanesulfonylamino-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000129_0002
Prepared analogously to 1 .3 from 0.22 g 4-[4-fluoro-2-(trans-4- methanesulfonylamino-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester (cpd.3.1 ).
Yield: 0.1 18 g
3.3. 4-[4-Fluoro-2-(trans-4-methanesulfonylamino-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000130_0001
Prepared analogously to 1 .4 from 0.1 1 g 4-[4-fluoro-2-(trans-4- methanesulfonylamino-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid (cpd.3.2).
Yield: 0.080 g
ESI mass spectrum: m/z = 494 (M+H)+
Rt (HPLC): 1 .31 min (method X)
Example 4
4-(4-Fluoro-2-(trans-4-(N-methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidin -6-carboxamide
Figure imgf000130_0002
4.1 Methyl 4-(4-fluoro-2-(trans-4-(N- methyl methylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2, 3- dlpyrimidine-6-carboxylate
Figure imgf000130_0003
Prepared analogously to 1 .1 from intermediate V (0.242 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.155 g). Yield: 0.272 g
4.2 4-(4-Fluoro-2-(trans-4-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthien dlpyrimidine-6-carboxylic acid
Figure imgf000131_0001
Prepared analogously to 1 .3 from 0.272 g methyl 4-(4-fluoro-2-(trans-4-(N- methylmethylsulfonamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylate (cpd.4.1 ).
Yield: 0.1 18 g
4.3 4-(4-Fluoro-2-(trans-4-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxamide
Figure imgf000131_0002
Prepared analogously to 1 .4 from 0.137 g 4-(4-fluoro-2-(trans-4-(N- methylmethylsulfonamido)cyclohexyloxy)phenylamino)-5-methylthie d]pyrimidine-6-carboxylic acid (cpd.4.2).
Yield: 0.099 g
ESI mass spectrum: m/z = 508 (M+H)+
Rt (HPLC): 1 .37 min (method X)
Example 5 4-(2-(trans-4-acetamidocvclohexyloxy)-4-fluorophenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxamide
Figure imgf000132_0001
5.1 Methyl 4-(2-(trans-4-acetamidocvclohexyloxy) 4-fluorophenylamino)-5- methylthieno[2,3-dlpyrinnidin -6-carboxylate
Figure imgf000132_0002
Prepared analogously to 1 .1 from intermediate VI (0.422 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.243 g).
Yield: 0.301 g
5.2 4-(2-(trans-4-acetamidocvclohexyloxy) 4-fluorophenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxylic acid
Figure imgf000132_0003
Prepared analogously to 1 .3 from 0.301 g methyl 4-(2-(trans-4- acetamidocyclohexyloxy) 4-fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.5.1 ).
Yield: 0.283 g 5.3 4-(2-(trans-4-acetamidocvclohexyloxy)-4-fluorophenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000133_0001
Prepared analogously to 1 .4 from 0.100 g 4-(2-(trans-4-acetamidocyclohexyloxy) 4- fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxylic acid (cpd.5.2). Yield: 0.073 g
ESI mass spectrum: m/z = 458 (M+H)+
Rt (HPLC): 1 .29 min (method X)
Example 6
4-(2-(trans-4-acetamidocvclohexyloxy)-4-fluorophenylamino)-N-(3- (dimethylamino)propyl)- -methylthieno[2,3-dlpyrimidine-6-carboxamide
Figure imgf000133_0002
Prepared analogously to 1 .4 from 0.092 g 4-(2-(trans-4-acetamidocyclohexyloxy) 4- fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxylic acid (cpd.5.2) and 3-(dimethylamino)propylamine (126 μΙ).
Yield: 0.050 g
ESI mass spectrum: m/z = 543 (M+H)+
Rt (HPLC): 1 .24 min (method X)
Example 7
4-(4-fluoro-2-(trans-4-(N-methylacetamidocvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000134_0001
7.1 Methyl 4-(4-fluoro-2-(trans-4-(N- methylacetamido)cvclohexyloxy)phenylamino)-5-methylthieno[^
carboxylate
Figure imgf000134_0002
Prepared analogously to 1 .1 from intermediate VII (0.255 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.184 g).
Yield: 0.225 g
7.2 4-(4-Fluoro-2-(trans-4-(N-methylacetamido)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxylic acid
Figure imgf000134_0003
Prepared analogously to 1 .3 from 0.225 g methyl 4-(4-fluoro-2-(trans-4-(N- methylacetamidocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.7.1 ).
Yield: 0.221 g
7.3 4-(4-fluoro-2-(trans-4-(N-methylacetamidocvclohexyloxy)phenylamino)-
5-methylthieno[2,3-dlpyrimidine-6-carboxamide
Figure imgf000135_0001
Prepared analogously to 1 .4 from 0.1 18 g 4-(4-fluoro-2-(trans-4-(N- methylacetamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyri^ carboxylic acid (cpd.7.2).
Yield: 0.062 g
ESI mass spectrum: m/z = 472 (M+H)+
Rt (HPLC): 1 .34 min (method X)
Example 8
N-(3-(dimethylamino)propyl)-4-(4-fluoro-2-(trans-4-(N- methylacetamido)cvclohexyloxy)phenylamino)- 5-methylthieno[2,3-dlpyrimidine-6- carboxamide
Figure imgf000135_0002
Prepared analogously to 1 .4 from 0.094 g 4-(4-Fluoro-2-(trans-4-(N- methylacetamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylic acid (cpd.7.2) and 3-(dimethylamino)propylamine (126 μΙ).
Yield: 0.060 g
ESI mass spectrum: m/z = 557 (M+H)+
Rt (HPLC): 1 .27 min (method X)
Example 9
4-(4-Fluoro-2-(cis-4-(N-methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000136_0001
9.1 Methyl 4-(4-fluoro-2-(cis-4-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxylate
Figure imgf000136_0002
Prepared analogously to 1 .1 from intermediate VIII (0.229 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.146 g).
Yield: 0.213 g
9.2 4-(4-Fluoro-2-(cis-4-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxylic acid
Figure imgf000136_0003
Prepared analogously to 1 .3 from 0.213 g methyl 4-(4-fluoro-2-(cis-4-(N- methylmethylsulfonamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylate (cpd.9.1 ).
Yield: 0.205 g
9.3 4-(4-Fluoro-2-(cis-4-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000137_0001
Prepared analogously to 1 .4 from 0.193 g 4-(4-fluoro-2-(cis-4-(N- methylmethylsulfonamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylic acid (cpd.9.2).
Yield: 0.096 g
ESI mass spectrum: m/z = 508 (M+H)+
Rt (HPLC): 1 .28 min (method X) Example 10
4-(4-fluoro-2-(cis-4-(N-methylacetamidocvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidin -6-carboxamide
Figure imgf000137_0002
10.1 Methyl 4-(4-fluoro-2-(cis-4-(N-methylacetamidocvclohexyloxy)phenylamino)- 5-methylthieno[2,3-dlpyhmidine-6-carboxylate
Figure imgf000137_0003
Prepared analogously to 1 .1 from intermediate IX (0.217 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.155 g).
Yield: 0.157 g 10.2 4-(4-Fluoro-2-(cis-4-(N-methylacetamidocvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000138_0001
Prepared analogously to 1 .3 from 0.157 g methyl 4-(4-fluoro-2-(cis-4-(N- methylacetamidocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.10.1 ).
Yield: 0.1 18 g
10.3 Methyl 4-(4-fluoro-2-(cis-4-(N-methylacetamidocvclohexyloxy)phenylamino)-
5-methylthieno[2,3-dlpyrimidine-6-carboxylate
Figure imgf000138_0002
Prepared analogously to 1 .4 from 0.1 13 g 4-(4-fluoro-2-(cis-4-(N- methylacetamidocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylic acid (cpd.10.2).
Yield: 0.084 g
ESI mass spectrum: m/z = 472 (M+H)+
Rt (HPLC): 1 .24 min (method X)
Example 1 1
Methyl trans-4-(2-(6-carbamoyl-5-methylthieno[2,3-dlpyhmidin-4-ylamino)-5- fluorophenoxy)cvclohexyl (methyl )carbamate
Figure imgf000139_0001
1 1 .1 Methyl 4-(4-fluoro-2-(trans-4-
(methoxycarbonyl(methyl)amino)cvclohexyloxy)phenylam
dlpyrinnidine-6-carboxylate
Figure imgf000139_0002
Prepared analogously to 1 .1 from intermediate X (0.236 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.166 g).
Yield: 0.31 1 g
1 1 .2 4-(4-Fluoro-2-(trans-4-
(methoxycarbonyl(methyl)amino)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxylic acid
Figure imgf000139_0003
Prepared analogously to 1 .3 from 0.31 1 g methyl 4-(4-fluoro-2-(trans-4- (methoxycarbonyl(methyl)amino)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylate (cpd.1 1 .1 ).
Yield: 0.249 g 1 1 .3 Methyl trans-4-(2-(6-carbamoyl-5-methylthi^^
fluorophenoxy)cvclohexyl (methyl Carbamate
Figure imgf000140_0001
Prepared analogously to 1 .4 from 0.098 g 4-(4-fluoro-2-(trans-4-
(methoxycarbonyl(methyl)amino)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylic acid (cpd.1 1 .2).
Yield: 0.021 g
ESI mass spectrum: m/z = 488 (M+H)+
Rt (HPLC): 1 .42 min (method X)
Example 12
4-(4-Fluoro-2-(trans-4-(methylamino)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000140_0002
12.1 Methyl 4-(2-(trans-4-(tert-butoxycarbonyl(methyl)amino)cvclohexyloxy)-4-
Figure imgf000140_0003
Prepared analogously to 1 .1 from intermediate XI (1 .29 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.728 g). Purification by chromatography. Yield: 0.439 g
12.2 4-(2-(trans-4-(tert-Butoxycarbonyl(nnethyl)annino)cvclohexyloxy)-4- fluorophenylamino)-5-methylthieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000141_0001
Prepared analogously to 1 .3 from 0.747 g methyl 4-(2-(trans-4-(tert- butoxycarbonyl(methyl)amino)cyclohexyloxy)-4-fluorophenylamino)-5- methylthieno[2,3-d]pyrimidine-6-carboxylate (cpd.12.1 ).
Yield: 0.747 g
12.3 tert-Butyl-trans-4-(-2-(6-carbamoyl-5-methylthieno[2,3-dlpyrimidin-4-ylamino)-
Figure imgf000141_0002
Prepared analogously to 1 .4 from 0.747 g 4-(2-(trans-4-(tert- butoxycarbonyl(methyl)amino)cyclohexyloxy)-4-fluorophenylamino)-5- methylthieno[2,3-d]pyrimidine-6-carboxylic acid (cpd.12.2).
Yield: 0.684 g
12.4 4-(4-Fluoro-2-(trans-4-(methylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine- -carboxamide
Figure imgf000141_0003
A mixture of 0.684 g tert-butyl-trans-4-(-2-(6-carbamoyl-5-methylthieno[2,3- d]pyrimidin-4-ylamino)-5-fluorophenoxy)cyclohexyl(methyl)carbamate in 5 ml 4 M HCI/dioxane and 5 ml MeOH was stirred at rt for 1 .5 h. The reaction mixture was concentrated in vacuo. The crude was purified by chromatography to give the desired product.
Yield: 0.387 g
Example 13
Racemic 4-(4-Fluoro-2-(trans-2-(N- methyl methylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2, 3- dlpyrimidine-6-carboxamide
Figure imgf000142_0001
relative stereochemistry
13.1 racemic Methyl 4-(4-fluoro-2-(trans-2-(N- methyl methylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2, 3- dlpyrimidine-6-carboxylate
Figure imgf000142_0002
relative stereochemistry
Prepared analogously to 1 .1 from intermediate XII (0.231 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.147 g).
Yield: 0.279 g 13.2 racemic 4-(4-Fluoro-2-(trans-2-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxylic acid
Figure imgf000143_0001
relative stereochemistry
Prepared analogously to 1 .3 from 0.279 g racemic methyl 4-(4-fluoro-2-(trans-2-(N- methylmethylsulfonamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylate (cpd.13.1 ).
Yield: 0.242 g 13.3 racemic 4-(4-Fluoro-2-(trans-2-(N- methylmethylsulfonamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000143_0002
relative stereochemistry
Prepared analogously to 1 .4 from 0.101 g racemic 4-(4-fluoro-2-(trans-2-(N- methylmethylsulfonamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylic acid (cpd.13.2).
Yield: 0.015 g
ESI mass spectrum: m/z = 508 (M+H)+
Rt (HPLC): 1 .33 min (method X)
Example 14
Racemic 4-(4-fluoro-2-(trans-2-(N-methylacetamido)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000144_0001
14.1 racemic Methyl 4-(4-fluoro-2-(trans-2-(N- methylacetamido)cvclohexyloxy)phenylamino)-5-methylthieno[2,3-dlpyrimidine-6- carboxylate
Figure imgf000144_0002
relative stereochemistry Prepared analogously to 1 .1 from intermediate XIII (0.225 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.162 g).
Yield: 0.180 g
14.2 racemic 4-(4-Fluoro-2-(trans-2-(N-methylacetamido)cvclohexyloxy) phenylamino)-5-methylthieno[2,3-dlpyhmidine-6-carboxylic acid
Figure imgf000144_0003
stereochemistry
Prepared analogously to 1 .3 from 0.180 g racemic methyl 4-(4-fluoro-2-(trans-2-(N- methylacetamidocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.14.1 ).
Yield: 0.170 g 14.3 Methyl 4-(4-fluoro-2-(trans-2-(N-nnethylacetannido)cvclohexyloxy)phenyl amino)-5-nnethylthieno[2,3-dlpynnnidine-6-carboxylate
Figure imgf000145_0001
relative stereochemistry
Prepared analogously to 1 .4 from 0.095 g 4-(4-fluoro-2-(trans-2-(N- methylacetamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylic acid (cpd.14.2). Purification by chromatography.
Yield: 0.040 g
ESI mass spectrum: m/z = 472 (M+H)+
Rt (HPLC): 1 .34 min (method X)
Example 15
4-(2-(trans-4-aminocvclohexyloxy)4-fluorophenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000145_0002
15.1 Methyl 4-(4-fluoro-2-(trans-4-(2,2,2-trifluoroacetamido)cvclohexyloxy)phenyl amino)-5-methylthieno[2,3-dlpyhmidine-6-carboxylate
Figure imgf000145_0003
Prepared analogously to 1 .1 from intermediate XIV (0.050 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.038 g).
Yield: 0.062 g 15.2 4-(2-(trans-4-Aminocvclohexyloxy)-4-fluorophenylamino)-5- methylthieno[2,3-dlpyhmidine- -carboxamide
Figure imgf000146_0001
0.100 g methyl 4-(4-fluoro-2-(trans-4-(2,2,2- trifluoroacetamido)cyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyhmidine-6- carboxylate (cpd.15.1 ) and 2 ml 7 M ammonia in MeOH were stirred in a pressure tube overnight at 70°C and 8 days at 90°C. The reaction mixture was concentrated in vacuo. The residue was purified by chromatography to give the desired compound. Yield: 0.067 g Example 16
4-(4-Fluoro-2-(trans-4-(1 -methylpiperidin-4-ylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000146_0002
0.019 g 1 -methyl-4-piperidone in 1 .5 ml MeOH followed by 1 drop acetic acid were added to a mixture of 0.070 g 4-(2-(trans-4-aminocyclohexyloxy)-4- fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxamide (cpd.15.2) in 2 ml methanol . Sodium cyanoborohydride was added when the mixture was stirred at rt for 40 min. After stirring at 50°C for 3 h further 0.010 g 1 -methyl-4-piperidone and 0.010 g sodium cyanoborohydride were added and heating was continued overnight. The reaction mixture was concentrated in vacuo. The residue was purified by chromatography followed by recrystallisation from MeOH.
Yield: 0.056 g
ESI mass spectrum: m/z = 513 (M+H)+
Rt (HPLC): 1 .16 min (method X)
Example 17
4-(4-Fluoro-2-(cis-3-(N-methylamino)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000147_0001
17.1 Methyl 4-(2-(3-(tert-butoxycarbonyl(methyl)amino)cvclohexyloxy-4- fluorophenylamino)-5-methylthieno[2,3-dlpyrimidine-6-carboxylate
Figure imgf000147_0002
Prepared analogously to 1 .1 from intermediate XV (0.170 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (0.130 g). Purification by chromatography (gradient: CH2CI2-> 2%MeOH/ CH2CI2 using the Biotage SP4) Yield: 0.190 g
17.2 4-(2-(3-(tert-Butoxycarbonyl(methyl)amino)cvclohexyloxy-4- fluorophenylamino)-5-methylthieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000148_0001
Prepared analogously to 1 .3 from 0.190 g methyl 4-(2-(3-(tert- butoxycarbonyl(methyl)amino)cyclohexyloxy-4-fluorophenylamino)-5- methylthieno[2,3-d]pyrimidine-6-carboxylate (cpd.17.1 ). The crude was triturated in hot MeCN.
Yield: 0.120 g
17.3 tert-Butyl 3-(2-(6-carbamoyl-5-methylthieno[2,3-dlpyrimidin-4-ylamino)-5- fluorophenoxy)cvclohexyl (methyl )carbamate
Figure imgf000148_0002
Prepared analogously to 1 .4 from 0.1 10 g 4-(2-(3-(tert- butoxycarbonyl(methyl)amino)cyclohexyloxy-4-fluorophenylamino)-5- methylthieno[2,3-d]pyrimidine-6-carboxylic acid (cpd.17.2). Purification by chromatography (gradient: CH2CI2-> 20%MeOH/ CH2CI2 using the Biotage SP4) Yield: 0.090 g
17.4 4-(4-Fluoro-2-(cis-3-(N-methylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyrimidine-6-carboxamide
Figure imgf000148_0003
relative stereochemistry 220 μΙ 4 M HCI in dioxane was added to 0.093 g tert-butyl 3-(2-(6-carbamoyl-5- methylthieno[2,3-d]pyrimidin-4-ylamino)-5- fluorophenoxy)cyclohexyl (methyl )carbamate (cpd. 17.3) in 4 ml dioxane. The reaction mixture was stirred for 1 h at rt when further aliquots of 4 M HCI in dioxane were added, methanol was added and the mixture stirred for 2 days at rt. The mixture was purified by chromatography (gradient: CH2CI2-> 20%MeOH/ CH2CI2 using the Biotage SP4).
ESI mass spectrum: m/z = 430 (M+H)+
Rt (HPLC): 1 .20 min (method X)
Example 18
4-(4-Fluoro-2-(trans-3-(N-methylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Chiral
Figure imgf000149_0001
relative stereochemistry
Prepared analogously to 17.4 from 0.093 g tert-butyl 3-(2-(6-carbamoyl-5- methylthieno[2,3-d]pyrimidin-4-ylamino)-5- fluorophenoxy)cyclohexyl (methyl )carbamate (cpd.17.3).
ESI mass spectrum: m/z = 430 (M+H)+
Rt (HPLC): 1 .20 min (method X)
Example 19
4-(2-(1 ,4-Dioxaspiro[4.51decan-8-yloxy)-4-fluorophenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000150_0001
19.1 Methyl 4-(2-(1 ,4-dioxaspiro[4.51decan-8-yloxy)-4-fluorophenylannino)-5- methylthieno[2,3-dlpyrinnidine-6-carboxylate
Figure imgf000150_0002
Prepared analogously to 1 .1 from intermediate III (2.300 g) and 4-chloro-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (2.080 g) at 80°C.
Yield: 3.600 g
ESI mass spectrum: m/z = 474 (M+H)+
Rt (HPLC): 1 .65 min (method X)
19.2 4-(2-(1 ,4-Dioxaspiro[4.51decan-8-yloxy)-4-fluorophenylamino)-5- methylthieno[2,3-dlpyrimidin -6-carboxylic acid
Figure imgf000150_0003
1 .065 g lithium hydroxide monohydrate was added to 2.003 g methyl 4-(2-(1 ,4- dioxaspiro[4.5]decan-8-yloxy)-4-fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine- 6-carboxylate (cpd.19.1 ) in 100 ml THF and 60 ml water. After stirring at rt overnight the reaction mixture was quenched by 2 M aq. HCI and concentrated in vacuo. The resulting aq. layer was filtered. The filtercake was dried and triturated with MeOH:Et2O 20:1 to give the desired compound.
Yield: 1 .280 g 19.3 4-(2-(1 ,4-Dioxaspiro[4.51decan-8-yloxy)-4-fluorophenylamino)-5- methylthieno[2,3-dlpyhmidi -6-carboxamide
Figure imgf000151_0001
Prepared analogously to 1 .4 from 1 .287 g 4-(2-(1 ,4-dioxaspiro[4.5]decan-8-yloxy)-4- fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxylic acid (cpd.19.2). Purification by chromatography.
Yield: 1 .210 g
Example 20
Methyl 4-(4-fluoro-2-(4-oxocvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxylate
Figure imgf000151_0002
1 .000 g p-toluenesulfonic acid was added to 0.500 g methyl 4-(2-(1 ,4- dioxaspiro[4.5]decan-8-yloxy)-4-fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine- 6-carboxylate (cpd.19.1 ) in 10 ml THF and 5 ml water. After refluxing overnight the reaction mixture was adjusted to pH 8 using aq. Na2CO3. The aq. layer was extracted with chloroform. The combined extracts were passed through a hydrophobic frit and concentrated to give the desired compound.
Yield: 0.413 g ESI mass spectrum: m/z = 430 (M+H)+
Rt (HPLC): 1 .50 min (method X)
Example 21
4-(4-Fluoro-2-(4-oxocvclohexyloxy)phenylamino)-5-methyltN
carboxamide
Figure imgf000152_0001
Prepared analogously to Example 20 from 1 .21 1 g 4-(2-(1 ,4-dioxaspiro[4.5]decan-8- yloxy)-4-fluorophenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxamide
(cpd.19.3). The crude was triturated with MeOH.
Yield: 0.888 g
ESI mass spectrum: m/z = 415 (M+H)+
Rt (HPLC): 1 .27 min (method X)
Example 22
4- (4-Fluoro-2-(trans-4-((2-methoxyethyl)(methyl)amino)cvclohexyloxy)phenylamino)-
Figure imgf000152_0002
22.1 Methyl 4-(4-fluoro-2-(4-((2- methoxyethyl)(methyl)amino)cvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxylate
Figure imgf000153_0001
To a stirred mixture of 0.100 g methyl 4-(4-fluoro-2-(4-oxocyclohexyl- oxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxylate (cpd.20) in 3 ml methylene chloride was added 0.045 g 2-(methoxyethyl)methylamine. After 15 min at rt 0.045 g sodium triacetoxyborohydride was added and stirring was continued overnight. The reaction was quenched by the addition of water. The mixture was passed through a hydrophobic frit and the organic layer was concentrated. The crude was crystallized in 7 M ammonia in MeOH to give the desired compound.
