WO2007059905A2 - Thienopyrimidines treating inflammatory diseases - Google Patents

Thienopyrimidines treating inflammatory diseases Download PDF

Info

Publication number
WO2007059905A2
WO2007059905A2 PCT/EP2006/011081 EP2006011081W WO2007059905A2 WO 2007059905 A2 WO2007059905 A2 WO 2007059905A2 EP 2006011081 W EP2006011081 W EP 2006011081W WO 2007059905 A2 WO2007059905 A2 WO 2007059905A2
Authority
WO
WIPO (PCT)
Prior art keywords
thieno
pyrimidin
yl
phenyl
amine
Prior art date
Application number
PCT/EP2006/011081
Other languages
French (fr)
Other versions
WO2007059905A3 (en
WO2007059905A9 (en
Inventor
Steven Taylor
Steven Murfin
Thomas Stephen Coulter
Stefan JÄKEL
Babette Aicher
Arndt-Rene Kelter
Joachim Krämer
Christian Kirchhoff
Andreas Scheel
Julian WÖLKE
Original Assignee
Develogen Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP05025772 priority Critical
Priority to EP05025772.4 priority
Application filed by Develogen Aktiengesellschaft filed Critical Develogen Aktiengesellschaft
Publication of WO2007059905A2 publication Critical patent/WO2007059905A2/en
Publication of WO2007059905A3 publication Critical patent/WO2007059905A3/en
Publication of WO2007059905A9 publication Critical patent/WO2007059905A9/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine, rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine, rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/411Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria

Abstract

The present invention relates to the use of thienopyrimidine compounds for the production of pharmaceutical compositions for the treatment of inflammatory diseases.

Description

Novel Use of Thienopyrimidines

The present invention relates to the use of thienopyrimidine compounds for the production of pharmaceutical compositions for the prophylaxis and/or treatment of inflammatory diseases which can be influenced by the inhibition of the kinase activity of Mnk1 (Mnkia or MnKIb) and/or Mnk2 (Mnk2a or Mnk2b) or further variants thereof. Particularly, the present invention relates to the use of thienopyrimidine compounds for the production of pharmaceutical compositions for the prophylaxis and/or therapy of cytokine related diseases.

Such diseases are i.a. inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, neurodegenerative diseases, allergies, or other conditions associated with proinflammatory cytokines.

Allergic and inflammatory diseases such as acute or chronic inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, asthma and septic shock and their consecutive complications and disorders associated therewith.

Inflammatory diseases like rheumatoid arthritis, inflammatory lung diseases like COPD, inflammatory bowel disease and psoriasis afflict one in three people in the course of their lives. Not only do those diseases impose immense health care costs, but also they are often crippling and debilitating. Although inflammation is the unifying pathogenic process of these inflammatory diseases below, the current treatment approach is complex and is generally specific for any one disease. Many of the current therapies available today only treat the symptoms of the disease and not the underlying cause of inflammation.

The compositions of the present invention are useful for the treatment and/or prophylaxis of inflammatory diseases and consecutive complications and disorders, such as chronic or acute inflammation, inflammation of the joints such as chronic inflammatory arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, Reiter's syndrome, rheumatoid traumatic arthritis, rubella arthritis, acute synovitis and gouty arthritis; inflammatory skin diseases such as sunburn, psoriasis, erythroderma psoriasis, pustular psoriasis, eczema, dermatitis, acute or chronic graft formation, atopic dermatitis, contact dermatitis, urticaria and scleroderma; inflammation of the gastrointestinal tract such as inflammatory bowel disease, Crohn's disease and related conditions, ulcerative colitis, colitis, and diverticulitis; nephritis, urethritis, salpingitis, oophoritis, endomyometritis, spondylitis, systemic lupus erythematosus and related disorders, multiple sclerosis, asthma, meningitis, myelitis, encephalomyelitis, encephalitis, phlebitis, thrombophlebitis, respiratory diseases such as asthma, bronchitis, chronic obstructive pulmonary disease (COPD), inflammatory lung disease and adult respiratory distress syndrome, and allergic rhinitis; endocarditis, osteomyelitis, rheumatic fever, rheumatic pericarditis, rheumatic endocarditis, rheumatic myocarditis, rheumatic mitral valve disease, rheumatic aortic valve disease, prostatitis, prostatocystitis, spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis; Hashimoto's thyroiditis, Kawasaki's disease, Raynaud's phenomenon, Sjogren's syndrome, neuroinflammatory disease, sepsis, conjubctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglottitis, bronchitis, pneumonitis, stomatitis, gingivitis, oesophagitis, gastritis, peritonitis, hepatitis, cholelithiasis, cholecystitis, glomerulonephritis, goodpasture's disease, crescentic glomerulonephritis, pancreatitis, endomyometritis, myometritis, metritis, cervicitis, endocervicitis, exocervicitis, parametritis, tuberculosis, vaginitis, vulvitis, silicosis, sarcoidosis, pneumoconiosis, pyresis, inflammatory polyarthropathies, psoriatric arthropathies, intestinal fibrosis, bronchiectasis and enteropathic arthropathies.

Moreover, cytokines are also believed to be implicated in the production and development of various cardiovascular and cerebrovascular disorders such as congestive heart disease, myocardial infarction, the formation of atherosclerotic plaques, hypertension, platelet aggregation, angina, stroke, Alzheimer's disease, reperfusion injury, vascular injury including restenosis and peripheral vascular disease, and, for example, various disorders of bone metabolism such as osteoporosis (including senile and postmenopausal osteoporosis), Paget's disease, bone metastases, hypercalcaemia, hyperparathyroidism, osteosclerosis, osteoporosis and periodontitis, and the abnormal changes in bone metabolism which may accompany rheumatoid arthritis and osteoarthritis.

Excessive cytokine production has also been implicated in mediating certain complications of bacterial, fungal and/or viral infections such as endotoxic shock, septic shock and toxic shock syndrome and in mediating certain complications of CNS surgery or injury such as neurotrauma and ischaemic stroke.

Excessive cytokine production has, moreover, been implicated in mediating or exacerbating the development of diseases involving cartilage or muscle resorption, pulmonary fibrosis, cirrhosis, renal fibrosis, the cachexia found in certain chronic diseases such as malignant disease and acquired immune deficiency syndrome (AIDS), tumour invasiveness and tumour metastasis and multiple sclerosis. The treatment and or prophylaxis of these diseases are also contemplated by the present inevention

Additionally, the inventive compositions may be used to treat inflammation associated with autoimmune diseases including, but not limited to, systemic lupus erythematosis, Addison's disease, autoimmune polyglandular disease (also known as autoimmune polyglandular syndrome), glomerulonephritis, rheumatoid arthritis scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, diabetes, autoimmune hemolytic anemia, glomerulonephritis, rheumatoid arthritis autoimmune neutropenia, thrombocytopenia, atopic dermatitis, chronic active hepatitis, myasthenia gravis, multiple sclerosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, psoriasis, and graft vs. host disease.

In a further embodiment the compositions of the present invention may be used for the treatment and prevention of infectious diseases such as sepsis, septic shock, Shigellosis, and Heliobacter pylori and viral diseases including herpes simplex type 1 (HSV-1), herpes simplex type 2 (HSV-2), cytomegalovirus, Epstein-Barr, human immunodeficiency virus (HIV), acute hepatitis infection (including hepatitis A, hepatits B, and hepatitis C), HIV infection and CMV retinitis, AIDS or malignancy, malaria, mycobacterial infection and meningitis. These also include viral infections, by influenza virus, varicella-zoster virus (VZV), Epstein-Barr virus, human herpesvirus-6 (HHV-6), human herpesvirus-7 (HHV-7), human herpesvirus-8 (HHV-8), pseudorabies and rhinotracheitis.

The compositions of the present invention may also be used topically in the treatment or prophylaxis of topical disease states mediated by or exacerbated by excessive cytokine production, such as by IL-1 or TNF respectively, such as inflamed joints, eczema, psoriasis and other inflammatory skin conditions such as sunburn; inflammatory eye conditions including conjunctivitis; pyresis, pain and other conditions associated with inflammation.

Periodontal disease has also been implemented in cytokine production, both topically and systemically. Hence use of compositions of the present invention to control the inflammation associated with cytokine production in such peroral diseases such as gingivitis and periodontitis is another aspect of the present invention.

Finally the compositions of the present invention may also be used to treat or prevent neurodegenerative disease selected from Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington's disease, cerebral ischemia or neurodegenerative disease caused by traumatic injury, glutamate neurotoxicity or hypoxia.

In a preferred embodiment the compositions of the present invention may be used to treat or prevent a disease selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn's disease, ulcerative colitis, multiple sclerosis and asthma.

Protein kinases are important enzymes involved in the regulation of many cellular functions. The LK6-serine/threonine-kinase gene of Drosophila melanogaster was described as a short-lived kinase which can associate with microtubules (J. Cell Sci. 1997, 110(2): 209-219). Genetic analysis in the development of the compound eye of Drosophila suggested a role in the modulation of the RAS signal pathway (Genetics 2000 156(3): 1219-1230). The closest human homologues of Drosophila LK6-kinase are the MAP-kinase interacting kinase 2 (Mnk2, e.g. the variants Mnk2a and Mnk2b) and MAP-kinase interacting kinase 1 (Mnk1) and variants thereof. These kinases are mostly localized in the cytoplasm. Mnks are phosphorylated by the p42 MAP kinases Erk1 and Erk2 and the p38- MAP kinases. This phosphorylation is triggered in a response to growth factors, phorbol esters and oncogenes such as Ras and Mos, and by stress signaling molecules and cytokines. The phosphorylation of Mnk proteins stimulates their kinase activity towards eukaryotic initiation factor 4E (elF4E) (EMBO J. 16: 1909- 1920, 1997; MoI Cell Biol 19, 1871-1880, 1990; MoI Cell Biol 21 , 743-754, 2001). Simultaneous disruption of both, the Mnk1 and Mnk2 gene in mice diminishes basal and stimulated elF4E phosphorylation (MoI Cell Biol 24, 6539-6549, 2004). Phosphorylation of elF4E results in a regulation of the protein translation (MoI Cell Biol 22: 5500-5511 , 2001).

There are different hypotheses describing the mode of the stimulation of the protein translation by Mnk proteins. Most publications describe a positive stimulatory effect on the cap-dependent protein translation upon activation of MAP kinase-interacting kinases. Thus, the activation of Mnk proteins can lead to an indirect stimulation or regulation of the protein translation, e.g. by the effect on the cytosolic phospholipase 2 alpha (BBA 1488:124-138, 2000).

WO 03/037362 discloses a link between human Mnk genes, particularly the variants of the human Mnk2 genes, and diseases which are associated with the regulation of body weight or thermogenesis. It is postulated that human Mnk genes, particularly the Mnk2 variants are involved in diseases such as e.g. metabolic diseases including obesity, eating disorders, cachexia, diabetes mellitus, hypertension, coronary heart disease, hypercholesterolemia, dyslipidemia, osteoarthritis, biliary stones, cancer of the genitals and sleep apnea, and in diseases connected with the ROS defense, such as e.g. diabetes mellitus and cancer. WO 03/03762 moreover discloses the use of nucleic acid sequences of the MAP kinase-interacting kinase (Mnk) gene family and amino acid sequences encoding these and the use of these sequences or of effectors of Mnk nucleic acids or polypeptides, particularly Mnk inhibitors and activators in the diagnosis, prophylaxis or therapy of diseases associated with the regulation of body weight or thermogenesis.

WO 02/103361 describes the use of kinases 2a and 2b (Mnk2a and Mnk2b) interacting with the human MAP kinase in assays for the identification of pharmacologically active ingredients, particularly useful for the treatment of diabetes mellitus type 2. Moreover, WO 02/103361 discloses also the prophylaxis and/or therapy of diseases associated with insulin resistance, by modulation of the expression or the activity of Mnk2a or Mnk2b. Apart from peptides, peptidomimetics, amino acids, amino acid analogues, polynucleotides, polynucleotide analogues, nucleotides and nucleotide analogues, 4- hydroxybenzoic acid methyl ester are described as a substance which binds the human Mnk2 protein.

Inhibitors of Mnk (referred to as CGP57380 and CGP052088) have been described (cf. MoI. Cell. Biol. 21 , 5500, 2001 ; MoI Cell Biol Res Comm 3, 205, 2000; Genomics 69, 63, 2000). CGP052088 is a staurosporine derivative having an IC5Q of 70 nM for inhibition of in vitro kinase activity of Mnk1. CGP57380 is a low molecular weight selective, non-cytotoxic inhibitor of Mnk2 (Mnk2a or Mnk2b) or of Mnk1 : The addition of CGP57380 to cell culture cells, transfected with Mnk2 (Mnk2a or Mnk2b) or Mnk1 showed a strong reduction of phosphorylated elF4E.

First evidence for a role of Mnks in inflammation was provided by studies demonstrating activation of Mnk1 by proinflammatory stimuli. The cytokines TNFα and IL-1β trigger the activation of Mnk1 in vitro (Fukunaga and Hunter, EMBO J 16(8): 1921-1933, 1997) and induce the phosphorylation of the Mnk- specific substrate elF4E in vivo (Ueda et al., MoI Cell Biol 24(15): 6539-6549, 2004). In addition, administration of lipopolysaccharide (LPS), a potent stimulant of the inflammatory response, induces activation of Mnk1 and Mnk2 in mice, concomitant with a phosphorylation of their substrate elF4E (Ueda et al., MoI Cell Biol 24(15): 6539-6549, 2004).,

Further more, Mnk1 has been shown to be involved in regulating the production of proinflammatory cytokines. Mnk1 enhances expression of the chemokine RANTES (Nikolcheva et al., J Clin Invest 110, 119-126, 2002). RANTES is a potent chemotractant of monocytes, eosinophils, basophiles and, natural killer cells. It activates and induces proliferation of T lymphocytes, mediates degranulation of basophils and induces the respiratory burst in eosinophils (Conti and DiGioacchino, Allergy Asthma Proc 22(3): 133-7, 2001)

WO 2005/00385 and Buxade et al., Immunity 23: 177-189, August 2005 both disclose a link between Mnks and the control of TNFα biosynthesis. The proposed mechanism is mediated by a regulatory AU-rich element (ARE) in the TNFα mRNA. Buxade et al. demonstrate proteins binding and controlling ARE function to be phosphorylated by Mnk1 and Mnk2. Specifically Mnk-mediated phosphorylation of the ARE-binding protein hnRNP A1 has been suggested to enhance translation of the TNFα mRNA.

TNFα is not the only cytokine regulated by an ARE. Functional AREs are also found in the transcripts of several interleukins, interferones and chemokines (Khabar, J lnterf Cytokine Res 25: 1-10, 2005). The Mnk-mediated phosphorylation of ARE-binding proteins has thus the potential to control biosynthesis of cytokines in addition to that of TNFα.

Current evidence demonstrates Mnks as down stream targets of inflammatory signalling as well as mediators of the inflammatory response. Their involvement in the production of TNFα, RANTES, and potentially additional cytokines suggests inhibition of Mnks as strategy for anti-inflammatory therapeutic intervention.

The problem underlying the present invention is to provide potent and selective Mnk1 and/or Mnk2 inhibitors which may effectively and safely be used for the treatment of inflammatory diseases and their consecutive complication and disorders.

It has now been surprisingly found that certain thienopyrimidine compounds may be useful in the prophylaxis and/or therapy of inflammatory diseases which can be influenced by the inhibition of the kinase activity of Mnk1 and/or Mnk2 (Mnk2a or Mnk2b) and/or variants thereof.

Thus the present invention provides the use of thienopyrimidine compounds of the general formula (1):

Figure imgf000009_0001
wherein X is O, S, SO2, CH2, CHR13, CR1aRib, CH(halogen), C(halogen)2, C=O, C(O)NRi3, NH or NR1a, wherein R1a and Rib are Ci-6 alkyl, Ci-6 alkyl C3-I0 cycloalkyl, 03.10 cycloalkyl, Ci-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, wherein Ri3 and Rib are optionally substituted with one or more R9;

Ri is hydrogen, Ci-6 alkyl, Ci-6 alkyl C3-I0 cycloalkyl, C3-I0 cycloalkyl, Ci-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, C6-i0 aryl, Ci_e alkyl C6-i0 aryl, C5-I0 heteroaryl comprising at least one heteroatom selected from N1 S and O, Ci_e alkyl C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, wherein R1 is optionally substituted with one or more Rg;

or if X is NRia, CHRi3, C(O)NRi3 or CRiaRib, Ri may form a carbocyclic or heterocyclic ring with Ri3 and the N or C atom to which they are attached, which may contain one or more additional heteroatoms selected from N, S and O, which may be substituted with one or more Rg;

R2 and R3 are the same or different and are independently selected from hydrogen, Ci-6 alkyl, Ci-6 alkyl C3-io cycloalkyl, C3-io cycloalkyl, C6.i0 aryl, Ci_e alkyl C6-I0 aryl, Cs-io heteroaryl comprising at least one heteroatom selected from N, S and O, Ci_β alkyl C5-io heteroaryl comprising at least one heteroatom selected from N, S and O, Ci-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, or together with the C atoms that they are attached to form a C3-7 cycloalkyl or a 3 to 10 membered heterocycloalkyl group, wherein R2 and R3 are optionally substituted with one or more Rg, R2 may also be Rg and R3 may also be R10;

R4 is hydrogen, C1-4 alkyl, urea, thiourea or acetyl optionally substituted with one or more Rg; or R4 may form a 5 or 6 membered heterocyclic ring with X;

R5 and R7 are the same or different and are independently selected from hydrogen, halogen; CN; COOR11; OR11; C(O)N(R11R113); S(O)2N(R11R113); S(O)N(R11R119); S(O)2R11; N(R11)S(O)2N(R113RHb); SR11; N(R11R113); OC(O)R11; N(R1-I)S(O)2R113; N(R11)S(O)R113; OC(O)N(R11R113); oxo (=0), where the ring is at least partially saturated; C(O)Ri1; C1-6 alkyl; phenyl; C3-7 cycloalkyl; or heterocyclyl, wherein C1-6 alkyl; phenyl; C3-7 cycloalkyl; and heterocyclyl are optionally substituted with one or more R10;

R6 and R8 are the same or different and are independently selected from hydrogen or Rg;

R9 is independently halogen; CN; COORi1; ORn; C(O)N(R11R113); S(O)2N(R11R113); S(O)N(R11R113); S(O)2R11; N(R11)S(O)2N(R113RHb); SR11; N(R11R113); OC(O)R11; N(R11)C(O)R113; N(R11)S(O)2R113; N(R11)S(O)R113; N(R11)C(O)N(R113RHb); N(Rn)C(O)OR113; OC(O)N(R11R113); oxo (=0), where the ring is at least partially saturated; C(O)R11; Ci-6 alkyl; phenyl; C3-7 cycloalkyl; or heterocyclyl, wherein C1-6 alkyl; phenyl; C3-7 cycloalkyl; and heterocyclyl are optionally substituted with one or more R10;

R10 is independently halogen; CN; OR11; S(O)2N(Ri1R113); S(O)N(R11Ri13); S(O)2R11; N(R11)S(O)2N(R113R1Ib); SRn; N(RnRna); OC(O)R11; N(R11)C(O)R113; N(R11)S(O)2R113; N(R11)S(O)Rn3; N(RiI)C(O)N(Rn3R1 Ib); N(R11)C(O)OR113; OC(O)N(R11R1-Ia); oxo (=0), where the ring is at least partially saturated; C(O)R11; C1-6 alkyl; phenyl; C3-7 cycloalkyl; or heterocyclyl, wherein Ci-6 alkyl; phenyl; C3-7 cycloalkyl; and heterocyclyl are optionally substituted with one or more Rg;

Rii> Riia, Rub are independently selected from the group consisting of hydrogen, Ci-6 alkyl, Ci-6 alkyl C3-10 cycloalkyl, C3-10 cycloalkyl, C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, C6-io aryl, 5 to 10 membered heteroaryl comprising at least one heteroatom selected from N, S and O, wherein R11, R118, R11b are optionally substituted with one or more Rg;

or a metabolite, prodrug or a pharmaceutically acceptable salt thereof for the preparation of a pharmaceutical composition for the treatment and/or prophylaxix of inflammatory diseases.

