WO2011099684A1

WO2011099684A1 - Single domain antibody against muc1

Info

Publication number: WO2011099684A1
Application number: PCT/KR2010/006295
Authority: WO
Inventors: 성승용; 조남혁; 최신규; 장숙희; 원해영; 나혜영; 문혜정; 조성은
Original assignee: 서울대학교 산학협력단
Priority date: 2010-02-12
Filing date: 2010-09-15
Publication date: 2011-08-18
Also published as: KR20110093427A

Abstract

The present invention relates to a single domain antibody (nanoscale antibody or NanoMAb) containing a mucin antigen 1 (MUC1) complementarity determining region (CDR) and a base sequence thereof, a mouse monoclonal antibody containing some or all of the base sequence or amino acid sequence, a humanized monoclonal antibody, a chimeric monoclonal antibody, a recombinant vector and a transformed host cell, and a pharmaceutical composition for the treatment of cancer or a composition for the diagnosis of cancer, containing some or all of an amino acid sequence constituting the single domain antibody or a polymer thereof. The antibody of the present invention has a specific and high affinity to the MUC1 tumor antigen, with only a variable region of a heavy chain antibody, and may be used for the diagnosis of cancerous tissues and as a therapeutic antitumor target, which binds various functional molecules to antibodies of the present invention to express MUC1.

Description

【Specification】

[Name of invention]

Single Domain Antibody Against MUC 1 [Technical Field]

The present invention provides a single domain antibody (single domain ant i body or nanoscale antibody or NanoMAb) comprising a MUCUmucin antigen 1) specific heavy chain variable region CDR (complementarity determining region) and its nucleotide sequence, a recombinant vector comprising the nucleotide sequence and The present invention relates to a transformed host cell, a pharmaceutical composition for anticancer immunotherapy comprising the single domain antibody, and a composition for diagnosing cancer.

[Background technology]

Human mucin (Mucin 1, MUC1) glycoprotein is overexpressed in a variety of carcinomas, including breast cancer (86%), pancreatic cancer (90¾, colon cancer (74.5%), or liver cancer (70.8%), and plays an important role in the development of cancer. The MUC1 antigen gene is located in the lq21-24 region of the chromosome and contains an intracellular region (69 amino acids), an extracellular region (repetitive sequence of 20 amino acids), and a transmembrane domain. Since MUC1 is known to be overexpressed in a variety of carcinomas, studies have been actively conducted to apply it as a target for the diagnosis and treatment of tumors expressing it, especially MUC1 specific antibodies for tumor diagnosis and treatment. In order to utilize as a tool for the mass production research is actively being conducted.

Currently, surgery, chemotherapy and radiation therapy are mainly used to treat cancer. However, the treatment method is to destroy the normal tissue, the treatment effect is different depending on the patient, there is a problem that various side effects such as recurrence of resistant tumors occur, there is a need for countermeasures.

Therefore, the development of targeted cancer therapy, which can effectively distinguish cancer cells from normal cells and target them, is currently active. It's going on. Targeted anticancer drugs are a method of developing antibodies or ligands of a protein by targeting a specific protein expressed in cancer cells. These drugs cannot bind or penetrate normal tissues and act specifically on cancer cells. It is believed to be a breakthrough drug that can eliminate.

Among the target anticancer drugs, immunotherapy based on therapeutic antibodies has been mainly studied. This is a method of injecting a cancer cell-specific antibody, and when the antibody binds to a tumor-specific antigen, kills the cancer cell through a natural immune response caused by the antibody or necrosis of a carcinoma by binding a toxin or a drug to the antibody.

These therapeutic antibodies can be applied to various tumor diseases as long as they have specific targets for the disease, and if the biological role of the targets is known, the side effects can be easily predicted when the antigen is injected, and the half-life of the body is long. It has the advantage of being sustained and is being actively developed as a biotech medicine.

Single cell antibody has been used as an in vitro diagnostic agent (mainly pregnancy and ovulation diagnostic reagent) in the 1980s, and has been applied to a variety of diagnostic treatment field through active research and development since then. Currently, about 260 companies around the world are focusing on the development of single-cell antibodies for the purpose of developing therapeutics or diagnostics, and about 900 antibodies are being developed or under development. More than about 30% of these are related to anticancer agents and cancer diagnostics. Therapeutic antibodies that are actually forming the market include Zenapax, the first humanized antibody to be sold in 1997 by Roche, Switzerland, which has gained popularity as an immunosuppressant as an antiinterleukin-2 receptor antibody. In addition, there is ReoPro, a platelet anti-chimeric antibody produced by Centocor in the United States, and Rituxan, a cancer therapy chimeric antibody developed jointly by Genentech and IDEC Pharmaceut icals, and the always-blood cell growth factor receptor developed by Genentech. There is a humanized antibody Herceptin against (HER2). Others include Centocor's humanized anti-TNF antibody, Remicade, Synagis, developed by Medimmune, USA, and marketed since 1998. Zevali, IDEC, USA, licensed in February 2002. This product It is a product that combines a radioactive material with an antibody, and has been developed as an anticancer agent that induces death of cancer cells by transferring the radioactive material into cancer cells when the antibody binds to antigens of cancer cells. Takeda Pharmaceutical Co., Ltd. acquired the domestic development and marketing rights of TRAIL-R1 single cell antibody for cancer treatment antibody discovered by US Human Genome Science (HGS). This drug, which uses protein antibody that is involved in immunity, is a humanized unicellular antibody to TRAIL-R1, a receptor that is involved in apoptosis, and has been shown to be effective in treating breast cancer, colon cancer or uterine cancer in animal experiments conducted by HGS. .

However, existing antibodies have a disadvantage in that they are relatively unstable and easily degraded because of their complex structure and high molecular weight. Therefore, there are many limitations in mass production or utilization of antibodies in vivo. Single domain antibodies are attracting attention as an alternative to overcome the problems of existing antibodies because of their simple manufacturing process, high specificity, small protein size, and stable characteristics.

When only the variable region of a heavy chain antibody (VHH) of a single domain antibody is used for anticancer target therapy, firstly, it is easy to select a desired antigen-specific antibody through genetic manipulation using genetic recombination. It can be mass-produced at low cost by overexpressing in coH, and is produced by genetic recombination with only single domain, so it has high solubility in aqueous solution, high homology with VH3 amino acid sequence of human antibody, and low immunogenicity. Since the size is small, the penetration efficiency into cancer tissue is higher than that of conventional antibodies. Throughout this specification many patent documents are referenced and their citations are indicated. The disclosure of the cited patent documents is hereby incorporated by reference in their entirety, whereby the level and content of the technical field to which the present invention pertains will be more clearly described. [Detailed Description of the Invention]

[Technical problem] The present inventors have attempted to develop a single domain antibody that can be used for the diagnosis and treatment of cancer tumors expressing MUC1 by specifically binding to mucin antigenl (MUCl) tumor antigen. The variable region of a heavy chain antibody of the developed single domain antibody has specific binding ability and high affinity for MUCl tumor antigen, and diagnoses cancer tissues expressing MUC1 when combined with various functional molecules. And showed excellent efficacy as anti-tumor target therapy.

Accordingly, it is an object of the present invention to provide a single domain antibody against MUC1.

Another object of the present invention is to provide a nucleic acid molecule encoding the single domain antibody.

Another object of the present invention to provide a recombinant vector comprising the nucleic acid molecule.

Another object of the present invention to provide a host cell transformed with the recombinant vector.

Still another object of the present invention is to provide a pharmaceutical composition for anticancer immunotherapy comprising the single domain antibody.

Another object of the present invention to provide a cancer diagnostic composition comprising the single domain antibody. Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

Technical Solution

According to one aspect of the present invention, there is provided a single domain antibody against MJC1 comprising a chain variable region having the following heavy chain CDR amino acid sequence: SEQ ID NO: 24 A group consisting of amino acid sequences consisting of SEQ ID NO: 30 sequence A CDR1 selected from the group consisting of an amino acid sequence consisting of the amino acid sequences consisting of SEQ ID NO: 31 to 37, and SEQ ID NO: 31 to the amino acid sequence consisting of SEQ ID NO: 38 to 44 CDR3 selected from the group consisting of: The present inventors have tried to develop a single domain antibody that can be used for the diagnosis and treatment of MUC1-expressing carcinoma by specifically binding to MUC1 tumor antigen, resulting in the development of a variable region of a heavy antigen. The chain antibody alone has a specific binding capacity and high affinity for MJC1 tumor antigen, and when combined with various functional molecules, MUC1 expresses excellent efficacy as a diagnostic and anti-tumor target therapy for cancer tissues expressing MUC1.

Single ^' domain antibodies of the invention have specific binding capacity to MUC1.

As used herein, the term “heavy chain” refers to a variable region domain VH comprising an amino acid sequence having sufficient variable region to confer specificity to an antigen and a full length heavy chain comprising three constant region domains CHI, CH2 and CH3 It means all fragments.

As used herein, the term "single domain antibody" as used to refer to MUC1 is a specific antibody against MUC1, the CDR is part of a single domain polypeptide, heavy chain antibodies, antibodies that are naturally free of light chains, conventional Single domain antibodies derived from 4-chain antibodies, engineered antibodies and single domain scaffolds other than those derived from antibodies.