Yield: 0.062 g
22.2 4-(4-Fluoro-2-(trans-4-((2-methoxyethyl)(methyl)amino)cvclo- hexyloxy)phenylamino)-5-methylthieno[2,3-dlpyrimidine-6-carboxamide
Figure imgf000153_0002
Prepared analogously to 15.2 from 0.060 g methyl 4-(4-fluoro-2-(4-((2- methoxyethyl)(methyl)amino)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylate (cpd.22.1 ) at 100°C for 14 h. The title compound was obtained by HPLC separation.
Yield: 0.01 1 g
ESI mass spectrum: m/z = 488 (M+H)+
Rt (HPLC): 1 .22 min (method X) Example 23
4-(4-Fluoro-2-(cis-4-((2-methoxyeth^
methylthieno[2,3-dlpyrimidine-6-carboxamide
Figure imgf000154_0001
Prepared analogously to 15.2 from 0.060 g methyl 4-(4-fluoro-2-(4-((2- methoxyethyl)(methyl)amino)cyclohexyloxy)phenylamino)-5-methylthieno[2,3- d]pyrimidine-6-carboxylate (cpd.22.1 ) at 100°C for 14 h. The title compound was obtained by HPLC separation.
Yield: 0.007 g
ESI mass spectrum: m/z = 488 (M+H)+
Rt (HPLC): 1 .16 min (method X)
Example 24
4-(4-Fluoro-2-(trans-4-(2-methoxyethylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-amide
Figure imgf000154_0002
24.1 Methyl 4-(4-fluoro-2-(4-(2-methoxyethylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxylate
Figure imgf000155_0001
Prepared analogously to 22.1 from 0.249 g methyl 4-(4-fluoro-2-(4- oxocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxylate (cpd.20). Crystallisation was replaced by purification by chromatography.
Yield: 0.280 g
24.2 4-(4-Fluoro-2-(trans-4-(2-methoxyethylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000155_0002
Prepared analogously to 15.2 from 0.280 g methyl 4-(4-fluoro-2-(4-(2- methoxyethylamino)cyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.24.1 ). The title compound was obtained by HPLC separation.
Yield: 0.055 g
ESI mass spectrum: m/z = 474 (M+H)+
Rt (HPLC): 1 .21 min (method X)
Example 25
4-(4-Fluoro-2-(cis-4-(2-methoxyethylamino)cvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000155_0003
Prepared analogously to 15.2 from 0.280 g methyl 4-(4-fluoro-2-(4-(2- methoxyethylamino)cyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.24.1 ). The title compound was obtained by HPLC separation. Yield: 0.104 g
ESI mass spectrum: m/z = 474 (M+H)+
Rt (HPLC): 1 .18 min (method X)
Example 26
4-(4-Fluoro-2-(trans-4-morpholinocvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Figure imgf000156_0001
26.1 Methyl 4-(4-fluoro-2-(4-morpholinocvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxylate
Figure imgf000156_0002
Prepared analogously to 22.1 from 0.249 g methyl 4-(4-fluoro-2-(4- oxocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxylate (cpd.20.). Crystallisation was replaced by purification by chromatography.
Yield: 0.275 g
26.2 4-(4-Fluoro-2-(trans-4-morpholinocvclohexyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000157_0001
Prepared analogously to 15.2 from 0.280 g methyl 4-(4-fluoro-2-(4- morpholinocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.26.1 ). The title compound was obtained by HPLC separation. Yield: 0.025 g
ESI mass spectrum: m/z = 486 (M+H)+
Rt (HPLC): 1 .20 min (method X)
Example 27
4-(4-Fluoro-2-(cis-4-morpholinocvclohexyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxami
Figure imgf000157_0002
Prepared analogously to 15.2 from 0.280 g methyl 4-(4-fluoro-2-(4- morpholinocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6- carboxylate (cpd.26.1 ). The title compound was obtained by HPLC separation. Yield: 0.023 g
ESI mass spectrum: m/z = 486 (M+H)+
Rt (HPLC): 1 .15 min (method X)
Example 28
Figure imgf000158_0001
28.1
Figure imgf000158_0002
A reaction mixture of 0.503 g 4-chloro-5-methyl-thieno[2,3-c/]pyhmidine-6-carboxylic acid methyl ester, 0.500 g intermdiate XXVIII and 0.070 g p-toluenesulfonic acid in 8 ml dioxane were heated under microwave radiation at 140°C for 15 minutes. The mixture was cooled, filtered and purified by chromatography. The crude was triturated with diethyl ether.
Yield: 0.320 g
ESI mass spectrum: m/z = 448 (M+H)+
Rt (HPLC): 1 .74 min (method K) 28.2
Figure imgf000158_0003
A mixture of 3.4 ml sodium hydroxide solution (1 M) and 0.300 g cpd. 28.1 in 10 ml MeOH was stirred at 100°C for 2 hours and at reflux for 40 minutes. Then the mixture was neutralized with aq. HCI, concentrated and filtered. The filtercake was washed with EtOH and diethyl ether and dried.
Yield: 0.230 g
ESI mass spectrum: m/z = 434 (M+H)+
Rt (HPLC): 1 .47 min (method K
28.3
Figure imgf000159_0001
A mixture of 0.060 g cpd. 28.2, 0.018 ml A/,/V-dimethyl-propane-1 ,3-diamine, 0.045 g TBTU and 0.049 ml DIPEA in 7.5 ml THF/DMF 2/1 was stirred at rt over the weekend. The mixture was concentrated and the crude was purified by
chromatography.
Yield: 0.100 g
ESI mass spectrum: m/z = 518 (M+H)+
Rt (HPLC): 1 .3 7 min (method K)
Example 29
Figure imgf000159_0002
29.1
Figure imgf000160_0001
Synthesized analogously to 28.1 from 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6- carboxylic acid methyl ester (1 .532 g) and intermdiate XXX (1 .700 g). The mixture was filtered and the filtercake was washed with dioxane, MeOH and diethyl ether. Yield: 2.150 g
ESI mass spectrum: m/z = 476 (M+H)+
Rt (HPLC): 2.08 min (method K)
Rf (TLC): 0.79 (silica gel, methylene chloride/methanol 9/1 ) 29.2
Figure imgf000160_0002
Prepared analogously to 28.2 from 1 .500 g cpd. 28.1 .
Yield: 1 .200 g
ESI mass spectrum: m/z = 462 (M+H)+
Rt (HPLC): .77 min (method K)
29.3
Figure imgf000160_0003
A mixture of 0.150 g cpd. 29.2, 0.700 ml 0.5 M ammonia in THF, 0.1 12 g TBTU and 0.122 ml DIPEA in 10 ml THF was stirred at rt over the weekend. The mixture was concentrated. The crude was diluted with DCM, washed with water, dried over Na2SO4 and concentrated. The residue was triturated with diethyl ether.
Yield: 0.085 g
ESI mass spectrum: m/z = 461 (M+H)+
Rt (HPLC): 1 .59 min (method K)
stereochemistry
Figure imgf000161_0001
stereochemistry
Prepared analogously to 29.1 from 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6- carboxylic acid methyl ester (0.362 g) and intermdiate XXIX (0.360 g).
Yield: 0.290 g
ESI mass spectrum: m/z = 448 (M+H)+
Rt (HPLC): 1 .65 min (method K) 30.2
Figure imgf000162_0001
Prepared analogously to 28.2 from 0.280 g cpd. 30.1 .
Yield: 0.230 g
ESI mass spectrum: m/z = 434 (M+H)+
Rt (HPLC): 1 .48 min (method K)
Example 31
4-[2-(4^-Dimethyl-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000162_0002
31 .1 4-[2-(4,4-Dimethyl-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3-
Figure imgf000162_0003
Prepared analogously to 29.1 from 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6- carboxylic acid methyl ester (1 .500 g) and intermdiate XXXI (1 .467 g).
Yield: 2.000 g
ESI mass spectrum: m/z = 444 (M+H)+
Rt (HPLC): 2.15 min (method K) 31 .2 4-[2-(4^-Dimethyl-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thi c lpyrimidine-6-carboxylic aci
Figure imgf000163_0001
Prepared analogously to 28.2 from 1 .000 g 4-[2-(4,4-dimethyl-cyclohexyloxy)-4- fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (cpd. 31 .1 ).
Yield: 0.850 g
ESI mass spectrum: m/z = 430 (M+H)+
Rt (HPLC): 2.27 min (method K)
31 .3 4-[2-(4,4-Dimethyl-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000163_0002
Prepared analogously to 29.3 from 0.150 g 4-[2-(4,4-dimethyl-cyclohexyloxy)-4- fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 31 .2). Yield: 0.065 g
ESI mass spectrum: m/z = 429 (M+H)+
Rt (HPLC): 2.09 min (method K)
Example 32
4-[2-(4,4-Dimethyl-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid (3-dimethylamino-propyl)-amide
Figure imgf000164_0001
Prepared analogously to 29.3 from 0.150 g 4-[2-(4,4-dimethyl-cyclohexyloxy)-4- fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 31 .2) and 0.044 ml A/,/V-dimethyl-propane-1 ,3-diamine.
Yield: 0.128 g
ESI mass spectrum: m/z = 514 (M+H)+
Rt (HPLC): 1 .46 min (method K)
Example 33
4-[2-(4,4-Difluoro-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000164_0002
33.1 4-[2-(4,4-Difluoro-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3-
Figure imgf000164_0003
A mixture of 0.087 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester, 0.088 g intermdiate XXXII and 0.006 g p-toluenesulfonic acid in 2 ml dioxane was heated at 120°C for 1 .5 h. The reaction mixture was cooled, filtered and the filtercake was washed with dioxane and dried.
Yield: 0.1 15 g 33.2 4-[2-(4,4-Difluoro-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000165_0001
0.620 ml sodium hydroxide solution (2M) was added to 0.1 10 g 4-[2-(4,4-difluoro- cyclohexyloxy)-4-fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (cpd. 33.1 ) in 4 ml THF/MeOH (1/1 ). An additional aliquot of sodium hydroxide solution was added when the reaction mixture was stirred at rt overnight. After further 6 hours at rt the mixture was concentrated, the resulting aq. layer was adjusted to pH 4-5 with aq. 2 M aq.HCI and stirred under cooling for 30 minutes. Then the mixture was filtered, the filtercake was washed with water and dried.
Yield: 0.100 g
33.3 4-[2-(4,4-Difluoro-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000165_0002
0.029 g EDC was added to a mixture of 0.050 g 4-[2-(4,4-difluoro-cyclohexyloxy)-4- fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 33.2) and 0.020 g 1 -hydroxy-pyrrolidine-2,5-dione in 1 ml DMF and stirred at rt over the weekend. After the addition of 0.327 ml ammonia (7M) the reaction mixture was stirred at rt for further 1 .5 hours. The mixture was concentrated and the residue was recrystallized from hot MeOH.
Yield: 0.041 g
ESI mass spectrum: m/z = 437 (M+H)+
Rt (HPLC): 1 .38 min (method X)
Example 34
4-[2-(4,4-Difluoro-cvclohexyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid (3-dimethylamino-propyl)-amide
Figure imgf000166_0001
Prepared analogously to 33.3 from 0.050 g 4-[2-(4,4-difluoro-cyclohexyloxy)-4-fluoro- phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 33.2) and 0.126 ml A/,/V-dimethyl-propane-1 ,3-diamine.
Yield: 0.023 g
ESI mass spectrum: m/z = 522 (M+H)+
Rt (HPLC): 1 .29 min (method X)
Example 35
4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000166_0002
35.1 4-[2-(trans-3-Acetylamino-cyclobutoxy)-4-fluoro-phenylamino]-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester
Figure imgf000167_0001
A mixture of 1 .700 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester, 2.000 g intermdiate XXXV and 0.255 g p-toluenesulfonic acid in 20 ml dioxane was heated under microwave radiation at 1 10°C for 1 h. The reaction mixture was filtered and the filtercake was washed with dioxane and stirred with MeOH . Then water was added and the mixure was filtered.
Yield: 1 .700 g
ESI mass spectrum: m/z = 445 (M+H)+
35.2 4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000167_0002
A mixture of 1 .800 g 4-[2-(trans-3-acetylamino-cyclobutoxy)-4-fluoro-phenylamino]-5- methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (cpd.35.1 ) in 17 ml sodium hydroxide solution (1 M) and 30 ml MeOH was stirred at rt overnight. The reaction mixture was neutralized with aq. HCI (1 M) and concentrated. The residue was filtered and the filtercake was washed with diethyl ether.
Yield: 1 .680 g
ESI mass spectrum: m/z = 431 (M+H)+ 35.3 4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid amide
Figure imgf000168_0001
0.050 ml DIPEA was added to a mixture of 0.100 g 4-[2-(trans-0.86 3-acetylamino- cyclobutoxy)-4-fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 35.2) and 0.095 g HATU in 1 .5 ml DMF and stirred at rt for 15 minutes. 2.323 ml ammonia in THF (0.5M) was added and the stirring was continued for further 6 hours. Then the reaction mixture was concentrated and the residue was purified by chromatography.
Yield: 0.015 g
ESI mass spectrum: m/z = 430 (M+H)+0 89
Rt (HPLC): 0.86 (method A) The following compounds were repared analogously to 35.3:
Figure imgf000168_0002
Figure imgf000168_0003
H 2.23 min
38 Cpd. 35.2 460 (M+H)+
(Method B)
1 .86 min
39 V ΓΛ Cpd. 35.2 541 (M+H)+
(Method B
1 .85 min
40 Cpd. 35.2 527 (M+H)+
(Method B)
H
I 2.1 1 min
41 Cpd. 35.2 474 (M+H)+
OH (Method B)
Example 42
4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid amide
Figure imgf000169_0001
42.1 4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid methyl ester
Figure imgf000169_0002
Prepared analogously to 1 .1 from 0.846 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine- 6-carboxylic acid methyl ester and 1 .000 g Intermdiate XXXXIV.
Yield: 1 .390 g 42.2 4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid
Figure imgf000170_0001
7 ml sodium hydroxide solution (2M) were added to a mixture of 1 .270 g 4-[4-fluoro- 2-((1 S,2S)-2-methoxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine- 6-carboxylic acid methyl ester (cpd. 42.1 ) in 10 ml MeOH/THF (1 :1 ). The reaction mixture was stirred at reflux for 15 minutes, then cooled and acidified with 2 M aq. HCI . The solvent was removed in vacuo, the residue suspended in water, filtered and dried.
42.3 4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000170_0002
Prepared analogously to 1 .4 from 0.100 g 4-[4-fluoro-2-((1 S,2S)-2-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid.
Yield: 0.074 g
ESI mass spectrum: m/z = 431 (M+H)+
Rt (HPLC): 1 .41 min (method X)
Example 43 4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,^ c lpyrimidine-6-carboxylic acid (3-dimethylamino-propyl)-amide
Figure imgf000171_0001
43.1 4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrinnidine-6-carboxylic acid 2,5-dioxo-pyrrolidin-1 -yl ester
Figure imgf000171_0002
EDC (53 mg, 0.28 mmol) was added to a mixture of 0.100 g 4-[4-fluoro-2-((1 S,2S)-2- methoxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd.42.2) and 0.040 g N-hydroxysuccinimide in 1 ml DMF. And stirred at rt overnight. The reaction mixture was diluted with EtOAc and washed with water and brine. The organic layer was passed through a hydrophobic frit and concentrated. Yield: 0.100 g 43.2 4-[4-Fluoro-2-((1 S,2S)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid (3-dimethylamino-propyl)-amide
Figure imgf000172_0001
0.129 g 3-dimethylaminopropylannine was added to 0.155 g 4-[4-fluoro-2-((1 S,2S)-2- methoxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidin
acid 2,5-dioxo-pyrrolidin-1 -yl ester in 2 ml DMF and stirred at rt for 30 minutes. The reaction mixture was concentrated. The residue was dissolved in EtOAc, washed with water and brine, passed through a hydrophobic frit and concentrated.
Yield: 0.129 g
ESI mass spectrum: m/z = 516 (M+H)+
Rt (HPLC): 1 .31 min (method X)
The following compounds were prepared analogously to 43.2:
Figure imgf000172_0002
Figure imgf000172_0003
1 .31 min
46 Cpd. 43.1 539 (M+H)+
(Method X)
1 .32 min
47 Cpd. 43.1 542 (M+H)+
(Method X)
1 .32 min
48 Cpd. 43.1 542 (M+H)+
(Method X)
1 .38 min
49 2 OH Cpd. 43.1 475 (M+H)+
(Method X)
Example 50
Racemci 4-[4-Fluoro-2-(trans-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000173_0001
racemic
50.1 racemic 4-[4-Fluoro-2-(trans-2-methoxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid methyl ester
Figure imgf000173_0002
racemic
A reaction mixture of 0.073 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester, 0.091 g intermdiate XVII and 0.003 g p-toluenesulfonic acid in 1 ml dioxane was heated at 1 10°C for 10 hours. The reaction mixture was diluted with methylene chloride and 3M ammonia and passed through a hydrophobic frit. The organic layer was concentrated and the residue was recrystallized from MeOH.
Yield: 0.098 g 50.2 racemic 4-[4-Fluoro-2-(trans-2-methoxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000174_0001
racemic
Prepared analogously to 42.2 from 0.089 g racemic 4-[4-fluoro-2-(trans-2-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (cpd. 50.1 ).
Yield: 0.075 g
50.3 racemic 4-[4-Fluoro-2-(trans-2-methoxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000174_0002
racemic
Prepared analogously to 1 .4 from 0.073 g 4-[4-fluoro-2-(trans-2-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 50.2).
Yield: 0.041 g
ESI mass spectrum: m/z = 431 (M+H)+ Rt (HPLC): 1 .41 min (method X)
Example 51
4-[4-Fluoro-2-((1 S,2S)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000175_0001
51 .1 4-[4-Fluoro-2-((1 S,2S)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid methyl ester
Figure imgf000175_0002
A mixture of 1 .832 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester, 1 .700 g intermdiate XXI and 0.130 g p-toluenesulfonic acid in 30 ml dioxane was stirred at 100°C for 2 hours. The reaction mixture was cooled, diluted with water and filtered. The filtercake was washed with water and dried.
Yield: 3.020 g
ESI mass spectrum: m/z = 432 (M+H)+
Rt (HPLC): 2.04 min (Method L)
51 .2 4-[4-Fluoro-2-((1 S,2S)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000176_0001
5 ml sodium hydroxide solution (4M) was added to a mixture of 2.960 g 4-[4-Fluoro- 2-((1 S,2S)-2-hydroxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine- 6-carboxylic acid methyl ester (cpd. 51 .1 ) in 60 ml methanol/THF (1 :1 ). The reaction mixture was stirred at rt for 3 hours, then acidified with aq. HCI and diluted with water. The mixture was filtered and the filtercake was dried.
Yield: 2.780 g
ESI mass spectrum: m/z = 418 (M+H)+
Rt (HPLC): 1 .85 min (Method L)
51 .3 4-[4-Fluoro-2-((1 S,2S)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000176_0002
A mixture of 0.100 g 4-[4-fluoro-2-((1 S,2S)-2-hydroxy-cyclohexyloxy)-phenylamino]- 5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 51 .2), 2.5 ml ammonia in dioxane (0.5M), 0.109 g HATU and 0.046 ml DIPEA in 2 ml DMF was stirred at rt overnight. The reaction mixture was diluted with water, stirred and filtered. The filtercake was dried.
Yield: 0.086 g
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 1 .61 min (Method L) Example 52
4-[4-Fluoro-2-((1 R,2R)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrinnidine-6-carboxylic acid amide
Figure imgf000177_0001
52.1 4-[4-Fluoro-2-((1 R,2R)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid methyl ester
Figure imgf000177_0002
Prepared analogously to 51 .I from 1 .723 g 4-chloro-5-methyl-thieno[2,3-c/]pyrimidine- 6-carboxylic acid methyl ester and 1 .600 g intermdiate XX.
Yield: 2.780 g
ESI mass spectrum: m/z = 432 (M+H)+
Rt (HPLC): 2.02 min (Method L) 52.2 4-[4-Fluoro-2-((1 R,2R)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000177_0003
Prepared analogously to 51 .2 from 2.750 g 4-[4-fluoro-2-((1 R,2R)-2-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thi^ acid methyl ester (cpd. 52.1 ).
Yield: 2.630 g
ESI mass spectrum: m/z = 418 (M+H)+
Rt (HPLC): 1 .74 min (Method L)
52.3 4-[4-Fluoro-2-((1 R,2R)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid amide
Figure imgf000178_0001
Prepared analogously to 51 .3 from 0.120 g 4-[4-fluoro-2-((1 R,2R)-2-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 52.2).
Yield: 0.095 g
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 1 .74 min (method L)
Example 53
4-[4-Fluoro-2-((1 R,2R)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid (3-dimethylamino-propyl)-amide
Figure imgf000178_0002
A mixture of 0.096 g 4-[4-fluoro-2-((1 R,2R)-2-hydroxy-cyclohexyloxy)-phenylamino]- 5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd. 52.2), 0.081 g TBTU and 0.088 ml DIPEA in 15 ml THF was stirred at rt for 30 minutes. Then 0.028 ml dimethylaminopropylamine was added and stirrind was continued overnight. The reaction mixture was concentrated and purified by chromatography.
Yield: 0.072 g
ESI mass spectrum: m/z = 502 (M+H)+
Rt (HPLC): 2.18 min (Method L)
Rf (TLC): 0.33 (silica gel, methylene chloride/methanol/NH3 90/10/1 )