The use of compounds in which X is O, S, SO2, CH2, CHRia, CRiaRit>. CH(halogen), C(halogen)2, C=O, C(O)NR13, NH or NRia, wherein R1a and R1b are C-I-6 alkyl, C1-6 alkyl C3--I0 cycloalkyl, C3-10 cycloalkyl, C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, wherein R13 and R1b are optionally substituted with one or more R9;

R1 is hydrogen, Ci-6 alkyl, C1-6 alkyl C3-1O cycloalkyl, C3-10 cycloalkyl, Ci-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, C6-I0 aryl, Ci_5 alkyl C6-I0 aryl, C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, Ci_β alkyl C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, wherein Ri is optionally substituted with one or more Rg;

or if X is NRia, CHRi3, C(O)NRia or CRiaRib) Ri may form a carbocyclic or heterocyclic ring with Ri3 and the N or C atom to which they are attached, which may contain one or more additional heteroatoms selected from N, S and O, which may be substituted with one or more R9;

R2 and R3 are the same or different and are independently selected from hydrogen, methyl, phenyl, ethyl, propyl, perfluoromethyl, or form together with the C atoms to which they are attached a 5-membered carbocyclic ring; R4 is hydrogen or Ci_4 alkyl;

R5. RΘ, R7 and Rs are the same or different and are independently selected from hydrogen, CONH2, CO2H, CO2CH3, Cl and F;

R9 is as defined above;

or a metabolite, prodrug or pharmaceutically acceptable salt thereof are preferred.

Also preferred is the use of compounds in which X is O, S, SO2, CH2, CHRi3, CRiaRib, CH(halogen), C(halogen)2, C=O, C(O)NR18, NH or NRia, wherein R18 and R-ib are C-ι-6 alkyl;

Ri is hydrogen, methyl, ethyl, propyl, butyl, difluoromethyl, bromoethyl, 1 ,1 ,2,2- tetrafluoroethyl, 1 ,1 ,1 -trifluoropropyl, perfluoromethyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, norbonanyl, tetrahydrofuranyl, tetrahydropyranyl, phenyl or pyrrolidin-3-yl substituted at the nitrogen with Rg;

or if X is NRia, R1 forms a morpholino group, a pyrrolidino group or a piperidino group together with R1a and the N atom to which they are attached, which may be substituted with -CH3 or -C(O)OC4H9;

R2 and R3 are the same or different and are independently selected from hydrogen, methyl, phenyl, ethyl, propyl, perfluoromethyl, or form together with the C atoms to which they are attached a 5-membered carbocyclic ring;

R4 is hydrogen or C1-4 alkyl;

R5, Re, R7 and R8 are the same or different and are independently selected from hydrogen, CONH2, CO2H, CO2CH3, Cl and F;

R9 is as defined above; or a metabolite, prodrug or pharmaceutically acceptable salt thereof.

The use of compounds wherein R2 and R3 are the same or different and are selected from methyl, hydrogen and perfluoromethyl is more preferred.

The present invention also relates to the use of compounds in which X is O, S, SO2, CH2, CHR13, CRiaRib, CH(halogen), C(halogen)2, C=O, C(O)NR13, NH or NR1a, wherein Ri3 and R-ιb are Ci-6 alkyl;

R1 is hydrogen, Ci-6 alkyl, C1-6 alkyl C3-10 cycloalkyl, C3.10 cycloalkyl, 5 to 10 membered heterocyclyl comprising at least one heteroatom selected from N, S and O, C6-10 aryl, C-i-β alkyl C6-10 aryl, C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, C1-^ alkyl Cs-I0 heteroaryl comprising at least one heteroatom selected from N, S and O, wherein R1 is optionally substituted with one or more Rg;

or if X is NR13, R1 may form a heterocyclic ring together with R13 and the N atom to which they are attached, which may contain an additional heteroatom selected from N, S and O, which may be substituted with one or more Rg;

R2 and R3 are the same or different and are independently selected from hydrogen, C1-4 alkyl which may optionally be substituted with one or more halogen atoms, an acetyl group, a urea, a hydroxyl, a phenyl group and an amino group or form together with the C atoms to which they are attached a C3-6 cycloalkyl group;

R4 is hydrogen or C1^ alkyl;

R5, Re, R7 and Re are the same or different and are independently selected from hydrogen, CO2H, CO2R1c, CONH2, CONHR1d and halogen, whereby R1c and R1d are C1-6 alkyl; Rg is as defined above;

with the proviso that if R3 is H or Ci-4 alkyl, R2 cannot be hydrogen;

or a metabolite, prodrug or pharmaceutically acceptable salt thereof.

The use of compounds in which R4 is hydrogen is preferred as well as the use of compounds in which X represents O and/or compounds in which the cycloalkyl group is adamantyl or norbonanyl, cyclohexyl or cyclopentyl.

The compounds used in accordance with the present invention may contain a halogen atom preferable selected from Cl, Br and F.

In one aspect, the present invention relates to the use of compounds in which R5, Re, R7 and Re are hydrogen and, in another aspect, to the use of compounds in which at least one of R5, Re, R7 and R8 represents F, CONH2 or CO2CH3.

In a preferred embodiment, the compounds used in accordance with the present invention contain a Ri group which is selected from hydrogen, methyl, ethyl, propyl, butyl, difluoromethyl, bromoethyl, 1 ,1 ,2,2-tertrafluoroethyl, 1 ,1 ,1- trifluoropropyl, perfluoromethyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, norbonanyl, tetrahydrofuranyl, tetrahydropyranyl, phenyl or pyrrolidin- 3-yl substituted at the nitrogen with R9, wherein Rg is as defined above.

Particularly preferred compounds are selected from:

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]- amine,

(5,6-Dimethyl-thieno[2>3-d]pyrimidin-4-yl)-[2-((R)-tetrahydro-furan-3-yloxy)- phenyl]-amine,

(δ.e-Dimethyl-thieno^.S-dlpyrimidin^-yO-p-CCSJ-tetrahydro-furan-S-yloxy)- phenyl]-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]-amine, (2-Cyclopentyloxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-pyran-4-yloxy)-phenyl]- amine,

(2-sec-Butoxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-lsopropoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(5)6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((R)-tetrahydro-furan-3-yloxy)-phenyl]- amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-pyran-4-yloxy)-phenyl]- amine,

(2-sec-Butoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

4-(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-methoxy-benzamide,

(2-Cyclopropylmethoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy-phenyl)-amine,

(2-Ethoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

3-Methoxy-4-(5-methyl-thieno[2,3-d] pyrimidin-4-ylamino)-benzamide,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((S)-tetrahydro-furan-3-yloxy)-phenyl]- amine,

(2-Cyclohexyloxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-teAt-Butoxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-ethoxy-phenyl)-amine,

(2-Cyclohexyloxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propoxy-phenyl)-amine,

(2,4-Dimethoxy-phenyl)-(6-phenyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Methoxy-phenyl)-(5,6,7,8-tetrahydro-benzo[4,5]thieno[2,3-d]pyrimidin-4-yl)- amine, (2-Cyclopentyloxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-annine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1-ethyl-pyrrolidin-3-yloxy)-phenyl]- amine,

(2-fe/t-Butoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methylsulfanyl-phenyl)-amine,

(2-Methylsulfanyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine)

(3-Chloro-2-methoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Difluoromethoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-annine,

[2-(1-Ethyl-pyrrolidin-3-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine,

(S-Methyl-thienop.S-dJpyrimidin^-ylJ-p^i .i ^^-tetrafluoro-ethoxyJ-phenyl]- amine,

(2-sec-Butoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,

(2-Ethoxy-phenyl)-(6-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Cyclopentyloxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isobutoxy-phenyl)-amine,

(2-lsopropoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,

(2-Difluoromethoxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Cyclohexyloxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,

(2-lsobutoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(δ.e-Dimethyl-thieno^.S-dlpyrimidin^-yO-^i .i ^^-tetrafluoro-ethoxyJ-phenyl]- amine,

3-Methoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,

(6-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]-amine,

[2-(Tetrahydro-furan-3-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,

[2-(Adamantan-2-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

[2-((S)-Tetrahydro-furan-3-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine, [2-(Adamantan-2-yloxy)-phenyl]-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-anrιine, (5-Chloro-2-methoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-ferf-Butoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-Morpholin-4-yl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, [2-(Tetrahydro-pyran-4-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine, (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy-phenyl)-amine, (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isobutylsulfanyl-phenyl)-amine, (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-trifluoromethoxy-phenyl)-amine, (2-Ethoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-Methylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propyl-phenyl)-amine, (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropyl-phenyl)-amine, (2-Methoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-ethyl-phenyl)-amine, ^-(Bicyclop^.iJhept^-yloxyJ-phenyll-thieno^.S-dlpyrimidin^-yl-amine, [2-(Adamantan-2-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine, (2-Methoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-lsobutoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-Methoxy-phenyl)-(6-methyl-thieno[2,3-d]pyrimidin-4-yl)-annine, (2-sec-Butyl-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Piperidin-1-yl-phenyl)-thieno[2)3-d]pyrimidin-4-yl-amine, [2-(Adamantan-1-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-lsobutylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, 2-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenol, (3-Chloro-2-methoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-sec-Butyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-sec-Butyl-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (6-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]-amine, (2-Bromo-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Cyclohexylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-Phenoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, 2-(Thieno[2,3-d]pyrimidin-4-ylamino)-phenol,

(2-lsobutylsulfanyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-lsopropoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

[2-(Tetrahydro-furan-3-yloxy)-phenyl]-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4- yl)-amine,

(6-lsopropyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]- amine,

(6-lsopropyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,

(6-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy-phenyl)-amine,

(2-Methanesulfonyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine)

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy-phenyl)-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-piperidin-1-yl-phenyl)-amine,

(6-lsopropyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,

(2-sec-Butoxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Cyclopentylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,

[2-(eπdo-Bicyclo[2.2.1]hept-2-yloxy)-phenyl]-(5,6-dimethyl-thieno[2,3-d]pyrimidin- 4-yl)-amine,

[2-(endo-Bicyclo[2.2.1]hept-2-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,

[2-(e/7do-Bicyclo[2.2.1]hept-2-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-ylmethoxy)- phenyl]-amine, ^-(Tetrahydro-furan-S-ylmethoxyJ-phenyll-thienoP.S-dlpyrimidin^-yl-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-ylmethoxy)-phenyl]- amine,

(2-lsopropoxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(1 ,2-Dimethyl-propoxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine, (2-Cyclopentyloxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(1 ,2-Dimethyl-propoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

[2-(1 ,2-Dimethyl-propoxy)-phenyl]-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)- amine,

2,6-Dimethyl-4-[2-(thieno[2,3-d]pyrimidin-4-ylannino)-phenyl]-piperazine-1- carboxylic acid tert-butyl ester,

[δ-Fluoro^-Ctetrahydro-furan-S-yloxyJ-phenylJ^S-methyl-thieno^.S-dJpyrimidin^- yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[5-fluoro-2-(tetrahydro-furan-3-yloxy)- phenyl]-amine,

[5-Fluoro-2-(tetrahydro-furan-3-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,

(2-Cyclopentyloxy-phenyl)-(6-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Methoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Ethoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-lsopropoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-sec-Butoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

3-(Tetrahydro-furan-3-yloxy)-4-(thieno[2,3-d]pyrimidin-4-ylamino)- benzoic acid methyl ester,

4-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-(tetrahydro-furan-3-yloxy)- benzoic acid methyl ester,

4-(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-(tetrahydro-furan-3-yloxy)- benzoic acid methyl ester, S-^etrahydro-furan-S-yloxyH^thienop.S-^pyrimiclin^-ylaminoJ-benzamicle,

Λ/-lsopropyl-Λ/'-thieno[2,3-d]pyrimidin-4-yl-benzene-1 ,2-diamine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methanesulfonyl-phenyl)-amine,

[2-(Tetrahydro-furan-3-yloxy)-phenyl]-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4- yl)-amine,

(2-Cyclopentyloxy-phenyl)-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

2,6-Dimethyl-4-[2-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenyl]-piperazine- 1-carboxylic acid tert-butyl ester,

(2-Ethoxy-5-fluoro-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-sec-Butoxy-phenyl)-(5-trifluoromethyl-thieno[2I3-d]pyrimidin-4-yl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1-ethyl-2-methyl-propoxy)-phenyl]- amine,

3-[2-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenoxy]-pyrrolidine-1- carboxylic acid tert-butyl ester,

3-[2-(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenoxy]-pyrrolidine-1- carboxylic acid tert-butyl ester,

[2-(3,5-Dimethyl-piperazin-1-yl)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine,

(2-Pyrrolidin-1-yl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-pyrrolidin-1-yl-phenyl)-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-pyrrolidin-1-yl-phenyl)-amine,

(2-Cyclopentyloxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

Λ/-lsopropyl-Λ/'-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-benzene-1 ,2-diamine,

Λ/-Cyclopentyl-Λ/'-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-benzene-1 ,2-diamine,

A/-sec-Butyl-Λ/l-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-benzene-1 ,2-diamine,

(6-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,

(2-Ethoxy-phenyl)-(6-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-sec-Butoxy-phenyl)-(6-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Ethoxy-5-fluoro-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Ethoxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

[2-(1-Ethyl-2-methyl-propoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine,

(6-Methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)- phenyl]-amine,

(2-lsopropoxy-phenyl)-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(1-Ethyl-2-methyl-propoxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine, Thieno[2,3-d]pyrimidin-4-yl-[2-(3,3,3-trifluoro-propoxy)-phenyl]-amine, (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(3,3,3-trifluoro-propoxy)-phenyl]-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(3,3,3-trifluoro-propoxy)-phenyl]- amine,

(5-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy-phenyl)-amine,

(2-sec-Butoxy-phenyl)-(5-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-Cyclopentyloxy-phenyl)-(5-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

[2-(3-Ethoxy-propoxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(3-ethoxy-propoxy)-phenyl]-amine,

(5-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]-amine,

3-Ethoxy-4-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,

3-lsopropoxy-4-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,

3-sec-Butoxy-4-(5-methyl-thieno[2)3-d]pyrimidin-4-ylamino)-benzamide,

3-Cyclopentyloxy-4-(5-methyl-thieno β.S-dtøyrimidin^-ylaminoJ-benzamide,

4-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-(tetrahydro-furan-3-yloxy)- benzamide,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[3-fluoro-2-(tetrahydro-furan-3-yloxy)- phenyl]-amine, [2-(3-Ethoxy-propoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(2-Ethoxy-ethoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(2-Ethoxy-ethoxy)-phenyl]-thieno [2,3-d]pyrimidin-4-yl-amine, (5)6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(2-ethoxy-ethoxy)-phenyl]-amine, 3-Ethoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, 3-lsopropoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, 3-sec-Butoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, 3-Cyclopentyloxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,

3-(Tetrahydro-furan-3-yloxy)-4-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4- ylamino)-benzamide,

(2,3-Dihydro-1 H-8-thia-5,7-diaza-cyclopenta[a]inden-4-yl)-(2-methoxy-phenyl)- amine,

[2-(exo-Bicyclo[2.2.1]hept-2-yloxy)-phenyl]-(5,6-dimethyl-thieno[2l3-d]pyrimidin-4- yl)-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((R)-tetrahydro-furan-3-yloxy)-phenyl]- amine,

(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-morpholin-4-yl-phenyl)-amine,

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy-phenyl)-amine,

(2-Ethyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

(2-lsopropyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,

[2-(2-Bromo-ethoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, and

(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propyl-phenyl)-amine.

Typical methods of preparing the compounds of the invention are described below in the experimental section.

The potent inhibitory effect of the compounds of the invention may be determined by in vitro enzyme assays as described in the Examples in more detail. Pharmaceutically acceptable salts of the compounds of the invention of formula (1) can be formed with numerous organic and inorganic acids and bases. Exemplary acid addition salts including acetate, adipate, alginate, ascorbate, aspartate, benzoate, benzenesulfonate, bisulfate, borate, butyrate, citrate, camphorate, camphersulfonate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethane sulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethane sulfonate, lactate, maleate, methane sulfonate, 2-naphthalene sulfonate, nicotinate, nitrate, oxalate, pamoate, pectinate, persulfate, 3-phenyl sulfonate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate, succinate, sulfate, sulfonate, tartrate, thiocyanate, toluene sulfonate such as tosylate, undecanoate, or the like.

Basic nitrogen-containing moieties can be quatemized with such agents as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chloride, bromide and iodide; dialkyl sulfates like dimethyl, diethyl, dibutyl, and diamyl sulfates, long- chain alkyl halides such as decyl, lauryl, myristyl and stearyl chloride, bromide and iodide, or aralkyl halides like benzyl and phenethyl bromides, or others. Water soluble or dispersible products are thereby obtained.