In the present invention, a single domain antibody is collectively referred to as NanoMAb ™.

Single domain antibodies can be derived from species such as mouse, human, camel, llama, goat, rabbit or cow. Single domain antibodies used in the present invention are naturally occurring single domain antibodies known as light chain free heavy chain antibodies. Such single domain antibodies are disclosed in WO 94/04678, and for the sake of clarity these variable regions derived from heavy chain antibodies that are naturally free of light chains can be distinguished from VHH or nanobody to distinguish them from the VH of conventional four-chain immunoglobulins. nanobody). Preferably, the single domain antibody of the present invention is Camelidae variable region of a heavy chain antibody (VHH) derived from camel, dromedary, llama, alpaca and wild llama. Other species than Camellia may naturally produce light chain-free heavy chain antibodies. Such VHH is within the scope of the present invention.

The single domain antibody used in the present invention is a heavy chain variable region derived from an immunoglobulin that is naturally free of light chains, such as from Camellia, disclosed in WO 94/04678, and the single domain antibody molecule is about 10 times larger than the IgG molecule. Smaller, they are very stable as single polypeptides, even at extreme pH and temperature conditions. In addition, they are resistant to the action of proteases, unlike conventional antibodies, and can be mass-produced in high yield when expressed in vitro.

Single domain antibody of the present invention is CDR1 selected from the group consisting of amino acid sequences consisting of amino acid sequences consisting of SEQ ID NO: 24 to 30 of SEQ ID NO: 30, CDR2 selected from the group consisting of amino acid sequences consisting of SEQ ID NO: 31 to 37 And a CDR3 selected from the group consisting of the amino acid sequences consisting of SEQ ID NO: 38 to SEQ ID NO: 44.

As used herein, the term CDR (complementarity determining region) "refers to the amino acid sequence of the hypervariable region of an immunoglobulin heavy chain (Kabat et al., Sequences of Proteins of Immunological Interest, 4th Ed., US). Department of Health and Human Services, National Institutes of Health (1987)) The heavy chain contains three CDR1, CDR2 and CDR3 CDRs provide the major contact residues for the antibody to bind antigen or epitope.

The single domain antibody of the present invention may include variants of amino acid sequences described in the attached sequence listing within the scope of specific recognition of MJC1. For example, changes can be made to the amino acid sequence of the antibody to improve the binding affinity and / or other biological properties of the antibody. Such modifications include, for example, deletions, insertions and / or substitutions of amino acid sequence residues of the antibody.

Such amino acid variations are made based on the relative similarity of amino acid chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and the like. By analysis of the size, shape and type of amino acid chain substituents, arginine, lysine and histidine are all positively charged residues; Alanine, glycine Serine have a similar size; It can be seen that phenylalanine, tryptophan and tyrosine have a similar shape. Thus, based on these considerations, arginine, lysine and histidine; Alanine, glycine and serine; Phenylalanine, tryptophan and tyrosine are biologically equivalent functions.

In introducing mutations, the hydropathic index of amino acids can be considered. Each amino acid is assigned a hydrophobic index according to its hydrophobicity and charge: isoleucine (+4.5); Valine (+4.2); Leucine (+3.8); phenylalanine (+2.8); Cysteine / cysteine (+2.5); Methionine (+1.9); Alanine (+1.8); Glycine (-0.4); Threonine (-0.7); Serine (-0.8); Tryptophan (-0.9); tyrosine (-1.3); Plin (-1.6); Histidine (-3.2); Glutamate (-3.5); glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); Lysine (-3.9) and arginine (-4.5).

Hydrophobic amino acid indexes are very important in conferring the interactive biological function of proteins. It is known that substitution with amino acids having similar hydrophobicity indexes can retain similar biological activity. When introducing a mutation with reference to the hydrophobicity index, substitutions are made between amino acids that exhibit a difference in hydrophobicity index within the range of 2, more preferably within 1, and even more preferably within 0.5.

On the other hand, it is also well known that substitutions between amino acids having similar hydrophilicity values result in proteins with equivalent biological activity. As disclosed in US Pat. No. 4,554,101, the following hydrophilicity values are assigned to each amino acid residue: arginine (+3.0); Lysine (+3.0); Asphaltate (+3.0 士 1); Glutamate (+3.0 sul 1); Serine (+0.3); asparagine (+0.2); Glutamine (+0.2); Glycine (0); Threonine (-0.4); Plin (-0.5 士 1); Alanine (-0.5); Histidine (-0.5); Cysteine (-1.0); methionine (-1.3); Valine (-1.5); Leucine (-1.8); Isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

When introducing the mutation with reference to the hydrophilicity value, preferably within 土 2, more preferably within 士 1, even more preferably within ∗ 0.5 Substitutions are made between amino acids that exhibit a difference in hydrophilicity.

Amino acid exchange in proteins that do not alter the activity of the molecule as a whole is known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). The most commonly occurring exchanges are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Exchange between Pro, Lys / Arg, Asp / Asn, Leu / I le, Leu / Val, Ala / Glu, Asp / Gly.

Given the above-described variations with biologically equivalent activity, a single domain antibody or nucleic acid molecule encoding the same of the present invention is to be interpreted to include sequences that exhibit substantial identity with the sequences listed in the Sequence Listing. The above substantial identity is at least 61% when the sequences of the present invention and any other sequences are aligned to the utmost, and the sequences are analyzed using algorithms commonly used in the art. Means a sequence that exhibits homology of, more preferably 70% homology, even more preferably 80% homology, and most preferably 90¾ homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for sequencing are described in Smith and

Wat erman C 1981), Adv. Appl. Math. 2: 482; Needleman and Wunsch (1970), J. Mol. Bio. 48: 443-53; Pearson and Li man (1988), Methods in Mol. Biol. 24: 307-31; Higgins and Sharp (1988), Gene 73: 237—44; Higgins and Sharp (1989), CABI0S 5: 151-3; Corpet et al. (1988), Nuc. Acids Res. 16: 10881-90; Huang et a 1. (1992), Comp. Appl. BioSci. 8: 155—65 and Pearson ef al. (1994), Meth. Mol. Biol. 24:30 it is disclosed in 31. NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. (1990), J. Mol. Biol. 215: 403-10) is accessible from the National Center for Biological Information (NBCI), and is available on the Internet in blastp, blasm, It can be used in conjunction with sequencing programs such as blastx, tblastn and tblastx. BLSAT is accessible at http://www.ncbi.nlm.nih.gov/BLAST/. Sequence homology comparison method using this program is http: // 丽. ncbi.nlm.nih.gov/BLAST/blast_heli). You can check it in html. According to a more preferred embodiment of the invention, a single domain of the invention The antibody heavy chain CDR amino acid sequence is an amino acid sequence comprising CDR1 of SEQ ID NO: 24, CDR2 of SEQ ID NO: 31 and CDR3 of SEQ ID NO: 38, _CDR1 of SEQ ID NO: ₂₅ , CDR2 of SEQ ID NO: 32 And an amino acid sequence comprising CDR3 of SEQ ID NO: 39, CDR1 of SEQ ID NO: 26, CDR2 of SEQ ID NO: 33, and CDR1 of SEQ ID NO: 40, CDR1 of SEQ ID NO: 27 , Amino acid sequence comprising CDR2 of SEQ ID NO: 34 and CDR3 of SEQ ID NO: 41, CDR1 of SEQ ID NO: 28, CDR2 of SEQ ID NO: 35, and CDR3 of SEQ ID NO: 42 , An amino acid sequence comprising CDR1 of SEQ ID NO: 29, CDR2 of SEQ ID NO: 36, and CDR3 of SEQ ID NO: 43, CDR1 of SEQ ID NO: 30, CDR2 and SEQ ID NO: 37 of SEQ ID NO: 37 The list is selected from the group consisting of the amino acid sequence comprising a CDR3 sequence of claim 44.

According to the most preferred embodiment of the present invention, the single domain antibody of the present invention consists of SEQ ID NO: 1 to 7 consisting of four sites (FR1-FR4) and three complementarity determining sites (CDR1-CDR3) Selected from the group consisting of amino acid sequences.

Antibodies of the invention include not only antibodies of the amino acid sequences described above, but also monoclonal antibodies, humanized antibodies and chimeric antibodies comprising some or all of the amino acid sequences.

According to a variant of the invention, the monodomain antibody against MUC1 of the invention is at least a divalency antibody comprising at least two or more monodomain antibodies. For bivalent or more antibodies, single domain antibodies may have the same amino acid sequence, and black may not all have the same sequence. It is within the scope of the present invention that a single domain antibody against MUC1 does not all share the same sequence but includes the same target, a single domain antibody against MUC1 against one or more of its antigens.