Example 54
4-[4-Fluoro-2-((1 R,2R)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid (2-methoxy-ethyl)-amide
Figure imgf000179_0001
Prepared analogously to 53 from 0.091 g 4-[4-fluoro-2-((1 R,2R)-2-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (cpd.
52.2) and 0.020 ml methoxyethylamine.
Yield: 0.069 g
ESI mass spectrum: m/z = 475 (M+H)+
Rt (HPLC): 2.85 min (Method L)
Rf (TLC): 0.43 (silica gel, methylene chloride/methanol/NH3 90/10/1 )
Example 55
Racemic 4-[4-Fluoro-2-(cis-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000180_0001
stereochemistry
55.1 racemic 4-[4-Fluoro-2-(cis-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid methyl ester
Figure imgf000180_0002
relative stereochemistry Prepared analogously to 50.1 from 0.136 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.147 g intermdiate XVI.
Yield: 0.163 g
55.2 racemic 4-[4-Fluoro-2-(cis-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000180_0003
relative stereochemistry Prepared analogously to 42.2 from 0.163 g racemic 4-[4-fluoro-2-(cis-2-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (cpd. 55.1 ).
Yield: 0.149 g 55.3 racemic 4-[4-Fluoro-2-(cis-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyrimidine-6-carboxylic acid amide
Figure imgf000181_0001
relative stereochemistry Prepared analogously to 1 .4 from 0.141 g racemic 4-[4-Fluoro-2-(cis-2-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid 55.2).
Yield: 0.094 g
ESI mass spectrum: m/z = 431 (M+H)+
Rt (HPLC): 1 .40 min (method X)
Example 56
Racemic 4-[4-Fluoro-2-((cis)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidi -6-carboxylic acid amide
Figure imgf000181_0002
relative stereochemistry
56.1 Racemic 4-[4-Fluoro-2-((cis)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-
Figure imgf000181_0003
istry
Prepared analogously to example 1 .1 from 0.277 g 4-Chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.267 g intermediate XXXXXIV. Yield: 0.173 g 56.2 Racemic 4-[4-Fluoro-2-((cis)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyrimidine-6-carboxylic acid
Figure imgf000182_0001
stereochemistry
Prepared analogously to example 1 .3 from 0.173 g racemic 4-[4-Fluoro-2-((cis)-2- hydroxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methylester.
Yield: 0.123 g 56.3 Racemic 4-[4-Fluoro-2-((cis)-2-hvdroxy-cvclohexyloxy)-phenylamino1-5-
Figure imgf000182_0002
chemistry
Prepared analogously to example 1 .4 from 0.083 g racemic 4-[4-Fluoro-2-((cis)-2- hydroxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxyl acid and ammonia.
Yield: 0.046 g
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 1 .3 (method X) Example 57
Racemic 4-[4-Fluoro-2-((cis)-3-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000183_0001
relative stereochemistry
57.1 4-[4-Fluoro-2-(3-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3-
Figure imgf000183_0002
Prepared analogously to example 1 .1 from 0.485 g 4-Chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.491 g intermediate XXXXXVI. Yield: 0.140 g 57.2 4-[4-Fluoro-2-(3-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000183_0003
Prepared analogously to example 1 .3 from 0.48 g 4-[4-Fluoro-2-(3-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester.
Yield: 0.448 g
57.3 Racemic 4-[4-Fluoro-2-((cis)-3-hvdroxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000184_0001
relative stereochemistry
Prepared analogously to example 1 .4 from 0.445 g 4-[4-Fluoro-2-(3-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid ammonia. Separation in racemic cis and trans-isomer was performed by HPLC. Yield: 0.095 g (title compound, cis. isomer)
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 1 .3 (method X)
Example 58
Racemic 4-[4-Fluoro-2-((trans)-3-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Figure imgf000184_0002
e stereochemistry
58.1 racemic Racemic 4-[4-Fluoro-2-((trans)-3-hvdroxy-cvclohexyloxy)- phenylamino1-5-methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid methylester
Figure imgf000184_0003
relative stereochemistry
Prepared analogously to example 1 .1 from 4.956 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 4.6 g intermediate II in isopropanol Yield: 6.1 g
ESI mass spectrum: m/z = 432 (M+H)+ 58.2 racemic Racemic 4-[4-Fluoro-2-((trans)-3-hvdroxy-cvclohexyloxy)- phenylamino1-5-meth -thieno[2,3-c lpyrimidine-6-carboxylic acid
Figure imgf000185_0001
relative stereochemistry
2.665 g lithium hydroxide were added to a mixture of 6.5 g racemic racemic 4-[4- fluoro-2-((trans)-3-hydroxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methylester in 350 ml water and 70 ml water. The mixture was stirred overnight. Then the mixture was acidified by addition of citric acid (10% in water) and concentrated. Water was added and the mixture was filtered. The solid was washed with water and dried.
Yield: 6.15 g
ESI mass spectrum: m/z = 418 (M+H)+
58.3 Racemic 4-[4-Fluoro-2-((trans)-3-hvdroxy-cvclohexyloxy)-phenylamino1-5-
Figure imgf000185_0002
Prepared analogously to example 1 .4 from 5.6 g racemic racemic 4-[4-Fluoro-2- ((trans)-3-hydroxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6- carboxylic acid and 100 ml ammonia (0.5 M in THF).
Yield: 3.85 g
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 2.55 (method A)
The following compounds were prepared analogously to 1 .4.:
Figure imgf000186_0001
relative stereochemistry
Figure imgf000186_0002
Figure imgf000187_0001
(Method F)
Example 79
Racemic 4-[4-Fluoro-2-((trans)-3-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000187_0002
ive stereochemistry 79.1 racemic 4-[4-Fluoro-2-((trans)-3-methoxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-c lpyrimidine-6-carboxylic acid ethylester
Figure imgf000188_0001
relative stereochemistry
Prepared analogously to example 1 .1 from 0.76 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid ethyl ester and 0.7 g intermediate XXXXI in dioxan. Yield: 1 .04 g
ESI mass spectrum: m/z = 460 (M+H)+
Rt (HPLC): 5.41 (method C)
79.2 racemic 4-[4-Fluoro-2-((trans)-3-methoxy-cvclohexyloxy)-phenylamino1-5-
Figure imgf000188_0002
stereochemistry
Prepared analogously to 1 .3 from 1 .02 g racemic 4-[4-fluoro-2-((trans)-3-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid ethylester.
Yield: 0.36 g
ESI mass spectrum: m/z = 432 (M+H)+
Rt (HPLC): 4.13 (method C)
79.3 Racemic 4-[4-Fluoro-2-((trans)-3-methoxy-cvclohexyloxy)-phenylamino1-5-
Figure imgf000188_0003
ochemistry Prepared analogously to example 1 .4 from 0.15 g racemic racemic 4-[4-Fluoro-2- ((trans)-3-methoxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c ]pyrimidine-6- carboxylic acid and ammonia (7 M in methanol).
Yield: 0.05 g
ESI mass spectrum: m/z = 431 (M+H)+
Rt (HPLC): 3.65 (method C)
The following compounds were prepared analogously to 1 .4.:
Figure imgf000189_0001
Figure imgf000189_0002
1 .56 min
87 ' ΓΛ Cpd. 79.2
542 (M+H)+
(Method E)
H 1 Cpd. 79.2 1 .54 min
88 516 (M+H)+
(Method E)
Example 89
Racemic 4-[4-Fluoro-2-((cis)-3-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000190_0001
ive stereochemistry
89.1 racemic 4-[4-Fluoro-2-((cis)-3-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid ethylester
Figure imgf000190_0002
relative stereochemistry
Prepared analogously to example 1 .1 from 0.52 g 4-chloro-5-ethyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.43 g intermediate XXXX in dioxan.
Yield: 0.82 g
ESI mass spectrum: m/z = 460 (M+H)+
Rt (HPLC): 5.34 (method C)
89.2 racemic 4-[4-Fluoro-2-((cis)-3-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidi -6-carboxylic acid
Figure imgf000190_0003
relative stereochemistry Prepared analogously to 1 .3 from 0.8g racemic 4-[4-fluoro-2-((cis)-3-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methylester.
Yield: 0.7 g
89.3 Racemic 4-[4-Fluoro-2-((cis)-3-methoxy-cvclohexyloxy)-phenylamino1-5-
Figure imgf000191_0001
ochemistry
Prepared analogously to example 1 .4 from 0.3 g racemic 4-[4-Fluoro-2-((cis)-3- methoxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and ammonia (0.5 M in dioxan).
Yield: 0.25 g
ESI mass spectrum: m/z = 431 (M+H)+
Rt (HPLC): 2.13 (method I)
The following compounds were prepared analogously to 1 .4.:
Figure imgf000191_0002
Figure imgf000191_0003
Figure imgf000192_0001
(Method E) H Cpd. 89.2 1 .94min
105 489 (M+H)+
(Method E)
106 ' ΓΛ Cpd. 89.2 1 .57 min
542 (M+H)+
(Method E)
/ Cpd. 89.2
H r-N 1 .56min
107 ' f /> 525 (M+H)+
(Method E)
H I Cpd. 89.2 1 .31 min
108 516 (M+H)+
(Method X)
H Cpd. 89.2 2.0min
109 459 (M+H)+
(Method E)
Example 1 10
Racemic 4-[2-((cis)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3-
Figure imgf000193_0001
relative stereochemistry
1 10.1 Racemic 4-[2-((cis)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl- thieno[2,3-c lpyhmidin -6-carboxylic acid methylester
Figure imgf000193_0002
relative stereochemistry
Prepared analogously to example 1 .1 from 2.22 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 1 .669 g intermediate XXXXII in dioxan.
Yield: 1 .82 g
ESI mass spectrum: m/z = 429 (M+H)+
Rt (HPLC): 5.08 (method C) 1 10.2 Racemic 4-[2-((cis)-3-methoxy-cvclohexyloxy)-pyndin-3-ylamino1-5-methyl- thieno[2,3-c lpyrimidin -6-carboxylic acid
Figure imgf000194_0001
relative stereochemistry
Prepared analogously to 1 .3 from 1 .82 g racemic 4-[2-((cis)-3-methoxy- cyclohexyloxy)-pyridin-3-ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methylester.
Yield: 1 .75 g
ESI mass spectrum: m/z = 415 (M+H)+
Rt (HPLC): 4.06 (method C
1 10.3 Racemic 4-[2-((cis)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide,
Figure imgf000194_0002
relative stereochemistry Prepared analogously to example 1 .4 from 0.1 g racemic 4-[2-((cis)-3-methoxy- cyclohexyloxy)-pyridin-3-ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and ammonia (7 M in methanol) using TBTU instead of HATU in DMF as solvent. Yield: 0.078 g
ESI mass spectrum: m/z = 414 (M+H)+
Rt (HPLC): 1 .32 (method J)
The following compounds were prepared analogously to 1 .4.:
Figure imgf000195_0001
relative stereochemistry
Figure imgf000195_0002
Figure imgf000196_0001
(Method E)
Example 131
Racemic 4-[2-((trans)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-
Figure imgf000196_0002
stereochemistry 131 .1 Racemic 4-[2-((trans)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl- thieno[2,3-c lpyrimidin -6-carboxylic acid methylester
Figure imgf000197_0001
relative stereochemstry
Prepared analogously to example 1 .1 from 1 .48 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid ethyl ester and 1 .1 g intermediate XXXXIII in dioxan. Yield: 1 .14 g
ESI mass spectrum: m/z = 443 (M+H)+
Rt (HPLC): 1 .76 (method H) 131 .2 Racemic 4-[2-((trans)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl- thieno[2,3-c lpyhmidin -6-carboxylic acid
Figure imgf000197_0002
relative stereochemstry
Prepared analogously to 1 .3 from 1 .1 g racemic 4-[2-((trans)-3-Methoxy- cyclohexyloxy)-pyridin-3-ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid ethylester.
Yield: 0.92 g
ESI mass spectrum: m/z = 415 (M+H)+
Rt (HPLC): 4.15 (method C) 131 .3 Racemic 4-[2-((trans)-3-Methoxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl- thieno[2,3-c lpyhmidi -6-carboxylic acid amide
Figure imgf000197_0003
relative stereochemstry Prepared analogously to example 1 .4 from 0.1 1 g racemic 4-[2-((trans)-3-Methoxy- cyclohexyloxy)-pyridin-3-ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and ammonia (7 M in methanol) using TBTU instead of HATU in DMF as solvent. Yield: 0.068 g
ESI mass spectrum: m/z = 414 (M+H)+
Rt (HPLC): 3.4 (method C)
The following compounds were prepared analogously to 1 .4.:
Figure imgf000198_0001
relative stereochemstry
Figure imgf000198_0002
Figure imgf000199_0001
(Method E)
Example 150
4-[4-Fluoro-2-((cis-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid amide
Figure imgf000200_0001
0.064 g sodium borohydride were added to a mixture of 0.7 g 4-(4-fluoro-2-(4- oxocyclohexyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxamide (example 21 ) in 20 ml methanol at 0 °C. The mixture was allowed to warm up overnight. The reaction mixture was filtered. The solid was recrystallized from hot methanol . The mixture of cis and trans isomer was separated by HPLC.
Cis-lsomer:
Yield: 0.412 g
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 1 .28 (method X)
Example 151
4-[4-Fluoro-2-(cis-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic a -dimethylamino-propyl)-amide
Figure imgf000200_0002
151 .1 4-[4-Fluoro-2-(cis-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3-
Figure imgf000200_0003
Prepared analogously to example 1 .1 from 0.218 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.225 g intermediate XXVI in dioxan Yield: 0.301 g 151 .2 4-[4-Fluoro-2-(cis-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000201_0001
Prepared analogously to 1 .3 from 0.301 g 4-[4-fluoro-2-(cis-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester.
Yield: 0.262 g 151 .3 4-[4-Fluoro-2-(cis-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic a -dimethylamino-propyl)-amide
Figure imgf000201_0002
Prepared analogously to example 1 .4 from 0.1 1 g 4-[4-fluoro-2-(cis-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid in DMF.
Yield: 0.1 13 g
ESI mass spectrum: m/z = 502 (M+H)+
Rt (HPLC): 1 .23 (method X) Example 152
4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid (3-dimethylamino-propyl)-amide
Figure imgf000202_0001
/
152.1 4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000202_0002
Prepared analogously to example 1 .1 from 2.756 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid ethyl ester and 2 g intermediate XXVII in dioxan.
Yield: 2.85 g
ESI mass spectrum: m/z = 446 (M+H)+ 152.2 4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid
Figure imgf000202_0003
Prepared analogously to 1 .3 from 2.8 g 4-[4-fluoro-2-(trans-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid ethyl ester.
Yield: 2.29 g
ESI mass spectrum: m/z = 418 (M+H)+
Rt (HPLC): 1 .65 (method K) 152.3 4-[2-((trans)-4-hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000203_0001
/
0.072 g EDC were added to a mixture of 0.13 g 4-[4-fluoro-2-(trans-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and 0.054 g N-Hydroxysuccinimide in DMF(2ml). The reaction mixture was stirred at rt overnight then diluted with EtOAc and washed with water and brine (2x). The organic phase was passed through a hydrophobic frit and evaporated.
The residue was treated with 2ml DMF and 213 μΙ 3-dimethylaminopropylamine were added. The mixture was stirred at rt for 40 minutes and then diluted with EtOAc and washed with water and brine (2x). The organic phase was dried with MgSO4 and passed through a hydrophobic frit.
Yield: 0.089 g
ESI mass spectrum: m/z = 502 (M+H)+
Rt (HPLC): 1 .23 (method X) Example 153
4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3-
Figure imgf000203_0002
153.1
Figure imgf000204_0001
0.309 g EDC were added to a suspension of 0.573 g 4-[4-fluoro-2-(trans-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and 0.231 g N-Hydroxysuccinimide in 5 ml DMF. The reaction mixture was stirred at rt overnight. Then EtOAc and water were added. The suspenion was filtered, the filtrate was separated and the aqueous phase was discarded. The organic phase was washed with water and brine (2x) and water. The solvent was evaporated and the residue suspended in ether and filtered. The residues were combined, washed with further ether and air-dried under vacuum.
Yield: 0.707 g
153.2 4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000204_0002
175 μΙ 3-pyrrolidin-1 -yl-propylamine were added to a solution of 0.12 g compound 153.1 in 1 ml DMF. The reaction mixture was stirred for 1 h then diluted with
EtOAc/H2O. The mixture was filtered, the solid washed with water and ether. The solid was dissolved in d6-DMSO and evaporated to dryness (Genevac).
Yield: 0.058 g
ESI mass spectrum: m/z = 528 (M+H)+
Rt (HPLC): 1 .24 (method X) The following compounds were prepared analogously to 153.2.
Figure imgf000205_0001
Figure imgf000205_0003
Example 158
4-[4-Fluoro-2-(trans4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000205_0002
Prepared analogously to example 1 .4 from 7 g 4-[4-fluoro-2-(trans-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid in DMF.
Yield: 2.82 g
ESI mass spectrum: m/z = 417 (M+H)+
Rt (HPLC): 1 .62 (method K)
The following compounds were prepared analogously to 1 .4.:
Figure imgf000206_0001
Figure imgf000206_0002
Figure imgf000207_0001
Example 175
4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid amide
Figure imgf000207_0002
175.1 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid ethylester
Figure imgf000208_0001
Prepared analogously to example 1 .1 from 5.842 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid ethyl ester and 4.9 g intermediate XXXXXVII in dioxan.
Yield: 2.85 g
ESI mass spectrum: m/z = 446 (M+H)+
175.2 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000208_0002
Prepared analogously to 58.2 from 9.1 g 4-[4-fluoro-2-(trans-4-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid ethylester.
Yield: 6.8 g
ESI mass spectrum: m/z = 432 (M+H)+
Rt (HPLC): 3.17 (method A)
175.3 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000208_0003
Prepared analogously to 1 .4 from 0.1 g 4-[4-fluoro-2-(trans-4-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxyl ammonia (7M in methanol).
Yield: 0.072 g
ESI mass spectrum: m/z = 431 (M+H)+
Rt (HPLC): 1 .39 (method X)
The following compound were prepared analogously to 1 .4.
Figure imgf000209_0001
Figure imgf000209_0002
Figure imgf000210_0001
Example 192
4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3-
Figure imgf000210_0002
192.1
Figure imgf000211_0001
Prepared analogously to 153.1 from 0.267 g 4-[4-fluoro-2-(trans-4-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and 0.143 g EDC.
Yield: 0.232 g
192.2 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000211_0002
Prepared analogously to 153.2 from 0.161 g compound 192.1 and 222 μΙ N-(3- aminopropyl)morpholine.
Yield: 0.130 g
ESI mass spectrum: m/z = 558 (M+H)+
Rt (HPLC): 1 .29 (method X)
The following compound were prepared analogously to 153.2.
Figure imgf000211_0003
Figure imgf000212_0001
Example 200
4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid (pipehdin-3-ylmethyl)-amide
Figure imgf000212_0002
200.1 3-[({4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpynmidine-6-carbonyl)-amino)-methyl1-piperidine-1 -carboxylic acid tert- butyl ester
Figure imgf000213_0001
Prepared analogously to 153.2 from 0.1 g compound 192.1 and 0.15 g 3- aminomethyl-piperidine-1 -carboxylic acid terf-butyl ester.
Yield: 0.1 19 g
200.2 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid (piperidin-3-ylmethyl)-amide
Figure imgf000213_0002
Prepared analogously to IV.2 from 0.1 19 g 3-[({4-[4-fluoro-2-(trans-4-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carbonyl}-amino)- methyl]-piperidine-1 -carboxylic acid terf-butyl ester.
Yield: 0.059 g
ESI mass spectrum: m/z = 558 (M+H)+
Example 201
4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c/lpyrimidine-6-carboxylic acid [3-(3-hydroxy-pyrrolidin-1 -vD-propyll-amide
Figure imgf000214_0001
201 .1 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000214_0002
Prepared analogously to 153.2 from 0.287 g compound 192.1 and 437 μΙ 1 -amino-
3,3-diethoxypropane.
Yield: 0.266 g
201 .2 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000214_0003
A mixture of 0.261 g compound 201 .1 and p-toluene sulfonic acid in 3 ml acetone were heated at reflux for 30 minutes. Then methylene chloride and aq. potassium carbonate solution (10%) were added and the mixture was shaken. After that the mixture was passed through a hydrophobic frit. The filtrate was evaporated.