Pharmaceutically acceptable basic addition salts include but are not limited to cations based on the alkaline and alkaline earth metals such as sodium, lithium, potassium, calcium, magnesium, aluminum salts and the like, as well as non toxic ammonium quarternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine and the like. Other representative amines useful for the formation of base addition salts include benzazethine, dicyclohexyl amine, hydrabine, N-methyl-D-glucamine, N-methyl- D-glucamide, t-butyl amine, diethylamine, ethylendiamine, ethanolamine, diethanolamine, piperazine and the like and salts with amino acids such as arginine, lysine, or the like. Compounds of the formula (1) can be present as tautomers. The present invention comprises all tautomeric forms. Furthermore, the present invention also comprises all stereoisomers of the compounds according to the invention, including its enantiomers and diastereomers. Individual stereoisomers of the compounds according to the invention can be substantially present pure of other isomers, in admixture thereof or as racemates or as selected stereoisomers.

As used herein the term "metabolite" refers to (i) a product of metabolism, including intermediate and products, (ii) any substance involved in metabolism (either as a product of metabolism or as necessary for metabolism), or (iii) any substance produced or used during metabolism. In particular, it refers to the end product that remains after metabolism.

As used herein the term "prodrug" refers to (i) an inactive form of a drug that exerts its effects after metabolic processes within the body convert it to a usable or active form, or (ii) a substance that gives rise to a pharmacologically active metabolite, although not itself active (i.e. an inactive precursor).

As used herein the term "C3_io cycloalkyl" refers to mono- or polycyclic carbocyclic alkyl substituent or group having 3 to 10 ring atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, cycloheptenyl, cycloheptadienyl, cycloheptatrienyl perhydrated naphthalene or indene, adamantyl or norbonanyl and the like.

The term "C1^ alkyl" as used herein alone or in combination with other terms such as in alkoxy refers to a Ci_6, preferably Ci_4 straight or branched alkyl/alkoxy group such as methyl, ethyl, propyl (iso-, n-), butyl (iso-, n-, sec-, tert-), pentyl, hexyl, methoxy, ethoxy, propoxy (iso-, n-), butoxy (iso-, n-, sec-, tert-), pentoxy, hexoxy; moreover, the term "Ci_ alkyl" also includes an alkyl group which may contain oxygen in the chain and may be substituted with halogen to form an ether or halogenated ether group. The term "halogen" refers to a halogen atom selected from fluorine, chlorine, bromine, iodine, preferably fluorine and chlorine, more preferably fluorine.

The term "aryl" refers to a mono- or bicyclic aromatic group having 6 to 10 backbone carbon atoms, wherein optionally one of the rings of the bicyclic structure is aromatic and the other is a carbocyclic group, such as phenyl, 1- naphthyl, 2-naphthyl, indenyl, indanyl, azulenyl, fluorenyl, 1 ,2,3,4- tetrahydronaphthyl.

The term "heterocyclyl" refers to monocyclic saturated or unsaturated heterocyclyl groups with 1 to 4 hetero atoms selected from N, S and O, with the remainder of the ring atoms being carbon atoms and having preferably a total number of ring atoms of 3 to 10, such as morpholino, piperazinyl, piperidinyl, pyridyl, pyrimidinyl, thiazolyl, indolyl, imidazolyl, oxadiazolyl, tetrazolyl, pyrazinyl, triazolyl, thiophenyl or furanyl.

The term "heteroaryl" refers to a mono- or bicyclic aromatic group with 1 to 4 hetero atoms selected from N, S and O, with the remainder of the ring atoms being carbon atoms and having preferably a total number of ring atoms of 5 to 10. Examples without limitation of heteroaryl groups are such as benzofuranyl, furyl, thienyl, benzothienyl, thiazolyl, imidazolyl, oxazolyl, oxadiazolyl, thiadiazolyl, benzothiazolyl, triazolyl, tetrazolyl, isoxazolyl, isothiazolyl, pyrrolyl, pyranyl, tetrahydropyranyl, pyrazolyl, pyridyl, quinolinyl, isoquinolinyl, purinyl, carbazolyl, benzoxazolyl, benzamidazolyl, indolyl, isoindolyl, pyrazinyl, diazinyl, pyrazine, triazinyltriazine, tetrazinyl, tetrazolyl, benzothiophenyl, benzopyridyl and benzimidazolyl.

The thienopyrimidine compound may optionally be formulated with a pharmaceutically acceptable carrier.

In accordance with the present invention the thienopyrimidine compounds may be administered concomitantly or sequentially in combination with an additional therapeutic agent. Particularly preferred are compositions, wherein the additional therapeutic agent is a histamine antagonist, a bradikinin antagonist, serotonin antagonist, leukotriene, an anti-asthmatic, an NSAID, an antipyretic, a corticosteroid, an antibiotic, an analgetic, a uricosuric agent, chemotherapeutic agent, an anti gout agent, a bronchodilator, a cyclooxygenase-2 inhibitor, a steroid, a 5-lipoxygenase inhibitor, an immunosuppressive agent, a leukotriene antagonist, a cytostatic agent, antibodies or fragments thereof against cytokines and soluble parts (fragments) of cytokine receptors.

More particularly preferred is the use wherein the additional therapeutic agent is selected from compounds such as clemastine, diphenhydramine, dimenhydrinate, promethazine, cetirizine, astemizole, levocabastine, loratidine, terfenadine, acetylsalicylic acid, sodoum salicylate, salsalate, diflunisal, salicylsalicylic acid, mesalazine, sulfasalazine, osalazine, acetaminophen, indomethacin, sulindac, etodolac, tolmetin, ketorolac, bethamethason, budesonide, chromoglycinic acid, dimeticone, simeticone, domperidone, metoclopramid, acemetacine, oxaceprol, ibuprofen, naproxen, ketoprofen, flubriprofen, fenoprofen, oxaprozin, mefenamic acid, meclofenamic acid, pheylbutazone, oxyphenbutazone, azapropazone, nimesulide, metamizole, leflunamide, eforicoxib, lonazolac, misoprostol, paracetamol, aceclofenac, valdecoxib, parecoxib, celecoxib, propyphenazon, codein, oxapozin, dapson, prednisone, prednisolon, triamcinolone, dexibuprofen, dexamethasone, flunisolide, albuterol, salmeterol, terbutalin, theophylline, caffeine, naproxen, glucosamine sulfate, etanercept, ketoprofen, adalimumab, hyaluronic acid, indometacine, proglumetacine dimaleate, hydroxychloroquine, chloroquine, infliximab, etofenamate, auranofin, gold, [224Ra]radium chloride, tiaprofenic acid, dexketoprofen (trometamol), cloprednol, sodium aurothiomalate aurothioglucose, colchicine, allopurinol, probenecid, sulfinpyrazone, benzbromarone, carbamazepine, lornoxicam, fluorcortolon, diclofenac, efalizumab, idarubicin, doxorubicin, bleomycin, mitomycin, dactinomycin, daptomycin, cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, adriamydin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides, penicillamine, a hyaluronic acid preparation, arteparon, glucosamine, MTX, soluble fragments of the TNF-receptor (such as etanercept (Enbrel)) and antibodies against TNF (such as infliximab (Remicade), natalizumab (Tysabri) and adalimumab (Humira).

It will be appreciated by the person of ordinary skill in the art that the compounds of the invention and the additional therapeutic agent may be formulated in one single dosage form, or may be present in separate dosage forms and may be either administered concomitantly (i.e. at the same time) or sequentially.

The pharmaceutical compositions of the present invention may be in any form suitable for the intended method of administration.

The compounds of the present invention may be administered orally, parenterally, such as bronchopulmonary, subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, transdermal^, transmucosally, subdurally, locally or topically via iontopheresis, sublingually, by inhalation spray, aerosol or rectally and the like in dosage unit formulations optionally comprising conventional pharmaceutically acceptable excipients.

Excipients that may be used in the formulation of the pharmaceutical compositions of the present invention comprise carriers, vehicles, diluents, solvents such as monohydric alcohols such as ethanol, isopropanol and polyhydric alcohols such as glycols and edible oils such as soybean oil, coconut oil, olive oil, safflower oil cottonseed oil, oily esters such as ethyl oleate, isopropyl myristate; binders, adjuvants, solubilizers, thickening agents, stabilizers, disintergrants, glidants, lubricating agents, buffering agents, emulsifiers, wetting agents, suspending agents, sweetening agents, colorants, flavors, coating agents, preservatives, antioxidants, processing agents, drug delivery modifiers and enhancers such as calcium phosphate, magnesium state, talc, monosaccharides, disaccharides, starch, gelatine, cellulose, methylcellulose, sodium carboxymethyl cellulose, dextrose, hydroxypropyl-β-cyclodextrin, polyvinylpyrrolidone, low melting waxes, ion exchange resins. Other suitable pharmaceutically acceptable excipients are described in Remington's Pharmaceutical Sciences, 15th Ed., Mack Publishing Co., New Jersey (1991).

Dosage forms for oral administration include tablets, capsules, lozenges, pills, wafers, granules, oral liquids such as syrups, suspensions, solutions, emulsions, powder for reconstitution.

Dosage forms for parenteral administration include aqueous or olageous solutions or emulsions for infusion, aqueous or olageous solutions, suspensions or emulsions for injection pre-filled syringes, and/or powders for reconstitution.

Dosage forms for local/topical administration comprise insufflations, aerosols, metered aerosols, transdermal therapeutic systems, medicated patches, rectal suppositories, and/or ovula.

The amount of the compound of the present invention that may be combined with the excipients to formulate a single dosage form will vary upon the host treated and the particular mode of administration.

The pharmaceutical compositions of the invention can be produced in a manner known per se to the skilled person as described, for example, in Remington's Pharmaceutical Sciences, 15th Ed., Mack Publishing Co., New Jersey (1991).

The pharmaceutical compositions of the invention are useful for prophylaxis and treatment of inflammatory diseases, in particular chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, gouty arthritis; psoriasis, erythrodermic psoriasis, pustular psoriasis, inflammatory bowel disease, Crohn's disease and related conditions, ulcerative colitis, colitis, diverticulitis, nephritis, urethritis, salpingitis, oophoritis, endomyometritis, spondylitis, systemic lupus erythematosus and related disorders, multiple sclerosis, asthma, meningitis, myelitis, encephalomyelitis, encephalitis, phlebitis, thrombophlebitis, chronic obstructive disease (COPD)1 inflammatory lung disease, allergic rhinitis, endocarditis, osteomyelitis, rheumatic fever, rheumatic pericarditis, rheumatic endocarditis, rheumatic myocarditis, rheumatic mitral valve disease, rheumatic aortic valve disease, prostatitis, prostatocystitis, spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis; Hashimoto's thyroiditis, Kawasaki's disease, Raynaud's phenomenon, Sjogren's syndrome, neuroinflammatory disease, sepsis, conjubctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglottitis, bronchitis, pneumonitis, stomatitis, gingivitis, oesophagitis, gastritis, peritonitis, hepatitis, cholelithiasis, cholecystitis, glomerulonephritis, goodpasture's disease, crescentic glomerulonephritis, pancreatitis, dermatitis, endomyometritis, myometritis, metritis, cervicitis, endocervicitis, exocervicitis, parametritis, tuberculosis, vaginitis, vulvitis, silicosis, sarcoidosis, pneumoconiosis, inflammatory polyarthropathies, psoriatric arthropathies, intestinal fibrosis, bronchiectasis and enteropathic arthropathies.

As already stated above, the compositions of the present invention are particularly useful for treating or preventing a disease selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn's disease, ulcerative colitis, multiple sclerosis and asthma.

Thus, in a more preferred embodiment of this invention the use of a thienopyrimidine compound for the production of a pharmaceutical composition for the prophylaxis or therapy of inflammatory diseases selected from chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, asthma and septic shock is provided.

For the purpose of the present invention, a therapeutically effective dosage will generally be from about 1 to 500 mg/day, preferably from about 10 to about 200 mg/day, and most preferably from about 10 to about 100 mg/day, which may be administered in one or multiple doses.

It will be appreciated, however, that specific dose level of the compounds of the invention for any particular patient will depend on a variety of factors such as age, sex, body weight, general health condition, diet, individual response of the patient to be treated time of administration, severity of the disease to be treated, the activity of particular compound applied, dosage form, mode of application and concomitant medication. The therapeutically effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgment of the ordinary clinician or physician.

Examples

General

LCMS analyses of purity and m/z were performed using a Waters Micromass LCT mass spectrometer linked to a ThermoHypersil- Keystone BDS 5μ, 2.1 x 500 mm column eluting with a gradient of 100% water to 95% acetonitrile in 5% water (0.1 % TFA buffer) over 2.1 minutes at a flow rate of 1 ml/min with detection by UV at 215 nm and ELS. Proton nuclear magnetic resonance (NMR) spectra were recorded on a Bruker AVANCE 400 MHz or on a Bruker DPX 250 MHz spectrometer with reference to the deuterated solvent peak.

Starting materials containing the thienopyrimidine ring core are commercially available from suppliers such as Fluorochem Ltd. and Maybridge. Access to thienopyrimidines with structurally diverse R2 and R3 groups is achieved from the appropriately substituted 2-amino-thiophene-3-carboxylic ester. This intermediate is prepared via the "Gewald thiophene synthesis" (Chem. Ber. 1966, 99, 94-100) (1. Method, shown below) or an alternative synthetic route described in Pharmazie 1996, 57(11), 833-836 where the R2 group can be selectively introduced (2. Method, shown below): 1. Method

PCl5, POCI3 Reflux

Figure imgf000032_0002
Figure imgf000032_0001

2. Method

2

Figure imgf000032_0003

The 2-amino-thiophene-3-carboxylic ester products are cyclized with formamide to yield the corresponding 4-oxo-thienopyrimidine which is readily converted into the activated 4-chloro-thienopyrimidine with a mixture of PCI5 and POCI3 or neat POCI3. The 4-chloro-thienopyrimidines are then reacted with aniline derivatives as described in synthetic routes 1 to 5 described below to afford the compound of the invention.

Example 1: Examples of preparation of the compounds of the invention

The compounds of the invention can be produced in a manner known per se and by the synthetic routes 1-5 described below. Example 1a: Synthesis Route 1

Figure imgf000033_0001

Compound 1A. 3-(2-Nitro-phenoxy)-tetrahydrofuran

Anhydrous tetrahydrofuran (1OmI) was added to sodium hydride as a 60% dispersion in mineral oil (312 mg, 1.1 eq, 7.8 mmol.) in a flask fitted with a condenser, a nitrogen inlet and a bubbler. While stirring, 3- hydroxytetrahydrofuran (624 mg, 7.09 mmol, 1 eq) was added slowly and the mixture was left to stir at room temperature for 10-15 minutes. To the solution of sodium alkoxide in THF was added 2-fluoronitrobenzene (1 g, 7.09 mmol, 1 eq). The reaction mixture was heated to reflux with stirring for 4.5 hours. The reaction was then allowed to cool down to room temperature, then water (20ml) was added to the reaction mixture. The resulting mixture was extracted three times with ethyl acetate (20 ml), the organics dried over sodium sulfate, filtered and the filtrate evaporated to dryness to give the title compound 3-(2-nitro-phenoxy)- tetrahydrofuran as an orange oil (1.48 g, 7.07 mmol, 100%). 1H NMR indicates desired compound in ca. 90% purity.

Compound 1B. 2-(Tetrahydro-furan-3-yloxy)-phenylamine

In a flask purged and fitted with a 3 way tap under nitrogen was added palladium on charcoal 10% (150 mg, 0.1 eq) followed by 20 ml of ethanol. The flask was purged again and placed under nitrogen and title compound 1a, 3-(2-nitro- phenoxy)-tetrahydrofuran (1.48 g, 7.07 mmol, 1 eq) in solution in ethanol (20ml) was added. The flask was purged and placed under an atmosphere of hydrogen and the reaction mixture was stirred overnight at room temperature. The palladium residues were filtered on glass fiber paper and the filtrate was evaporated to dryness to yield the title compound 2-(tetrahydro-furan-3-yloxy)- phenylamine (1.14 g, 6.36 mmol, 90%). 1H NMR indicates desired compound in ca. 95% purity.

Compound 1C. (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- furan-3-yloxy)-phenyl]-amine

Title compound 1 B, 2-(tetrahydro-furan-3-yloxy)-phenylamine (100 mg, 0.58 mmol, 1 eq) was placed in an Ace pressure tube to which was added 4-chloro- 5,6-dimethyl-thieno[2,3-d]pyrimidine (111 mg, 0.58 mmol, 1 eq). 2-Propanol (4ml) was added and the reaction mixture was stirred at 9O0C for 7 hours. The title compound precipitated as the hydrochloride salt and was filtered off. It was then taken in 4 ml of sodium hydroxide 5N and extracted twice with dichloromethane (3ml). The organics were filtered through a PS-syringe fitted with a sodium sulfate drying cartridge and the filtrate was evaporated to dryness. The crude compound was purified by column chromatography on silica using hexane followed by a mixture hexane/ethyl acetate (9:1) as an eluant to yield (5,6-dimethyl-thieno[2,3- d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]-amine (24.5 mg, 0.07 mmol, 13%). LCMS; [M+H]+=342, Rt = 1.92 min, 100% purity.