According to a preferred embodiment of the present invention, the single domain antibody of the present invention is further bound to a functional molecule. Since MUC1 is a molecule that is generally expressed on the surface of epithelial cells, a functional molecule can be additionally bound to a single domain antibody against MUC1 and used for the prevention, treatment or diagnosis of carcinoma expressing MUC1. According to a preferred embodiment of the present invention, the functional molecule additionally bound to the single domain antibody of the present invention is a chemical, peptide, polypeptide, nucleic acid, carbohydrate, lipid or inorganic particle, more preferably chemical, peptide, polypeptide Or inorganic particles.

As functional molecules, the chemical is preferably a pharmacologically active substance, more preferably an anticancer agent, for example, abyssin, aclarubicin, acodazole, acromycin, adozelesin, alanosine, aldehydes. , Allopurinol sodium, Althetamine, Aminoglutetimide, Amonapiide, Ampligen, Amsacrine, Androgens, Anguidine, Apidicholine glycinate, Asari, Asparaginase, 5-Aza Citidine, Azathioprine, Bacillus Calmette-Guerin (BCG), Bakers Antipole, Beta-2—Deoxythioguanosine, Bisantrene HC1, Bleomycin Sulfate, Bullionine, Butionine Suloximine, BWA 773U82, BW 502U83 / HC1, BW 7U85 mesylate, ceracemide, carbetimer, carboplatin, carmustine, chlorambucil, chloroquinoxaline-sulfonamide, chlorozotocin, chromomai Sin A3, Cisplatin, Cladribine, Corticosteroids, Corinbacterium Parboom, CPT-11, Crisna, Cyclocytidine, Cyclophosphamide, Ci-itarabine, Cytembena, Davies Maliate, Decarbazine ， Dactinomycin, Daunorubicin HC1, Diazauridine, Dexauramic acid, Dihydrohydrogalacti, Diajikuon, Dibromodulci, Didemin B, Diethyldithiocarbamate ， Diclico Aldehyde, Dihydro-5-Azacytin, Doxorubicin, Echinomycin, Deda trexate, Edelfosin, Eplenithine, Eliots solution, Elsamitrusine, Epirubicin, Esorubicin, Estramustine phosphate, Estrogen , Etanidazol, Ethiophos, Etoposide, Padrazole, Pazarabine, Penretinide, Filgrastim, Finasteride, Flavone Acetic Acid, Plutok Yuridine, Fludarabine Phosphate, 5'-Fluorouracil, F! Uosol ™, Flutamide, Gallium Nitrate, Gemcitabine, Goserelin Acetate, Hepsulpam, Nutrimethylene Bisacetamide, Homohartontonin, Hydrazine Sulfate, 4-Hydroxyandrostenedione, Hydrourea, Idarubicin HC1, Iphosphamide, 4-Ipomeanol, Iproplatin, Isotretinoin, Leucovorin Calcium, Leproprolide Acetate, Levamisol, Liposome Daunorubicin ， liposome capture doxorubicin ， romastin ， Methanol extracts of Rhodamine, Maitansine, Mechloretamine Hydrochloride, Melphalan, Menogaryl, Merbaron, 6-mercaptopurine, Mesna, Bacillus calete-guerine Methotrexate, N-methylformamide, Mifepristone, Mitoguazone, mitomycin-C, mitotan, miroxanthrone hydrochloride, monosite / macrophage colony-stimulating factor, nabilone, napoxidine, neocarcinostatin, octreotide acetate, ormaplatin, Oxaliplatin, paclitaxel, pala, pentostatin, piperazinedione, fibrobromine, pyrarubicin, pyritrexime, pyroxanthrone hydrochloride, PIXY-321, plicamycin, porpimer sodium, prednisostin, pro Carbazine, Progestins, Pyrazopurin, Razoic Acid, Sargramothim, Semustine, Spirogermanium, Spyromus Tin, strepto-nigreen, straptozosin, sulofener, suramin sodium, tamoxifen, taxorere, tegapur, teniposide, terephthalamidine, theeroxrone, thioguanine, thiotepa, thymidine injection, thiazofurin , Topotecan, toremifene, tretinoin, trifluoroferrazine hydrochloride, trifluidine, trimetrexate, tumor necrosis factor, uracil mustard, vinblastine sulfate, vincristine sulfate, vindesine, vinorelbine Vinzolidine, Yoshi 864, zorubicin, cytosine arabinoside, etoposide, melparan, taxol and combinations thereof, but not limited to these. As the anticancer agent, most preferably methotrexate, doxorubicin, daunorubicin, cytosine arabinoside, etoposide, 5'-polourouracil, melfaran, chlorambucil, cyclophosphamide, cisplatin, binddesin, mai Tomycin, bleomycin, tamoxifen and taxol.

Peptides or polypeptides as functional molecules are not particularly limited and include hormones, hormone analogs, enzymes, inhibitors, signaling proteins or parts thereof, antibodies or parts thereof, short chain antibodies, binding proteins or binding domains, antigens, adhesion proteins , Structural proteins, regulatory proteins, toxin proteins, cytokines, transcriptional regulators, blood coagulation factors, and vaccines, but are not limited thereto. More specifically, the peptide or polypeptide additionally bound to the single domain antibody of the present invention is insulin, insulin-like growth factor 1 (IGF-1), growth hormone, erythropoietin, G-CSFs (granulocyte— colony) stimulating factors), GM-CSFs (granulocyte / macrophagea: olony stimulating factors), interferon alpha interferon beta, interferon gamma, interleukin-1 alpha and beta, interleukin-3 interleukin-4, interleukin-6, interleukin-2, EGFs (epidermal growth factors) calcitonin ), ACTH (adrenocorticotropic hormone), TNF (tumor necrosis factor), Atobisban, buserel in buseroelx, cetrorelix, deslorelin desmopressin ), Dynorphin A (1-13) elcatonin, eleidosin eptipifide, GHRH-II (growth hormone releasing hormone I II), gonadorerin (gonadorel in), goserel in histrelin, leuprorelin, lypressin octreotide, oxytocin, pitressin secretin secret in), sincal ide, terri Ter 1 ipressin thymopentin, thymosine αΐ triptorelin, bivalirudin carbetocin, cyclosporin, exedine lanretide ( lanreotide, LHRH (luteinizing hormone-releasing hormone), naparlin, parathyroid hormone, pramlint ide, T-20 (enfuvirtide), thymalfasin, ziconotide, lysine, Lysine A chain, Pseudomonas exotoxin, diphtheria toxin, pokeweed antiviral protein, abrin, abrin A chain, cobra venom factor, gelonin, saporin, modecin ), Volkensin, biscumin, Clostridium FERRINGGENS phospholipase C and bovine pancreatic ribonucleases.

According to a preferred embodiment of the present invention, the peptide or polypeptide as a functional ingredient of the present invention is a cell killing substance as lysine, lysine A chain, Pseudomonas exotoxin, diphtheria toxin, pokeweed antiviral protein, abrin ), Abrin A hex, Cobra Venom factor, gelonin, sapor in, modeccin, volkensin, viscumin, Clostridium perpringens force Lipase C and bovine pancreatic ribonucleases, more preferably diphtheria toxin. Toxin proteins, as cell killing substances, are fused with the single domain antibodies of the invention to produce recombinant immunotoxins.

According to another preferred embodiment of the present invention, the diphtheria toxin additionally bound to the present invention is bound directly to a single domain antibody or indirectly through a linker.

In the present invention, "directly linked" means a recombinant immunotoxin to which only diphtheria toxin and a single domain antibody are combined and not fused through a linker, and "indirectly coupled" means that the linker is interposed therebetween. By recombinant immunotoxin, a diphtheria toxin and a single domain antibody are combined and fused.

The linker used in the present invention may be any compound or peptide linker used in the art as a linker depending on whether the functional molecule is a compound or a peptide that binds to a single domain antibody, and a linker suitable for the type of functional group in the single domain antibody may be used. You can choose. For example, when the functional molecule is a compound, the compound as a linker is N-succinimidyl iodoacetate, N_Hydroxysuccinimidyl Bromoacetate, or m-maleic. M-Maleimidobenzoyl-N-hydroxyoxyccideimide ester, m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester, N-Malimidobutyryloxysuccinamide astere (N-Ma 1 eimi dobut yry 1 oxysucc i nam i de ester), (N—

Ma 1 eimi dobut yr y 1 oxysu 1 f osucc i nam i de ester), Ε—maleimido ^ 1 "proic acid hydrazideHCl1 (E-Maleimidocaproic acid hydrazide-HC1), [N 一 maledidocaproyloxy -Succinamide] ([N- (E-maleimidocaproyloxy)-succinamide]), [N-maleimidocaproyloxy) -sulfosuccinamide] ([N- (E- maleimidocaproyloxy) -sul fosuccinamide]), maleimido Maleimidopropionic Acid N-Hydroxysuccinimide Ester, Maleimidopropionic Acid N-Hydroxysulfosuccinimide Ester, Maleimidopropionic Acid N-Hydroxysuccinimide Ester, Maleimidopropionic Acid N-Hydroxysuccinimide Ester (Maleimidopropionic Acid HydrazideHc1), N-succinimidyl-3_ (2-pyridyldithio) propionate, N-succinimidyl