Yield: 0.213 g 201 .3 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000215_0001
0.155 g sodium triacetoxyborohydride were added to a solution of the 0.21 g 4-[4- fluoro-2-(trans-4-methoxy-cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid (3-oxo-propyl)-amide and 43 μΙ 3-pyrrolidinol in methylene chloride followed by addition of 49 μΙ acetic acid. The mixture was stirred at rt overnight, diluted with methylene chloride and then washed with 10% aq. K2CO3.
The mixture was passed through a hydrophobic frit. The filtrate was evaporated and purified by chromatography.
Yield: 0.15 g
ESI mass spectrum: m/z = 558 (M+H)+
Rt (HPLC): 1 .28 (method X) Example 202
4-[4-Fluoro-2-(cis-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic a -dimethylamino-propyl)-amide
Figure imgf000215_0002
202.1 4-[4-Fluoro-2-(cis-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid methylester
Figure imgf000216_0001
Prepared analogously to example 1 .1 from 0.507 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.5 g intermediate XXXXXVIII in dioxan.
Yield: 0.905 g
ESI mass spectrum: m/z = 446 (M+H)+
Rt (HPLC): 2.22 (method K)
202.2 4-[4-Fluoro-2-(cis-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000216_0002
Prepared analogously to 1 .3 from 0.85 g 4-[4-fluoro-2-(cis-4-methoxy-cyclohexyloxy)- phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methylester.
Yield: 0.753 g
ESI mass spectrum: m/z = 432 (M+H)+
Rt (HPLC): 3.22 (method A)
202.3 4-[4-Fluoro-2-(cis-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-
Figure imgf000216_0003
Prepared analogously to 1 .4 from 0.1 g 4-[4-fluoro-2-(cis-4-methoxy-cyclohexyloxy)- phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and 42 μΙ Ν,Ν- dimethyl-1 ,3-propanediamine.
Yield: 0.097 g
ESI mass spectrum: m/z = 516 (M+H)+
Rt (HPLC): 1 .34 (method K)
The following compound was prepared analogously to 1 .4.
Figure imgf000217_0001
Figure imgf000217_0003
Example 204
4-[2-(trans-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid ami
Figure imgf000217_0002
204.1 4-[2-(4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid methylester
Figure imgf000218_0001
Prepared analogously to example 1 .1 from 1 .78 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 1 .53 g intermediate XXXXXIX in dioxan.
Yield: 1 .8 g
204.2 4-[2-(4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000218_0002
Prepared analogously to 1 .3 from 0.363 g 4-[2-(4-hydroxy-cyclohexyloxy)-pyridin-3- ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methylester.
Yield: 0.221 g
204.3 4-[2-(trans-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid ami
Figure imgf000218_0003
Prepared analogously to 1 .4 from 0.1 g 4-[2-(trans-4-hydroxy-cyclohexyloxy)-pyrid 3-ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and ammonia in methanol (7M) in DMF. Separated from cis isomer by chromatography.
Yield: 0.008 g
Example 205 4-[2-(cis-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid ami
Figure imgf000219_0001
Prepared analogously to 1 .4 from 0.1 g 4-[2-(4-hydroxy-cyclohexyloxy)-pyridin-3- ylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid and ammonia in methanol (7M) in DMF. Separated from trans isomer by chromatography.
Yield: 0.009 g
ESI mass spectrum: m/z = 400 (M+H)+
Rt (HPLC): 1 .26 (method X)
Example 206
4-[2-(trans-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic aci -dimethylamino-propyl)-amide
Figure imgf000219_0002
206.1 4-[2-(trans-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3-
Figure imgf000219_0003
Prepared analogously to example 1 .1 from 0.262 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.203 g intermediate XXXXXX in dioxan.
Yield: 0.352 g ESI mass spectrum: m/z = 415 (M+H)+
206.2 4-[2-(trans-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000220_0001
Prepared analogously to 58.2 from 0.352 g 4-[2-(trans-4-hydroxy-cyclohexyloxy)- pyridin-3-ylamino]-5-methyl-thieno[2,3-c ]pyrimidine-6-carboxylic acid methylester. Yield: 0.083 g
ESI mass spectrum: m/z = 401 (M+H)+
206.3 4-[2-(trans-4-Hvdroxy-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic aci -dimethylamino-propyl)-amide
Figure imgf000220_0002
Prepared analogously to 1 .4 from 0.083 g 4-[2-(trans-4-hydroxy-cyclohexyloxy)- pyridin-3-ylamino]-5-methyl-thieno[2,3-c ]pyrimidine-6-carboxylic acid and 26 μΙ Ν,Ν- dimethyl-1 ,3-propanediamine in THF using TBTU instead of HATU.
Yield: 0.077 g
ESI mass spectrum: m/z = 485 (M+H)+
Rt (HPLC): 1 .91 (method A)
Example 207
4-[2-(trans-4-Methoxy-cvclohexyloxy)-pyhdin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide
Figure imgf000221_0001
207.1 4-(2-Hydroxy-pyridin-3-ylamino)-5-m
acid methyl ester
Figure imgf000221_0002
Prepared analogously to example 1 .1 from 0.2 g 4-chloro-5-methyl-thieno[2,3- c/]pyrimidine-6-carboxylic acid methyl ester and 0.1 g 3-amino-pyridin-2-ol in dioxan.
Yield: 0.258 g
ESI mass spectrum: m/z = 317 (M+H)+ 207.2 4-[2-(trans-4-Methoxy-cvclohexyloxy)-pyhdin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid meth lester
Figure imgf000221_0003
Prepared analogously to example XVI.1 from 1 .215 g 4-(2-hydroxy-pyridin-3- ylamino)-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester and 0.6 g cis-4-methoxycyclohexanol using DTAD and triphenylphosphine (polymerically bound from Aldrich).
Yield: 0.24 g
ESI mass spectrum: m/z = 429 (M+H)+ 207.3 4-[2-(trans-4-methoxy-cvclohexyloxy)-pyhdin-3-ylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000222_0001
Prepared analogously to 1 .3 from 0.24 g 4-[2-(trans-4-methoxy-cyclohexyloxy)- pyridin-3-ylamino]-5-methyl-thieno[2,3-c ]pyrimidine-6-carboxylic acid methylester. Yield: 0.21 g
207.4 4-[2-(trans-4-methoxy-cvclohexyloxy)-pyhdin-3-ylamino1-5-methyl-thieno[2,3-
Figure imgf000222_0002
Prepared analogously to 1 .4 from 0.005 g 4-[2-(trans-4-methoxy-cyclohexyloxy)- pyridin-3-ylamino]-5-methyl-thieno[2,3-c ]pyrimidine-6-carboxylic acid and ammonia (0.5 M in THF) in DMF using TBTU instead of HATU.
Yield: 0.034 g
ESI mass spectrum: m/z = 414 (M+H)+ The following compounds were prepared analogously to 1 .4.
Figure imgf000222_0003
Figure imgf000222_0004
H
I
209 Cpd. 207.3 458 (M+H)+ 1 .83min
(Method K)
H I
210 Cpd. 207.3 499 (M+H)+ 1 .83min
(Method K)
Example 21 1
Figure imgf000223_0001
stereochemistry
21 1 .1
Figure imgf000223_0002
relative stereochemistry Intermediate XXXXXXI (243 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (250 mg) and p-toluenesulfonic acid (20 mg) in dioxane (3.0 ml) were heated at 1 10°C for 8 h. The reaction mixture was diluted with DCM and NH OH, separated and filtered. The solid was washed with DCM and water. The filtrate was separated and the organic layer was concentrated in vacuo. The residue was suspended in water and filtered. The combined solids were washed with water and diethyl ether then dried in vacuo to give the desired product.
Yield: 366 mg
21 1 .2.
Figure imgf000224_0001
relative stereochemistry
2.0 M aq. sodium hydroxid was added to a mixture of compound 21 1 .1 (366 mg) in ethanol (4.0 ml) and THF (4.0 ml) and stirred at rt for 4 h. The mixture was diluted with 10% aq. KHSO4 and filtered. The filtercake was washed with water and diethyl ether and dried in vacuo to give the desired product.
Yield: 342 mg
21 1 .3
Figure imgf000224_0002
relative stereochemistry
HATU (388 mg) was added at 0°C to a mixture of compound 21 1 .2 (356 mg) and DIPEA (178 μΙ) in DMF (4.0 ml). After 30 min 7 M NH3 in methanol (2.0 ml) was added and the mixture was allowed to warm to room temperature overnight. The reaction mixture was partitioned between EtOAc and water and filtered. The filtercake was washed with EtOAc and water, then suspended in ethanol and evaporated in vacuo. The residue was suspended in methanol, filtered and dried in vacuo to give the desired product.
Yield: 200 mg
ESI-MS: m/z = 419 [M+H]+
Rt (HPLC): 1 .19 (method X)
Example 212
Figure imgf000225_0001
relative stereochemistry
Example 212.1
Figure imgf000225_0002
relative stereochemistry Intermediate XXXXV (379 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (344 mg) and p-toluenesulfonic acid (27 mg) in dioxane (5.0 ml) were heated at 1 10°C for 1 h. The reaction mixture was diluted with EtOAc and washed with 10% aq. K2CO3 and brine. The organic layer was concentrated in vacuo. The residue suspended in methanol and filtered to yield the desired product. Yield: 428 mg
212.2
Figure imgf000225_0003
relative stereochemistry
2 M aq. HCI (10.0 ml) was added to compound 212.1 (672 mg) in THF (10.0 ml) and the mixture was heated at reflux. After 30 min the reaction mixture was concentrated in vacuo. The residue was partitioned between methylene chloride and 2 M aq. sodium hydroxid. The mixture was filtered. The filtercake was washed with diethyl ether and dried under vacuo to give the desired product.
Yield: 406 mg
ESI-MS: m/z = 434 [M+H]+
212.3
Figure imgf000226_0001
relative stereochemistry
Prepared analogously to 1 .3 from 0.333 g compound 212.2.
Yield: 250 mg
212.4
Figure imgf000226_0002
relative stereochemistry
Prepared analogously to 1 .4 from 0.249 g compound 212.3 and ammonia (7 M in methanol).
Yield: 183 mg
ESI-MS: m/z = 419 [M+H]+
Rt (HPLC): 1 .2 (method X) Example 213
Figure imgf000227_0001
relative stereochemistry
A mixture of compound 212.4 (84 mg), 2,2-dimethoxypropan (1 .0 ml) and p- toluenesulfonic acid (16 mg) in DMF (1 .0 ml) was stirred at room temperature overnight. The reaction mixture was diluted with EtOAc and and washed with 10% aq. K2CO3 and water. The organic layer was concentrated in vacuo. After triturated with diethyl ether the residue was heated in methanol/water, allowed to cool and filtered to give the desired product.
Yield: 60 mg
ESI-MS: m/z = 459 [M+H]+
Rt (HPLC): 1 .4 (method X)
Example 214
Figure imgf000227_0002
relative stereochemistry
214.1
Figure imgf000227_0003
Relative stereochemistry Intermediate XXXXVI (89 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester (83 mg) and p-toluenesulfonic acid (7 mg) in dioxane (1 .0 ml) were heated at 1 10°C for 2 h. The reaction mixture was diluted with methylene chloride and 3 M aq. NH3 and passed through a hydrophobic frit. The organic layer was concentrated in vacuo. The residue suspended in methanol and filtered to yield the desired product.
Yield: 128 mg
ESI-MS: m/z = 446 [M+H]+
214.2
Figure imgf000228_0001
Relative stereochemistry
Compound 214.1 (126 mg) in ethanol (1 .0 ml), THF (1 .0 ml) and 2 M aq. sodium hydroxid (0.7 ml) were heated at reflux for 1 .5 h. 2 M aq.HCI was added to the reaction mixture and filtered. The filtercake was suspended in ethanol and
concentrated in vacuo to give the desired product.
Yield: 1 19 mg
214.3
Figure imgf000228_0002
Relative stereochemistry
HATU (123 mg) was added at 0°C to a mixture of compound 214.2 (1 16 mg) and DIPEA (56 μΙ) in DMF (1 .5 ml). After 30 min 7 M NH3 in methanol (0.7 ml) was added and the mixture was allowed to warm to room temperature overnight. The reaction mixture was concentrated in vacuo and re-evaporated from toluene. The residue was suspended in methanol, heated to reflux and cooled. The mixture was filtered and the filtercake was washed with diethyl ether to give the desired product.
Yield: 86 mg
ESI-MS: m/z = 431 [M+H]+
Rt HPLC-MS: 1 .32 min (Method X)
The following compound was prepared analogously to 1 .4.:
Figure imgf000229_0001
Figure imgf000229_0003
Example 216
Figure imgf000229_0002
relative stereochemistry
216.1
Figure imgf000230_0001
relative stereochemistry
Intermediate XXXXVII (360 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (285 mg) and p-toluenesulfonic acid (22 mg) in dioxane (3.0 ml) were heated at 1 10°C for 5 h. The reaction mixture was allowed to cool, diluted with methylene chloride and 10% aq. K2CO3 and passed through a
hydrophobic frit. The organic layer was concentrated in vacuo to give the desired product.
Yield: 430 mg
216.2
Figure imgf000230_0002
relative stereochemistry
Compound 216.1 (430 mg) in methanol (5.0 ml), THF (5.0 ml) and 2 M aq. sodium hydroxid (2.4 ml) was heated at reflux for 20 min. After addition of 2 M aq.HCI the reaction mixture was concentrated in vacuo. The crude was suspended in water, filtered and washed with water. The filtercake was re-evaporated from ethanol. The residue was triturated with hot methanol, cooled, filtered and dried to give the desired product.
Yield: 346 mg
216.3
Figure imgf000231_0001
Relative stereochemistry
HATU (91 mg) was added at 0°C to a mixture of compound 216.2 (90 mg) and DIPEA (42 μΙ) in DMF (1 .0 ml). After 30 min 7 M NH3 in methanol (1 .0 ml) was added and the mixture was allowed to warm to room temperature over weekend. The reaction mixture was concentrated in vacuo. The residue was treated with ethanol and water, filtered and washed with water and diethyl ether. The filtercake was re- evaporated from DMSO to yield the desired product.
Yield: 20 mg
ESI-MS: m/z = 447 [M+H]+
Rt HPLC-MS: 1 .31 min (Method X)
The following compound was prepared analogously to 1 .4.:
Figure imgf000231_0002
Figure imgf000231_0003
Example 218
Figure imgf000232_0001
218.1
Figure imgf000232_0002
relative stereochemistry Intermediate XXXXVIII (139 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (128 mg) and p-toluenesulfonic acid (10 mg) in dioxane (2.0 ml) were heated at 100°C for 2 h. The reaction mixture was allowed to cool and treated with DCM and 10% aq. K2CO3. The mixture separated. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue triturated with MeOH to yield the desired product.
Yield: 194 mg
218.2
Figure imgf000233_0001
relative stereochemistry
Compound 218.1 (194 mg) in MeOH (2.5 ml), THF (2.5 ml) and 2 M aq. sodium hydroxid (1 .0 ml) were heated at reflux for 30 min. The reaction mixture was allowed to cool and concentrated in vacuo. The crude was treated with 2 M aq.HCI and filtered. The filtercake was washed with water, suspended in EtOH and concentrated in vacuo to give the desired product.
Yield: 153 mg
218.3
Figure imgf000233_0002
HATU (158 mg) was added at 0°C to a mixture of compound 218.2(150 mg) and
DIPEA (72 μΙ) in DMF (1 .5 ml). After 30 min 7 M NH3 in methanol (0.75 ml) was added and the mixture was allowed to warm to room temperature overnight. The reaction mixture was concentrated in vacu. The residue was partitioned between
EtOAc and water and filtered. The filtercake was washed with water and diethyl ether and purified by chromatography to give the desired product.
Yield: 50 mg
ESI-MS: m/z = 431 [M+H]+
Rt HPLC-MS: 1 .29 min (Method X) Example 219
Figure imgf000234_0001
relative stereochemistry
219.1
Figure imgf000234_0002
Relative stereochemistry Intermediate XXXXIX (363 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (330 mg) and p-toluenesulfonic acid (26 mg) in dioxane (5.0 ml) were heated at 1 10°C for 4 h. The reaction mixture was treated with EtOAc and 10% aq. K2CO3. The mixture was filtered and the filtercake was washed with diethyl ether. The filtrate was separated. The organic layer was concentrated in vacuo. The crude was suspended in methanol and filtered to yield the desired product.
Yield: 6 5 mg 219.2
Figure imgf000235_0001
relative stereochemistry
2 M aq. HCI (10.0 ml) was added to compound 219.1 (644 mg) in THF (10.0 ml) and the mixture was heated at reflux. After 20 min the reaction mixture was allowed to cool and concentrated in vacuo. The residue was partitioned between methylene chloride and 10% aq. K2CO3. The mixture was filtered. The filtercake was washed with diethyl ether and dried to give the desired product.
Yield: 531 mg
ESI-MS: m/z = 434 [M+H]+
219.3
Figure imgf000235_0002
relative stereochemistry
Compound 219.2 (448 mg) in EtOH (5.0 ml), THF (5.0 ml) and 2M aq. sodium hydroxid (3.0 ml) was stirred at room temperature for 1 .5 h. The reaction mixture was concentrated in vacuo. The crude was treated with 10% aq. KHSO4 and filtered. The filtercake was washed with water and diethyl ether and dried to give the desired product.
Yield: 372 mg
219.4
Figure imgf000236_0001
relative stereochemistry
HATU (91 mg) was added at 0°C to a mixture of compound 219.3 (82 mg) and DIPEA (42 μΙ) in DMF (1 .0 ml). After 30 min 7 M NH3 in methanol (0.5 ml) was added and the mixture was allowed to warm to room temperature overnight. The reaction mixture was partitioned between EtOAc and water. The organic layer was washed with brine and water. The resultant mixture was filtered. The filtercake was washed with diethyl ether, water and diethyl ether to give the desired product.
Yield: 46 mg
ESI-MS: m/z = 419 [M+H]+
Rt HPLC-MS: 1 .21 min (Method X)
Example 220
Figure imgf000236_0002
relative stereochemistry
A mixture of compound 219.4 (218 mg), 2,2-dimethoxypropan (1 .0 ml) and p- toluenesulfonic acid (20 mg) in DMF (1 .0 ml) was stirred at room temperature overnight. Further p-toluenesulfonic acid (20 mg) was added and stirring continued at
60°C for 45 min. The reaction mixture was diluted with 10% aq. K2CO3 and methanol.
The mixture was filtered to give the desired product.
Yield: 177 mg
ESI-MS: m/z = 459 [M+H]+ Rt HPLC-MS: 1 .35 min (Method X)
Example 221
Figure imgf000237_0001
stereochemistry
221 .1
Figure imgf000237_0002
relative stereochemistry
Intermediate XXXXX (505 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (385 mg) and p-toluenesulfonic acid (60 mg) in dioxane (5.0 ml) were heated at 1 10°C for 8 h. The reaction mixture was diluted with methylene chloride and 10% aq. K2CO3 and brine. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue was triturated with methanol to yield the desired product.
Yield: 488 mg
221 .2
Figure imgf000238_0001
relative stereochemistry
Compound 221 .1 (488 mg) in methanol (5.0 ml), THF (5.0 ml) and 2M aq. sodium hydroxid (2.6 ml) were stirred at reflux for 30 min. The reaction mixture was allowed to cool and treated with 10% aq. KHSO4. The mixture was filtered. The filtercake was washed with water and dried to give the desired product.
Yield: 600mg
221 .3
Figure imgf000238_0002
relative stereochemistry
HATU (228 mg) was added at 0°C to a mixture of compound 221 .2 (230 mg) and DIPEA (104 μΙ) in DMF (3.0 ml). After 30 min 7 M NH3 in methanol (1 .5 ml) was added and the mixture was allowed to warm to room temperature over weekend. The reaction mixture was concentrated in vacuo. The residue was treated with THF (3.0 ml) and 2 M aq. HCI (3 ml) at reflux for 20 min. The mixture was partitioned between EtOAc and water and filtered. The filtercake was washed with water and diethyl ether to give the desired product.
Yield: 134 mg
ESI-MS: m/z = 419 [M+H]+
Rt HPLC-MS: 1 .21 min (Method X)
Example 222
Figure imgf000239_0001
relative stereochemistry
HATU (228 mg) was added at 0°C to a mixture of 221 .2 (230 mg) and DIPEA (104 μΙ) in DMF (3.0 ml). After 30 min 3-dimethylaminopropylamine (315 μΙ) was added and the mixture was allowed to warm to room temperature over weekend. The reaction mixture was concentrated in vacuo. The residue was treated with THF (3.0 ml) and 2 M aq. HCI (3 ml) at reflux for 20 min. The mixture was partitioned between EtOAc and 10% aq. K2CO3. The organic layer was was concentrated in vacuo. The residue was triturated with methanol, filtered and washed with diethyl ether to give the desired product.
Yield: 65 mg
ESI-MS: m/z = 504 [M+H]+
Rt HPLC-MS: 1 .18 min (Method X)
Example 223
Figure imgf000239_0002
relative stereochemistry
223.1
Figure imgf000240_0001
relative stereochemistry