The following compounds were prepared analogously:

Compound 2A: 3(S)-(2-Nitro-phenoxy)-tetrahydrofuran

Yield; 1.71 g, 8.17 mmol, 100%

1H NMR indicates desired compound in ca. 90% purity

Compound 2B: 2-(Tetrahydro-furan-3(S)-yloxy)-phenylamine

Yield; 1.03g, 5.75 mmol, 81 %

1H NMR indicates desired compound in ca. 95% purity

Compound 2C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- furan-3(S)-yloxy)-phenyl]-amine

Yield; 135.9 mg, 0.398 mmol, 72%

LCMS; [M+H]+ = 342, Rt = 1.92 min, 98% purity Compound 3A: 3(R)-(2-Nitro-phenoxy)-tetrahydrofuran

Yield; 1.58 g, 7.56 mmol, 100%

1H NMR indicates desired compound in ca. 90% purity

Compound 3B: 2-(Tetrahydro-furan-3(R)-yloxy)-phenylamine

Yield; 985.7mg, 5.50 mmol, 72%

1H NMR indicates desired compound in ca. 95% purity

Compound 3C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- furan-3(R)-yloxy)-phenyl]-amine

Yield; 125.4 mg, 0.367 mmol, 66%

LCMS; [M+H]+ = 342, Rt = 1.92 min, 100% purity

Compound 4C: (5-methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- furan-3-yloxy)-phenyl]-amine

Yield; 63.9 mg, 0.195 mmol, 35%

LCMS; [M+H]+ = 328, Rt = 1.88 min, 100% purity

Compound 5A: i-Cyclopentyloxy-2-nitro-benzene

Yield; 664.1 mg, 3.21 mmol, 45%

1H NMR indicates desired compound in ca. 90% purity

Compound 5B: 2-Cyclopentyloxy-phenylamine

Yield; 325.4 mg, 1.83 mmol, 58%

1H NMR indicates desired compound in ca. 95% purity

Compound 5C: (2-Cyclopentyloxy-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 23 mg, 0.071 mmol, 12.5%

LCMS; [M+H]+ = 326, Rt = 2.26 min, 100% purity Compound 6C: (5-methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- furan-3(S)-yloxy)-phenyl]-amine

Yield; 82 mg, 0.448 mmol, 45%

LCMS; [M+H]+ = 328, Rt = 1.88 min, 100% purity

Compound 7A: 4-(2-Nitro-phenoxy)-tetrahydro-pyran

Yield; 1.59 g, 7.25 mmol, 100%

1H NMR indicates desired compound in ca. 90% purity

Compound 7B: 2-(Tetrahydro-pyran-4-yloxy)-phenylamine

Yield; 1.24g, 6.42 mmol, 91 %

1H NMR indicates desired compound in ca. 88% purity (12% w/w EtOH remaining)

Compound 7C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- pyran-4-yloxy)-phenyl]-amine

Yield; 132.6 mg, 0.373 mmol, 72%

LCMS; [M+H]+ = 356, Rt = 1.96 min, 100% purity

Compound 8A: 1-sec-Butoxy-2-nitro-benzene

Yield; 1.33 g, 6.86 mmol, 97%

LCMS; [M+H]+ = Nl, Rt = 1.53 min, 90% purity

1H NMR indicates desired compound in ca. 95% purity

Compound 8B: 2-sec-Butoxy-phenylamine

Yield; 902.6 mg, 5.5 mmol, 80%

1H NMR indicates desired compound in ca. 98% purity

Compound 8C: (2-sec-Butoxy-phenyl)-(5,6-dimethyl-thieno[2,3- d]pyιϊmidin-4-yl)-amine

Yield; 17.8 mg, 0.054 mmol, 9%

LCMS; [M+H]+ = 328, Rt = 1.69 min, 100% purity Compound 9a: 1-lsopropoxy-2-nitro-benzene

Yield; 1.18 g, 6.52 mmol, 92%

LCMS; [M+H]+ = Nl, Rt = 1.41 min, 95% purity

Compound 9B: 2-lsopropoxy-phenylamine

Yield; 0.9g, 5.96 mmol, 91 %

LCMS; [M+H]+ = 152, Rt = 0.72 min, 100% purity

Compound 9C: (2-lsopropoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin- 4-yl)-amine

Yield; 35 mg, 0.117 mmol, 22%

LCMS; [M+H]+ = 300, Rt = 1.57 min, 100% purity

Compound 10C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- furan-3(R)-yloxy)-phenyl]-amine

Yield; 138.8 mg, 0.424 mmol, 76%

LCMS; [M+H]+ = 328, Rt = 1.88 min, 100% purity

Compound 11C: (2-sec-Butoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin- 4-yl)-amine

Yield; 20.2 mg, 0.064 mmol, 11%

LCMS; [M+H]+ = 314, Rt = 1.77 min, 94% purity

Compound 12C: (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro- pyran-4-yloxy)-phenyl]-amine

Yield; 150.2 mg, 0.439 mmol, 85%

LCMS; [M+H]+ = 342, Rt = 1.93 min, 100% purity

Compound 16C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy- phenyl)-amine

Yield; 66 mg, 0.211 mmol, 39%

LCMS; [M+H]+ = 314, Rt = 1.61 min, 89% purity Compound 19A: i-Cyclohexyloxy-2-nitro-benzene

Yield; 1.79 g, 8.09 mmol, 100%

1H NMR indicates desired compound in ca. 90% purity

Compound 19B: 2-Cyclohexyloxy-phenylamine

Yield; 1.49 g, 7.78 mmol, 96%

1H NMR indicates desired compound in ca. 95% purity

Compound 19C: (2-Cyclohexyloxy-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 47.2 mg, 0.139 mmol, 27%

LCMS; [M+H]+ = 340, Rt = 2.33 min, 100% purity

Compound 2OA: i-Cyclopropylmethoxy-2-nitro-benzene

Yield; 1.22 g, 6.32 mmol, 89%

1H NMR indicates desired compound in ca. 90% purity

Compound 2OB: 2-Cyclopropylmethoxy-phenylamine

Yield; 954.9 mg, 5.85 mmol, 93%

LCMS; [M+H]+ = 164, Rt = 0.84 min, 100% purity

1H NMR indicates desired compound in ca. 95% purity

Compound 2OC: (2-Cyclopropylmethoxy-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 74.3 mg, 0.239 mmol, 39%

LCMS; [M+H]+ = 312, Rt = 1.68 min, 100% purity

Compound 22C: (2-Cyclohexyloxy-phenyl)-(5,6-dimethyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 102.9 mg, 0.291 mmol, 56%

LCMS; [M+H]+ = 354, Rt = 2.36 min, 97% purity Compound 23A: 1-tert-Butoxy-2-nitro-benzene

Yield; 1.08 g, 6.32 mmol, 78%

1H NMR indicates desired compound in ca. 95% purity

Compound 23B: 2-tert-Butoxy-phenylamine

Yield; 719.8 mg, 4.36 mmol, 79%

LCMS; [M+H]+ = 166, Rt = 0.89 min, 100% purity

1H NMR indicates desired compound in ca. 95% purity

Compound 23C: (2-tert-Butoxy-phenyl)-(5,6-dimethyl-thieno[2,3- d]pyrϊmidin-4-yl)-amine

Yield; 25.3 mg, 0.077 mmol, 13%

LCMS; [M+H]+ = 328, Rt = 1.67 min, 94% purity

Compound 25A: 1-Nitro-2-propoxy-benzene

LCMS; [M+H]+ = Nl, Rt = 1.44 min, 100% purity

Compound 25B: 2-Propoxy-phenylamine

The desired compound was used without purification in the subsequent reaction.

Compound 25C: (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propoxy- phenyl)-amine

Yield; 10 mg, 0.033 mmol, 13%

LCMS; [M+H]+ = 300, Rt = 1.54 min, 100% purity

Compound 26C: (2-Cyclopentyloxy-phenyl)-(5,6-dimethyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 8.8 mg, 0.026 mmol, 5%

LCMS; [M+H]+ = 340, Rt = 2.29 min, 92% purity

Compound 27A: 1-Ethyl-3-(2-nitro-phenoxy)-pyrrolidine

Yield; 1.7O g, 7.2 mmol, 100%

1H NMR indicates desired compound in ca. 95% purity Compound 27B: 2-(1-Ethyl-pyrrolidin-3-yloxy)-phenylamine

Yield; 1.47 g, 7.13 mmol, 99%

1H NMR indicates desired compound in ca. 95% purity

Compound 27C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1-ethyl- pyrrolidin-3-yloxy)-phenyl]-amine

Yield; 8.0 mg, 0.022 mmol, 4.5%

LCMS; [M+H]+ = 369, Rt = 1.61 min, 92% purity

Compound 28C: (2-tert-Butoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine

Yield; 32 mg, 0.102 mmol, 17%

LCMS; [M+H]+ = 314, Rt = 2.10 min, 93% purity

Compound 32C: (2-Cyclopropylmethoxy-phenyl)-(5,6-dimethyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 88.2 mg, 0.271 mmol, 44%

LCMS; [M+H]+ = 326, Rt = 2.20 min, 100% purity

Compound 34A: 1-lsobutoxy-2-nitro-benzene

Yield; 1.22 g, 6.25 mmol, 88%

1H NMR indicates desired compound in ca. 95% purity

Compound 34B: 2-lsobutoxy-phenylamine

Yield; 1.18 g, 7.14 mmol, 100%

LCMS; [M+H]+ = 166, Rt = 1.52 min, <98% purity

1H NMR indicates desired compound in ca. 95% purity

Compound 34C: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isobutoxy- phenyl)-amine

Yield; 95.3 mg, 0.291 mmol, 48%

LCMS; [M+H]+ = 328, Rt = 2.25 min, 100% purity Compound 37C: (5[2-(1-Ethyl-pyrrolidin-3-yloxy)-phenyl]-(5-methyl- thieno[2,3-d] pyrimidin-4-yl)-amine

Yield; 2.7 mg, 0.008 mmol, 1.5%

LCMS; [M+H]+ = 328, Rt = 2.25 min, 100% purity

Compound 38C: (2-lsopropoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine

Yield; 71 mg, 0.248 mmol, 75%

LCMS; [M+H]+ = 286, Rt = 1.18 min, 94% purity

Compound 39C: (2-sec-Butoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine

Yield; 5.9 mg, 0.020 mmol, 3.2%

LCMS; [M+H]+ = 300, Rt = 1.33 min, 100% purity

Compound 40C: (2-lsobutoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine

Yield; 132.2 mg, 0.422 mmol, 70%

LCMS; [M+H]+ = 314, Rt = 2.23 min, 100% purity

Compound 43A: 2-(2-Nitro-phenoxy)-adamantane

Yield; 1.7 g, 6.22 mmol, 88%

1H NMR indicates desired compound in ca. 95% purity

Compound 43B: 2-(Adamantan-2-yloxy)-phenylamine

Yield; 1.75 g, 7.2 mmol, 100%

LCMS; [M+H]+ = 244, Rt = 1.86 min, 89% purity

1H NMR indicates desired compound in ca. 95% purity

Compound 43C: [2-(Adamantan-2-yloxy)-phenyl]-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 22.6 mg, 0.058 mmol, 14%

LCMS; [M+H]+ = 392, Rt = 2.42 min, 100% purity Compound 45C: [2-(Adamantan-2-yloxy)-phenyl]-(5,6-dimethyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 27.8 mg, 0.069 mmol, 17%

LCMS; [IVMH]+ = 406, Rt = 2.44 min, 100% purity

Compound 5OA: 1-lsobutylsulfanyl-2-nitro-benzene

Yield; 1.63 g, 7.72 mmol, 100%

1H NMR indicates desired compound in ca. 95% purity

Compound 5OB: 2-lsobutylsulfanyl-phenylamine

Yield; 1.23 g, 6.8 mmol, 90%

1H NMR indicates desired compound in ca. 95% purity

Compound 5OC: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2- isobutylsulfanyl-phenyl)-amine

Yield; 22.9 mg, 0.066 mmol, 12%

LCMS; [M+H]+ = 344, Rt = 2.34 min, 90% purity

Compound 55A: 1-(2-Nitro-phenoxy)-adamantane

Yield; 1.91 g, 6.99 mmol, 98%

1H NMR indicates desired compound in ca. 90% purity

Compound 55B: 2-(Adamantan-1-yloxy)-phenylamine

Yield; 1.47 g, 6.04 mmol, 87%

LCMS; [M+H]+ = 244, Rt = 1.86 min, 98% purity

1H NMR indicates desired compound in ca. 95% purity

Compound 55C: [2-(Adamantan-1-yloxy)-phenyl]-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 35.7 mg, 0.091 mmol, 22%

LCMS; [M+H]+ = 392, Rt = 2.46 min, 95% purity Compound 58B: 4-Methoxy-pyridin-3-ylamine

Yield; 300 mg, 2.4 mmol, >100%

LCMS: [M+H]+=125, Rt = 0.51 min, 100% purity

Compound 58C: (4-Methoxy-pyridin-3-yl)-(5-methyl-thieno[2,3-d]pyrimidin- 4-yl)-amine

Yield; 40 mg, 0.15 mmol, 27%

LCMS; [M+H]+ = 273, Rt = 0.91 min, 94% purity

Compound 65C: (2-lsobutylsulfanyl-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 9.8 mg, 0.03 mmol, 5%

LCMS; [M+H]+ = 330, Rt = 2.30 min, 96% purity

Example 1b: Synthesis Route 2

Figure imgf000043_0001

Figure imgf000043_0002

IPA, 120 °C, 18 hr

Figure imgf000043_0003
Figure imgf000043_0004

Compound 14A. 3-Methoxy-4-nitro-benzoyl chloride

To a stirred solution of 3-methoxy-4-nitro-benzoic acid (1.0 g, 5.1 mmol) in tetrahydrofuran (14 ml) at 0 0C was added a 2 M solution of oxalyl chloride in dichloromethane (2.8 ml, 5.6 mmol) followed by 5 drops of dimethyl formamide. The reaction was stirred under a nitrogen atmosphere for 3 hours allowing the temperature to slowly rise to room temperature. The reaction was then concentrated under reduced pressure to give the title compound as a yellow solid (1.2 g, 5.6 mmol, >100%). LCMS in methanol, trapping Me-ester: [M+H]+=212, Rt = 1.30 min, 71% purity.

Compound 14B. 3-Methoxy-4-nitro-benzamide

To a solution of 0.5 M ammonia in dioxane (110 ml, 55 mmol) at 0 0C was added the title compound 14A 1.1 g, 5.1 mmol) in tetrahydrofuran (10 ml). The reaction was stirred at room temperature under a nitrogen atmosphere for 5 hours and then diluted with ethyl acetate (100 ml). The solution was washed with water (2 x 200 ml), dried (MgSO4), filtered and concentrated under reduced pressure to give the title compound as a pale yellow solid (813 mg, 4.14 mmol, 81 %). LCMS: [M+H]+=197, Rt = 0.92 min, 100% purity.

Compound 14C. 4-Amino-3-methoxy-benzamide

The title compound 14B 500 mg, 2.55 mmol), 10% palladium on carbon (100 mg), and ethanol (50 ml) were stirred at room temperature under a hydrogen atmosphere for 19 hours. The reaction was then filtered through celite and the filtrate evaporated under reduced pressure to give the title compound as a beige solid. (450 mg, 2.7 mmol, >100%). LCMS: [M+H]+=167, Rt = 0.54 min, 70% purity.

Compound 14D. 4-(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-3- methoxy-benzamide

4-Chloro-5,6-dimethylthieno[2,3-d]pyrimidine (100 mg, 0.50 mmol) and the title compound 14C 84 mg, 0.50 mmol) were heated at 120 0C in isopropanol (3 ml) for 18 hours. The reaction was then cooled to room temperature, diluted with water (3 ml) and basified to pH 10 with ammonium hydroxide solution. The resulting precipitate was filtered, washed with water (20 ml), and dried in vacuo. The title compound was obtained as a cream solid (132 mg, 0.40 mmol, 80%). LCMS: [M+H]+=329, Rt = 1.74 min, 82% purity.

Compound 15D. 4(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-methoxy- benzamide

Yield; 59 mg, 0.19 mmol, 35%

LCMS; [M+H]+ = 315.24, Rt = 1.69 min, 100% purity Example 1c: Synthesis Route 3

Figure imgf000045_0001

Compound 29A. (5,6-Dimethyl-thieno[2,3-d]pyrϊmidin-4-yl)-(2- methylsulfanyl-phenyl)-amine

2-Methylsulfanyl-phenylamine (100 mg, 0.72 mmol, 1 eq) was placed in an Ace pressure tube to which was added 4-Chloro-5,6-dimethyl-thieno[2,3-d]pyrimidine (143 mg, 0.72 mmol, 1 eq). 2-Propanol (4mL) was added and the reaction mixture was stirred at 12O0C for 18 hours. The reaction mixture was allowed to cool down to room temperature. Ammonium hydroxide (1 ml_) was added followed by water (5-6 ml_). The product precipitated and was filtered off, washed with 1 ml_ of water and dried to yield the title compound (5,6-Dimethyl-thieno[2,3- d]pyrimidin-4-yl)-(2-methylsulfanyl-phenyl)-amine as a yellow solid (157.2 mg, 0.521 mmol, 72%). LCMS; [M+H]+=302, Rt = 1.99 min, 100% purity

The compounds below can be produced by an analogous method.