(Iodoacetyl) aminobenzoate (N-Succinimidyl- (4-iodoacetyl ) aminobenzoate), succinimidyl - (N_ maleimido-methyl) cyclohexane-1-carboxylate acid (Succinimidyl- (N-maleimidomethyl) cyclohexane ^~ l-car boxy late), succinimidyl-4- (p-maleimidophenyl) butyrate, sulfosuccinimidyl— (4 一 iodoacetyl) aminobenzoate ( Sulfosuccinimidyl- (4- iodoacetyl) aminobenzoate), sulfosuccinimidyl 一 4— (Ν— maleimidomethyl) cyclonucleic acid-1-carboxylate (Sulfosuccinimidyl— 4- (Ν- maleimi dome thy 1) eye 1 ohexane_l 一car boxy late), Sulfosuccinimidyl-4-(-maleimidophenyl) butyrate, m-maleimidobenzoic acid hydrazide HC1), 4- (N-maleimidomethyl) cyclonucleic acid-1-carboxylic acid hydrazide Η (: 1 (4- (N-Ma 1 eimi dome t hy 1) e ye 1 ohexane- 1-car boxy lie acid hydrazide HC1), 4- (4-N-maleimidophenyl) butyric acid hydrazide HC1 (4- (4-N-maleimidophenyl) butyric acid hydrazide-HC1), N- Succinimidyl 3- (2-pyridyldithio) propionate (N-succinimidyl 3_ (2-pyridyldithio) propionate), bis (sulfosuccinimidyl) suberate (Bis (sulfosuccinimidyl) suberate), 1,2 Di [3 ，-(2'-pyridyldithio) propionamido] butane (1,2-Di [3 '-

(2 ， pyridyldithio) propionamido] Butane), Dissuccinimidyl Suberate, Dissuccinimidyl Tartarate, Disulfosuccinimidyl Tartarate, Dithio- Bis- (succinimidyl propionate) (Dithio-bis- (succinimidyl propionate)), 3,3'-dithio-bis- (sulfosuccinimidyl-propionate) (3,3'-Di thio -bi s- (sulfosuccinimidyl -prop i onat e), ethylene glycol bis (Sthenimidyl succinate) and ethylene glycol bis (sulfosuccinimidyl succinate) (Ethylene Glycol bis (Sulfosuccinimidylsuccinate)), but is not limited thereto. On the other hand, the sequence of a suitable peptide linker used when the functional molecule bound to the single domain antibody is a peptide or polypeptide can be selected in consideration of the following factors: ( _a ) which can be applied to a flexible extended structure ability; (b) the ability not to create secondary structures that interact with epitopes; And (c) the absence of a hydrophobic moiety or moiety that can react with the epitope. Preferred peptide linkers include Gly, Asn and Ser residues.

Other neutral amino acids such as Thr and Ala can also be included in the linker sequence. Suitable amino acid sequences for linkers are Maratea et al. (1985), Gene 40: 39-46; Murphy et al. (1986), Proc. Natl. Acad Sci. USA 83: 8258-8562; US Pat. Nos. 4,935,233, 4,751,180 and 5,990,275. The linker sequence may consist of 1-50 amino acid residues. Exemplary linker sequences include, “Gly Gly Gly Gly Ser Gly Gly Gly Ser”, “Gly Gly Gly Gly Gly Ser Gly”.

Gly Gly Gly Ser Gly Gly Gly Ser "," Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser "," Gly Ser Thr Ser Gly

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly "or" Gly Ser

Thr Ser Gly Lys Pro Ser Glu Gly Lys Gly ", preferably" Gly Gly Gly Gly Ser Gly Gly Gly Ser "of SEQ ID NO: 15.

According to the most preferred embodiment of the present invention, when the diphtheria toxin is directly bound to a single domain antibody in the present invention, the single domain antibody is selected from the group consisting of amino acid sequences consisting of SEQ ID NO: 8 to 14 Amino acid sequence.

According to another most preferred embodiment of the present invention, in the present invention, when the diphtheria toxin is indirectly bound to a single domain antibody through a linker, the single domain antibody is selected from the group consisting of SEQ ID NOs: 17 to 23 Amino acid sequence.

According to another preferred embodiment of the present invention, the functional molecule additionally bound to the single domain antibody of the present invention is a contrast agent as a compound or inorganic particle (e.g. T1 contrast agent, T2 contrast agent such as superparamagnetic substance, radioisotope, etc.) ᅳ fluorescent markers (eg, fluorescent quantum dots) or staining material. According to still another aspect of the present invention, the present invention provides a

Nucleic acid molecules encoding single domain antibodies against MUC1 are provided.

As used herein, the term “nucleic acid molecule” is meant to encompass DN gDNA and cDNA) and RNA molecules inclusively, and the nucleotides that are the basic structural units in nucleic acid molecules are natural nucleotides, as well as analogs in which sugar or base sites are modified. also included (analogue) (Scheit (1980), Nucleotide Analogs, John Wiley, New York; Uhlman and Peyman (1990), Chemical Reviews, 90: 543-584).

Nucleic acid molecules encoding a single domain antibody consisting of an amino acid sequence consisting of SEQ ID NO: 1 to 7 of the present invention is SEQ ID NO: 45 to 51, each consisting of SEQ ID NO: 8 to 14 Nucleic acid molecules encoding a recombinant immunotoxin in which a diphtheria toxin is directly bound to a single domain antibody composed of an amino acid sequence are SEQ ID NOs 52-58, respectively, and comprise an amino acid sequence consisting of SEQ ID NOs 17-23 Nucleic acid molecules encoding a recombinant immunotoxin wherein the constructed single domain antibody and diphtheria toxin are indirectly bound through a linker are SEQ ID NOs: 59-65, respectively.

Nucleic acid molecules of the invention are also construed to include nucleotide sequences that exhibit substantial identity to the nucleotide sequences described above. The above substantial identity is at least 80% when the nucleotide sequence of the present invention and any other sequence are arranged as maximally as possible and the sequence is analyzed using algorithms commonly used in the art. By nucleotide sequence exhibiting homology, more preferably at least 90% homology, most preferably at least 95¾ homology. According to another aspect of the present invention, there is provided a recombinant vector comprising a nucleic acid molecule encoding the aforementioned single domain antibody of the present invention or a nucleic acid molecule encoding the amino terminal region of MUC1.

As used herein, the term "vector" refers to a gene of interest in a host cell. Plasmid vectors as a means for expression; Phageimide vector; Cosmid vector; And viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated virus vectors, and the like, and are preferably phagemid vectors or polamide vectors.

According to a preferred embodiment of the invention, the nucleic acid molecule encoding a single domain antibody in the vector of the invention is operatively linked with the promoter.

As used herein, the term “operably linked” means a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences, thereby The regulatory sequence will control the transcription and / or translation of said other nucleic acid sequence. The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, This document is incorporated herein by reference.

Vectors of the invention can typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts.

When the vector of the present invention is an expression vector and the prokaryotic cell is a host, a strong promoter capable of promoting transcription (for example, the tac promoter, the lac promoter, the lacUV5 promoter, the lpp promoter, the p promoter, the ρΐλ promoter, the rac5 promoter, amp promoters, recA promoters, SP6 promoters, trp promoters and T7 promoters, etc.), ribosome binding sites and transcription / detox termination sequences for initiation of translation. When E. coli (e.g., HB101, BL21, DH5 α, etc.) is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthetic pathway (Yanofsky, C. (1984), J. Bacteriol., 158: 1018) -1024) and phage. Left promoter of λ (p promoter, Herskowitz, I. and Hagen, D. 1980), Ann. Rev. Genet. , 14: 399-445) can be used as regulatory sites. On the other hand, often used plasmid (such as in the art are vectors that can be used in the present invention: pSClOl, pGV1106, pACYC177, ColEl, pKT230, _Ρ ΜΕ290, PBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFRl, Made by manipulating pHVU, pGEX series, ET series and pUC19), phagemids (e.g. pComb3X), phages (e.g. gt4-λΒ, λ -Charon, λ Δζΐ and M13) or viruses (e.g. SV40 Can be.

On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is a host, a promoter derived from the genome of mammalian cells (e.g., metallothionine promoter) or a promoter derived from a mammalian virus (e.g., adeno) Late viral promoters, vaccinia virus 7.5k promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence. The vector of the present invention may be fused with other sequences as needed to facilitate the purification of the amino terminus protein of MUC1 expressed therefrom, and the sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), Maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x HisChexahistidine; Quiagen, USA) may be used, but is not limited thereto. Preferably the MUC1 protein expressed by the vector of the invention is purified by affinity chromatography, preferably by Ni-affinity column.

On the other hand, the expression vector of the present invention as an optional marker, and may include antibiotic resistance genes commonly used in the art, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin And resistance genes for neomycin and tetracycline.

The vector expressing the single domain antibody or MUC1 antigen of the present invention is preferably a system for expressing the single domain antibody and the MUC1 antigen in separate vectors, respectively.