Prepared analogously to 1 .1 from intermediate 0.091 g XXXXXI and 0.076 g 4- chloro-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester.
Yield: 76 mg
223.2
Figure imgf000240_0002
relative stereochemistry
Compound 223.1 (76 mg) in MeOH (0.5 ml), THF (0.5 ml) and 2M aq. sodium hydroxid (0.4 ml) were stirred at reflux for 20 min. The reaction mixture was allowed to cool and treated with 10% aq. KHSO4. The mixture was filtered. The filtercake was washed with water and dried to give the desired product.
Yield: 70 mg
223.3
Figure imgf000240_0003
relative stereochemistry HATU (64 mg) was added at 0°C to a mixture of compound 223.2 (94 mg) and DIPEA (29 μΙ) in DMF (1 .0 ml). After 30 min 7 M NH3 in methanol (0.5 ml) was added and the mixture was allowed to warm to room temperature over weekend. The reaction mixture was concentrated in vacuo. The residue was treated with THF (1 .0 ml) and 2 M aq. HCI (1 .0 ml) at reflux for 20 min. The mixture was diluted with EtOAc and washed with water and 10% aq. K2CO3. The organic was concentrated in vacuo. The residue was purified by chromatography to yield the desired product.
Yield: 15 mg
ESI-MS: m/z = 419 [M+H]+
Rt HPLC-MS: 1 .20 min (Method X)
Example 224
Figure imgf000241_0001
relative stereochemistry
224.1
Figure imgf000241_0002
relative stereochemistry
Intermediate XXXXXII (384 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (429 mg) and p-toluenesulfonic acid (34 mg) in dioxane (5.0 ml) were heated at 1 10°C for 4 h. The reaction mixture was diluted with methylene chloride and washed with 10% aq. K2CO3 and brine. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue was treated with diethyl ether, filtered and washed to yield the desired product. Yield: 480 mg
224.2
Figure imgf000242_0001
relative stereochemistry
Compound 224.1 (200 mg) in methanol (1 .5 ml), THF (1 .5 ml) and 2M aq. sodium hydroxid (1 .3 ml) were stirred at reflux for 20 min. After addition of 2 M aq. HCI (3.0 ml) the reaction mixture was concentrated in vacuo. The residue was treated with water, filtered and washed with water. The crude was re-evaporated from ethanol before it was treated with diethyl ether. The mixture was filtered and the filtercake was washed with diethyl ether to give the desired product.
Yield: 156 mg
224.3
Figure imgf000242_0002
relative stereochemistry
HATU (207 mg) was added at 0°C to a mixture of compound 224.2 (156 mg) and DIPEA (95 μΙ) in DMF (2.0 ml). After 30 min 7 M NH3 in methanol (1 .0 ml) was added and the mixture was allowed to warm to room temperature overnight. The reaction mixture was concentrated in vacuo and re-evaporated from toluene. The residue was treated with hot methanol. The mixture was allowed to cool, then it was filtered to yield the desired product.
Yield: 78 mg
ESI-MS: m/z = 403 [M+H]+ Rt HPLC-MS: 1 .28 min (Method X) Example 225
Figure imgf000243_0001
225.1
Figure imgf000243_0002
Intermediate XXXXXIII (990 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (948 mg) and p-toluenesulfonic acid (74 mg) in dioxane (10.0 ml) were heated at 1 10°C for 8 h. The reaction mixture was diluted with methylene chloride and 10% aq. K2CO3. The organic layer was passed through a hydrophobic frit and concentrated in vacuo. The residue was treated with methanol to yield the desired product.
Yield: 898 mg
225.2 4-(4-fluoro-2-(3-hvdroxycvclopentyloxy)phenylamino)-5- methylthieno[2,3-dlpyrimidine-6-carboxilic acid
Figure imgf000244_0001
Methyl 4-(4-fluoro-2-(3-hydroxycyclopentyloxy)phenylamino)-5-methylthieno[2,3- d]pyrinnidine-6-carboxylate (150 mg) in methanol (2.0 ml), THF (2.0 ml) and 2M aq. sodium hydroxid (0.9 ml) was stirred at reflux for 40 min. After addition of 2 M aq. HCI (8.0 ml) the reaction mixture was concentrated in vacuo. The aqueous layer was filtered and washed with water. The crude was re-evaporated from EtOH to give the desired product.
Yield: 141 mg 225.3. 4-(4-fluoro-2-(3-hvdroxycvclopentyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000244_0002
HATU (147 mg) was added at 0°C to a mixture of 4-(4-fluoro-2-(3- hydroxycyclopentyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxilic acid (130 mg) and DIPEA (67 μΙ) in DMF (2.0 ml). After 30 min 7 M NH3 in MeOH (1 .0 ml) was added and the mixture was allowed to warm to room temperature over weekend. The reaction mixture was concentrated in vacuo. The residue was treated with hot MeOH. The mixture was allowed to cool, then it was filtered to yield the desired product.
Yield: 88 mg
ESI-MS: m/z = 403 [M+H]+ Rt HPLC-MS: 1 .27 min (Method X)
Example 226
226.1
Figure imgf000245_0001
EDC (147 mg) was added to a mixture of 268 mg 4-(4-fluoro-2-(3- hydroxycyclopentyloxy)phenylamino)-5-methylthieno[2,3-d]pyrimidine-6-carboxilic acid (225.2) and N-hydroxysuccinimide (1 10 mg) in DMF (3.0 ml). After stirring at room temperature overnight the reaction mixture was diluted with EtoAc and washed with water and brine. The organic layer was passed through a hydrophobic frit and concentrated in vacuo to yield the desired product.
Yield: 314 mg 226.2. N-(3-(dimethylamino)propyl)- 4-(4-fluoro-2-(3- hvdroxycvclopentyloxy)phenylamino)-5-methylthieno[2,3-dlpyhmidine-6-carboxamide
Figure imgf000245_0002
Prepared analogously to 153.2 from 0.145 g compound 226.1 and 3- dimethylaminopropylamine (200 μΙ) Yield: 88 mg
ESI-MS: m/z = 488 [M+H]+
Rt HPLC-MS: 1 .22 min (Method X) Example 227
4-(4-Fluoro-2-(3-hvdroxycvclopentyloxy)phenylamino)-N-(2-hvdroxyethyl)-5- methylthieno[2,3-dlpyrimidine-6-carboxamide
Figure imgf000246_0001
Prepared analogously to 153.2 from 0.165 g compound 226.1 and 2-aminoethanol (100 μΙ).
Yield: 84 mg
ESI-MS: m/z = 447 [M+H]+
Rt HPLC-MS: 1 .25 min (Method X) Example 228
{(1 S,3S)-3-[2-(6-Carbamoyl-5-methyl-thieno[2,3-c lpyhmidin-4-ylamino)-5-fluoro- phenoxyl-cyclopentvD-carbamic acid fe/f-butyl ester
Chiral
Figure imgf000246_0002
228.1 4-[2-((1 S,3S)-3-Amino-cvclopentyloxy)-4-fluoro-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid methyl ester Chiral
Figure imgf000247_0001
Intermediate XXXVII (155 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (121 mg) and p-toluenesulfonic acid (15 mg) in dioxane (3.0 ml) were heated at 1 10°C for 2 hours under microwave radiation. The reaction mixture was filtered, the filtercake was washed with diisopropyl ether and dried to give the desired compound.
Yield: 150 mg
ESI-MS: m/z = 417 [M+H]+ 228.2 4-r2-((1 S,3S)-3- e/t-Butoxycarbonylamino-cvclopentyloxy)-4-fluoro- phenylamino1-5-methyl-thieno[2,3-c lpyrimidine-6-carboxylic acid methyl ester
Chiral
Figure imgf000247_0002
A mixture of 4-[2-((1 S,3S)-3-amino-cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl- thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (150 mg), di-tert-butyl dicarbonat (173 mg) and triethylamine (145 μΙ) in THF (10 ml) was stirred at rt overnight. The reaction mixture was concentrated and the crude partitioned between
DCM and water. The organic layer was dried, concentrated and the residue was triturated with diisopropyl ether to give the desired compound.
Yield: 1 13 mg
ESI-MS: m/z = 517 [M+H]+
Rt HPLC-MS: 4.05 min (method A)
Rf (TLC): 0.29 (silica gel, DCM) 228.3 4-[2-((1 S,3S)-3- e/t-Butoxycarbonylannino-cvclopentyloxy)-4-fluoro- phenylamino1-5-methyl-thieno[2,3-c lpyrimidine-6-carboxylic acid
Figure imgf000248_0001
A mixture of 4-[2-((1 S,3S)-3-te/t-butoxycarbonylamino-cyclopentyloxy)-4-fluoro- phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (100 mg) and lithium hydroxide (133 mg) in THF/MeOH/H2O 1 /1/1 (15 ml) was stirred at rt over the weekend. The reaction mixture was acidified with aq. HCI and extracted with DCM. The organic layer was dried, concentrated and the residue was triturated with diisoprpyl ether to give the desired compound.
Yield: 57 mg
ESI-MS: m/z = 503 [M+H]+
Rt HPLC-MS: 3.95 min (method A) 228.4 {(1 S,3S)-3-r2-(6-Carbamoyl-5-methyl-thienor2,3-c lpyrimidin-4-ylamino)-
5-fluoro-phenoxy1-cvclopentyl)-carbamic acid fe/f-butyl ester
Chiral
Figure imgf000248_0002
A mixture of 4-[2-((1 S,3S)-3-te/t-butoxycarbonylamino-cyclopentyloxy)-4-fluoro- phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (1 15 mg), TBTU (81 mg) and DIPEA (88 μΙ) in THF (15 ml) was stirred at rt for 30 minutes. After the addition of 0.5 M ammonia in dioxane (458 μΙ) and DMF the mixture was stirred at rt overnight. The reaction mixture was concentrated, diluted with water and extracted with DCM. The organic layer was concentrated and the crude was purified by chromatography to give the desired product.
Yield: 53 mg
ESI-MS: m/z = 502 [M+H]+
Rt HPLC-MS: 2.78 min (method A)
Rf (TLC): 0.69 (silica gel, DCM/MeOH/NH3 80/20/1 )
Example 229
4-[2-((1 S,3S)-3-Amino-cvclopentyloxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid amide trifluoroacetate
hiral
Figure imgf000249_0001
To compound 228.4 (310 mg) in DCM 815 ml) was added at 0°C TFA (1 .7 ml) and stirred at rt for 4 hours. The reaction mixture was concentrated at rt and the crude was triturated with diisopropyl ether to give the desired product.
Yield: 376 mg
ESI-MS: m/z = 402 [M+H]+
Rt HPLC-MS: 2.56 min (method A)
Rf (TLC): 0.37 (silica gel, DCM/MeOH/NH3 80/20/1 ) Example 230
4-[2-((1 S,3S)-3-Acetylamino-cvclopentyloxy)-4-fluoro-phenylamino1-5-methyl- thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Chiral
Figure imgf000249_0002
Acetyl chloride (21 μΙ) was added at 0°C to a mixture of 4-[2-((1 S,3S)-3-amino- cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid amide trifluoroacetate (cpd. 229, 206 mg) and DIPEA (348 μΙ) in DCM (25 ml) and stirred at rt for 4 hours. The reaction mixture was concentrated, diluted with water and extracted with DCM. The organic layer was dried, concentrated and the crude was purified by chromatography to give the desired product.
Yield: 55 mg
ESI-MS: m/z = 444 [M+H]+
Rt HPLC-MS: 3.04 min (method A)
Rf (TLC): 0.74 (silica gel, DCM/MeOH 4/1 )
Example 231
4-[2-((1 S,3S)-3-Acetylamino-cvclopentyloxy)-4-fluoro-phenylamino1-5-methyl-
Figure imgf000250_0001
231 .1 4-[2-((1 S,3S)-3-Acetylamino-cvclopentyloxy)-4-fluoro-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid methyl ester
Chiral
Figure imgf000250_0002
Intermediate XXXXXXII (155 mg), 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6- carboxylic acid methyl ester (242 mg) and p-toluenesulfonic acid (34 mg) in dioxane (4.0 ml) were heated at 1 10°C for 1 hours under microwave radiation. The reaction mixture was concentrated, washed with water and concentrated. The crude was purified by chromatography and triturated with diisopropyl ether to give the desired compound. Yield: 196 mg
ESI-MS: m/z = 459 [M+H]+
Rt HPLC-MS: 3.02 min (method A)
Rf (TLC): 0.34 (silica gel, DCM/MeOH/NH3 90/10/1 )
231 .2 4-[2-((1 S,3S)-3-Acetylamino-cvclopentyloxy)-4-fluoro-phenylannino1-5- methyl-thieno[2,3-c lpyrinnidine-6-carboxylic acid
Chiral
Figure imgf000251_0001
Prepared analogously to example 228.3 from 4-[2-((1 S,3S)-3-acetylamino- cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyhmidine-6-carboxyl acid methyl ester, cpd.231 .1 (1 .44 g).
Yield: 1 .15 g
ESI-MS: m/z = 445 [M+H]+
Rt HPLC-MS: 2.72 min (method A)
231 .3 4-[2-((1 S,3S)-3-Acetylamino-cvclopentyloxy)-4-fluoro-phenylamino1-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid (2-hydroxy-ethyl)-amide
Figure imgf000251_0002
Synthesized analogously to example 225.3 from 4-[2-((1 S,3S)-3-acetylamino- cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (1 1 1 mg) and 2-aminoethanol (18 μΙ). The reaction mixture was concentrated, the residue was partitioned between DCM and water and the organic layer was dried and concentrated again. The crude was purified by chromatography to give the desired product. Yield: 32 mg
ESI-MS: m/z = 488 [M+H]+
Rt HPLC-MS: 2.43 min (method A)
Rf (TLC): 0.21 (silica gel, DCM/MeOH/NH3 90/10/1 )
The following compounds were prepared analogously to 231 .3.
Figure imgf000252_0001
Figure imgf000252_0002
238 Cpd. 231 .2 499 (M+H)+ 2.12 min
NH2
(method A)
239 Cpd. 231 .2 555 (M+H)+ 2.15 min
(method A)
Example 240
4-{2-[(1 S,3S)-3-(Acetyl-methyl-amino)-cvclopentyloxy1-4-fluoro-phenylamino)-5- methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Chiral
Figure imgf000253_0001
240.1 4-{2-r(1 S,3S)-3-(Acetyl-methyl-amino)-cvclopentyloxy1-4-fluoro- phenylamino)-5-methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid methyl ester
Chiral
Figure imgf000253_0002
Prepared analogously to example 231 .1 from intermediate XXXVIII (266 mg) and 4- chloro-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester (243 mg). Yield: 242 mg
ESI-MS: m/z = 473 [M+H]+
Rt HPLC-MS: 3.13 min (method A)
Rf (TLC): 0.52 (silica gel, DCM/MeOH/NH3 90/10/1 ) 240.2 4-{2-r(1 S,3S)-3-(Acetyl-methyl-amino)-cvclopentyloxy1-4-fluoro- phenylamino)-5-methyl-thieno[2,3-c lpyrimidine-6-carboxylic acid
Chiral
Figure imgf000254_0001
Prepared analogously to example 228.3 from 4-{2-[(1 S,3S)-3-(acetyl-methyl-amino)- cyclopentyloxy]-4-fluoro-phenylamino}-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (185 mg).
Yield: 126 mg
ESI-MS: m/z = 459 [M+H]+
Rt HPLC-MS: 2.80 min (method A)
240.3 4-{2-r(1 S,3S)-3-(Acetyl-methyl-amino)-cvclopentyloxy1-4-fluoro- phenylamino)-5-methyl-thieno[2,3-c lpyhmidine-6-carboxylic acid amide
Chiral
Figure imgf000254_0002
Prepared analogously to example 225.3 from 4-{2-[(1 S,3S)-3-(acetyl-methyl-amino)- cyclopentyloxy]-4-fluoro-phenylamino}-5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (126 mg) and 0.5 M ammonia in dioxane (2.1 ml).
Yield: 37 mg
ESI-MS: m/z = 458 [M+H]+
Rt HPLC-MS: 2.55 min (method A)
Rf (TLC): 0.30 (silica gel, DCM/MeOH/NH3 90/10/1 )
Example 241
4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid cyanomethyl-amide
Figure imgf000255_0001
Prepared analogously to example 35.1 from compound 35.2 (80 mg) and
aminoaetonitrile (14 mg).
Yield: 70 mg
ESI-MS: m/z = 469 [M+H]+
Rt HPLC-MS: 1 .61 min (method L
Example 242
Separation into 4-(4-fluoro-2-(cis-3-hvdroxycvclopentyloxy)phenylamino)-5- methylthieno[2,3-dlpyhmidine-6-carboxamide and 4-(4-fluoro-2-(trans-3- hvdroxycvclopentyloxy)phenylamino)-5-methylthieno[2,3-dlpyhmidine-6-carboxamide Chiral
Figure imgf000255_0002
The cis/trans mixture from 225.3 (50 mg) was separated into the isomers by SFC chromatography:
Column: Daicel ASH 250 mm x 4.6 mm
Mobile phase: CO2 / Methanol 60:40 (with addition of 0.2% Diethyl amine) Eluting first: cis isomer; eluting second: trans isomer
4-(4-fluoro-2-(cis-3-hvdroxycvclopentyloxy)phenylamino)-5-methylthieno[2,3- dlpyhmidine-6-carboxamide
Yield: 5 mg ESI-MS: m/z = 403 [M+H]+
4-(4-fluoro-2-(trans-3-hvdroxycvclopentyloxy)phenylamino)-5-methylthieno[2,3- dlpyrimidine-6-carboxannide
Yield: 5 mg
ESI-MS: m/z = 403 [M+H]+
Example 243
4-(2-Cvclobutoxy-4-fluoro-phenylamm
carboxylic acid amide
Figure imgf000256_0001
243.1 4-(4-Fluoro-2-hvdroxy-phenylamino)-5-methyl-thieno[2,3-c lpyrimidine-6- carboxylic acid methyl ester
Figure imgf000256_0002
A mixture of 4-chloro-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester (500 mg), 2-amino-5-fluor-phenol (265 mg) and p-toluenesulfonic acid (75 mg) in dioxane (5 ml) was stirred at 140°C for 15 minutes under microwave radiation. The reaction mixture was allowed to cool, filtered and the filtercake was washed with dioxane, MeOH and diethyl ether to give the desired product.
Yield: 605 mg
ESI-MS: m/z = 334 [M+H]+ 243.2 4-(2-Cvclobutoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3-
Figure imgf000257_0001
A mixture of 4-(4-fluoro-2-hydroxy-phenylamino)-5-methyl-thieno[2,3-c/]pyrimidine-6- carboxylic acid methyl ester (200 mg), potassium carbonate (166 mg) and
bromocyclobutane (1 13 μΙ) in DMF (3 ml) was stirred at 60°C over the weekend. The reaction mixture was diluted with EtOAc and washed with water and brine. The organic layer was concentrated and the residue was triturated with diethyl ether to give the desired compound.
Yield: 130 mg
243.3 4-(2-Cvclobutoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000257_0002
Prepared analogously to example 1 .3 from 4-(2-cyclobutoxy-4-fluoro-phenylamino)-5- methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (130 mg).
Yield: 125 mg
243.4 4-(2-Cvclobutoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid amide
Figure imgf000258_0001
Prepared analogously to example 1 .4 from 4-(2-cyclobutoxy-4-fluoro-phenylamino)-5- methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (127 mg) and 7 M ammonia in MeOH (1 ml).
Yield : 45 mg
ESI-MS: m/z = 372 [M+H]+
Rt HPLC-MS: 1 .42 min (method X)
Example 244
4-(2-Cvclopentoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3-c lpyhm
carboxylic acid amide
Figure imgf000258_0002
244.1 4-(2-Cvclopentoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid methyl ester
Figure imgf000258_0003
Prepared analogously to example 243.2 from 4-(4-fluoro-2-hydroxy-phenylamino)-5- methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (67 mg) and
bromocyclopentane (60 mg).
Yield: 46 mg
244.2 4-(2-Cvclopenttoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3- c lpyrimidine-6-carboxylic acid
Figure imgf000259_0001
Prepared analogously to example 1 .3 from 4-(2-cyclopentoxy-4-fluoro-phenylamino)- 5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid methyl ester (73 mg).
Yield: 62 mg
244.3 4-(2-Cvclopentoxy-4-fluoro-phenylamino)-5-methyl-thieno[2,3- c lpyhmidine-6-carboxylic acid amide
Figure imgf000259_0002
Prepared analogously to example 1 .4 from 4-(2-cyclopentoxy-4-fluoro-phenylamino)- 5-methyl-thieno[2,3-c/]pyrimidine-6-carboxylic acid (59 mg) and 7 M ammonia in MeOH (0.5 ml).
Yield : 27 mg
ESI-MS: m/z = 387 [M+H]+
Rt HPLC-MS: 1 .45 min (method X) Example 245
4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl-thieno [2,3- dlpyrimidine-6-carboxylic acid (4-dimethylamino-but-2-vnyl)-amide
Figure imgf000260_0001
Prepared analogously to 35.3 from 0.080 g 4-[2-(trans-3-acetylamino-cyclobutoxy)- 4-fluoro-phenylamino]-5-methyl-thieno [2,3-d]pyrimidine-6-carboxylic acid (cpd. 35.2) and 0.045 g 4-(dimethylamino)-but-2-ynylamin*2HCI.
Yield: 0.0075 g
ESI mass spectrum: m/z = 525 (M+H)D
Example 246
4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl-thieno [2,3- dlpyrimidine-6-carboxylic acid (2-amino-cvclopropyl)-amide
Figure imgf000260_0002
2 246.1 [2-({4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl- thieno [2,3-dlpyhmidine-6-carbonyl)amino)-cvclopropyl1-carbamic acid tert-butyl ester
Figure imgf000261_0001
Prepared analogously to 35.3 from 0.080 g 4-[2-(trans-3-acetylamino-cyclobutoxy)- 4-fluoro-phenylamino]-5-methyl-thieno [2,3-d]pyrimidine-6-carboxylic acid (cpd. 35.2) and 0.050 g tert-butyl (1 R,2R)-2-aminocyclopropylcarbamate hydrochloride. 246.2 4-[2-(trans-3-Acetylamino-cvclobutoxy)-4-fluoro-phenylamino1-5-methyl- thieno [2,3-dlpyrimidine-6-carboxylic acid (2-amino-cvclopropyl)-amide
Figure imgf000261_0002
2
A mixture of 0.15 g [2-({4-[2-(trans-3-acetylamino-cyclobutoxy)-4-fluoro- phenylamino]-5-methyl-thieno [2,3-d]pyrimidine-6-carbonyl}amino)-cyclopropyl]- carbamic acid tert-butyl ester in 5 ml dioxane was added 1 M hydrochloric acid solution in Dioxan and was stirred at rt overnight. The reaction mixture was
concentrated and the residue was purified by chromatography.
Yield: 0.014 g
ESI mass spectrum: m/z = 485 (M+H)D
Rt (HPLC): 1 .71 min (method L)
Example 247 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- dlpyrimidine-6-carboxylic acid methyl ester
Chiral
Figure imgf000262_0001
A reaction mixture of 1 .00 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 1 .98 g intermediate XVIII and 0.071 g p-toluenesulfonic acid in 20 ml dioxane washeated at 100°C for 2 hours. The reation mixture was allowed to reach rt and diluted with water. The mixture was filtered. The solid was washed with water. The solid was dried in vacuo at 65°C.