Compound 13A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy- phenyl)-amine

Yield; 1.01 g, 3.54 mmol, 33%

LCMS; [M+H]+ = 286, Rt = 1.80 min, 100% purity Compound 17A: (2-Ethoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine

Yield; 20.3 mg, 0.071 mmol, 17.%

LCMS; [M+H]+ = 286, Rt = 1.48 min, 100% purity

Compound 21 A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-ethoxy- phenyl)-amine

Yield; 56.8 mg, 0.190 mmol, 38.%

LCMS; [M+H]+ = 300, Rt = 1.58 min, 100% purity

Compound 31 A: (2-Methylsulfanyl-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 154.6 mg, 0.538 mmol, 75%

LCMS; [M+H]+ = 288, Rt = 1.95 min, 100% purity

Compound 35A: (3-Chloro-2-methoxy-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 63 mg, 0.21 mmol, 38%

LCMS; [M+H]+ = 306, Rt = 1.57 min, 100% purity

Compound 36A: (2-Difluoromethoxy-phenyl)-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 42.4 mg, 0.140 mmol, 44%

LCMS; [M+H]+=308, Rt = 1.42 min, 95% purity

Compound 41 A: (2-Difluoromethoxy-phenyl)-(5,6-dimethyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Yield; 26.0 mg, 0.081 mmol, 26%

LCMS; [M+H]+=322, Rt = 1.50 min, 100% purity Compound 42A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1 ,1 ,2,2- tetrafluoro-ethoxy) phenyl]-amine

Yield; 15 mg, 0.042 mmol, 14%

LCMS; [M+H]+ = 372, Rt = 1.49 min, 100% purity

Compound 44A: (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1 ,1 ,2,2- tetrafluoro-ethoxy)-phenyl]-amine

Yield; 16 mg, 0.044 mmol, 15%

LCMS; [M+H]+ = 358, Rt = 1.45 min, 93% purity

Compound 46A: (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy- phenyl)-amine

Yield; 2.9 mg, 0.009 mmol, 1.6%

LCMS; [M+H]+ = 334, Rt = 1.71 min, 98% purity

Compound 47 A: (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2- trifluoromethoxy-phenyl)-amine

Yield; 4.5 mg, 0.014 mmol, 5%

LCMS; [M+H] + =326, Rt = 1.54 min, 100% purity

Compound 48A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-ethyl- phenyl)-amine

Yield; 21 mg, 0.074 mmol, 9%

LCMS; [M+H]+ = 284, Rt = 1.82 min, 97% purity

Compound 49A: (2-Methoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine

Yield; 8 mg, 0.029 mmol, 7%

LCMS; [M+H]+ = 272, Rt = 1.30 min, 100% purity Compound 51 A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-morpholin-4- yl-phenyl)-amine

Yield; 130 mg, 0.382 mmol, 68%

LCMS; [M+H]+ = 341 , Rt = 1.96 min, 100% purity

Compound 52A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propyl- phenyl)-amine

Yield; 31.8 mg, 0.107 mmol, 14%

LCMS; [M+H]+ = 298, Rt = 1.92 min, 98% purity

Compound 53A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropyl- phenyl)-amine

Yield; 28.3 mg, 0.095 mmol, 13%

LCMS; [M+H]+ = 298, Rt = 1.91 min, 100% purity

Compound 54A: (2-Ethyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine

Yield; 64.2 mg, 0.238 mmol, 29%

LCMS; [M+H]+ = 270, Rt = 1.77 min, 100% purity

Compound 56A: (2-sec-Butyl-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin- 4-yl)-amine

Yield; 47.2 mg, 0.152 mmol, 23%

LCMS; [M+H]+ = 312, Rt = 1.98 min, 97% purity

Compound 57 A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropyl- phenyl)-amine

Yield; 48 mg, 0.169 mmol, 23%

LCMS; [M+H]+ = 284, Rt = 1.86 min, 100% purity Compound 59A: (2-sec-Butyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine

Yield; 38.7 mg, 0.130 mmol, 19%

LCMS; [M+H]+ = 298, Rt = 1.93 min, 100% purity

Compound 6OA: (2-sec-Butyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine

Yield; 41.1 mg, 0.145 mmol, 20%

LCMS; [M+H]+ = 284, Rt = 1.88 min, 97% purity

Compound 61 A: (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy- phenyl)-amine

Yield; 155.2 mg, 0.447 mmol, 83%

LCMS; [M+H]+ = 348, Rt = 2.22 min, 100% purity

Compound 66A: (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-piperidin-1-yl- phenyl)-amine

Yield; 10.9 mg, 0.033 mmol, 17%

LCMS; [M+H]+ =311 , Rt = 1.12min, 100% purity

Compound 67A: 2-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenol

Yield; 45 mg, 0.175 mmol, 40%

LCMS; [M+H]+ = 258, Rt = 1.18 min, 100% purity Example 1d: Synthesis Route 4

reflux, 11h

Figure imgf000050_0001
Figure imgf000050_0002

Compound 62A. 2-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenol

2-Hydroxyaniline (200 mg, 1.83 mmol, 1 eq) was placed in an Ace pressure tube to which was added 4-chloro-5-methyl-thieno[2,3-d]pyrimidine (338 mg, 1.83 mmol, 1 eq). 2-Propanol (4 ml_) was added and the reaction mixture was stirred at 1050C for 2 hours. The reaction mixture was allowed to cool down to room temperature. The title compound precipitated as the hydrochloride salt and was filtered off. It was then taken in 4 ml_ of sodium hydroxide 5N and precipitated in aqueous as the free base. It was filtered off and dried to yield 2-(5-methyl- thieno[2,3-d]pyrimidin-4-ylamino)-phenol (230 mg, 0.894 mmol, 49%). LCMS; [M+H]+=258, Rt = 1.03 min, 83% purity.

Compound 62B. [2-(2-Bromo-ethoxy)-phenyl]-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine

Title compound 62a, 2-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenol, (50 mg, 0.194 mmol, 1 eq) was stirred in solution in acetone (3 ml_) with potassium carbonate (54mg, 0.39 mmol, 2 eq). Dibromoethane (92 mg, 0.49 mmol, 2.5 eq) was added to the mixture and the reaction was heated to reflux for 12 hours after which there was no evolution. The mixture was allowed to cool down to room temperature and water (10 ml_) was added. The mixture was extracted twice with ethyl acetate (10 ml_) and the organics were dried over sodium sulfate, filtered and the filtrate was evaporated to dryness. The mixture was purified on column chromatography on silica using dichloromethane as an eluant to yield the title compound [2-(2-bromo-ethoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine (6.7 mg, 0.018 mmol, 9%). LCMS; [M+H]+=366, Rt = 1.52 min, 90% purity. Example 1e: Synthesis Route 5

Figure imgf000051_0001

Compound 63. (2-Bromo-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine

2-Bromoaniline (0.93 g, 1.0 eq., 5.4 mmol) and 4-chloro-5-methylthienopyrimidine (1 g, 1.0 eq., 5.4 mmol) were suspended in isopropanol (8 ml). The suspension was heated to 12O0C under stirring for 20 hours and then allowed to cool to room temperature. The reaction mixture was concentrated in vacuo. The resultant crude material was purified by chromatography using a gradient of eluant: from 1 to 10% of methanol in dichloromethane. The title compound was isolated as a residue (7 mg, 0.21 mmol, 0.4%). LCMS: [M+H]+=320, Rt = 1.55 min, 100% purity.

oxone in dioxane-water

Figure imgf000051_0003
Figure imgf000051_0002
Compound 64. (2-Methanesulfonyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin- 4-yl)-amine

(2-Methylsulfanyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine (20 mg, 1 eq., 0.069 mmol) and oxone (172 mg, 4 eq., 0.278 mol) were stirred in dioxane- water (4:1 , 1 ml) for 1 hour at room temperature. Then to the reaction mixture was added a saturated aqueous solution of NaHCθ3 (2 ml). The mixture was extracted with ethyl acetate (2 x 4 ml), the organics combined, dried over Na2SO4 and solvent removed in vacuo to give the title compound as a residue (20 mg, 0.062 mmol, 89%). LCMS: [M+H]+= 320, Rt = 1.88 min, 94% purity.

Example 2. Kinase Fluorescence Polarization Assays

Assay principle: Inhibitory potency of compounds against Mnk1 , Mnk2a and other kinases was assessed with assays based on a format known to those skilled in the art as the indirect (competitive) fluorescence polarization. The assay detection system comprises a small fluorophore-labeled phospho-peptide (termed ligand) bound to a phospho-specific antibody. The product generated by the kinase reaction competes with the ligand for antibody binding. Based on the larger molecular volume of the bound ligand, which results in a lower rotation rate in solution, its emitted light has a higher degree of polarization than the one from the free ligand.

Description of the specific homogenous kinase assay

Example 2a. Mnk1 and Mnk2a in vitro kinase assay

As a source of enzyme, human Mnk1 and human Mnk2a were expressed as GST fusion proteins in E. coli, purified to >80% homogeneity by glutathione affinity chromatography and activated in vitro with pre-activated ERK2. In brief, the open reading frames of human Mnk1 and Mnk2a were amplified from cDNA using the forward/reverse primer pairs

SEQ ID NO: 1 5'TTTAGGATCCGTATCTTCTCAAAAGTTGG /

SEQ ID NO: 2 5' CTGGGTCGACTCAGAGTGCTGTGGGCGG and

SEQ ID NO: 3 5'ACAGGGATCCGTGCAGAAGAAACCAGCC /

SEQ ID NO: 4 5'GATGGTCGACTCAGGCGTGGTCTCCCACC

(utilized restriction sites underlined), respectively, and cloned into the BamHI and Sail sites of the vector pGEX-4T1 (Amersham, Sweden, cat. no. 27-4580-01). These constructs allow prokaryotic expression of Mnk1 or Mnk2a as fusion protein with a N-terminal glutathione S-transferase (GST) tag, referred to as GST- Mnk1 or GST-Mnk2a. The following expression and purification procedure was identical for GST-Mnk1 and GST-Mnk2a, referring in general to GST-Mnk, when not distinguishing between the two isoforms. Expression of GST-Mnk was in E. coli BL21 (Merck Biosciences, Germany, cat. no. 69449). Cells were grown in LB- Bouillon (Merck, Germany, cat. no. 1.10285) supplemented with 100 μg/ml ampicillin (Sigma, Germany, cat. no. A9518) at 37°C. When the culture had reached a density corresponding to an Aβoo of 0.8, an equal volume of ice cold LB/ampicillin was added, the culture transferred to 25°C and induced for 4 h with 1 mM isopropyl thiogalactoside (IPTG, Roth, Germany, cat. no. 2316.4). Cells harvested by centrifugation were resuspended in 10 ml lysis buffer (50 mM tris(hydroxymethyl)aminomethane hydrochloride (Tris/HCI, Sigma, Germany, cat. no. T5941) pH 7.5, 300 mM sodium chloride (NaCI, Sigma, Germany, cat. no. S7653), 5% (w/v) glycerol (Sigma, Germany, cat. no. G5516), 3 mM DTT dithiotreitol (DTT, Sigma, Germany, cat. no. D9779)) per gram wet weight cell pellet. Lysates were prepared by disruption of cells with a sonifier and subsequent clearing by centrifugation at 38000 g for 45 min at 40C.

The lysate was applied to a GSTPrep FF 16/10 column (Amersham, Sweden, cat. no. 17-5234-01) equilibrated with lysis buffer. Removal of unbound material was with 3 column volumes (CV) lysis buffer. Elution was with 2 CV of elution buffer (50 mM Tris/HCI pH 7.5, 300 mM NaCI, 5% (w/v) glycerol, 20 mM glutathione (Sigma, Germany, cat. no. G4251)). Peak fractions were pooled and the protein transferred into storage buffer (50 mM Tris/HCI pH 7.5, 200 mM NaCI, 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N1,N'-tetraacetic acid (EGTA, Aldrich, Germany, cat. no. 23,453-2), 1 mM DTT, 10% (w/v) glycerol, 0.5 M sucrose (Sigma, Germany, cat. no. S0389) by gel filtration on a PD10 desalting column (Amersham, Sweden, cat. no. 17-0851-01). Aliquots were shock frozen in liquid nitrogen and stored at -8O0C.

Activation of Mnk1 and Mnk2a was at a concentration of 2.5 μM of either purified GST-MnM or GST-Mnk2a by incubation with 150 nM pre-activated NHis-ERK2 (see ERK2 assay for preparation) and 50 μ M adenosine triphosphate (ATP, Sigma, cat. no. A2699) in a buffer comprising 20 mM N-(2-hydroxyethyl) piperazine-N'-(2-ethanesulfonic acid) (HEPES1 Fluka, Germany, cat. no 54459)/potassium hydroxide (KOH, Roth, Germany, cat. no 6751.1) pH 7.4, 10 mM magnesium chloride (MgCI2, Sigma, Germany, cat. no. M2670), 0.25 mM DTT, 0.05% (w/v) polyoxyethylene 20 stearylether (Brij 78, Sigma, Germany, cat. no. P4019) (HMDB buffer) for 45 min at 3O0C. After the incubation, the preparation was aliquoted into single-use samples, shock frozen in liquid nitrogen, stored at -8O0C and utilized for Mnk1 or Mnk2a kinase assays as detailed below. The presence of activating kinase has been tested to not interfere with the Mnk activity assay.

SUBSTRATE: A carboxy-terminal amidated 12mer peptide with the sequence SEQ ID NO: 5 TATKSGSTTKNR, derived from the amino acid sequence around serine 209 of the eukaryotic translation initiation factor 4E (elF4E) has been synthesized and purified by high performance liquid chromatography (HPLC) to >95% (Thermo, Germany). The serine residue phosphorylated by Mnk kinases is underlined.

LIGAND: The peptide TATKSG-pS-TTKNR, containing an amidated carboxy- terminus and conjugated at the amino-terminus with the oxazine derived fluorophore depicted below was synthesized and used as ligand.

Figure imgf000055_0001

ANTIBODY: SPF New Zealand White Rabbits have been immunized according to standard protocols with the peptide NH2-CTATKSG-pS-TTKNR-CONH2, coupled to keyhole limpet hemocyanin (KLH). The immune globulin G (IgG) fraction was purified from serum of boosted animals by techniques known in the art. In brief, serum was subjected to protein A affinity chromatography. Eluted material was precipitated at 50% cold saturated ammonium sulfate, pellets dissolved and desalted. The resulting material was appropriate for use in below described assay without further antigen-specific purification.

ASSAY SETUP: Inhibition of kinase activity of Mnk1 and Mnk2a was assessed with the same assay system, using pre-activated GST-Mnk1 or GST-Mnk2a, respectively. The kinase reaction contains 30 μ M substrate peptide, 20 μ M ATP, 60 nM ligand and one of either 25 nM pre-activated Mnk1 or 2.5 nM pre-activated Mnk2a. The reaction buffer conditions are 16 mM HEPES/KOH pH 7.4, 8 mM MgCI2, 0.4 mM DTT, 0.08 % (w/v) bovine serum albumin (BSA, Sigma, Germany, cat. no. A3059), 0.008% (w/v) Pluronic F127 (Sigma, Germany, cat. no. P2443), 3% (v/v) DMSO (Applichem, Germany, cat. no. A3006). The kinase reaction is at 3O0C for 40 min. The kinase reaction is terminated by addition of 0.67 reaction volumes of 1 μM antibody in 20 mM HEPES/KOH pH 7.4, 50 mM ethylenediaminetetraacetic acid, disodium salt (EDTA, Sigma, Germany, cat. no. E5134), 0.5 mM DTT, 0.05% (w/v) polyoxyethylene-sorbitan monolaureate (Tween 20, Sigma, Germany, cat. no. P7949). After 1 h equilibration time at room temperature, samples are subjected to fluorescence polarization measurement. The fluorescence polarization readout was generated on an Analyst AD multimode reader (Molecular Devices, Sunnyvale, CA, USA) equipped with a DLRP650 dichroic mirror (Omega Opticals, Brattleboro, VT, USA, cat. no. XF2035), a 630AF50 band pass filter (Omega Opticals, Brattleboro, VT, USA, cat. no. XF 1069) on the excitation and a 695AF55 band pass filter on the emission side (Omega Opticals, Brattleboro, VT, USA, cat. no. XF3076).

Example 2b. ERK2 in vitro kinase assay

KINASE: As a source of enzyme, human ERK2 was expressed as N-terminal hexa-histidin fusion protein in E. coli, purified to >80% homogeneity by immobilized metal ion affinity chromatography (IMAC) and activated in vitro with a constitutively active mutant of MEK1.

In brief, the open reading frame of human ERK2 was amplified from cDNA using the forward/reverse primer pair

SEQ ID NO:6 5'AGCCGTCGACGCGGCGGCGGCGGCGGCGGGC /

SEQ ID NO:7 5TGACAAGCTTAAGATCTGTATCCTGGCTGG

(utilized restriction sites underlined) and cloned into the Sail and Hindlll sites of the vector pQE81 L (Qiagen, Germany, cat. no. 32923). This construct allows prokaryotic expression of ERK2 as fusion protein with a N-terminal hexa-histidin tag, referred to as NHis-ERK2. Expression of NHis-ERK2 was in E. coli BL21. Cells were grown in LB-Bouillon supplemented with 100 μg/ml ampicillin at 370C. When the culture had reached a density corresponding to an Aβoo of 0.8, an equal volume of ice cold LB/ampicillin was added, the culture transferred to 250C and induced for 4 h with 1 mM IPTG. Cells harvested by centrifugation were resuspended in 10 ml lysis buffer (50 mM Tris/HCI pH 7.5, 300 mM NaCI, 5% (w/v) glycerol, 10 mM β-mercapto ethanol (Sigma, Germany, cat. no. M3148) per gram wet weight cell pellet. Lysates were prepared by disruption of cells with a sonifier and subsequent clearing by centrifugation at 38000 g for 45 min at 4°C. The lysate was applied to a column containing 25 ml Ni-NTA Superflow matrix (Qiagen, Germany, cat. no. 1018611) equilibrated with lysis buffer. Removal of unbound material was with 3 column volumes (CV) wash buffer (50 mM Tris/HCI pH 7.5, 300 mM NaCI, 5% (w/v) glycerol, 10 mM β-mercapto ethanol, 20 mM imidazol (Sigma, Germany, cat. no. I2399)/HCI pH 7.5). Elution was with 2 CV of elution buffer (50 mM Tris/HCI pH 7.5, 300 mM NaCI, 5% (w/v) glycerol, 300 mM imidazol). Peak fractions were pooled and the protein transferred into storage buffer (50 mM Tris/HCI pH 7.5, 200 mM NaCI, 0.1 mM EGTA, 1 mM DTT, 10% (w/v) glycerol, 0.5 M sucrose) by gel filtration on a PD10 desalting column. Aliquots were shock frozen in liquid nitrogen and stored at -8O0C.

The open reading frame of human MEK1 was amplified from cDNA using the forward/reverse primer pair

SEQ ID NO:8 5OTCCGJ3ATCCCCCAAGAAGAAG CCGACG CCC

SEQ ID NO:9 5' TCCCGTCGACTTAGACGCCAGCAGCATGGG

(utilized restriction sites underlined) and cloned into the BamHI and Sail sites of the vector pQE80L (Qiagen, Germany, cat. no. 32923). By techniques known in the art, the serine codons 212 and 214 were mutagenized to encode aspartate and glutamate. The resulting expression construct is referred to as NHis-MEK1

SSDE. This construct allows prokaryotic expression of MEK1 as a constitutively active mutant. NHis-MEK1 SSDE was expressed and purified under the conditions described for NHis-ERK2.

Activation of NHis-ERK2 was at a concentration of 11.3 μM of purified enzyme by incubation with 1 μM NHis-MEK1 SSDE and 100 μM ATP in a buffer comprising 20 mM HEPES/KOH pH 7.4, 10 mM MgCI2, 0.25 mM DTT, 0.05% (w/v) Brij 78 (HMDB buffer) for 20 min at 300C. After the incubation, the preparation was aliquoted into single-use samples, shock frozen in liquid nitrogen, stored at -8O0C and utilized for ERK2 kinase assay as detailed below and for activation of Mnk1 and Mnk2a as described above. The presence of MEK1 SSDE has been tested to not interfere with the ERK2 activity assay. SUBSTRATE: A carboxy-terminal amidated 17mer peptide with the sequence SEQ ID NO:10 FFKNIVTPRTPPPSQGK

(synthesis by Thermo, Germany), derived from the amino acid sequence around threonine 98 of the myelin basic protein (MBP) has been synthesized and purified by HPLC to >95%. The relevant residue phosphorylated by ERK2 is underlined.