According to another aspect of the present invention, the present invention provides a host cell comprising the vector of the present invention described above. Host cells capable of stably and continuously cloning and expressing the vector of the present invention may use any host cell known in the art, for example, Escherichia coli, Bacillus subtilis and Bacillus thuringin Bacillus genus strains such as cis, Streptomyces, Pseudomonas (e.g. Pseudomonas putida), Proteus mirabilis or Staphylococcus (e.g. For example, but not limited to, prokaryotic host cells such as Staphylocus carnosus. The host cell is preferably E. coli and more preferably E. coli ER2537, E. coli ER2738, E. coli XL-1 Blue, E. coli BL21 (DE3), E. coli JM109, E. coli DH Series, Ε · coli T0P10, E. coli TGI and E. coli HB1. Most preferably the host cell is E. coli ER2537, E. coli BL2KDE3) or E. coli TOP10. In the present invention, E. coli can be used for mass production at low cost by overexpressing a single domain antibody.

The method of carrying the vector of the present invention into a host cell may be performed by CaC12 method (Cohen, SN et al. (1973), Proc. Natl. Acac. Sci. USA, 9: 2110-2114), one method (Cohen, SN et al. (1973), Proc. Natl. Acac. Sci. USA, 9: 2110-2114; and Hanahan, D. (1983), J. Mol. Biol., 166: 557-580) and electroporation methods ( Dower, WJ et al. (1988), Nucleic. Acids Res., 16: 6127-6145).

The vector injected into the host cell can be expressed in the host cell, in which case a large amount of the single domain antibody or MUC1 antigen of the present invention is obtained. According to another aspect of the present invention, the present invention provides a method for preparing a single domain antibody against mucin antigenl (MUC1) comprising the following steps: (a) a nucleic acid molecule encoding the single domain antibody of the present invention as described above Culturing the host cell transformed with the recombinant vector comprising a; And (b) expressing a single domain antibody against MUC1 in said host cell.

The culture of the host cell transformed in the single domain antibody production is It can be made according to the appropriate medium and culture conditions known in the art. This culture process can be used by those skilled in the art can be easily adjusted according to the strain selected. Such various culture methods can be found in various literatures (eg,

James M. Lee, Biochemical Engineering, Prentice-Hal 1 International Editions, 138-176. Cell culture is divided into a batch culture, a fed-batch, and a continuous culture method according to suspension culture, adhesion culture, and culture method according to the cell growth method. The medium used for culturing must adequately meet the requirements of the particular strain.

During the culture, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, during the culture, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble generation. In addition, to maintain the aerobic state of the culture, oxygen or oxygen-containing gas (eg air) is injected into the culture. The temperature of the culture is usually 20 ^° C to 45 ^° C, preferably 25 ^° C to 40 ^° C.

Antibodies obtained by culturing the transformed host cell can be used without purification and can be further purified and purified using various conventional methods such as dialysis, salt precipitation and chromatography. Among them, a method using chromatography is most commonly used, and the type and order of columns can be selected from ion exchange chromatography, size exclusion chromatography, and affinity chromatography according to the characteristics of the antibody and the culture method. According to another aspect of the present invention, the present invention provides a pharmaceutical composition for anticancer immunotherapy comprising (a) a pharmaceutically effective amount of a single domain antibody against MUC1 of the present invention, (b) a pharmaceutically acceptable carrier. to provide. According to another aspect of the present invention, the present invention provides a cancer diagnostic composition comprising a single domain antibody against MUC1 of the present invention described above. Since the single domain antibody prepared by the above method specifically binds to the MUC1 tumor antigen, the single domain antibody may be used as a pharmaceutical composition for anticancer immunotherapy or a cancer diagnostic composition alone or in combination with a conventional pharmaceutically acceptable carrier. According to a preferred embodiment of the present invention, the cancer to which the composition of the present invention is applied is a cancer expressing MUC1, and more preferably, bile duct cancer, bladder cancer, brain tumor, breast cancer, cervical cancer, chorionic cancer, colon cancer, endometrium Cancer, esophageal cancer, gastric cancer, multiple myeloma, AIDS-related leukemia and adult T-cell lymphoma / leukemia, intraepithelial cancer, liver cancer, lung cancer, lymphoma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, Testicular cancer, thyroid cancer or renal cell cancer, even more preferably breast cancer, prostate cancer, lung cancer, ovarian cancer, colon cancer, renal cell cancer or brain tumor, most preferably breast cancer.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in the preparation, lactose, textose, sucrose, sorbbi, manny, starch, acacia rubber, phosphate, alginate, Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil Including, but not limited to. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The term, "pharmaceutically effective amount" means an amount sufficient to prevent or treat cancer expressing MUC1. The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, intraarterial injection around cancer tissue, transdermal administration, or the like. have.

Appropriate dosages of the pharmaceutical compositions of the present invention may vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to the patient. Can be. On the other hand, the dosage of the pharmaceutical composition of the present invention is preferably 0.001-100 mg / kg (body weight) per day.

The pharmaceutical composition of the present invention can be easily carried out by those skilled in the art according to the present invention, 10006295

Formulated with pharmaceutically acceptable carriers and / or excipients may be prepared in unit dose form or may be prepared by incorporation into a multidose container. The formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium or in the form of an external preparation including axles, powders, granules, tablets, capsules or gargles, ointments, solids, cataplasmas, , May further include a dispersant or stabilizer. The compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, i.e. in the form in which other therapeutic agents (functional molecules) are bound to the single domain antibody. According to a preferred embodiment of the invention, the functional molecule (therapeutic agent) is a chemical, peptide, polypeptide, nucleic acid, carbohydrate, lipid or inorganic particle.

Functional molecules for the prevention or treatment of cancer by in vivo in the form of antibody-therapeutic conjugates, including toxin proteins and enzymes as anti-cancer agents, peptides or polypeptides, preferably as chemicals, as described above It is omitted to avoid duplication of specification.

Various conditions suitable and desirable for targeting agents to specific target sites are reported, for example, in Trouet et al. (1982), Plenum Press, New York and London, 19-30. Many of the problems arising from the treatment of drug-resistant tumors can be addressed by targeted anticancer therapies by targeting effective therapies directly to the lesions using highly specific antibodies prepared against the MUC1 antigen. Drugs targeted to the lesion may also elevate the drug to high concentrations at the tumor site.

According to another aspect of the present invention, the present invention provides a diagnostic kit for detecting MUC1 tumor antigens comprising the single domain antibody of the present invention against MUC1 described above.

The single domain antibodies of the invention against the MUC1 tumor antigen can be applied to biological samples to diagnose the development of cancer in which MUC1 is expressed. As used herein, the term "biological sample" includes but is not limited to tissues, cells, whole blood, serum, plasma, tissue autopsy samples (brain, skin, lymph nodes, spinal cord, etc.), cell culture supernatant, ruptured eukaryotic cells, and the like. It is not limited. These biological samples may be reacted with a single domain antibody of the present invention, with or without manipulation, to confirm the occurrence of cancer expressing MUC1.

The formation of the antigen-antibody complexes described above can be performed by the colormetric method, the electrochemical method, the fluorescence method, the luminometry, the particle counting method, and the visual assessment. Alternatively, it can be detected by scintillation method (scinti 1 lat ion counting method).

"Detection" herein is for detecting antigen-antibody complexes and can be carried out using various labels. Specific examples of the label include enzymes, fluorescent, ligands, luminescent, microparticles or radioisotopes. Enzymes used as detection markers include acetylcholinesterase, alkaline phosphatase, β-D-galactosidase, horseradish peroxidase and β-latamase, and the like, and fluorescein , Eu ³ +, Eu ³ + chelate or creep includes a Tate or the like, and a ligand, including biotin derivatives, and to the light-emitting water and the like acridinium esters and isobutyl luminol derivative, the colloidal gold with fine particles And colored latex and the like, and radioisotopes include 57Co, 3H, 1251, and 1251-Bolton Hunter reagent reagents.

Preferably, the antigen-antibody complex can be detected using enzyme immunosorbent adsorption (ELISA). Enzyme immunosorbent methods (ELISA) include direct ELISA using labeled antibodies that recognize antigens attached to a solid support, and indirect ELISAs using labeled secondary antibodies that recognize captured antibodies in a complex of antibodies that recognize antigens attached to a solid support. Direct sandwich ELISA using another labeled antibody that recognizes the antigen in the complex of the antibody and the antibody attached to the solid support, followed by reaction with another antibody that recognizes the antigen in the complex of the antibody and the antigen attached to the solid support. Various ELISA methods include indirect sandwich ELISAs using labeled secondary antibodies that recognize the antibody. Antibodies of the invention may have a detection label, the detection label If not, the antibody of the present invention can be captured and can be identified by treating another antibody having a detection label.

Advantageous Effects

The features and advantages of the present invention are summarized as follows:

(1) Development of MUC1-specific Single Domain Antibody Clones

In the present invention, a gene domain of a single domain antibody was constructed and a single domain antibody gene clone capable of specifically binding to the MUC1 protein was selected. And by developing a method that can be isolated and purified through the E. coli expression system proposed a method that can economically mass-produce MUC1 specific single domain antibodies, the produced single domain antibodies are produced in various tumors expressing MUC1 antigen It can be used for diagnosis and treatment. (2) In Vivo Imaging of MUC1-positive Tumors

When the anti-MUC1 single domain antibody selected in the present invention is combined with an imaging probe such as a quantum dot, the anti-MUC1 single domain antibody can be used for diagnosis of tumors through in vivo imaging. Mouse model tests expressing MJC1 positive tumors demonstrated that tumor-specific target imaging of selected antibodies was possible and suggested that it could be used as a tool for diagnosing various target-type cancer tissues in the future.