Yield: 1 .75 g
ESI mass spectrum: m/z = 446 (M+H)D
Rt (HPLC): 2.41 min (method L)
Example 248 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- dlpyrimidine-6-carboxylic acid
Chiral
Figure imgf000262_0002
248.1 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid methyl ester
Chiral
Figure imgf000263_0001
Prepared analogously to 247 from 1 .00 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine- 6-carboxylic acid methyl ester and 1 .98 g intermediate XVIII.
248.2 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyhmidine-6-carboxylic acid
Chiral
Figure imgf000263_0002
A mixture of 1 .75 g 4-[4-fluoro-2-((1 R,2R)-2-methoxy-cyclohexyloxy)-phenylamino]-5- methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester, 4M sodium hydroxide solution, 20 ml THF and 20 ml MeOH was stirred at rt overnight.
The reaction mixture was acidified by addition of hydrochloric acid, diluted with 80 ml water and filtered. The solid was washed with water and dried in vacuo at 65°C.
Yield: 1 .575 g
ESI mass spectrum: m/z = 432 (M+H)D
Rt (HPLC): 2.05 min (method L)
Example 249 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- dlpyrimidine-6-carboxylic acid amide
Figure imgf000264_0001
249.1 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid methyl ester
Chiral
Figure imgf000264_0002
Prepared analogously to 247 from 1 .00 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidin 6-carboxylic acid methyl ester and 1 .98 g intermediate XVIII.
249.2 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyhmidine-6-carboxylic acid
Chiral
Figure imgf000264_0003
A mixture of 1 .75 g 4-[4-fluoro-2-((1 R,2R)-2-methoxy-cyclohexyloxy)-phenylamino]-5- methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester, 4M sodium hydroxide solution, 20 ml THF and 20 ml MeOH wAS stirred at rt overnight. The reaction mixture was acidified by addition of hydrochloric acid, diluted with 80 ml water and filtered. The solid was washed with water and dried in vacuo at 65°C.
Yield: 1 .575 g
ESI mass spectrum: m/z = 432 (M+H)D
Rt (HPLC): 2.05 min (method L)
249.3 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid amide
Figure imgf000265_0001
A mixture of 0.21 g 4-[4-Fluoro-2-((1 R,2R)-2-methoxy-cyclohexyloxy)-phenylamino]- 5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid, 5 ml ammonia 0,5 M in dioxane, 0.22 g HATU, 0.10 ml DIPEA and 2 ml DMF was stirred at rt overnight. The reaction mixture was diluted with water and filtered. The solid was dried in vacuo at 65°C. Yield: 0.21 1 g
ESI mass spectrum: m/z = 431 (M+H)D
Rt (HPLC): 1 .80 min (method L)
The following compounds were prepared analogously to 1 .4 using TBTU and TEA instead of HATU and DIPEA:
Figure imgf000265_0002
Example NR1 R2 educt Mass spectrum HPLC
(retention time)
H 0 1 .86 min
250 Cpd. 515 (M+H) D
249.2 (Method L) — ' racemic
H Chiral
1 .87 min
251 Cpd. 515 (M+H) D
0 249.2 (Method L)
H
I 2.05 min
252 Cpd. 505 (M+H) D
s
249.2 (Method L)
H .
1 .40 min
253 Cpd. 515 (M+H) D
(Method L) 249.2
1 .42 min
254 Cpd. 542 (M+H) D
(Method L) 249.2
H
I
255 s Cpd. 521 (M+H) D 3.67 min
0 249.2 (Method B)
Example 256
4-[4-fluoro-2-( s:::;-2-hvdroxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-dlpyrimidine-6-carboxylic acid methyl ester
(The absolute configuration has not been determined, i.e. the compound can be either the structure shown or the other enantiomer.) C iral
Figure imgf000267_0001
Prepared analogously to 247 from 0.437 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine- 6-carboxylic acid methyl ester and 0.410 g intermediate XXII.3.
Yield: 0.707 g
ESI mass spectrum: m/z = 432 (M+H) D
Rt (HPLC): 2.08 min (method L)
Example 257
: ; i 4-[4-fluoro-2-(- : ; -2-hvdroxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-dlpyhmidine-6-carboxylic acid methyl ester
(The absolute configuration has not been determined, i.e. the compound can be either the structure shown or the other enantiomer.)
Chiral
Figure imgf000267_0002
Prepared analogously to 247 from 0.451 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine- 6-carboxylic acid methyl ester and 0.420 g intermediate XXII.4
Yield: 0.783 g
ESI mass spectrum: m/z = 432 (M+H) D
Rt (HPLC): 2.03 min (method L) Example 258 Pure enantiomere of 4-[4-fluoro-2-(cis-2-hvdroxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-dlpyrimidine-6-carboxylic acid
(The absolute configuration has not been determined, i.e. the compound can be either the structure shown or the other enantiomer.)
C iral
Figure imgf000268_0001
Prepared analogously to 51 .2 from 0.630 g 4-[4-fluoro-2-( : : -2-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester (cpd. 256)
Yield: 0.594 g
ESI mass spectrum: m/z = 418 (M+H) D
Rt (HPLC): 1 .78 min (method L)
The following compounds were prepared analogously to 1 .4 using TBTU and TEA instead of HATU and DIPEA:
Figure imgf000268_0002
Figure imgf000268_0003
1 .31 min
260 Cpd. 258 528 (M+H) D
(Method L)
1 .44 min
261 Cpd. 258 502 (M+H) D
(Method L)
Example 262
Pure enantiomeres of 4-[4-fluoro-2-(cis-2-hvdroxy-cvclohexyloxy)-phenylamino1-5- methyl-thieno[2,3-dlpyhmidine-6-carboxylic acid
(The absolute configuration has not been determined, i.e. the compound can be either the structure shown or the other enantiomer.)
Chiral
Figure imgf000269_0001
Prepared analogously to 51 .2 from 0.72 g 4-[4-fluoro-2-(cis-2-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester (cpd. 257)
Yield: 0.585 g
ESI mass spectrum: m/z = 418 (M+H) D
Rt (HPLC): 1 .77 min (method L)
The following compounds were prepared analogously to 1 .4 using TBTU instead of HATU and no DIPEA:
Figure imgf000270_0001
Example NR1R2 educt Mass spectrum HPLC
(retention time)
1.32 min
263 Cpd.262 528 (M+H)D
(Method L)
1.33 min
264 Cpd.262 502 (M+H)D
(Method L)
The following compound was prepared analogously to 1.4 using TBTU and TEA instead of HATU and DIPEA:
l
Figure imgf000270_0002
Figure imgf000270_0003
Example 266 4-[2-(trans-4-hvdroxy-cvclohexyloxy)-pyrimidin-3-ylamino1-5-methyl-thien
dlpyrinnidine-6-carboxylic acid (2-hvdroxy-ethyl)-annide
Figure imgf000271_0001
266.1 4-[2-(trans-4-hvdroxy-cvclohexyloxy)-pyrimidin-3-ylamino1-5-methyl- thieno[2,3-dlpyrinnidine-6-carboxylic acid methylester
Figure imgf000271_0002
A reaction mixture of 2.913 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 2.5 g intermediate XXIV and 0.413 g p-toluenesulfonic acid in 60 ml dioxane was heated at 1 10°C in the microwave for 1 hour. The reaction mixture was concentrated and the residue was purified by chromatography.
Yield: 1 .547 g
ESI mass spectrum: m/z = 415 (M+H)D
266.2 4-[2-(trans-4-hvdroxy-cvclohexyloxy)-pyrimidin-3-ylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000271_0003
A reaction mixture of 1 .541 g 4-[2-(trans-4-hydroxy-cyclohexyloxy)-pyrimidin-3- ylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methylester, 2.00 g lithium hydroxide, 13.3 ml THF, 13.3 ml MeOH and 13.3 ml water was stirred at rt overnight. Then the mixture was acidified by addition of hydrochloric acid and extracted with DCM. The organic phase was dried, filtered and the filtrate was concentrated.
Yield: 1 .683 g
ESI mass spectrum: m/z = 401 (M+H) D
266.3 4-[2-(trans-4-hvdroxy-cvclohexyloxy)-pyrimidin-3-ylamino1-5-methyl- thieno[2,3-dlpyhmidine-6-carboxylic acid (2-hydroxy-ethyl)-amide
Figure imgf000272_0001
Prepared analogously to 1 .4 from 0.2 g 4-[4-fluoro-2-(cis-2-hydroxy-cyclohexyloxy)- phenylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid and 36 μΙ ethanolamine.
Yield: 0.051 g
ESI mass spectrum: m/z = 444 (M+H) D
Rt (HPLC): 2.27 min (method A)
The following compounds were repared analogously to 1 .4:
Figure imgf000272_0002
Figure imgf000272_0003
2.05 min
268 Cpd. 51 1 (M+H) D
(Method A) 266.3
1 .94 min
269 Cpd. 497 (M+H) D
(Method A) 266.3
H 1 .24 min
270 Cpd. 497 (M+H) D
(Method A) 266.3
Example 271
4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- dlpyrimidine-6-carboxylic acid [3-(2-oxo-pyrrolidin-1 -vD-propyll-amide
Figure imgf000273_0001
271 .1 4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000273_0002
A reaction mixture of 2.56 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid ethyl ester, 1 .86 g intermediate XXVII and 0.25 g p-toluenesulfonic acid in 50 ml dioxane was heated at 100°C for 1 .5 hours. At rt the reaction mixture was diluted with water. The mixture was filtered and the solid was washed with water. The solid was dried in vacuo at 50°C. To the solid was added 10 ml THF, 10 ml MeOH, 2 ml 2M sodium hydroxide solution. This mixture was stirred at rt overnight. The mixture was concentrated, neutralized with 2M hydrochloric acid and filtered. The solid was washed with water and and triturated with diethylether. The the solid was dried in vacuo at 50°C.
Yield: 2.14 g
ESI mass spectrum: m/z = 418 (M+H) D
Rt (HPLC): 2.05 min (method K)
271 .2 4-[4-Fluoro-2-(trans-4-hvdroxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid [3-(2-oxo-pyrrolidin-1 -vD-propyll-amide
Figure imgf000274_0001
Prepared analogously to 1 .4 from 0.042 g 4-[4-fluoro-2-(trans-4-hydroxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid_and and 0.015 g 1 -(3-aminopropyl)-2-pyrrolidinone. The residue was purified by chromatography.
Yield: 0.034 g
ESI mass spectrum: m/z = 542 (M+H) D
Rt (HPLC): 2.18 min (method method E) Example 272
2-({4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl-thieno[2,3- dlpyrimidine-6-carbonyl)-amino)-3-hvdroxy-propionic acid methyl ester
Chiral
Figure imgf000274_0002
272.1 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid methyl ester
Figure imgf000275_0001
A reaction mixture of 1 1 .2 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 10.0 g intermediate XXXXXVII and 1 .76 g p-toluenesulfonic acid in 95 ml dioxane was heated at 90°C 2 hours. The reaction mixture was poured in water and filtered. The solid was washed with water and dissolved in DCM. The organic phase was dried and then filtered. The filtrate was concentrated.
Yield: 15.914 g
ESI mass spectrum: m/z = 446 (M+H)
272.2 4-[4-Fluoro-2-(trans-4-methoxy-cvclohexyloxy)-phenylamino1-5-methyl- thieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000275_0002
Prepared analogously to 58.2 from 15.914 g 4-[4-fluoro-2-(trans-4-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester.
Yield: 14.54 g
ESI mass spectrum: m/z = 432 (M+H)D
272.3 Methyl (2S)-2-{[4-({4-fluoro-2-[(4-methoxycyclohexyl)oxy]phenyl}amino)-5- methylthieno[2,3-d]pyrimidin-6-yl]formamido}-3-hydroxypropanoate Chiral
Figure imgf000276_0001
Prepared analogously to 1 .4 from 1 .50 g 4-[4-fluoro-2-(trans-4-methoxy- cyclohexyloxy)-phenylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxyl
0.541 g L-(+)-serine methyl ester hydrochloride.
Yield: 1 .648 g
ESI mass spectrum: m/z = 533 (M+H) D
Rt (HPLC): 2.87 min (method A)
The following compounds were repared analogously to 1 .4:
Figure imgf000276_0002
Figure imgf000276_0003
The following compounds were prepared analogously to 1 .4 using TBTU instead of HATU:
Figure imgf000277_0001
Example 281
4-[2-(4-Amino-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3-dlpyrimidine-6- carboxylic acid methyl ester
Figure imgf000278_0001
A reaction mixture of 0.5 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 0.636 g intermediate XXXXXXIII and 0.04 g p-toluenesulfonic acid in 10 ml isopropanol was heated at 140°C in the microwave for 14 min. The reaction mixture was concentrated and the residue was purified by chromatography.
Yield: 0.36 g
ESI mass spectrum: m/z = 414 (M+H)D
Rt (HPLC): 1 .22 min (method K)
Example 282
4-[2-(4-Amino-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3-dlpyrim carboxylic acid
Figure imgf000278_0002
A mixture of 0.05 g 4-[2-(4-amino-cyclohexyloxy)-pyridin-3-ylamino]-5-methyl- thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester and 1 M sodium hydroxide solution in 5 ml MeOH was stirred at 70°C for 1 hour. The reaction mixture was neutralized with 1 M hydrochloric acid and concentrated. The residue was dissolved in DCM and MeOH, dried and filtered. The filtrate was concentrated. The residue was triturated with diethylether.
Yield: 0.048 g
ESI mass spectrum: m/z = 400 (M+H)D
Example 283
4-[2-(4-Amino-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3-dlpyrimidine-6- carboxylic acid amide
Figure imgf000279_0001
283.1 4-[2-(4- tert-Butoxycarbonylamino-cvclohexyloxy)-pyhdin-3-ylamino1-5- methyl-thieno[2,3-dlpyhmidine-6-carboxylic acid methyl ester
Figure imgf000279_0002
A reaction mixture of 0.2 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 0.506 g intermediate XXXXXXIII and 0.4 ml DIPEA in 6 ml
Isopropanol were heated at 140°C in the microwave for 7 hours. The reaction mixture was cooled down overnight and filtered. The solid was washed with diethylether, the residue was dissolved in DCM+MeOH, filtered and concentrated. Yield: 0.140 g
ESI mass spectrum: m/z = 514 (M+H) D
Rt (HPLC): 2.19 min (method K)
283.2 4-[2-(4-tert-Butoxycarbonylamino-cvclohexyloxy)-pyridin-3-ylamino1-5- methyl-thieno[2,3-dlpyrimidine-6-carboxylic acid
Figure imgf000280_0001
A mixture of 7 g 4-[2-(4- tert-butoxycarbonylamino-cyclohexyloxy)-pyridin-3-ylamino]- 5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester and 4M sodium hydroxide solution (60 ml) and 500 mg lithium hydroxide in 60 ml MeOH was stirred at 80°C for 5 hours.To the reaction mixture were added 65.2 ml 4M hydrochloric acid and the mixture was concentrated afterwards. The residue was triturated with water. The solid was isolated by filtration, washed with water.and dried in a desiccator.. Yield: 6.8 g
ESI mass spectrum: m/z = 500 (M+H) D 283.3 4-[2-(4-Amino-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3- dlpyrimidine-6-carboxylic acid amide
Figure imgf000281_0001
A mixture of 0.025 g 4-[2-(4-tert-butoxycarbonylamino-cyclohexyloxy)-pyridin-3- ylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid, 0.016 g TBTU, 17 μΙ DIPEA and 3 ml DMF/THF 1 :1 was stirred for 30 minutes at rt. 20 μΙ ammonia were added and the mixture was stirred overnight. The reaction mixture was concentrated and the residue was dissolved in DCM. The organic phase was washed with water, dried and filtered. The filtrate was concentrated. The residue was dissolved in 5 ml DCM, 1 ml trifluoroacetic acid was added and the mixture was stirred at rt for 1 hour. The reaction mixture was concentrated and the residue was purified by
chromatography.
Yield: 0.020 g
ESI mass spectrum: m/z = 399 (M+H)D
Rt (HPLC): 1 .75 min (method K)
The following compounds were prepared analogously to 283.3:
Figure imgf000281_0002
Figure imgf000281_0003
H
1 1 .39 min
284 Cpd. 283.2 427 (M+H) D
(Method K)
H
1 1 .82 min
285 Cpd. 283.2 413 (M+H) D
(Method A)
H
1 1 .14 min
286 Cpd. 283.2 455 (M+H) D
(Method M)
H 1 .08 min
287 Cpd. 283.2 441 (M+H) D
(Method M)
The following compounds were prepared analogously to 283.3 using DMF instead of DMF/THF:
Figure imgf000282_0001
Figure imgf000282_0002
Example 289
4-[2-(4-Amino-cvclohexyloxy)-pyridin-3-ylamino1-5-methyl-thieno[2,3-dlpyrimidine-6- carboxylic acid propyl amide
Figure imgf000283_0001
A mixture of 0.1 g 4-[2-(4-tert-butoxycarbonylamino-cyclohexyloxy)-pyridin-3- ylamino]-5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid, 39.689 μΙ chlor-trimethyl- propylenamine, 24 μΙ propylamine, 30.664 μΙ TEA and 5 ml DCM was stirred at rt overnight. The reaction mixture was washed successively with 0.1 M hydrochloric acid and 0.1 M sodium hydroxide solution, dried and filtered. The filtrate was concentrated. The residue was triturated with diethylether.
Yield: 0.050 g
ESI mass spectrum: m/z = 441 (M+H)D
Rt (HPLC): 1 .10 min (method M)
Example 290
4- [4-Fluoro-2-(tetrahvdro-cvclopenta [1 ,31dioxol-5-yloxy)phenylamino1- - methyl-thieno[2,3-dlpyhmidine-6-carboxylic acid
Figure imgf000283_0002
relative stereochemistry
290.1 4-[4-Fluoro-2-(tetrahvdro-cvclopenta [1 ,31dioxol-5-yloxy)phenylamino1- 5-methyl-thieno[2,3-dlpyhmidine-6-carboxylic acid methyl ester
Figure imgf000284_0001
relative stereochemistry
A reaction mixture of 1 .79 g 4-chloro-5-methyl-thieno[2,3d]_pyrimidine-6-carboxylic acid methyl ester, 1 .77 g intermediate XXXXVI and 0.422 g p-toluenesulfonic acid in 50 ml isopropanol was heated at 90°C for 2 hours. The reaction mixture was poured in water and filtered. The solid was washed with water, triturated with ACN and dried in vacuo at 60°C.
Yield: 72.2 g
ESI mass spectrum: m/z = 446 (M+H)D
Rt (HPLC): 3.30 min (method A)
290.2 4-[4-Fluoro-2-(tetrahvdro-cvclopenta [1 ,31dioxol-5-yloxy)phenylamino1- 5-methyl-thieno[2, -dlpyhmidine-6-carboxylic acid
Figure imgf000284_0002
relative stereochemistry
A reaction mixture of 2.1 g 4-[4-fluoro-2-(tetrahydro-cyclopenta [1 ,3]dioxol-5- yloxy)phenylamino]- 5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid methyl ester and 0.56g lithium hydroxide in 150 ml THF was stirred at rt overnight. Then the mixture was acidified by addition of 10 % citric acid, concentrated and filtered. The solid was dried in vacuo at 60°C.
Yield: 1 .79 g
ESI mass spectrum: m/z = 432 (M+H)D
Rt (HPLC): 3.02 min (method A)
Example 291
4-[4-Fluoro-2-(tetrahvdro-cvclopenta [1 ,31dioxol-5-yloxy)phenylamino1- 5-methyl-thieno[2,3-dlpynmidine-6-carboxylic acid (3-pyrrolidin-1 -yl-propyD-amide
Figure imgf000285_0001
relative stereochemistry
A mixture of 0.15 g 4-[4-fluoro-2-(tetrahydro-cyclopenta [1 ,3]dioxol-5- yloxy)phenylamino]- 5-methyl-thieno[2,3-d]pyrimidine-6-carboxylic acid, 0.045g 1 -(3- aminopropy)pyrrolidine, 0.159 g HATU and 0.097 ml TEA in 15 ml DMF was stirred at rt for 1 hour. The reaction mixture was poured on water, extracted with DCM, dried and filtered. The filtrate was concentrated. The residue was triturated with
diisopropylether.
Yield: 0.1 10 g
ESI mass spectrum: m/z = 542 (M+H) D
Rt (HPLC): 1 .28 min (method K)
The following compound was prepared analogously to 291 .3 :
Figure imgf000285_0002
relative stereochemistry
Figure imgf000285_0003
Example 293 (1 S.2S) 4-{2-[2-(Cvclopropanecarbonyl-annino)-cvclopentyloxy1-4-fluoro- phenylamino)-5-methyl thieno 2,3-dlpyrimidine-6-carboxylic acid amide
Chiral
Figure imgf000286_0001
0.15 g (1 S,2S) 4-[2-(2-amino-cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl thieno[2,3-d]pyrimidine-6-carboxylic acid amide and 0.45 ml N,N- diisopropylethylamine were mixed with DCM. 0.047 g cydopropanecarbonyl chloride were added to the mixture and stirred for 1 hour at rt. Then the reaction mixture was diluted with water and filtrated. The residue was dissolved in 3 ml dioxane and sodium-carbonate-solution and stirred at rt overnight.
To the mixture were added DCM and water. The mixture was filtrated and the solid was air-dried.
Yield: 0.093 g
ESI mass spectrum: m/z = 470 (M+H)D
Rt (HPLC): 1 .66 min (method L)
The following compound was prepared analogously to 293: Chiral
Figure imgf000286_0002
Figure imgf000286_0003
0 Cpd.
1 .66 min
294 460 (M+H)D
XXXXXXIV.6
(Method L)
Example 295
(1 S.2S) 4-{2-[2-(Acetyl-amino)-cvclopentyloxy1-4-fluoro-phenylamino)-5-methyl thieno[2,3-dlpyrimidine-6-carboxylic acid amide Chiral
Figure imgf000287_0001
0.15 g (1 S,2S) 4-[2-(2-amino-cyclopentyloxy)-4-fluoro-phenylamino]-5-methyl thieno[2,3-d]pyrimidine-6-carboxylic acid amide and 0.32 ml N,N- diisopropylethylamine were mixed with DCM. 0.027 g acetylchloride were added to the mixture and stirred for 1 hour at rt. Then the reaction mixture was diluted with water and filtrated. The solid was air-dried.
Yield: 0.14 g
ESI mass spectrum: m/z = 444 (M+H)D
Rt (HPLC): 1 .53 min (method L)