LIGAND: The peptide KNIVTPR-pT-PPPS, containing an amidated carboxy- terminus and conjugated at the amino-terminus with the fluorophore 5- carboxytetramethylrhodamine (5-TAMRA) was purchased from Thermo (Germany) and used as ligand.

ANTIBODY: Anti-phospho-MBP antibody (clone P12) was purchased from Upstate, Waltham, MA, USA (cat. no. 05-429).

ASSAY SETUP: The kinase reaction contains 60 μM substrate peptide, 10 μM ATP and 30 nM pre-activated NHis-ERK2. The reaction buffer conditions are 16 mM HEPES/KOH pH 7.4, 8 mM MgCI2, 0.4 mM DTT, 0.08 % (w/v) BSA, 0.008% (w/v) Pluronic F127, 3% (v/v) DMSO.

The kinase reaction is at 30°C for 40 min. The kinase reaction is terminated by addition of 0.67 reaction volumes of 5 nM ligand and 50 nM antibody in 20 mM HEPES/KOH pH 7.4, 50 mM EDTA, 0.5 mM DTT, 0.05% (w/v) Tween 20. After 30 min equilibration time at room temperature, samples are subjected to fluorescence polarization measurement. The fluorescence polarization readout was generated on an Analyst AD multimode reader (Molecular Devices, Sunnyvale, CA, USA) equipped with a 561 nm dichroic mirror (Molecular Devices, Sunnyvale, CA, USA, cat. no. 42-000-0048), a 550/10 nm band pass filter (Molecular Devices, Sunnyvale, CA, USA, cat. no. 42-000-0130) on the excitation and a 580/10 nm band pass filter (Molecular Devices, Sunnyvale, CA, USA , cat. no. 42-000-0034) on the emission side. Example 2c. MAPKAP-K2 in vitro kinase assay

KINASE: Human, pre-activated MAPKAP-K2 has been purchased from Upstate, Waltham, MA, USA (cat. no. 14-337).

SUBSTRATE: A carboxy-terminal amidated 17mer peptide with the sequence SEQ ID NO:11 APAYS RALS RQLSSGVS, derived from the amino acid sequence around serine 78 of the heat-shock protein 27 (HSP27) has been synthesized and purified by HPLC to >95% (Thermo, Germany). The residue phosphorylated by MAPKAP-K2 is underlined.

LIGAND: The peptide YSRAL-pS-RQLSS, containing an amidated carboxy- terminus and conjugated at the amino-terminus with the fluorophore 5- carboxytetramethylrhodamine (5-TAMRA) was purchased from Thermo (Germany) and used as ligand.

ANTIBODY: Anti-phospho-HSP27 antibody (clone JBW502) was purchased from Upstate, Waltham, MA, USA (cat. no. 05-645).

ASSAY SETUP: The kinase reaction contains 3 μM substrate peptide, 10 μM ATP and 0.5 nM MAPKAP-K2. The reaction buffer conditions are 16 mM HEPES/KOH pH 7.4, 8 mM MgCI2, 0.4 mM DTT, 0.08 % (w/v) BSA, 0.008% (w/v) Pluronic F 127, 3% (v/v) DMSO. The kinase reaction is at 3O0C for 30 min. The kinase reaction is terminated by addition of 0.67 reaction volumes of 12.5 nM ligand and 25 nM antibody in 20 mM HEPES/KOH pH 7.4, 50 mM EDTA, 0.5 mM DTT, 0.05% (w/v) Tween 20. After 30 min equilibration time at room temperature, samples are subjected to fluorescence polarization measurement. The fluorescence polarization readout was generated on an Analyst AD multimode reader (Molecular Devices) with a filter setup as described for the ERK2 assay. Example 2d. EGFR in vitro kinase assay

KINASE: Human EGFR has been purchased from Sigma, Germany (cat. no.

E3614).

SUBSTRATE: PoIy(GIu, Tyr) purchased from Sigma, Germany (cat. no. P0275) has been employed as kinase substrate.

LIGAND: Ligand was from the Tyrosine Kinase Assay Kit, Green (Invitrogen, Germany, cat. no. P2837), supplied as 10fold concentrate.

ANTIBODY: Phospho-tyrosine specific antibody was from the Tyrosine Kinase Assay Kit, Green (Invitrogen, Germany, cat. no. P2837), supplied as 10fold concentrate.

ASSAY SETUP: The kinase reaction contains 3 μg/ml poly(Glu, Tyr), 3 μM ATP and 10 nM EGFR. The reaction buffer conditions are 20 mM HEPES/KOH pH 7.4, 5 mM MgCl2, 2 mM manganese chloride (MnC^, Roth, Germany, cat. no. T881.1), 0.25 mM DTT, 0.03% Tween 20, 50 μM sodium orthovanadate (Na3VO4, Sigma, Germany, cat. no. S6508), 3% (v/v) DMSO. The kinase reaction is at 22°C for 30 min. The kinase reaction is terminated by addition of 0.67 reaction volumes of 2.5fold concentrated ligand and 2.5fold concentrated antibody in 25 mM HEPES/KOH pH 7.4, 100 mM EDTA, 0.3 mM DTT, 0.05% (w/v) Tween 20. After 30 min equilibration time at room temperature, samples are subjected to fluorescence polarization measurement. The fluorescence polarization readout was generated on an Analyst AD multimode reader (Molecular Devices, Sunnyvale, CA, USA) equipped with a 505 nm dichroic mirror (Molecular Devices, Sunnyvale, CA, USA, cat. no. 42-000-0033), a 485/20 nm band pass filter (Molecular Devices, Sunnyvale, CA, USA, cat. no. 42-000-0031) on the excitation and a 530/10 nm band pass filter (Molecular Devices, Sunnyvale, CA, USA , cat. no. 42-000-0140) on the emission side. Example 2e. CDK2 in vitro kinase assay

KINASE: Active human CDK2/cyclinE has been purchased from Upstate, Waltham, MA, USA (cat. no. 14-475).

SUBSTRATE: RBING peptide purchased from Invitrogen, Germany (cat. no. P2939) has been employed as kinase substrate.

LIGAND: Ligand was from the CDK RBING Kinase Assay Kit (Invitrogen, Germany, cat. no. P2929), supplied as 10fold concentrate.

ANTIBODY: Phospho-specific antibody was from the CDK RBING Kinase Assay Kit (Invitrogen, Germany, cat. no. P2929), supplied as 4fold concentrate.

ASSAY SETUP: The kinase reaction contains 2 μM RBING peptide, 1.66fold concentrated tracer, 20 μ M ATP and 0.36 μg/ml CDK2. The reaction buffer conditions are 16 mM HEPES/KOH pH 7.4, 8 mM MgCI2, 0.4 mM DTT, 0.08 % (w/v) BSA, 0.008% (w/v) Pluronic F 127, 3% (v/v) DMSO. The kinase reaction is at 30°C for 40 min. The kinase reaction is terminated by addition of 0.67 reaction volumes of 2.5fold cone, antibody in 20 mM HEPES/KOH pH 7.4, 50 mM EDTA, 0.5 mM DTT, 0.05% (w/v) Tween 20. After 30 min equilibration time at room temperature, samples are subjected to fluorescence polarization measurement. The fluorescence polarization readout was generated on an Analyst AD multimode reader (Molecular Devices) with a filter setup as described for the EGFR assay.

Without being exhaustive, the following principles and methods may be employed to identify and select therapeutic compounds for use in treating inflammatory diseases and conditions as contemplated by the present invention as defined above and in the claims.

As a general principle, a system which has not been exposed to an inflammatory stimulus is exposed to such stimulus and the candidate therapeutic compound. Such system may comprise cultured cells, or components of cells, or isolated organs or tissues from animals. Alternatively, animals can be exposed to an inflammatory stimulus and the compound.

Specifically, a control group is given a known amount of inflammatory stimulus. Treatment groups are exposed to the same amount of inflammatory stimulus as well as aliquots of the candidate therapeutic compound. Inflammatory response in each group are detected by conventional means known to those of skill in the art and compared.

In particular the following assays may be used:

Assay utilizing peripheral blood mononuclear cells (e.g. Newton, J Leukoc Biol 39:299-311, 1986)

Human peripheral blood mononuclear cells are prepared from the peripheral blood using a ficoll-hypaque density separation (Hansell et al., J lmm Methods 145:105, 1991). Cells are cultured in appropriate medium and at appropriate density. Such density could be 105 to 106 cells per well of a 96-well plate. An appropriate culture medium could comprise RPMI 1640 supplemented with 10% fetal calf serum. Cells are incubated with serial dilutions of test compounds for a given time. This incubation is followed by an inflammatory stimulus applied to the cells. This stimulus could comprise LPS, or another agent, or a combination of agents. After yet another incubation, supernatant is withdrawn from the compound treated and control cells and analyzed for molecules useful for monitoring the inflammatory response. This analysis may comprise detection and quantification of cytokines (e.g., interleukins, interferones, tumor necrosis factors, chemokines), or leukotrines, or prostaglandins, or their derivatives. Detection may be with, e.g. commercially available enzyme-linked immunosorbent assays (ELISAs). Assay for Inhibition of Cytokine Production in Lipopolysaccharide Stimulated Mice or Rats

Injection of lipopolysaccharide (LPS) into mice or rats induces a rapid release of soluble cytokines into the periphery (e.g. Wichterman et al., J Surg Res 29:189- 201 , 1980, Beutler 1992. Tumor necrosis factors: the molecules and their emerging role in medicine. Raven Press, New York, N.Y.). Prior to LPS injection, compounds of the invention are given either orally, or s.c, or i.v. Compounds may be given acute or sub acute. After a given time or at several given time points after LPS injection, blood is withdrawn from animals and is analysed for cytokine levels. Effects in compound treated and sham treated animals are compared.

Assay for Inhibition of Adjuvant Arthritis (Pearson, Proc Soc Exp Biol Med 91 :95-101, 1956)

Adjuvant arthritis is an acute inflammatory disease induced in certain rat strains by the administration of heat-killed mycobacteria dispersed in incomplete Freund's adjuvant. The disease is manifest by severe joint swelling, mainly of the ankles and feet.

Treatment groups and control groups of rats, e.g. Lewis rats, are immunized with heat-killed mycobacteria tuberculosis emulsified in incomplete Freund's adjuvant. Thereafter, the control groups receive mock treatment, while the treatment groups receive compounds of the invention. Administration may be either orally, or s.c, or i.v. Treatment may be acute or sub acute. During the treatment phase the arthritis progression is determined by scoring the swelling of limbs.

The following animal models may be utilized as described above by the general testing principle to identify and select compounds for the indicated inflammatory diseases and conditions. Animal Models of Inflammatory and Rheumatoid Arthritis

Animal models reflecting disease progression of inflammatory and rheumatoid arthritis have been reviewed by Brand (Comp Med 55(2):114-122, 2005). Specifically models of antigen-induced arthritis (Dumonde and Glynn, Br J Exp Pathol 43:373-383, 1962), adjuvant arthritis (Pearson, Proc Soc Exp Biol Med 91 :95-101 , 1956), antibody arthritis (Terato et al., J Immunol 148:2103-2108, 1992) or collagen-induced arthritis (Trentham et al., J Exp Med 146:857- 868,1977; Courtenay et al., Nature 283:666-668, 1980) may be employed to select specific compounds of the invention.

Animal Models of Inflammatory Bowel Diseases and Related Disorders

Animal models of inflammatory bowel diseases such as Crohn's disease and ulcerative colitis have been reviewed by Wirtz and Neurath (Int J Colorectal Dis 15(3):144-60, 2000). States reflecting the pathogenesis of chronic intestinal inflammation may be induced by administration of formaldehyde in combination with immune complexes (Hodgson et al., Gut 19:225-232, 1978; Mee et al., Gut 20:1-5, 1979), acetic acid (MacPherson and Pfeiffer, Digestion 17:135- 150,1978), indomethacin (Banerjee and Peters, Gut 31 :1358-1364, 1990; Yamada et al., Inflammation 17:641-662, 1993), dextran sulfate sodium(Okayasu et al., Gastroenterology 98:694-702, 1990), or haptens like trinitrobenzene sulfonic acid (TNBS)/ dinitrobenzene sulfonic acid (DNBS) (Morris et al., Gastroenterology 96:795-803, 1989;

Elson et al., J Immunol 157:2174-2185, 1996; Neurath et al., J Exp Med 182:1281-1290, 1995; Yamada et al., Gastroenterology 102:1524-1534, 1992; Dohi et al., J Exp Med 189: 1169-1180, 1999) or oxazolone (Ekstrom, Scand J Gastroenterol 33:174-179, 1998; Boirivant et al., J Exp Med 188:1929- 1939,1998). Animal Models of Septic Shock

Animal models of septic shock expose specimen to lipopolysaccharide (LPS), gram-negative or gram-positive bacteria, or combinations thereof (Wichtermanet al., J Surg Res 29:189-201 , 1980; Fink and Heard, J Surg Res 49(2):186-96, 1990). The rodent model of cecal ligation and puncture (CLP) resembles the situation of bowel perforation and mixed bacterial infection of intestinal origin (Baker et al., Surgery 94:331-335, 1983).

Animal Model of Psoriasis

To invest the suitability of compounds for the treatment of psoriasis, the human psoriatic skin xenotransplantation model (Nickoloff, Arch Dermatol 135:1104— 1110, 1999; Nickoloff, J Invest Dermatol Symp Proc 5:67-73, 2000) may be utilized.

Animal Model of Allergic Asthma

In a commonly employed rodent model of allergic asthma animals are sensitized to an antigen (e.g. ovalbumin) and are subsequently challenged with the same antigen by inhalation of an aerosol (e.g. Fujitani et al., Am J Respir Crit Care Med 155:1890-1894, 1997; Kanehiro et al.,. Am J Respir Crit Care Med 163:173- 184, 2001 ; Henderson et al., Am J Respir Crit Care Med 165:108-116, 2002; Oh et al., J Immunol 168: 1992-2000, 2002).