(3) Use as an anti-tumor target therapeutic agent through the production of immunotoxin

In the present invention, a recombinant immunotoxin was produced by fusing diphtheria toxin to the selected anti-MUC1 single domain antibody, and the MJC1 specific efficacy of the immunotoxin was demonstrated in cell culture model and in vivo tumor animal model. Therefore, it was suggested that the selected single domain antibody can be used as an anti-tumor target therapy through immunotoxin production. [Brief Description of Drawings] 1 is a gel photograph showing total RNA samples isolated and purified from camel peripheral blood leukocytes. RNA isolated from a total of three camels # 1, # 2 and # 3 was purified by separate experiments of 1-10, 1-7 and 1-11, respectively.

2 shows a single domain antibody gene amplification strategy for single domain antibody construction. Panel a) shows a cDNA production method of a single domain antibody gene and panel b) shows a schematic diagram of amplification strategy of the PCR method capable of specifically amplifying only a single domain antibody coding region in the produced cDNA.

Figure 3 panel a) is a gel image of the first amplified single domain antibody gene samples (about 650 bp) from cDNA samples and panel b) a gel image of the two-step enzyme chain reaction results (about 450 bp) samples Indicates. # 1-3 on the left side of the panel is the camel individual number, and each gel photograph in the panel is the result of the amplification fragments obtained from the respective RNA samples prepared in FIG. M represents a 1 kb DNA size marker.

4 shows a strategy diagram for constructing a single domain antibody gene phagemid library. Phageimide vector DNA into which the fragments amplified through FIGS. 1 and 3 were inserted into E. coli and phages expressing single domain antibody proteins were generated using helper phage.

FIG. 5 shows the results of experiments in which 10 clones were randomly selected from a phagemid library into which a single domain antibody gene was inserted to purify DNA, and treated with Sfil restriction enzymes to identify the inserted single domain antibody gene.

Figure 6 shows the results of the diversity evaluation of the produced single domain antibody library. To determine the diversity of the library, and optionally making the selection of 19 clones, ompseq (5 '-AAGACAGCTAT CGCGATTGCAG- 3') and ^{^{gback (5 '- GCCCCCTTATTAGCGTTTGCCATC -3'}} ) limit the gene PCR fragment amplified with the primer set BstOl RFLP analysis was performed by treatment with enzymes.

^"Figure 7 is a schematic diagram showing the recombinant DNA (a) and the check result of the expression and purification of MUC1-N protein with this, (b) used for the production of MUC1-N protein. The gene fragment encoding the MUC1-N protein was cloned into the pET23d vector, which was then introduced into E. coli to express and purify the protein, and Western blot using Coomassie blue staining (CBB st a in) and anti-MUC1 antibody. Check with (B). E. coli lysate before protein purification (b, lane 1) and protein samples after purification (lane 2) were used for analysis, respectively. ·

8 is a graph showing the panning results of the single domain antibody library for MUC1. Phage titers put in MUC1-adsorbed 96 well plates and phage titers separated after washing (0/1 ratio) were displayed for each panning step.

9 shows analysis results of some antibody clones showing high affinity for MUC1 using ELISA in clones obtained through panning. Anti-pi II Ab was used as a positive control and pComb3xTT phage sample as a negative control group, and the absorbance increase value obtained by dividing the absorbance of each test sample by the absorbance value of the negative control group.

Figure 10 shows the results of analyzing the amino acid sequence of the selected single domain antibody gene clones. The human VH3 amino acid sequence and the sequence of the selected clones were compared and analyzed on the basis of IMGT numbering, and 4 FR (frame region) and 3 CDR (comp 1 ement arity determining reg) n (n CDR) n were displayed. Hallmark amino acid residues of the gene are indicated with a red box.

11 shows the results of analysis of single domain antibody clones expressed and purified in E. coli by Western blot using Coomassie blue staining (CBB stain), anti-HA antibody and anti-His antibody after SDS-PAGE. give.

12 shows the results of confirming the reactivity of the anti-MUC1 single domain antibody to the MUC1 expressing cell line through confocal microscopy. Panel a) shows the results of confirming MUC1 protein expression in MC38-MUC1 cells and MC38-pcDNA3.1 cells using anti-MUC1 antibody, panel b) immunofluorescence of cell lines using selected single domain antibody clone proteins. Show staining results.

FIG. 13 shows a sensorgram measuring the affinity of selected single domain antibody clones with MUC1 antigen. Anti-MUC1 Ab plotted the positive control and assay results of selected single domain antibody clones VHH524, VHH530, VHH33 and VHH39.

14 is a table analyzing the affinity of the single domain antibody and JC1 antigen. Figure 15 shows anti-MUC1 single domain antibody clones labeled with Q dots The results of in vivo imaging tests in the mouse tumor model used are shown. White ellipses indicate tumor inoculation sites and gray arrows mark Q dot signals accumulated on the tumor site.

Panel a) of FIG. 16 shows a plasmid schematic for the production of diphtheria toxin and camel single domain antibody fusion protein, and panel b) shows the cloning result. DT (G4S) 2-VHH524 and DT (G4S) 2—VHH530 represents an immunotoxin with linke (G4S) 2] between diphtheria toxin and single domain antibody genes, and DT-VHH524 and DT-VHH530 are single to diphtheria toxin Immunotoxins with direct fusion of domain antibodies are shown.

FIG. 17 shows the results of expression and purification of recombinant anti-MUC1 single domain antibody immunotoxin bound to diphtheria toxin followed by Western blot using Coomassie blue (CBB) staining and anti-His antibody.

18 is a sensorgram measuring the affinity of an immunotoxin for the MUC1 antigen.

19 shows the results of affinity analysis of immune toxins for MUC1 antigen. 20 is a graph showing the results of analysis of cell killing ability of recombinant immunotoxins on cells expressing MUC1. Panel a) shows the results of analysis using DT (G4S) 2-VHH524, b) shows the results of analysis using DT-VHH524 immunotoxin, and panel c) shows the cell killer test results of VHH524 clone without toxin binding.

21 is a graph showing tumor growth inhibitory effects of selected immune toxins in tumor animal models expressing MUC1. PBS is a negative control, VHH524 is a single domain antibody to which diphtheria toxin is not bound, and DT (G4S) 2-VHH524 is an immunotoxin bound to diphtheria toxin.

EXAMPLE

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for explaining the present invention in more detail, and the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention to those skilled in the art. Will be self-evident. EXAMPLE

Example 1. Gene Amplification of Single Domain Antibodies

RNA was isolated and purified 28 times from monocytes isolated from three camel peripheral blood (FIG. 1; numbers shown on the left of each panel are camel's individual number and lane number on electrophoresis picture with different RNA samples). Number), and the reverse transcriptase polymerase chain reaction was performed as a template to amplify the variable region of a heavy chain antibody (VHH) gene. Amplification of single domain antibody genes is followed by a two step polymerase chain reaction (PCR) (FIG. 2). The DNA fragment (approximately 650 bp) comprising a single domain antibody and a CH2 domain of a heavy chain antibody was synthesized via a first-stage polymerase chain reaction (Fig. 3a; the number shown on the left of each panel is a camel individual. No., lane number of electrophoresis picture is different RNA sample number), which was subjected to two-step enzymatic chain polymerization again to obtain 28 DNA fragments (450-500 bp) samples containing only VHH (FIG. 3b). ). The sequence of the primers used in the one-step polymerase chain reaction was VHBACK6: 5'-GATGTGCAGCTGCAGGCGTCTGGAGGAGG-3 '(SEQ ID NO: 66); CH2F0RT4: 5'-CGCCATCAAGGTACCAGTTGA_3 '(SEQ ID NO: 67), and the sequence of the primers used in the two-step polymerase chain reaction was VHBAC 4: 5' -CATGCCATGACTCGCGGCCCAGGCGGCCATGGCCGATGTGCAGCT-3 '(SEQ ID NO: 68); VHF0R36: 5'-TGAACTGGCCGGCCTGGCCTGAGGAGACGGTGACCTG-3 '(SEQ ID NO: 69). Example 2. Library Construction of Single Domain Antibodies

Single domain antibody that combines all 28 samples obtained by polymerase chain reaction to produce a library of single domain antibodies

DNA fragment samples and phagemid vector pComb3X (Scr ipps Research.