Claims

Claims
1 . A compound of general formula
Figure imgf000288_0001
wherein
X is CH or N,
R1 is a hydrogen or halogen atom,
R2 is C3-7 cycloalkyi group that is substituted with one or two substituents selected from oxo, halogen, Ch alky!, hydroxy, Ci-3 alkoxy, Ci-4 alkoxy-carbonyl, amino and morpholinyl, wherein the hydrogen atoms of the amino group may optionally be independently replaced by a Ch alky!, Ci-3 alkoxy-(CH2)m-, Ci-4 alkoxy- carbonyl, Ci-3 alkylsulfonyl, Ci-3 alkyl-carbonyl, C3-6-cycloalkyl-carbonyl or piperidinyl group, wherein m is 2 or 3 and wherein the piperidinyl group may optionally be substituted by a methyl group, wherein two substituents, which are attached to the same carbon atom, together may form a -O-(CH2)2-O- group, and wherein two substituents, which are attached to two adjacent carbon atoms, together may form a -O-CH2-O- or -O-C(CH3)2-O- group, R3 is a C1-2 alkyl group and
R4 is a carboxy, Ci-3 alkoxy-carbonyl, aminocarbonyl, N-(Ci-4 alkyl)-aminocarbonyl or N,N-[di-(Ci-4 alkyl)]-aminocarbonyl group, wherein the aminocarbonyl group may be substituted with a Ci-3 akylsulfonyl, CN, OH, Ci-3 alkoxy, C3-6 cycloalkyl, -CH2-C≡C-CH2-NH2, -CH2-C≡C-CH2- NH(Ci-3 alkyl) or -CH2-C≡C-CH2-N(Ci-3 alkyl)2 group or with a piperidinyl or pyrrolidinyl group bound via a carbon atom, and wherein the alkyl moieties of the above-mentioned N-(Ci-4 alkyl)-amino- carbonyl and N,N-[di-(Ci-4 alkyl)]-aminocarbonyl groups may optionally be substituted with an aminocarbonyl, N-(Ci-3 alkyl)-aminocarbonyl or N,N-[di-(Ci- 3 alkyl)]-aminocarbonyl group or with a pyrrolidinyl, oxazolyl, imidazolyl, piperidinyl or morpholinyl group, each bound via a carbon atom, or, from position 2 of an ethyl, propyl or butyl moiety onwards, with a OH, CN, Ci-3 alkoxy, amino, N-(Ci-3 alkyl)-amino, N,N-[di-(Ci-3 alkyl)]-amino, Ci-5 alkyloxy- carbonyl-amino, morpholino, piperidino, piperazino, pyrrolidino, azetedinyl, aziridinyl or imidazolyl group, wherein each of the above-mentioned cycloalkyl, pyrrolidinyl, oxazolyl, piperidinyl, morpholinyl, piperazinyl and imidazolyl groups may be substituted with a methyl, amino, hydroxy group or Ci-3 alkoxy, or a salt thereof.
2. A compound of formula (I) according to claim 1 , wherein X, R1, R2 and R4 are defined as in claim 1 and
R3 is methyl,
or a salt thereof.
3. A compound of formula (I) according to claim 1 or 2, wherein
R2 to R4 are defined as in claim 1 and
X is CH and
R1 is a fluorine atom,
or a salt thereof.
4. A compound of formula (I) according to claim 1 or 2, wherein
R2 to R4 are defined as in claim 1 and
X is N and
R1 is a hydrogen atom,
or a salt thereof.
5. A compound of formula (I) according to any of the preceding claims, wherein X and R1 to R3 are defined as in any one of claims 1 to 4, and R4 is carboxy, Ci-3 alkoxy-carbonyl, aminocarbonyl or N-(Ci-3 alkyl)-aminocarbonyl group, wherein the methyl moiety of the above-mentioned N-(methyl)-aminocarbonyl group may optionally be substituted with a piperidinyl, N-methyl-piperidinyl or morphohnyl group, each bound via a carbon atom, and wherein the ethyl resp. propyl moiety of the above-mentioned N-(C2-3 alkyl)-aminocarbonyl group may optionally be terminally substituted with hydroxy, methoxy, amino, N-methyl- amino, Ν,Ν-dimethyl-amino, morpholino, imidazolyl, 4-methyl-piperazinyl, 1 - methyl-pyrrolidinyl, piperidinyl, pyrrolidinyl or 4-hydroxy-piperidino group, or a salt thereof.
6. A compound of formula (I) according to claim 5, wherein
X and R1 to R3 are defined as in any one of claims 1 to 4, and R4 is aminocarbonyl or N-(Ci-3 alkyl)-aminocarbonyl group, wherein the methyl moiety of the above-mentioned N-(methyl)-aminocarbonyl group may optionally be substituted with a piperidinyl, N-methyl-piperidinyl or morpholinyl group, each bound via a carbon atom, and wherein the ethyl resp. propyl moiety of the above-mentioned N-(C2-3 alkyl)-aminocarbonyl group may optionally be terminally substituted with hydroxy, methoxy, amino, N-methyl- amino, Ν,Ν-dimethyl-amino, morpholino, imidazolyl, 4-methyl-piperazinyl, 1 - methyl-pyrrolidinyl, piperidinyl, pyrrolidinyl or 4-hydroxy-piperidino group, or a salt thereof.
7. A compound of formula (I) according to any of the preceding claims, wherein
X, R1, R3 and R4 are defined as in any one of claims 1 to 4, and R2 is cyclopentyl substituted with one or two hydroxy or methoxy groups or with an amino, methylcarbonyl-amino, N-methyl-N-methylcarbonyl-amino group or wherein two adjacent carbon atoms are linked to each other via a -O-CH2-O- or -O-C(CH3)2- O- group, or cyclohexyl substituted with one or two fluorine atoms or one or two hydroxy or methoxy groups or an oxo, Ci-3 alkoxy-carbonyl, morpholino, methyl-piperidinyl or an amino group, wherein the hydrogen atoms of the amino group my optionally independently be replaced with a methyl, methylcarbonyl, 2-methoxy-ethyl or methylsulfonyl group, or wherein two adjacent carbon atoms are linked to each other via-O-C(CH3)2-O- group or wherein two hydrogen atoms attached to the same carbon atom are replaced by a -O-(CH2)2-O- group, or a salt thereof.
8. A compound of formula (I) according to claim 7, wherein
X, R1, R3 and R4 are defined as in any one of claims 1 to 4, and
R2 is cyclohexyl substituted with one hydroxy or methoxy group, cyclopentyl substituted with one hydroxy, methoxy, methylcarbonyl-amino or N- methyl-N-methylcarbonyl-amino group or cyclopentyl, wherein two adjacent carbon atoms are linked to each other via a -O- CH2-O- group, or cyclobutyl substituted with a methylcarbonyl-annino or methylcarbonyl-N(methyl)- amino group,
or a salt thereof.
9. A compound of formula (I) according to claim 1 selected from:
Figure imgf000293_0001
Figure imgf000294_0001
or a salt thereof.
10. A pharmaceutically acceptable salt of a compound according to any one of claims 1 to 9.
1 1 . Pharmaceutical composition comprising a compound according to any one of claims 1 to 9 or a salt according to claim 10 and optionally a pharmaceutically acceptable carrier.
Pharmaceutical composition according to claim 1 1 further comprising additional therapeutic agent.
13. Pharmaceutical composition according to claim 12 wherein the additional
therapeutic agent is selected from an antidiabetic agent, a lipid lowering agent, a cardiovascular agent, an antihypertensive agent, a diuretic agent, a thrombocyte aggregation inhibitor, an antineoplastic agent or an anti-obesity agent.
Compound as defined in any one of claims 1 to 9 or a salt according to claim 10 for use in inhibiting the activity of the kinase activity of Mnk1 or Mnk2 (Mnk2a, Mnk2b) or variants thereof.
Compound as defined in any one of claims 1 to 9 or a salt according to claim 10 for use in the prophylaxis or therapy of metabolic diseases, hematopoietic disorders, neurodegenerative diseases, kidney damage, inflammatory disorders and cancer and their consecutive complications and diseases.
Compound according to any one of claims 1 to 9 or a salt according to claim 10 for use in the prophylaxis or therapy of metabolic diseases of the
carbohydrate and/or lipid metabolism and their consecutive complications and disorders.
Compound according to claim any one of claims 1 to 9 or a salt accord claim 10 for use in the prophylaxis or therapy of diabetes.
18. Compound according to any one of claims 14 to 17 for concomitant or sequential administration to a patient in combination with an additional therapeutic agent.
19. Compound as defined in any of claims 1 to 9 or a salt according to claim 10 for use in treating or preventing cytokine related disorders.
20. Compound according to claim 19 for concomitant or sequential administration to a patient in combination with an additional therapeutic agent.
21 . Compound according to claim 20, wherein the additional therapeutic agent is selected from a histamine antagonist, a bradikinin antagonist, serotonin antagonist, leukotriene, an anti-asthmatic, an NSAID, an antipyretic, a corticosteroid, an antibiotic, an analgetic, a uricosuric agent, chemotherapeutic agent, an anti gout agent, a bronchodilator, a cyclooxygenase-2 inhibitor, a steroid, a 5-lipoxygenase inhibitor, an immunosuppressive agent, a leukotriene antagonist, a cytostatic agent, an antineoplastic agent, a mTor inhibitor, a Tyrosine kinase inhibitor, antibodies or fragments thereof against cytokines and soluble parts (fragments) of cytokine receptors.
PCT/EP2011/052806 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions Ceased WO2011104334A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
EA201201191A EA201201191A1 (en) 2010-02-26 2011-02-25 4- [CYCLOALKYLOXY (HETERO) ARYLAMINO] THIENO [2,3-D] PYRIMIDINES THAT HAVE INHIBITING ACTIVITY WITH RESPECT TO MNKL / MNK2 INTENDED FOR PHARMACEUTICAL COMPOSITIONS
CA2791103A CA2791103A1 (en) 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2,3-d] pyrimidines having mnk1/ mnk2 inhibiting activity for pharmaceutical compositions
CN2011800209882A CN102858782A (en) 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions
BR112012021364A BR112012021364A2 (en) 2010-02-26 2011-02-25 "thienopyrimidines-containing cycloalkyl compounds and pharmaceutical compositions".
MX2012009735A MX2012009735A (en) 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions.
PH1/2012/501693A PH12012501693A1 (en) 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2,3 - d] pyrimidines having mnkl/mnk2 inhibiting activity for pharmaceutical compositions
EP11707386.6A EP2539345B1 (en) 2010-02-26 2011-02-25 4-[cycloalkyloxy(hetero)arylamino]-thieno[2,3-d]pyrimidines having mnk1/ mnk2 inhibiting activity for pharmaceutical compositions
ES11707386.6T ES2547905T3 (en) 2010-02-26 2011-02-25 4- [Cycloalkyloxy (hetero) arylamino] -thieno [2,3-d] pyrimidines having Mnk1 / Mnk2 inhibitory activity for pharmaceutical compositions
AU2011219758A AU2011219758A1 (en) 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having Mnkl/ Mnk2 inhibiting activity for pharmaceutical compositions
KR1020127022311A KR20130008538A (en) 2010-02-26 2011-02-25 4-[cycloalkyloxy (hetero) arylamino] thieno [2,3-d] pyrimidines having mnk1/mnk2 inhibiting activity for pharmaceutical compositions
JP2012554346A JP5575274B2 (en) 2010-02-26 2011-02-25 4- [Cycloalkyloxy (hetero) arylamino] thieno "2,3-D] pyrimidines having MNKL / MNK2 inhibitory activity for pharmaceutical compositions
IL221086A IL221086A0 (en) 2010-02-26 2012-07-24 4-[cycloalkyloxy (hetero) arylamino] thieno [2,3-d] pyrimidines having mnkl/mnk2 inhibiting activity for pharmaceutical compositions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP10154922 2010-02-26
EP10154922.8 2010-02-26

Publications (1)

Publication Number Publication Date
WO2011104334A1 true WO2011104334A1 (en) 2011-09-01

Family

ID=43799684

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/052806 Ceased WO2011104334A1 (en) 2010-02-26 2011-02-25 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions

Country Status (18)

Country Link
US (1) US8754079B2 (en)
EP (1) EP2539345B1 (en)
JP (1) JP5575274B2 (en)
KR (1) KR20130008538A (en)
CN (1) CN102858782A (en)
AR (1) AR080326A1 (en)
AU (1) AU2011219758A1 (en)
BR (1) BR112012021364A2 (en)
CA (1) CA2791103A1 (en)
CL (1) CL2012002317A1 (en)
EA (1) EA201201191A1 (en)
ES (1) ES2547905T3 (en)
IL (1) IL221086A0 (en)
MX (1) MX2012009735A (en)
PH (1) PH12012501693A1 (en)
TW (1) TW201141872A (en)
UY (1) UY33246A (en)
WO (1) WO2011104334A1 (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8486953B2 (en) 2008-08-26 2013-07-16 Boehringer Ingelheim International Gmbh Thienopyrimidines for pharmaceutical compositions
WO2013174735A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Substituted benzothienopyrimidines
WO2013174744A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines
US8633201B2 (en) 2006-04-07 2014-01-21 Boehringer Ingelheim International Gmbh Thienopyrimidines having Mnk1/Mnk2 inhibiting activity for pharmaceutical compositions
US8648068B2 (en) 2010-02-26 2014-02-11 Boehringer Ingelheim International Gmbh Heterocycloalkyl-containing thienopyrimidines for pharmaceutical compositions
US8697713B2 (en) 2006-07-10 2014-04-15 Boehringer Ingelheim International Gmbh Pyrrolopyrimidines for pharmaceutical compositions
US8754079B2 (en) 2010-02-26 2014-06-17 Boehringer Ingelheim International Gmbh Cycloalkyl containing thienopyrimidines for pharmaceutical compositions
WO2014118229A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted thienopyrimidines and pharmaceutical use thereof
WO2014118226A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted pyrazolopyrimidinylamino-indazoles
US8853193B2 (en) 2010-02-26 2014-10-07 Boehringer Ingelheim International Gmbh Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
WO2015074986A1 (en) * 2013-11-20 2015-05-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines as mknk1 and mknk2 inhibitors
WO2015100282A1 (en) 2013-12-24 2015-07-02 Bristol-Myers Squibb Company Tricyclic compounds as anticancer agents
US9382255B2 (en) 2012-09-20 2016-07-05 Bayer Pharma Aktiengesellschaft Substituted pyrrolopyrimidinylamino-benzothiazolones as MKNK kinase inhibitors
WO2017085483A1 (en) * 2015-11-20 2017-05-26 Medical Research Council Technology Pyrropyrimidine compounds as mnks inhibitors
US9675612B2 (en) 2013-03-06 2017-06-13 Bayer Pharma Aktiengesellschaft Substituted thiazolopyrimidines
US10167296B2 (en) 2014-05-07 2019-01-01 Evotec International Gmbh Sulfoximine substituted quinazolines for pharmaceutical compositions