Claims

Claims
1. Use of a compound of the general formula (1)
Figure imgf000066_0001
wherein X is O, S, SO2, CH2, CHR13, CRiaRib, CH(halogen), C(halogen)2, C=O, C(O)NR13, NH or NR13, wherein R13 and R1b are C1-6 alkyl, C1-6 alkyl C3-10 cycloalkyl, C3-1O cycloalkyl, C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, wherein R-ιa and R1b are optionally substituted with one or more Rg;
R1 is hydrogen, C1-6 alkyl, Ci-6 alkyl C3-10 cycloalkyl, C3-I0 cycloalkyl, C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, C6-10 aryl, C-i-e alkyl C6-10 aryl, Cs-10 heteroaryl comprising at least one heteroatom selected from N, S and O, C-ι-6 alkyl C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, wherein R1 is optionally substituted with one or more R9; or if X is NR-ia, CHRia> C(O)NR13 or CRiaRib, Ri may form a carbocyclic or heterocyclic ring with R-ia and the N or C atom to which they are attached, which may contain one or more additional heteroatoms selected from N, S and O, which may be substituted with one or more Rg;
R2 and R3 are the same or different and are independently selected from hydrogen, Ci-6 alkyl, C1-6 alkyl C3-10 cycloalkyl, C3-10 cycloalkyl, C6-10 aryl, C-ι-6 alkyl C6-10 aryl, C5_10 heteroaryl comprising at least one heteroatom selected from N, S and O, Ci_e alkyl C5-I0 heteroaryl comprising at least one heteroatom selected from N, S and O1 C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, or together with the C atoms that they are attached to form a C3-7 cycloalkyl or a 3 to 10 membered heterocycloalkyl group, wherein R2 and R3 are optionally substituted with one or more Rg, R2 may also be Rg and R3 may also be R10;
R4 is hydrogen, C1-4 alkyl, urea, thiourea or acetyl optionally substituted with one or more R9;
or R4 may form a 5 or 6 membered heterocyclic ring with X;
R5 and R7 are the same or different and are independently selected from hydrogen, halogen; CN; COOR11; OR11; C(O)N(R11R113); S(O)2N(R11R113); S(O)N(R11R113); S(O)2R11; N(R11)S(O)2N(R113RHb); SR11; N(R11R113); OC(O)R11; N(R11)S(O)2R113; N(R11)S(O)R113; OC(O)N(R11R113); oxo (=0), where the ring is at least partially saturated; C(O)Ri1; C1-6 alkyl; phenyl; C3- 7 cycloalkyl; or heterocyclyl, wherein C1-6 alkyl; phenyl; C3-7 cycloalkyl; and heterocyclyl are optionally substituted with one or more R10;
R6 and Re are the same or different and are independently selected from hydrogen or Rg; R9 is independently halogen; CN; COORn; ORn; C(O)N(R11RiIa); S(O)2N(R11R11B); S(O)N(R11R113); S(O)2R11; N(Rn)S(O)2N(R11aRnb); SR11; N(R11R113); OC(O)R11; N(R11)C(O)R113; N(R11)S(O)2Rn3; N(R11)S(O)R113; N(R11)C(O)N(R113R1Ib); N(R11)C(O)OR113; OC(O)N(R11R113); oxo (=0), where the ring is at least partially saturated; C(O)R11; C1-6 alkyl; phenyl; C3- 7 cycloalkyl; or heterocyclyl, wherein C1-6 alkyl; phenyl; C3-7 cycloalkyl; and heterocyclyl are optionally substituted with one or more R10;
R10 is independently halogen; CN; OR11; S(O)2N(R11R113); S(O)N(R11R113); S(O)2R11; N(Ri1)S(O)2N(RHaRiIb); SR11; N(R11R113); OC(O)R11; N(R11)C(O)R113; N(R11)S(O)2R113; N(R11)S(O)R113; N(Rn)C(O)N(R11aR11b); N(R11)C(O)OR113; OC(O)N(R11R113); oxo (=0), where the ring is at least partially saturated; C(O)Rn; C1-6 alkyl; phenyl; C3-7 cycloalkyl; or heterocyclyl, wherein Ci-6 alkyl; phenyl; C3-7 cycloalkyl; and heterocyclyl are optionally substituted with one or more Rg;
Rii, Rna, Rub are independently selected from the group consisting of hydrogen, C1-6 alkyl, C1-6 alkyl C3-10 cycloalkyl, C3-10 cycloalkyl, C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, C6-1O aryl, 5 to 10 membered heteroaryl comprising at least one heteroatom selected from N, S and O, wherein R11, R11a, Rnb are optionally substituted with one or more R9;
or a metabolite, prodrug or a pharmaceutically acceptable salt thereof for the preparation of a pharmaceutical composition for treating or preventing cytokine related diseases.
2. Use according to claim 1 , wherein X is O, S, SO2, CH2, CHR13, CR1aR1b, CH(halogen), C(halogen)2, C=O, C(O)NR13, NH or NR1a, wherein R13 and R-ib are C1-6 alkyl, C1-6 alkyl C3--I0 cycloalkyl, C3-10 cycloalkyl, C1-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N1 S and O, wherein R1a and R-ιb are optionally substituted with one or more R9;
Ri is hydrogen, Ci-6 alkyl, Ci-6 alkyl C3-I0 cycloalkyl, C3-io cycloalkyl, Ci-6 alkyl 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, 3 to 10 membered heterocycloalkyl comprising at least one heteroatom selected from N, S and O, C6-io aryl, Ci_6 alkyl C6-I0 aryl, C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, Ci_β alkyl C5-io heteroaryl comprising at least one heteroatom selected from N, S and O1 wherein Ri is optionally substituted with one or more Rg;
or if X is NRia, CHRi3, C(O)NRi3 or CRiaRib, Ri may form a carbocyclic or heterocyclic ring with Ria and the N or C atom to which they are attached, which may contain one or more additional heteroatoms selected from N, S and O, which may be substituted with one or more Rg;
R2 and R3 are the same or different and are independently selected from hydrogen, methyl, phenyl, ethyl, propyl, perfluoromethyl, or form together with the C atoms to which they are attached a 5-membered carbocyclic ring;
R4 is hydrogen or C1-4 alkyl;
R5, Re, R7 and R8 are the same or different and are independently selected from hydrogen, CONH2, CO2H, CO2CH3, Cl and F;
R9 is as defined in claim 1 ;
or a metabolite, prodrug or pharmaceutically acceptable salt thereof.
3. Use according to claim 1 or 2, wherein X is O, S, SO2, CH2, CHRia, CR1aRib, CH(halogen), C(halogen)2, C=O, C(O)NR13, NH or NR1a, wherein Ria and R-ib are Ci-6 alkyl;
Ri is hydrogen, methyl, ethyl, propyl, butyl, difluoromethyl, bromoethyl, 1 ,1 ,2,2-tetrafluoroethyl, 1 ,1 ,1 -trif luoropropyl , perfluoromethyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, norbonanyl, tetrahydrofuranyl, tetrahydropyranyl, phenyl or pyrrolidin-3-yl substituted at the nitrogen with R9;
or if X is NR-ia, Ri forms a morpholino group, a pyrrolidino group or a piperidino group together with R-ia and the N atom to which they are attached, which may be substituted with -CH3 Or-C(O)OC4H9;
R2 and R3 are the same or different and are independently selected from hydrogen, methyl, phenyl, ethyl, propyl, perfluoromethyl, or form together with the C atoms to which they are attached a 5-membered carbocyclic ring;
R4 is hydrogen or Ci_4 alkyl;
R5, Re, R7 and R8 are the same or different and are independently selected from hydrogen, CONH2, CO2H, CO2CH3, Cl and F;
Rg is as defined in claim 1 ;
or a metabolite, prodrug or pharmaceutically acceptable salt thereof.
4. Use according to any one of claims 1 to 3, wherein R2 and R3 are the same or different and are selected from methyl, hydrogen and perfluoromethyl.
5. Use according to claim 1 , wherein X is O, S, SO2, CH2, CHR1a, CRiaRib, CH(halogen), C(halogen)2, C=O, C(O)NR13, NH or NRia, wherein R13 and R1b are Ci-6 alkyl;
Ri is hydrogen, d-6 alkyl, Ci-6 alkyl C3-10 cycloalkyl, C3.10 cycloalkyl, 5 to 10 membered heterocyclyl comprising at least one heteroatom selected from N, S and O, C6-i0 aryl, Ci_β alkyl C6-i0 aryl, C5-10 heteroaryl comprising at least one heteroatom selected from N, S and O, d-β alkyl Cs-io heteroaryl comprising at least one heteroatom selected from N, S and O, wherein Ri is optionally substituted with one or more Rg;
or if X is NRia, Ri may form a heterocyclic ring together with Ria and the N atom to which they are attached, which may contain an additional heteroatom selected from N, S and O, which may be substituted with one or more Rg;
R2 and R3 are the same or different and are independently selected from hydrogen, Ci-4 alkyl which may optionally be substituted with one or more halogen atoms, an acetyl group, a urea, a hydroxyl, a phenyl group and an amino group or form together with the C atoms to which they are attached a C3-6 cycloalkyl group;
R4 is hydrogen or Ci-4 alkyl;
R5. Rδ. R7 and Re are the same or different and are independently selected from hydrogen, CO2H, CO2Ric, CONH2, CONHRid and halogen, whereby Ric and Rid are Ci-6 alkyl;
R9 is as defined in claim 1 ;
with the proviso that if R3 is H or Ci-4 alkyl, R2 cannot be hydrogen;
or a metabolite, prodrug or pharmaceutically acceptable salt thereof.
6. Use according to any one of claims 1 to 5, wherein R4 is hydrogen.
7. Use according to any one of claims 1 to 6, wherein X is O.
8. Compound according to any one of claims 1 to 7, wherein the cycloalkyl group is adamantyl or norbonanyl, cyclohexyl or cyclopentyl.
9. Use according to any one of claims 1 to 8, wherein the halogen atom is selected from Cl, Br and F.
10. Use according to any one of claims 1 to 9, wherein R5, Re, R7 and Ra are hydrogen.
11. Use according to any one of claims 1 to 9, wherein at least one of R5, RQ, R7 and R8 is F, CONH2 or CO2CH3.
12. Use according to any one of claims 5 to 11 , wherein Ri is hydrogen, methyl, ethyl, propyl, butyl, difluoromethyl, bromoethyl, 1 ,1 ,2,2- tertrafluoroethyl, 1 ,1 ,1 -trifluoropropyl, perfluoromethyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, norbonanyl, tetrahydrofuranyl, tetrahydropyranyl, phenyl or pyrrolidin-3-yl substituted at the nitrogen with Rg, wherein Rg is as defined in claim 1.
13. Use according to claim 1 , wherein the compound is selected from:
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)- phenyl]-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((R)-tetrahydro-furan-3-yloxy)- phenyl]-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((S)-tetrahydro-furan-3-yloxy)- phenyl]-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]- amine, (2-Cyclopentyloxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-pyran-4-yloxy)- phenyl]-amine,
(2-sec-Butoxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-lsopropoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(S.Θ-Dimethyl-thienop.S-dlpyrimidin^-ylJ^-methoxy-phenyO-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((R)-tetrahydro-furan-3-yloxy)- phenyl]-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-pyran-4-yloxy)- phenyl]-amine,
(2-sec-Butoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, 4-(5I6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-methoxy-benzamide,
(2-Cyclopropylmethoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amineJ (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy-phenyl)-amine, (2-Ethoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, 3-Methoxy-4-(5-methyl-thieno[2,3-d] pyrimidin-4-ylamino)-benzamide,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((S)-tetrahydro-furan-3-yloxy)- phenyl]-amine,
(2-Cyclohexyloxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-te/t-Butoxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-ethoxy-phenyl)-amine,
(2-Cyclohexyloxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propoxy-phenyl)-amine,
(2,4-Dimethoxy-phenyl)-(6-phenyl-thieno[213-d]pyrimidin-4-yl)-amine, (2-Methoxy-phenyl)-(5>6,7,8-tetrahydro-benzo[4)5]thieno[2,3-d]pyrimidin-4- yl)-amine,
(2-Cyclopentyloxy-phenyl)-(5,6-dinnethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1-ethyl-pyrrolidin-3-yloxy)- phenyl]-amine,
(2-teAf-Butoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methylsulfanyl-phenyl)-amine>
(2-Methylsulfanyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(3-Chloro-2-methoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-annine,
(2-Difluoromethoxy-phenyl)-(5-methyl-thieno[2)3-d]pyrimidin-4-yl)-amine,
[2-(1-Ethyl-pyrrolidin-3-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1 , 1 ,2,2-tetrafluoro-ethoxy)- phenyl]-amine,
(2-sec-Butoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Ethoxy-phenyl)-(6-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-Cyclopentyloxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isobutoxy-phenyl)-amine,
(2-lsopropoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Difluoromethoxy-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
(2-Cyclohexyloxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-lsobutoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2)3-d]pyrimidin-4-yl)-[2-(1 ,1 ,2,2-tetrafluoro-ethoxy)- phenyl]-amine,
3-Methoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, (6-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]- amine,
[2-(Tetrahydro-furan-3-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
[2-(Adamantan-2-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrinnidin-4-yl)- amine,
[2-((S)-Tetrahydro-furan-3-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
[2-(Adamantan-2-yloxy)-phenyl]-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
(5-Chloro-2-methoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-tert-Butoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Morpholin-4-yl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
[2-(Tetrahydro-pyran-4-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy-phenyl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isobutylsulfanyl-phenyl)- amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-trifluoromethoxy-phenyl)-amine,
(2-Ethoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Methylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propyl-phenyl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropyl-phenyl)-amine,
(2-Methoxy-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-ethyl-phenyl)-amine,
^-(Bicyclo^^.ilhept^-yloxyJ-phenyll-thienop.S-dJpyrimidin^-yl-amine,
[2-(Adamantan-2-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Methoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-lsobutoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Methoxy-phenyl)-(6-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-sec-Butyl-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Piperidin-1-yl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
[2-(Adamantan-1-yloxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
(2-lsobutylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
2-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenol,
(3-Chloro-2-methoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-sec-Butyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-sec-Butyl-phenyl)-(5,6-dimethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(6-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]- amine,
(2-Bromo-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-Cyclohexylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Phenoxy-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine>
2-(Thieno[2,3-d]pyrimidin-4-ylamino)-phenol,
(2-lsobutylsulfanyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-lsopropoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
[2-(Tetrahydro-furan-3-yloxy)-phenyl]-(5-trifluoromethyl-thieno[2,3- d]pyrimidin-4-yl)-amine,
(6-lsopropyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)- phenyl]-amine,
(6-lsopropyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,
(6-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy-phenyl)-amine,
(2-Methanesulfonyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy-phenyl)-amine)
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-piperidin-1-yl-phenyl)-amine, (6-lsopropyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine, (2-sec-Butoxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Cyclopentylsulfanyl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
^-(enαfo-Bicyclop^.iJhept^-yloxyJ-phenyπ^S.Θ-dimethyl-thienop.S- d]pyrimidin-4-yl)-amine,
^-(eπdo-Bicyclo^^.ijhept^-yloxyJ-phenyll-thieno^.S-dJpyrimidin^-yl- amine,
^-(endo-Bicyclop^.iJhept^-yloxyJ-phenyll-Cδ-methyl-thieno^.S- d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3- ylmethoxy)-phenyl]-amine,
^-(Tetrahydro-furan-S-ylmethoxyJ-phenylJ-thienop.S-dJpyrimidin^-yl- amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-ylmethoxy)- phenyl]-amine,
(2-lsopropoxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
[2-(1 ,2-Dimethyl-propoxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
(2-Cyclopentyloxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
[2-(1 ,2-Dimethyl-propoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
[2-(1 ,2-Dimethyl-propoxy)-phenyl]-(5,6-dimethyl-thieno[2,3-d]pyrinnidin-4- yl)-amine,
2,6-Dimethyl-4-[2-(thieno[2,3-d]pyrimidin-4-ylamino)-phenyl]-piperazine-1- carboxylic acid tert-butyl ester,
[5-Fluoro-2-(tetrahydro-furan-3-yloxy)-phenyl]-(5-methyl-thieno[2,3- d]pyrimidin-4-yl)-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[5-fluoro-2-(tetrahydro-furan-3- yloxy)-phenyl]-amine, [5-Fluoro-2-(tetrahydro-furan-3-yloxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl- amine,
(2-Cyclopentyloxy-phenyl)-(6-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-Methoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine)
(2-Ethoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-lsopropoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
(2-sec-Butoxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
3-(Tetrahydro-furan-3-yloxy)-4-(thieno[2,3-d]pyrimidin-4-ylamino)- benzoic acid methyl ester,
4-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-(tetrahydro-furan-3-yloxy)- benzoic acid methyl ester,
4-(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-(tetrahydro-furan-3- yloxy)-benzoic acid methyl ester,
3-(Tetrahydro-furan-3-yloxy)-4-(thieno[2,3-d]pyrimidin-4-ylamino)- benzamide,
/V-lsopropyl-ΛMhieno[2,3-d]pyrimidin-4-yl-benzene-1 ,2-diamine,
(5,6-Dimethyl-thieno[2>3-d]pyrimidin-4-yl)-(2-methanesulfonyl-phenyl)- amine,
[2-(Tetrahydro-furan-3-yloxy)-phenyl]-(5-trifluoromethyl-thieno[2,3- d]pyrimidin-4-yl)-amine,
(2-Cyclopentyloxy-phenyl)-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
2,6-Dimethyl-4-[2-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenyl]- piperazine-1-carboxylic acid te/f-butyl ester,
(2-Ethoxy-5-fluoro-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine, (2-sec-Butoxy-phenyl)-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(1-ethyl-2-methyl-propoxy)- phenyl]-amine,
3-[2-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenoxy]-pyrrolidine-1- carboxylic acid tert-butyl ester,
3-[2-(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-ylamino)-phenoxy]-pyrrolidine- 1-carboxylic acid tert-butyl ester,
[2-(3,5-Dimethyl-piperazin-1-yl)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine,
(2-Pyrrolidin-1-yl-phenyl)-thieno[2,3-d]pyrimidin-4-yl-amine,
(S-Methyl-thieno^.S-dJpyrimidin^-yO^-pyrrolidin-i-yl-phenyO-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-pyrrolidin-1-yl-phenyl)-amine,
(2-Cyclopentyloxy-phenyl)-(6-methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)- amine,
Λ/-lsopropyl-Λ/'-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-benzene-1 ,2-diamine,
Λ/-Cyclopentyl-Λ/I-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-benzene-1 ,2- diamine,
Λ/-sec-Butyl-Λ/I-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-benzene-1 ,2-diamine,
(6-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-methoxy-phenyl)-amine,
(2-Ethoxy-phenyl)-(6-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-sec-Butoxy-phenyl)-(6-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
(2-Ethoxy-5-fluoro-phenyl)-(5-methyl-thieno[2)3-d]pyrimidin-4-yl)-amine,
(2-Ethoxy-phenyl)-(6-isopropyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
[2-(1-Ethyl-2-methyl-propoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4- yl)-amine,
(6-Methyl-5-propyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3- yloxy)-phenyl]-amine,
(2-lsopropoxy-phenyl)-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, /iyl-2-methyl-propoxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
Figure imgf000080_0001
/5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(3,3,3-trifluoro-propoxy)- phenyl]-amine,
(5-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-isopropoxy-phenyl)-amine, (2-sec-Butoxy-phenyl)-(5-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-Cyclopentyloxy-phenyl)-(5-ethyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(3-Ethoxy-propoxy)-phenyl]-thieno[2,3-d]pyrimidin-4-yl-amine,
(δ.θ-Dimethyl-thienop.S-dlpyrimidin^-yO-^S-ethoxy-propoxyJ-phenyl]- amine,
(5-Ethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(tetrahydro-furan-3-yloxy)-phenyl]- amine,
3-Ethoxy-4-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-benzamide)
3-lsopropoxy-4-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,
3-sec-Butoxy-4-(5-methyl-thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,
3-Cyclopentyloxy-4-(5-methyl-thieno [2,3-d]pyrimidin-4-ylamino)- benzamide,
4-(5-Methyl-thieno[2,3-d]pyrimidin-4-ylamino)-3-(tetrahydro-furan-3-yloxy)- benzamide,
(S.e-Dimethyl-thieno^.S-dlpyrimidin^-yO-IS-fluoro^-Ctetrahydro-furan-S- yloxy)-phenyl]-amine,
[2-(3-Ethoxy-propoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrinnidin-4-yl)- amine,
[2-(2-Ethoxy-ethoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, [2-(2-Ethoxy-ethoxy)-phenyl]-thieno [2,3-d]pyrimidin-4-yl-amine, (5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-[2-(2-ethoxy-ethoxy)-phenyl]- amine,
3-Ethoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, 3-lsopropoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, 3-sec-Butoxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide, 3-Cyclopentyloxy-4-(thieno[2,3-d]pyrimidin-4-ylamino)-benzamide,
3-(Tetrahydro-furan-3-yloxy)-4-(5-trifluoromethyl-thieno[2,3-d]pyrimidin-4- ylamino)-benzamide,
(2,3-Dihydro-1 H-8-thia-5,7-diaza-cyclopenta[a]inden-4-yl)-(2-methoxy- phenyl)-amine,
^-(exo-Bicyclop^.ilhept^-yloxyJ-phenyll-Cδ.θ-dimethyl-thienop.S- d]pyrimidin-4-yl)-amine,
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-[2-((R)-tetrahydro-furan-3-yloxy)- phenyl]-amine,
(5,6-Dimethyl-thieno[2,3-d]pyrimidin-4-yl)-(2-morpholin-4-yl-phenyl)-amine, (5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-phenoxy-phenyl)-amine, (2-Ethyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, (2-lsopropyl-phenyl)-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine,
[2-(2-Bromo-ethoxy)-phenyl]-(5-methyl-thieno[2,3-d]pyrimidin-4-yl)-amine, and
(5-Methyl-thieno[2,3-d]pyrimidin-4-yl)-(2-propyl-phenyl)-amine.
14. Use according to any one of claims 1 to 13 wherein the pharmaceutical composition is to be administered to a patient concomitantly or sequentially in combination with an additional therapeutic agent.
15. Use composition according to claim 14, wherein the additional therapeutic agent is selected from a histamine antagonist, a bradikinin antagonist, serotonin antagonist, leukotriene, an anti-asthmatic, an NSAID, an antipyretic, a corticosteroid, an antibiotic, an analgetic, a uricosuric agent, chemotherapeutic agent, an anti gout agent, a bronchodilator, a cyclooxygenase-2 inhibitor, a steroid, a 5-lipoxygenase inhibitor, an immunosuppressive agent, a leukotriene antagonist, a cytostatic agent, antibodies or fragments thereof against cytokines and soluble parts (fragments) of cytokine receptors.
16. Use according to claim 14 or 15, wherein the additional therapeutic agent is selected from clemastine, diphenhydramine, dimenhydrinate, promethazine, cetirizine, astemizole, levocabastine, loratidine, terfenadine, acetylsalicylic acid, sodoum salicylate, salsalate, diflunisal, salicylsalicylic acid, mesalazine, sulfasalazine, osalazine, acetaminophen, indomethacin, sulindac, etodolac, tolmetin, ketorolac, bethamethason, budesonide, chromoglycinic acid, dimeticone, simeticone, domperidone, metoclopramid, acemetacine, oxaceprol, ibuprofen, naproxen, ketoprofen, flubriprofen, fenoprofen, oxaprozin, mefenamic acid, meclofenamic acid, pheylbutazone, oxyphenbutazone, azapropazone, nimesulide, metamizole, leflunamide, eforicoxib, lonazolac, misoprostol, paracetamol, aceclofenac, valdecoxib, parecoxib, celecoxib, propyphenazon, codein, oxapozin, dapson, prednisone, prednisolon, triamcinolone, dexibuprofen, dexamethasone, flunisolide, albuterol, salmeterol, terbutalin, theophylline, caffeine, naproxen, glucosamine sulfate, etanercept, ketoprofen, adalimumab, hyaluronic acid, indometacine, proglumetacine dimaleate, hydroxychloroquine, chloroquine, infliximab, etofenamate, auranofin, gold, [224Ra]radium chloride, tiaprofenic acid, dexketoprofen(trometamol), cloprednol, sodium aurothiomalate aurothioglucose, colchicine, allopurinol, probenecid, sulfinpyrazone, benzbromarone, carbamazepine, lornoxicam, fluorcortolon, diclofenac, efalizumab, idarubicin, doxorubicin, bleomycin, mitomycin, dactinomycin, daptomycin, cytarabin, fluorouracil, fluoroarabin, gemcitabin, tioguanin, capecitabin, adriamydin/daunorubicin, cytosine arabinosid/cytarabine, 4-HC, or other phosphamides, penicillamine, a hyaluronic acid preparation, arteparon, glucosamine, MTX, soluble fragments of the TNF-receptor and antibodies against TNF.
17. Use according to any one of claims 1 to 16, wherein the pharmaceutical composition is adapted for oral, parenteral (e.g. bronchopulmonary), local, or topical administration.
18. Use according to any one of claims 1 to 17, wherein the inflammatory disease is selected from chronic or acute inflammation, chronic inflammatory arthritis, arthritis, rheumatoid arthritis, psoriatic arthritis, osteoarthritis, juvenile rheumatoid arthritis, gouty arthritis; psoriasis, erythrodermic psoriasis, pustular psoriasis, inflammatory bowel disease, Crohn's disease and related conditions, ulcerative colitis, colitis, diverticulitis, nephritis, urethritis, salpingitis, oophoritis, endomyometritis, spondylitis, systemic lupus erythematosus and related disorders, multiple sclerosis, asthma, meningitis, myelitis, encephalomyelitis, encephalitis, phlebitis, thrombophlebitis, chronic obstructive disease (COPD), inflammatory lung disease, allergic rhinitis, endocarditis, osteomyelitis, rheumatic fever, rheumatic pericarditis, rheumatic endocarditis, rheumatic myocarditis, rheumatic mitral valve disease, rheumatic aortic valve disease, prostatitis, prostatocystitis, spondoarthropathies ankylosing spondylitis, synovitis, tenosynovotis, myositis, pharyngitis, polymyalgia rheumatica, shoulder tendonitis or bursitis, gout, pseudo gout, vasculitides, inflammatory diseases of the thyroid selected from granulomatous thyroiditis, lymphocytic thyroiditis, invasive fibrous thyroiditis, acute thyroiditis; Hashimoto's thyroiditis, Kawasaki's disease, Raynaud's phenomenon, Sjogren's syndrome, neuroinflammatory disease, sepsis, conjubctivitis, keratitis, iridocyclitis, optic neuritis, otitis, lymphoadenitis, nasopaharingitis, sinusitis, pharyngitis, tonsillitis, laryngitis, epiglottitis, bronchitis, pneumonitis, stomatitis, gingivitis, oesophagitis, gastritis, peritonitis, hepatitis, cholelithiasis, cholecystitis, glomerulonephritis, goodpasture's disease, crescentic glomerulonephritis, pancreatitis, dermatitis, endomyometritis, myometritis, metritis, cervicitis, endocervicitis, exocervicitis, parametritis, tuberculosis, vaginitis, vulvitis, silicosis, sarcoidosis, pneumoconiosis, inflammatory polyarthropathies, psoriatric arthropathies, intestinal fibrosis, bronchiectasis and enteropathic arthropathies.
19. Use according to claim 18 for treating or preventing chronic or acute inflammation, chronic inflammatory arthritis, rheumatoid arthritis, psoriasis, COPD, inflammatory bowel disease, septic shock, Crohn's disease, ulcerative colitis, multiple sclerosis and asthma.
PCT/EP2006/011081 2005-11-25 2006-11-17 Thienopyrimidines treating inflammatory diseases WO2007059905A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP05025772 2005-11-25
EP05025772.4 2005-11-25