Institute, La Jolla, CA, USA) was treated with SfiKNEB, Ipswich, MA, USA) restriction enzymes and ligated to obtain recombinant DNA (FIG. 4), which was transformed into an E. coli ER2537 by an electrical transformation device (Gene Pulser). , Bio-Rad, Hercules, CA, USA). SB with Ampicillin E. coli ER2537 Transformed with Phagemid Vector Containing Single Domain Antibody DNA Fragments After 2 hours of incubation in the medium, it was infected with helper phage VCSM13 (Stratagene, La Jolla, Calif., USA), incubated for 18 hours, and single domain antibody phage libraries were recovered. To confirm the presence of a single domain antibody DNA fragment inserted into the phagemid vector, ten transformed E. coli ER2537 colonies were randomly selected and cultured, and the phagemid DNA was purified and treated with Sfil restriction enzymes. Single domain antibody DNA fragments (450-500 bp) inserted in were identified (FIG. 5). In order to confirm the diversity of the produced library, phagemid DNA was purified from 19 randomly selected colonies of E. coli, ompseq (5 '-AAGACAGCTATCGCGATTGCAG-3') (SEQ ID NO: 70) and gback (5 '-GCCCCCTTATTAGCGTTTGCCATC). 3 ') (SEQ ID NO: SEQ ID NO :) Amplified single domain antibody DNA fragments using the primers were subjected to RFLP analysis by BstOl restriction enzyme treatment. As shown in FIG. 6, all 19 clones analyzed showed different RFLP patterns, resulting in a single-domain antibody gene library with sufficient diversity. Example 3. Expression and Isolation Purification of Human MUC1 Protein

Screening for antibodies with high specificity to MUC1 in the MUC1 amino-terminal part to (MUC1-N, 2-147 amino acids , NCBI accession no .: J05582) a pET- 23d (+) vector (1: 1: 1: 1 ^"0 ∞) expression of the protein MUC1-N protein was expressed in the E. coli BL21-star (DE3) strain (Novagen, Madison, WI, USA), the E. coli was dissolved and Ni- in the supernatant. Purified using an NTA column (Novagen, Madison, WI, USA), elimination of imidazole via dialysis, polyacrylamide gel electrophoresis (PAGE), coomassie staining and anti-His antibody (Cell Signaling Technology, Beverly, Purity and amount of protein expressed in Western blot using MA, USA) (FIG. 7b; lane 1, pre-purification E. coli lysate, lane 2, sample after protein purification) Example 4. Single for MUC1 Selection of Domain Antibody Clones

The selection and retrieval of antibodies that recognize MUC1 from the constructed single domain antibody gene library is described in Barbas (Barbas CF 3rd et a 1. (1991), Proc Natl The phage display method of Acad Sci USA .88 (18): 7978-82 J was carried out.

First, purified MUC1-N protein (10 / g / ml) was added to 50 ^ aliquots in 96 well plates for coating of MUC1 protein and coated overnight at 4 ^° C. 50 antibody antibody phage libraries were added to a 96 well plate to which the MUC1-N protein was attached, bound for 1 hour at room temperature, washed 10 times with PBS, and recovered by treatment with 50 trypsin solution (10 mg / ml). The recovered phages were infected with E. coli ER2537 (New England Biolabs, Beverly, USA) in logarithmic growth phase, and then plated in ampicillin-added LB broth medium and incubated at 37 ^° C for 18 hours. Some phages were infected with E. coli ER2537 in logarithmic growth phase and then amplified using VCSM13 helper phage (Stratagene, La Jolla, Calif., USA) and used for panning.

For panning of the recovered single-domain antibody phage clones, colonies formed on LB agar medium were inoculated in 2 ml of SB (SB / Amp) liquid medium to which ampicillin was added and shaken at 37 ^° C for 250 hours at 250 rpm. At this time, in order to check the colony was inoculated in LB woofer medium and a master plate was prepared. The phage VCSM13 to the form 1010 to pfu, which was further cultured at 37 ^° C and incubated for 1 hour and 30 minutes at 250 rpm at 37 ^° C after the infection allowed to stand at room temperature for 30 minutes and addition of kanamycin for 18 hours. The culture solution was centrifuged at 3,000 rpm for 20 minutes to recover the supernatant containing phage, and then the phage was precipitated with 5 X PEG / NaCl (20 polyethylene glycol -8000, 2.5 M NaCl) solution. Phage precipitate was recovered with PBS solution containing 1% bovine serum albumin (BSA; Sigma, St Louis, MO, USA), 0.03% sodium azide (Sigma, St Louis, M0, USA). MUCl specific single domain antibody phagemid library was selected by repeating five panning cycles and quantifying the phage to determine 0/1 ratio (FIG. 8).

After panning, MUC1-specific single domain antibody phagemids with high binding strength were selected from the single domain antibody phage clones by ELISA. To this end, MUC1-N protein was immobilized in a 96 well plate and the recovered phage antibody was diluted in the same amount (1 × 10 10 PFU / ml) and reacted for 1 hour at phase silver. After washing five times, HRP-bound anti-M13 antibody was added to PBS. Diluted 1: 3000, 50 ^ each was added and reacted at room temperature for 1 hour. After the reaction, the reaction was washed 10 times and reacted by adding 50 ^ substrate reagent (TMB substrate reagent; Sigma, St Louis, MO, USA). After the development of color reaction, absorbance was measured at 450 nm by adding 50 fd of stop solution and shaking gently. The absorbance measured in each clone was normalized by the hop absorbance values obtained from the negative control group (pComb3XTT, phage expressing a single domain antibody against Tetanus toxin (TT)), and the absorbance increase rate was compared and analyzed. Antibody against was used as a positive control (FIG. 9). This resulted in the selection of six MUC1-specific single domain antibody clones whose absorbance increased more than 10-fold compared to the negative control. Example 5: Example of nucleotide sequence and amino acid sequence analysis of antibody fragment

Gene sequencing of MUC1-specific single domain antibody-phagemid clones selected through phage panning and ELISA was performed using Ompseq primers (5′-AAGACAGCTATCGCGATTGCAG-3 ′) (SEQ ID NO: 70). Sequence information and amino acid sequence information obtained through sequencing were compared using MegAlign software version 5 (DNAStar, Inc., Madison, Wis., USA) (FIG. 10). A comparative analysis of the amino acid sequence of the VH3 region of the human antibody and the obtained single domain antibody clones showed high homology of 45-57%, and IMGT (ImMunoGeneTics) numbering (Lefranc MP et al., (2003) Dev Corap Immunol; 27: 55-77.). The results of subsequent confirmation showed that the single domain antibody hallmark amino acid sequence (Ser 12, Phe 42, Arg) was found in all clones except for some of the amino acids present in the framework2 site. 50, Gly 52; red box) (FIG. 10). Example 6: Production and Purification of MUC1 Specific Single Domain Antibodies in E.

Among the MUC1-specific single domain antibody clones obtained by ELISA analysis, some clones (VHH524, 530, 33, 39) were incubated in SB / Amp medium, and the fulllasmid was extracted. Extracted plasmids from E. coli

To lOF'CStratagene, La Jolla, CA, USA) Inoculated into the liquid medium and incubated at 37 ^° C at 250 rpm for 18 hours. Cultures were re-inoculated with one hundredth to SB / Amp liquid medium, and cultured at 250 rpm at 37 ^° C. When the OD600 reached 0.5, IPTG (Sigma, St Louis, MO, USA) was added to the final ImM and incubated at 250 rpm for 4 hours at 37 ^° C. to express a single domain antibody protein. Overexpressed single domain antibody proteins were purified using a Ni-NTA affinity column and subjected to 15% SDS-PAGE for Coomassie blue staining, mouse anti-HA antibodies and anti-His antibodies (Cell Signaling Technology, Beverly, MA, USA), and confirmed by Western blot (Fig. 11). Example 7: Confirmation of MUC1 specificity of single domain antibody using immunofluorescence staining In order to confirm the reactivity of the selected H clones against MUC1, the cell line expressing MUC1 in colon cancer cell line MC38 cells (ATCC, Manassas, VA, USA) Immunofluorescence staining was performed using MC38-PCDNA3.1 transformed with only MC38-MUC1 cell line and pcDNA3.1 vector. Expression of MUC1 in these cell lines was confirmed by Western blot using anti-MUC1 antibody (clone VU4H5, Santa Cruz, CA, USA) (FIG. 12A). After fixing each MC38 cell line, the purified single domain antibody was reacted at room temperature for 1 hour, stained with an anti-His antibody conjugated with FITC, and observed for binding by confocal microscopy. Selected anti-MUC1 single domain antibody clones were confirmed to specifically react only to MC38-MUC1 cells at levels similar to the commercially available anti-MUC1 antibodies (clone VU4H5, Santa Cruz, CA, USA) (FIG. 12B). ). Example 8: MUC1 Affinity Analysis of Single Domain Antibodies Using BIAC0RE