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1899353A1 (en) * 2005-06-22 2008-03-19 DeveloGen Aktiengesellschaft Thienopyrimidines for pharmaceutical compositions
MX2012009869A (en) 2010-02-26 2012-09-12 Japan Tobacco Inc DERIVED FROM 1, 3,4, 8-TETRAHIDRO-2H-PIRIDO [1, 2-A] PIRAZINA AND ITS USE AS AN INHIBITOR OF THE INTEGRESS OF HIV.
US9550072B2 (en) * 2012-08-03 2017-01-24 Cerca Solutions, LLC Diagnostic device, therapeutic device, and uses thereof
GB201520500D0 (en) * 2015-11-20 2016-01-06 Medical Res Council Technology Compounds
WO2019023651A2 (en) * 2017-07-28 2019-01-31 Massachusetts Institute Of Technology Small molecule modulators of the androgen receptor
BR112022026275A2 (en) * 2020-06-30 2023-03-14 4E Therapeutics Inc PYRIDINE-1,5-DIONES THAT EXHIBIT MNK INHIBITION AND THEIR METHODS OF USE
CN115638916B (en) * 2022-10-18 2024-01-23 广州众纳科技有限公司 Device and detection method for sensing human body pressure of wearable product

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002103361A1 (en) 2001-06-18 2002-12-27 Biovitrum Ab Method for identification of agents for the treatment of diabetes
WO2003003762A2 (en) 2001-06-29 2003-01-09 Bwa Technology, Inc. Frequency re-used for point to multipoint applications
WO2003037362A2 (en) 2001-10-29 2003-05-08 DeveloGen Aktiengesellschaft für entwicklungsbiologische Forschung Mnk kinase homologous proteins involved in the regulation of energy homeostasis and organelle metabolism
WO2005000385A1 (en) 2003-05-19 2005-01-06 Sutton William R Monitoring and control of sleep cycles
WO2006066937A2 (en) 2004-12-23 2006-06-29 Develogen Aktiengesellschaft Mnk1 or mnk2 inhibitors
WO2006136402A1 (en) 2005-06-22 2006-12-28 Develogen Aktiengesellschaft Thienopyrimidines for pharmaceutical compositions
WO2007059905A2 (en) * 2005-11-25 2007-05-31 Develogen Aktiengesellschaft Thienopyrimidines treating inflammatory diseases
WO2007115822A1 (en) 2006-04-07 2007-10-18 Develogen Aktiengesellschaft Thienopyrimidines having mnkl /mnk2 inhibiting activity for pharmaceutical compositions
WO2008006547A2 (en) 2006-07-10 2008-01-17 Develogen Aktiengesellschaft Pyrrolopyrimidines for pharmaceutical compositions
WO2010023181A1 (en) * 2008-08-26 2010-03-04 Boehringer Ingelheim International Gmbh Thienopyrimidines for pharmaceutical compositions

Family Cites Families (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CH408945A (en) 1956-02-10 1966-03-15 Ciba Geigy Process for the preparation of heterocyclic compounds
DE3036390A1 (en) 1980-09-26 1982-05-13 Troponwerke GmbH & Co KG, 5000 Köln Antiinflammatory intermediate 7H-pyrrolo-(2,3-D)-pyrimidine derivs. - prepd. by dealkylation of 7-phenyl:ethyl derivs. by reaction with hydrochloric, phosphoric or poly:phosphoric acid
DD248593A1 (en) 1985-01-11 1987-08-12 Univ Halle Wittenberg PROCESS FOR PREPARING 4-BASED SUBSTITUTED THIENO / 2,3-D / PYRIMIDIN-6-YLCARBOXYANESEESTERS
DE4008726A1 (en) 1990-03-19 1991-09-26 Basf Ag Thieno-(2,3-D)pyrimidine derivs. - are plant growth regulators, herbicides and pesticides, esp. insecticides
EP0452002A3 (en) 1990-03-30 1992-02-26 Dowelanco Thienopyrimidine derivatives
TW444018B (en) 1992-12-17 2001-07-01 Pfizer Pyrazolopyrimidines
IL112249A (en) * 1994-01-25 2001-11-25 Warner Lambert Co Pharmaceutical compositions containing di and tricyclic pyrimidine derivatives for inhibiting tyrosine kinases of the epidermal growth factor receptor family and some new such compounds
DE59500788D1 (en) * 1994-05-03 1997-11-20 Ciba Geigy Ag Pyrrolopyrimidine derivatives with antiproliferative activity
EP0729758A3 (en) 1995-03-02 1997-10-29 Pfizer Pyrazolopyrimidines and pyrrolopyrimidines to treat neuronal disorders and other diseases
US6395733B1 (en) * 1995-06-07 2002-05-28 Pfizer Inc Heterocyclic ring-fused pyrimidine derivatives
AR004010A1 (en) 1995-10-11 1998-09-30 Glaxo Group Ltd HETERO CYCLIC COMPOUNDS
WO1999024440A1 (en) 1997-11-11 1999-05-20 Pfizer Products Inc. Thienopyrimidine and thienopyridine derivatives useful as anticancer agents
US20030162795A1 (en) * 1998-10-22 2003-08-28 Pfizer Inc. Thienopyrimidine and thienopyridine derivatives useful as anticancer agents
GB9906566D0 (en) * 1999-03-23 1999-05-19 Zeneca Ltd Chemical compounds
HK1045306A1 (en) 1999-06-03 2002-11-22 Abbott Laboratories Cell adhesion-inhibiting antiinflammatory compounds
JP2002020386A (en) * 2000-07-07 2002-01-23 Ono Pharmaceut Co Ltd Pyrazolopyridine derivative
CN101100472A (en) 2001-04-30 2008-01-09 美国拜尔公司 4-amino-5,6-substituted thiopheno [2,3-D] pyrimidines compound and its uses
WO2004037159A2 (en) 2002-10-23 2004-05-06 Obetherapy Biotechnology Compounds, compositions and methods for modulating fat metabolism
CA2527496C (en) 2003-05-28 2012-08-14 Francesco Bondavalli 4-substituted derivatives of pyrazolo [3,4-d] pyrimidine and pyrrolo [2,3-d] pyrimidine and uses thereof
EP1641804A1 (en) 2003-06-20 2006-04-05 Celltech R & D Limited Thienopyridone derivatives as kinase inhibitors
CA2530281C (en) 2003-07-24 2013-02-12 Bayer Pharmaceuticals Corporation Substituted tetrahydrobenzothienopyrimidinamine compounds useful for treating hyper-proliferative disorders
US7419978B2 (en) 2003-10-22 2008-09-02 Bristol-Myers Squibb Company Phenyl-aniline substituted bicyclic compounds useful as kinase inhibitors
AU2005204358B2 (en) * 2004-01-05 2008-09-04 Merz Pharma Gmbh & Co. Kgaa Memantine for the treatment of mild and mild-to-moderate Alzheimer's disease
WO2005080377A1 (en) 2004-02-20 2005-09-01 Kirin Beer Kabushiki Kaisha COMPOUND HAVING TGF-β INHIBITORY ACTIVITY AND PHARMACEUTICAL COMPOSITION CONTAINING SAME
US20080269238A1 (en) * 2004-04-01 2008-10-30 Takeda Pharmaceutical Company Limited Thiazolopyrimidine Derivative
GB0412467D0 (en) 2004-06-04 2004-07-07 Astrazeneca Ab Chemical compounds
WO2006014325A2 (en) 2004-07-02 2006-02-09 Exelixis, Inc. C-met modulators and method of use
US7943357B2 (en) 2005-03-08 2011-05-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Crystallographic structure of Mnk-1 and Mnk-2 proteins
WO2006124874A2 (en) 2005-05-12 2006-11-23 Kalypsys, Inc. Inhibitors of b-raf kinase
JP5148499B2 (en) 2005-05-20 2013-02-20 メチルジーン インコーポレイテッド Inhibitors of VEGF receptor and HGF receptor signaling
US20070099877A1 (en) * 2005-11-02 2007-05-03 Cytovia, Inc. N-aryl-thienopyrimidin-4-amines and analogs as activators of caspases and inducers of apoptosis and the use thereof
WO2007056214A2 (en) 2005-11-02 2007-05-18 Cytovia, Inc N-alkyl-n-aryl-thienopyrimidin-r-amines and uses thereof
US7915411B2 (en) 2005-12-21 2011-03-29 Abbott Laboratories Anti-viral compounds
US20080108611A1 (en) 2006-01-19 2008-05-08 Battista Kathleen A Substituted thienopyrimidine kinase inhibitors
KR20080107466A (en) * 2006-03-09 2008-12-10 파마코페이아, 인코포레이티드 8-Heteroarylpurine MN2 Inhibitor for Treatment of Metabolic Disorders
US20080039450A1 (en) 2006-06-22 2008-02-14 Jensen Annika J Compounds
US20100247517A1 (en) * 2007-11-22 2010-09-30 Boehringer Ingelheim Internationational GmbH Use of mnk inhibitors for the treatment of alzheimer's disease
ES2734288T3 (en) * 2007-11-28 2019-12-05 Dana Farber Cancer Inst Inc Bcr-abl small molecule myristate inhibitors and methods of use
WO2009093662A1 (en) * 2008-01-25 2009-07-30 Sharp Kabushiki Kaisha Mobile station device and program
WO2009104027A1 (en) * 2008-02-19 2009-08-27 Vichem Chemie Kutató Kft Therapeutic application of triciclic aromatic and saturated benzo(4,5)thieno-(2,3-d)pyrimidine derivates, as well as their therapeutically acceptable salts
US20100015708A1 (en) * 2008-06-18 2010-01-21 Mdrna, Inc. Ribonucleic acids with non-standard bases and uses thereof
UY33241A (en) * 2010-02-26 2011-09-30 Boehringer Ingelheim Int ? Tienopyrimidines containing heterocycloalkyl for pharmaceutical compositions ?.
US20130065914A1 (en) * 2010-02-26 2013-03-14 Boehringer Ingelheim International Gmbh Halogen or cyano substituted thieno [2,3-d]pyrimidines having mnk1/mnk2 inhibiting activity for pharmaceutical compositions
EA201201191A1 (en) 2010-02-26 2013-04-30 Бёрингер Ингельхайм Интернациональ Гмбх 4- [CYCLOALKYLOXY (HETERO) ARYLAMINO] THIENO [2,3-D] PYRIMIDINES THAT HAVE INHIBITING ACTIVITY WITH RESPECT TO MNKL / MNK2 INTENDED FOR PHARMACEUTICAL COMPOSITIONS
AR080328A1 (en) 2010-02-26 2012-03-28 Boehringer Ingelheim Int TIENOPIRIMIDINES CONTAINING A SUBSTITUTED RENTING GROUP, INHIBITORS OF MNK1 AND / OR MNK2 QUINASES, PHARMACEUTICAL COMPOSITIONS CONTAINING THEM AND USE OF THE SAME FOR THE TREATMENT OF METABOLIC DISORDERS SUCH AS DIABETES AND OTHERS
DK2567807T3 (en) * 2011-09-07 2016-08-22 Nordex Energy Gmbh A process for producing a rotor blade-construction part for a wind power plant and of a previously prepared headband

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002103361A1 (en) 2001-06-18 2002-12-27 Biovitrum Ab Method for identification of agents for the treatment of diabetes
WO2003003762A2 (en) 2001-06-29 2003-01-09 Bwa Technology, Inc. Frequency re-used for point to multipoint applications
WO2003037362A2 (en) 2001-10-29 2003-05-08 DeveloGen Aktiengesellschaft für entwicklungsbiologische Forschung Mnk kinase homologous proteins involved in the regulation of energy homeostasis and organelle metabolism
WO2005000385A1 (en) 2003-05-19 2005-01-06 Sutton William R Monitoring and control of sleep cycles
WO2006066937A2 (en) 2004-12-23 2006-06-29 Develogen Aktiengesellschaft Mnk1 or mnk2 inhibitors
WO2006136402A1 (en) 2005-06-22 2006-12-28 Develogen Aktiengesellschaft Thienopyrimidines for pharmaceutical compositions
WO2007059905A2 (en) * 2005-11-25 2007-05-31 Develogen Aktiengesellschaft Thienopyrimidines treating inflammatory diseases
WO2007115822A1 (en) 2006-04-07 2007-10-18 Develogen Aktiengesellschaft Thienopyrimidines having mnkl /mnk2 inhibiting activity for pharmaceutical compositions
WO2008006547A2 (en) 2006-07-10 2008-01-17 Develogen Aktiengesellschaft Pyrrolopyrimidines for pharmaceutical compositions
WO2010023181A1 (en) * 2008-08-26 2010-03-04 Boehringer Ingelheim International Gmbh Thienopyrimidines for pharmaceutical compositions

Non-Patent Citations (40)

* Cited by examiner, † Cited by third party
Title
"A Textbook of Druq Desiqn and Development", 1991, GORDON & BREACH, article "Design and Applications of Prodrugs"
"Bioreversible Carriers in Druq Desiqn", 1987, ELSEVIER
"Burqer's Medicinal Chemistry and Druq Discovery", vol. 1, 1995, JOHN WILEY & SONS, pages: 172 - 178,949-
"Desiqn of Prodruqs", 1985
"Methods in Enzvmoloqv", vol. 42, 1985, ACADEMIC PRESS, pages: 309 - 396
"Pro-Druqs as Novel Delivery Systems", 1975, AM. CHEM. SOC.
"Prodruqs: Topical and Ocular Druq Delivery", 1998, MARCEL DEKKER
"Remington's Pharmaceutical Sciences", 1991, MACK PUBLISHING CO.
BARNHART; SIMON, J CLIN INVEST., vol. 117, no. 9, 2007, pages 2385 - 8
BBA, vol. 1488, 2000, pages 124 - 138
BUXADE ET AL., IMMUNITY, vol. 23, August 2005 (2005-08-01), pages 177 - 189
CONTI; DIGIOACCHINO, ALLERGY ASTHMA PROC, vol. 22, no. 3, 2001, pages 133 - 7
CULJKOVIC ET AL., J CELL BIOL., vol. 175, no. 3, 2006, pages 415 - 26
DE BENEDETTI; GRAFF, ONCOGENE, vol. 23, no. 18, 2004, pages 3189 - 99
DIABETES, vol. 48, 1999, pages 1836 - 1841
EMBO J., vol. 16, 1997, pages 1909 - 1920
FUKUNAGA; HUNTER, EMBO J, vol. 16, no. 8, 1997, pages 1921 - 1933
GENETICS, vol. 156, no. 3, 2000, pages 1219 - 1230
GENOMICS, vol. 69, 2000, pages 63
GRAFF ET AL., J CLIN INVEST., vol. 117, no. 9, 2007, pages 2638 - 48
GRAFF, CANCER RES., vol. 68, no. 3, 2008, pages 631 - 4
J. CELL SCI., vol. 110, no. 2, 1997, pages 209 - 219
JAMA, vol. 288, 2002, pages 2209 - 2716
KHABAR, J, INTERF CYTOKINE RES, vol. 25, 2005, pages 1 - 10
KNAUF ET AL., MOL CELL BIOL., vol. 21, no. 16, August 2001 (2001-08-01), pages 5500 - 11
LADA, DIABETES CARE., vol. 8, 2001, pages 1460 - 1467
MOL CELL BIOL RES COMM, vol. 3, 2000, pages 205
MOL CELL BIOL, vol. 19, 1990, pages 1871 - 1880
MOL CELL BIOL, vol. 21, 2001, pages 743 - 754
MOL CELL BIOL, vol. 22, 2001, pages 5500 - 5511
MOL CELL BIOL, vol. 24, 2004, pages 6539 - 6549
MOL. CELL. BIOL., vol. 21, 2001, pages 5500
NIKOLCHEVA ET AL., J CLIN INVEST, vol. 110, 2002, pages 119 - 126
RUGGERO ET AL., NAT MED., vol. 10, no. 5, May 2004 (2004-05-01), pages 484 - 6
SCHEPER ET AL., MOL CELL BIOL., vol. 21, no. 3, February 2001 (2001-02-01), pages 743 - 54
TOPISIROVIC ET AL., CANCER RES., vol. 64, no. 23, 2004, pages 8639 - 42
UEDA ET AL., MOL CELL BIOL, vol. 24, no. 15, 2004, pages 6539 - 6549
UEDA ET AL., MOL CELL BIOL., vol. 24, no. 15, 2004, pages 6539 - 49
WENDEL ET AL., GENES DEV., vol. 21, no. 24, 2007, pages 3232 - 7
WENDEL ET AL., NATURE, vol. 428, no. 6980, 2004, pages 332 - 7

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8633201B2 (en) 2006-04-07 2014-01-21 Boehringer Ingelheim International Gmbh Thienopyrimidines having Mnk1/Mnk2 inhibiting activity for pharmaceutical compositions
US8697713B2 (en) 2006-07-10 2014-04-15 Boehringer Ingelheim International Gmbh Pyrrolopyrimidines for pharmaceutical compositions
US8486953B2 (en) 2008-08-26 2013-07-16 Boehringer Ingelheim International Gmbh Thienopyrimidines for pharmaceutical compositions
US8648068B2 (en) 2010-02-26 2014-02-11 Boehringer Ingelheim International Gmbh Heterocycloalkyl-containing thienopyrimidines for pharmaceutical compositions
US8754079B2 (en) 2010-02-26 2014-06-17 Boehringer Ingelheim International Gmbh Cycloalkyl containing thienopyrimidines for pharmaceutical compositions
US8853193B2 (en) 2010-02-26 2014-10-07 Boehringer Ingelheim International Gmbh Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
US9296757B2 (en) 2012-05-21 2016-03-29 Bayer Pharma Aktiengesellschaft Substituted benzothienopyrimidines
WO2013174735A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Substituted benzothienopyrimidines
WO2013174744A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines
US9540392B2 (en) 2012-05-21 2017-01-10 Bayer Pharma Aktiengesellschaft Thienopyrimidines
US9382255B2 (en) 2012-09-20 2016-07-05 Bayer Pharma Aktiengesellschaft Substituted pyrrolopyrimidinylamino-benzothiazolones as MKNK kinase inhibitors
US9556181B2 (en) 2013-02-01 2017-01-31 Bayer Pharma Aktiengesellschaft Substituted pyrazolopyrimidinylamino-indazoles
WO2014118226A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted pyrazolopyrimidinylamino-indazoles
WO2014118229A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted thienopyrimidines and pharmaceutical use thereof
US9675612B2 (en) 2013-03-06 2017-06-13 Bayer Pharma Aktiengesellschaft Substituted thiazolopyrimidines
WO2015074986A1 (en) * 2013-11-20 2015-05-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines as mknk1 and mknk2 inhibitors
WO2015100282A1 (en) 2013-12-24 2015-07-02 Bristol-Myers Squibb Company Tricyclic compounds as anticancer agents
EP3466949A1 (en) 2013-12-24 2019-04-10 Bristol-Myers Squibb Company Tricyclic compound as anticancer agents
US10167296B2 (en) 2014-05-07 2019-01-01 Evotec International Gmbh Sulfoximine substituted quinazolines for pharmaceutical compositions
WO2017085483A1 (en) * 2015-11-20 2017-05-26 Medical Research Council Technology Pyrropyrimidine compounds as mnks inhibitors
US10604524B2 (en) * 2015-11-20 2020-03-31 Life Arc Pyrropyrimidine compounds as MNKs inhibitors
EP3792264A1 (en) * 2015-11-20 2021-03-17 LifeArc Pyrropyrimidine compounds as mnks inhibitors

Also Published As

Publication number Publication date
IL221086A0 (en) 2012-09-24
US8754079B2 (en) 2014-06-17
CN102858782A (en) 2013-01-02
US20110217311A1 (en) 2011-09-08
EA201201191A1 (en) 2013-04-30
PH12012501693A1 (en) 2012-11-05
BR112012021364A2 (en) 2016-10-25
CA2791103A1 (en) 2011-09-01
ES2547905T3 (en) 2015-10-09
MX2012009735A (en) 2012-09-12
CL2012002317A1 (en) 2012-11-30
UY33246A (en) 2011-09-30
EP2539345A1 (en) 2013-01-02
AU2011219758A1 (en) 2012-08-16
AR080326A1 (en) 2012-03-28
EP2539345B1 (en) 2015-07-22
TW201141872A (en) 2011-12-01
JP2013520471A (en) 2013-06-06
JP5575274B2 (en) 2014-08-20
KR20130008538A (en) 2013-01-22

Similar Documents

Publication Publication Date Title
US8754079B2 (en) Cycloalkyl containing thienopyrimidines for pharmaceutical compositions
EP2539346B1 (en) 4-[heterocycloalkyloxy(hetero)arylamino] thieno[2,3-d]pyrimidines having mnk1/ mnk2 inhibiting activity for pharmaceutical compositions
EP2539344B1 (en) Halogen or cyano substituted thieno[2,3-d]pyrimidines having mnk1/ mnk2 inhibiting activity for pharmaceutical compositions
US8853193B2 (en) Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
US8486953B2 (en) Thienopyrimidines for pharmaceutical compositions
EP1889847A1 (en) Pyrrolopyrimidines for pharmaceutical compositions
AU2015257917A1 (en) Sulfoximine substituted quinazolines for pharmaceutical compositions

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180020988.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11707386

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011707386

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011219758

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 221086

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2011219758

Country of ref document: AU

Date of ref document: 20110225

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012002317

Country of ref document: CL

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/009735

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2791103

Country of ref document: CA

Ref document number: 20127022311

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012554346

Country of ref document: JP

Ref document number: 7378/DELNP/2012

Country of ref document: IN

Ref document number: 12012501693

Country of ref document: PH

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 201201191

Country of ref document: EA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012021364

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012021364

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120824