Publications (3)

Publication Number Publication Date
WO2007059905A2 true WO2007059905A2 (en) 2007-05-31
WO2007059905A3 WO2007059905A3 (en) 2007-08-02
WO2007059905A9 WO2007059905A9 (en) 2007-11-01

Family

ID=37682624

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/011081 WO2007059905A2 (en) 2005-11-25 2006-11-17 Thienopyrimidines treating inflammatory diseases

Country Status (1)

Country Link
WO (1) WO2007059905A2 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009104026A1 (en) * 2008-02-19 2009-08-27 Vichem Chemie Kutató Kft Tricyclic benzo[4,5]thieno-[2,3-d]pyrimidine-4-yl-amin derivatives, their salts, process for producing the compounds and their pharmaceutical use
US20100247517A1 (en) * 2007-11-22 2010-09-30 Boehringer Ingelheim Internationational GmbH Use of mnk inhibitors for the treatment of alzheimer's disease
WO2011104340A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
WO2011104337A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh Heterocycloalkyl-containing thienopyrimidines for pharmaceutical compositions
WO2011104338A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh Halogen or cyano substituted thieno [2,3-d]pyrimidines having mnk1/mnk2 inhibiting activity for pharmaceutical compositions
WO2011104334A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions
EP2381775A1 (en) * 2008-12-23 2011-11-02 President and Fellows of Harvard College Small molecule inhibitors of necroptosis
US20130005822A1 (en) * 2010-03-15 2013-01-03 Rubin Bruce K Aerosolized dapsone as a therapy for inflammation of the airway and abnormal mucociliary transport
US8486953B2 (en) 2008-08-26 2013-07-16 Boehringer Ingelheim International Gmbh Thienopyrimidines for pharmaceutical compositions
WO2013174744A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines
WO2013174735A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Substituted benzothienopyrimidines
US8633201B2 (en) 2006-04-07 2014-01-21 Boehringer Ingelheim International Gmbh Thienopyrimidines having Mnk1/Mnk2 inhibiting activity for pharmaceutical compositions
US8697713B2 (en) 2006-07-10 2014-04-15 Boehringer Ingelheim International Gmbh Pyrrolopyrimidines for pharmaceutical compositions
WO2014118226A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted pyrazolopyrimidinylamino-indazoles
WO2014118229A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted thienopyrimidines and pharmaceutical use thereof
WO2015074986A1 (en) * 2013-11-20 2015-05-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines as mknk1 and mknk2 inhibitors
US9382255B2 (en) 2012-09-20 2016-07-05 Bayer Pharma Aktiengesellschaft Substituted pyrrolopyrimidinylamino-benzothiazolones as MKNK kinase inhibitors
US9675612B2 (en) 2013-03-06 2017-06-13 Bayer Pharma Aktiengesellschaft Substituted thiazolopyrimidines
US9725452B2 (en) 2013-03-15 2017-08-08 Presidents And Fellows Of Harvard College Substituted indoles and pyrroles as RIP kinase inhibitors
US9868744B2 (en) 2014-04-25 2018-01-16 Pfizer Inc. Heteroaromatic compounds and their use as dopamine D1 ligands

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000056738A1 (en) * 1999-03-23 2000-09-28 Astrazeneca Ab Pyridine and pyrimidine derivatives and their use as inhibitors of cytokine mediated disease
WO2005042537A1 (en) * 2003-10-22 2005-05-12 Bristol-Myers Squibb Company Phenyl-aniline substituted bicyclic compounds useful as kinase inhibitors
WO2006136402A1 (en) * 2005-06-22 2006-12-28 Develogen Aktiengesellschaft Thienopyrimidines for pharmaceutical compositions

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000056738A1 (en) * 1999-03-23 2000-09-28 Astrazeneca Ab Pyridine and pyrimidine derivatives and their use as inhibitors of cytokine mediated disease
WO2005042537A1 (en) * 2003-10-22 2005-05-12 Bristol-Myers Squibb Company Phenyl-aniline substituted bicyclic compounds useful as kinase inhibitors
WO2006136402A1 (en) * 2005-06-22 2006-12-28 Develogen Aktiengesellschaft Thienopyrimidines for pharmaceutical compositions

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8633201B2 (en) 2006-04-07 2014-01-21 Boehringer Ingelheim International Gmbh Thienopyrimidines having Mnk1/Mnk2 inhibiting activity for pharmaceutical compositions
US8697713B2 (en) 2006-07-10 2014-04-15 Boehringer Ingelheim International Gmbh Pyrrolopyrimidines for pharmaceutical compositions
US20100247517A1 (en) * 2007-11-22 2010-09-30 Boehringer Ingelheim Internationational GmbH Use of mnk inhibitors for the treatment of alzheimer's disease
US8802849B2 (en) 2008-02-19 2014-08-12 Vichem Chemie Kutató Kft. Tricyclic benzo[4,5]thieno-[2,3-d]pyrimidine-4-yl-amin derivatives, their salts, process for producing the compounds and their pharmaceutical use
WO2009104026A1 (en) * 2008-02-19 2009-08-27 Vichem Chemie Kutató Kft Tricyclic benzo[4,5]thieno-[2,3-d]pyrimidine-4-yl-amin derivatives, their salts, process for producing the compounds and their pharmaceutical use
US8486953B2 (en) 2008-08-26 2013-07-16 Boehringer Ingelheim International Gmbh Thienopyrimidines for pharmaceutical compositions
US9586880B2 (en) 2008-12-23 2017-03-07 President And Fellows Of Harvard College Small molecule inhibitors of necroptosis
EP2381775A1 (en) * 2008-12-23 2011-11-02 President and Fellows of Harvard College Small molecule inhibitors of necroptosis
JP2012513481A (en) * 2008-12-23 2012-06-14 プレジデント アンド フェロウズ オブ ハーバード カレッジPresident and Fellows of Harvard College Small molecule inhibitors of necroptosis
EP2381775A4 (en) * 2008-12-23 2012-08-15 Harvard College Small molecule inhibitors of necroptosis
US8754079B2 (en) 2010-02-26 2014-06-17 Boehringer Ingelheim International Gmbh Cycloalkyl containing thienopyrimidines for pharmaceutical compositions
CN102858782A (en) * 2010-02-26 2013-01-02 贝林格尔.英格海姆国际有限公司 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions
CN102869669A (en) * 2010-02-26 2013-01-09 贝林格尔.英格海姆国际有限公司 Heterocycloalkyl-containing thienopyrimidines for pharmaceutical compositions
JP2013520471A (en) * 2010-02-26 2013-06-06 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング Having MNKL / Mnk2 inhibitory activity for the pharmaceutical compositions of 4- [cycloalkyloxy (hetero) arylamino] thieno "2,3-d] pyrimidine
JP2013520473A (en) * 2010-02-26 2013-06-06 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング Thieno which is halogen or cyano-substituted with a Mnk1 / Mnk2 inhibitory activity of a pharmaceutical composition for the [2,3-d] pyrimidine
JP2013520474A (en) * 2010-02-26 2013-06-06 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング Substituted alkyl group containing thienopyrimidine for pharmaceutical compositions
JP2013520472A (en) * 2010-02-26 2013-06-06 ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング Heterocycloalkyl containing thienopyrimidine for pharmaceutical compositions
CN102858783A (en) * 2010-02-26 2013-01-02 贝林格尔.英格海姆国际有限公司 Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
US8853193B2 (en) 2010-02-26 2014-10-07 Boehringer Ingelheim International Gmbh Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
WO2011104340A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh Thienopyrimidines containing a substituted alkyl group for pharmaceutical compositions
WO2011104338A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh Halogen or cyano substituted thieno [2,3-d]pyrimidines having mnk1/mnk2 inhibiting activity for pharmaceutical compositions
US8648068B2 (en) 2010-02-26 2014-02-11 Boehringer Ingelheim International Gmbh Heterocycloalkyl-containing thienopyrimidines for pharmaceutical compositions
WO2011104337A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh Heterocycloalkyl-containing thienopyrimidines for pharmaceutical compositions
WO2011104334A1 (en) * 2010-02-26 2011-09-01 Boehringer Ingelheim International Gmbh 4 - [cycloalkyloxy (hetero) arylamino] thieno [2, 3 - d] pyrimidines having mnkl/ mnk2 inhibiting activity for pharmaceutical compositions
US20150040894A1 (en) * 2010-03-15 2015-02-12 Virginia Commonwealth University Aerosolized Dapsone as a Therapy for Inflammation of the Airway and Abnormal Mucociliary Transport
US20130005822A1 (en) * 2010-03-15 2013-01-03 Rubin Bruce K Aerosolized dapsone as a therapy for inflammation of the airway and abnormal mucociliary transport
US9296757B2 (en) 2012-05-21 2016-03-29 Bayer Pharma Aktiengesellschaft Substituted benzothienopyrimidines
WO2013174735A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Substituted benzothienopyrimidines
WO2013174744A1 (en) 2012-05-21 2013-11-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines
US9540392B2 (en) 2012-05-21 2017-01-10 Bayer Pharma Aktiengesellschaft Thienopyrimidines
US9382255B2 (en) 2012-09-20 2016-07-05 Bayer Pharma Aktiengesellschaft Substituted pyrrolopyrimidinylamino-benzothiazolones as MKNK kinase inhibitors
WO2014118229A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted thienopyrimidines and pharmaceutical use thereof
WO2014118226A1 (en) 2013-02-01 2014-08-07 Bayer Pharma Aktiengesellschaft Substituted pyrazolopyrimidinylamino-indazoles
US9556181B2 (en) 2013-02-01 2017-01-31 Bayer Pharma Aktiengesellschaft Substituted pyrazolopyrimidinylamino-indazoles
US9675612B2 (en) 2013-03-06 2017-06-13 Bayer Pharma Aktiengesellschaft Substituted thiazolopyrimidines
US9725452B2 (en) 2013-03-15 2017-08-08 Presidents And Fellows Of Harvard College Substituted indoles and pyrroles as RIP kinase inhibitors
CN106061980A (en) * 2013-11-20 2016-10-26 拜耳制药股份公司 Thienopyrimidines as MKNK1 and MKNK2 Inhibitors
WO2015074986A1 (en) * 2013-11-20 2015-05-28 Bayer Pharma Aktiengesellschaft Thienopyrimidines as mknk1 and mknk2 inhibitors
US9868744B2 (en) 2014-04-25 2018-01-16 Pfizer Inc. Heteroaromatic compounds and their use as dopamine D1 ligands
US10077272B2 (en) 2014-04-25 2018-09-18 Pfizer Inc. Heteroaromatic compounds and their use as dopamine D1 ligands

Also Published As

Publication number Publication date
WO2007059905A3 (en) 2007-08-02
WO2007059905A9 (en) 2007-11-01

Similar Documents

Publication Publication Date Title
AU744014B2 (en) 2-aryl-8-oxodihydropurine derivatives, process for producing the same, medicinal compositions containing the same, and intermediates thereof
AU2006281497B2 (en) Piperidine and piperazine derivatives as P2X3 antagonists
AU2002232760B2 (en) Methods of treating p38 kinase-associated conditions and pyrrolotriazine compounds useful as kinase inhibitors
JP4205168B2 (en) Pyrimidine derivatives and their preparation
JP3869725B2 (en) PDE5 8 quinoline xanthine and 8-quinoline xanthine derivatives as inhibitors
CN1222527C (en) Pyridine and pyrimidine derivatives and their use as inhibitors of cytokine mediated disease
CA2647391C (en) Kinase antagonists
ES2340093T3 (en) Pyrazine and pyridine derivatives as MNK kinase inhibitors.
US6787541B1 (en) Thieno-and furopyrimidine derivatives as A2A-receptor antagonists
US6569863B1 (en) Bicyclic heteroamatic compounds useful as LH agonists
US7459454B2 (en) Aminopyrazine derivatives and compositions
JP6068451B2 (en) Kinase inhibitors
US7951803B2 (en) 8-heteroarylpurine MNK2 inhibitors for treating metabolic disorders
US20030104974A1 (en) Dual inhibitorsof PDE 7 and PDE 4
CN101594871B (en) Pyrrolopyrimidine compounds and their uses
US8697693B2 (en) Pharmaceutical compounds
US7763729B2 (en) Bicyclic heteroaromatic derivatives
JP5014551B2 (en) Effective as phosphodiesterase inhibitors β- carboline derivatives
ES2338234T3 (en) Compositions useful as inhibitors of protein kinases.
US20030232831A1 (en) Aryl ketone pyrrolo-triazine compounds useful as kinase inhibitors
US7176215B2 (en) Bicyclic oxopyridine and oxopyrimidine derivatives
KR101139314B1 (en) Pyrimidothiophene compounds
US6670357B2 (en) Methods of treating p38 kinase-associated conditions and pyrrolotriazine compounds useful as kinase inhibitors
JP5301986B2 (en) Thieno pyrimidines of pharmaceutical compositions
US7592455B2 (en) Bicyclic heteroaromatic compounds as kinase inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06818649

Country of ref document: EP

Kind code of ref document: A2