The affinity for the MUC1 protein of the purified single domain antibody was determined by BIAC0 E 2000 (Pharmacia Biosensor AB, Uppsala, Sweden). Purified MUC1 protein was immobilized on the CM5 sensor chip (Pharmacia Biosensor AB, Uppsala, Sweden) by amine coupling method. Blocking the sensor chip to which the MUC1 antigen was fixed with ethanolamine was carried out affinity experiment. The reaction solution was HBS complete solution (10 mM HEPES, H 7.4, containing 150 mM NaCl, 3 mM EDTA, 0.005% surfactant P20) was used, and the flow rate of the antibody reaction solution was 30 / zi / min, and binding constants (Κοη) and dissociation constants (Koff) were determined using single domain antibody proteins of different concentrations between 62.5 ηΜ-1 μΜ. Measured (FIG. 13). The experiment was repeated three times and the affinity (Kd) for the MUC1 antigen of the single domain antibody was calculated as Kd = Kon / Koff (FIG. 14). The analysis of the sensorgram was analyzed by BIAevaluation 3.1 software (Pharmacia Biosensor), and the single domain antibody remaining on the surface of the CM5 chip after reaction was removed with 10 mM glycine solution (pH 2.5) after each measurement. As can be seen in the results of FIG. 14, the affinity of the prepared single domain antibody was measured to be 1.6-3.3 × 10 −7 M, and was used as a positive control anti-MUC1 antibody (clone VU4H5, Santa Cruz, CA, USA) It is relatively low compared to (0.2 X 10-7M), and the affinity comparison between them should take into account the fact that the positive control antibody has two antigen binding sites. Example 9: Establishment of a Mouse Tumor Model Expressing MUC1

EL4-MUC1 cell line expressing MUC1 in C57BL / 6 mice and EL4-pcDNA3.1 cell line as a negative control (Yang H et a 1. (2009), Clin Exp I 隱 unol, The Tat-conjugated N1 terminal region of mucin A mouse tumor model was constructed by administering 1 × 10 6 antigens (MUCl) induces protective immunity against MUCl one expressing tumours). Mice injected with tumor cells produced clear cancer tissues after 1 week, and in the present invention, experiments were performed after 2 weeks of cell injection. Example 10 Preparation of Fluorescent Quantum Dot Conjugates with a Single Domain Antibody Specific for MUC1 Antigen

Single domain antibodies (VHH524) were labeled with Qdot 800 using the Qdot 800 Antibody Binding Kit (Invitrogen, Carlsbad, Calif., USA) following the method suggested by the manufacturer. Activated Qdot 800 was reacted with antibody molecules treated with DTT at room temperature for 1 hour. Then reaction was stopped by adding β-mercaptoethanol. Separation column is used to remove unbound Qdot 800 molecules and single domain antibody with fluorescent quantum dots Purified. Experimental Example 11: Diagnostic Specificity Test of a Single Domain Antibody in an In vivo MUC1-positive Tumor Model

The reaction specificity of single domain antibodies in the MUC1 positive tumor mouse model constructed was evaluated. In vivo imaging equipment (Maestro, CRI Inc. Woburn, Intramuscular injection of 100 ιΛ (300 pmo 1/100) of a single domain antibody bound to fluorescent quantum dots into a mouse and concentration of the antibody into the tumor site in a mouse model MA, USA) When observed 2 hours, 5 hours and 24 hours after injection, it was confirmed that a single domain antibody reacted at the tumor site (white ellipse) where MUC1 is expressed after 2 hours. (Figure 15 right panel), it was confirmed that the antibody does not accumulate in tumors that do not express MUC1 (left panel of Figure 15.) Nonspecific antibody accumulation was observed in both the test group and the site estimated to be liver and spleen. In this case, a decrease in signal intensity was observed after 5 hours Example 12 Expression Purification of Diphtheria Toxin and Immunotoxin Combined with Single Domain Antibody and Familiarity with MUC1 Antigen Analysis

The E. coli expression system was used to produce recombinant immunotoxins in which selected anti-MUC1 single domain antibody genes were combined with diphtheria toxin genes (FIG. 16A). Gene encoding the subunit (1—388 AA) of the diphtheria toxin (DT) linking the (G4S) 2 linker to the pET-23a vector (Novagen, Madison, WI, USA) and the toxin without linking the linker The fragments were cloned into the EcoRI and Hindi II sites, respectively, and the selected single domain antibody genes were cloned into the Hindlll and Xhol sites at the C-terminus of the toxin. The immunotoxin gene inserted into the prepared recombinant plasmid was confirmed using restriction enzymes (FIG. 16B). The immunotoxin recombinant proteins were isolated and purified in E. coli in the same manner as in Example 6, and confirmed by Western blot using Coomassie blue staining and anti-His antibody (FIG. 17). The affinity of the purified immunotoxin for the MUC1 protein was measured using BIAC0RE 2000 in the same manner as in Example 8 (FIG. 18). Of the immunotoxin obtained through Coupling constants (Kon), dissociation constants (Koff), and affinity (Kd) are summarized in FIG. 19. Experimental Example 13: Analysis of cytotoxicity of immunotoxin against cells expressing MUC1 antigen

In order to confirm the MUC1-specific cell killing ability of the purified immunotoxin, cell killing assay was performed using MC38-MUC1 cell line and MC38-pcDNA3.1 cell line. Each cell line lX104 / well was dispensed with 200 ≠ in 96 well folate and treated with purified immunotoxin (50 j «g / ml-400« g / ml) for 48 hours, followed by MTT (Sigma, St Louis, MO, USA). Cell viability was examined using the assay. As can be seen in FIG. 20, in the experiments in which the linker introduced the immunotoxin (DT (G4S) 2-VHH524; FIG. 20A) and the unintroduced immunotoxin (DT-VHH524; FIG. 20B), the added immunotoxin was added. Statistically significant cell killing ability was observed for cell lines expressing MUC1 antigen in a concentration-dependent manner (*, p <0.05), and a slightly superior cell killing capacity was observed for the immunotoxin introduced with the linker. On the other hand, in the case of the antibody not bound to DT it was confirmed that almost no cell killing ability (Fig. 20c). This result means that the produced immunotoxin can bind specifically to the MUC1 antigen and exert its killing ability. Experimental Example 14 Evaluation of Tumor Growth Inhibition Activity of Immunotoxin in MUC1-positive Tumor Animal Model

In order to confirm the efficacy of purified immunotoxin in MUC1-positive tumor animal model, tumor model was established using MC38-MUC1 cell line and tumor growth was measured by administering 7 immunotoxins at 3 days interval one week after tumor injection. (FIG. 21A). Purified immunotoxin was injected intravenously at 50 β, 25 g or 12.5 per mouse, and a group injected with PBS alone and a group injected with 100 / g of mouse without DT binding antibody (VHH524) as a control group. Five mice were used in each group, and tumor size was measured for 27 days after tumor injection. As can be seen in the results of FIG. 21B, the control group observed very fast growth of the tumor. However, in the group injected with immunotoxin, it was confirmed that tumor growth was inhibited by ¾1 (* ， p <0.05). These results indicate that even when the prepared immunotoxins are applied in vivo, they can specifically react to MJC1 positive tumors to inhibit tumor growth and exhibit antitumor activity. Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that this specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the invention will be defined by the appended claims and equivalents thereof.

Claims

[Patent Claims]

[Claim 1]

Single domain antibody against MUC mucin antigen 1) comprising a heavy chain variable region having the following heavy chain CDR amino acid sequence: SEQ ID NO: 24 to SEQ ID NO: 30 CDR1 selected from the group consisting of amino acid sequences consisting of CDR2 selected from the group consisting of amino acid sequences consisting of SEQ ID NO: 31 to 37, and SEQ ID NO: 37 consisting of amino acid sequences consisting of SEQ ID NO: 38 to SEQ ID NO: 44 CDR3 selected from the group.

[Claim 2]

The amino acid sequence of claim 1, wherein the heavy chain CDR amino acid sequence comprises CDR1 of SEQ ID NO: 24, CDR2 of SEQ ID NO: 31 and CDR3 of SEQ ID NO: 38; CDR1 of SEQ ID NO: 25 Amino acid sequence comprising CDR2 of SEQ ID NO: 32 and CDR3 of SEQ ID NO: 39, CDR1 of SEQ ID NO: 26, CDR2 of SEQ ID NO: 33 and amino acid sequence comprising CDR3 of SEQ ID NO: 40 An amino acid sequence comprising CDR1 of SEQ ID NO: 27, CDR2 of SEQ ID NO: 34 and CDR3 of SEQ ID NO: 41, CDR1 of SEQ ID NO: 28, CDR2 of SEQ ID NO: 35, and SEQ ID NO: 42 of SEQ ID NO: 42 Amino acid sequence comprising CDR3, CDR1 of SEQ ID NO: 29, CDR2 of SEQ ID NO: 36 and CDR3 of SEQ ID NO: 43, and CDR1 of SEQ ID NO: 30, SEQ ID NO: A single domain antibody against MUC1, characterized in that the amino acid sequence selected from the group consisting of CDR2 of SEQ ID NO: 37 and CDR3 oligo of SEQ ID NO: 44.

[Claim 3]

The single domain antibody of claim 1, wherein the single domain antibody comprises an amino acid sequence selected from the group consisting of amino acid sequences consisting of SEQ ID NOs: 1 to 7 sequences.

[Claim 4]

According to claim 1, wherein the antibody is Camelidae (Camelidae) variable domain of a heavy chain antibody (VHH), characterized in that the single domain antibody against MUC1.

[Claim 5]

The single domain antibody of claim 1, wherein the single domain antibody is a divalent or higher antibody comprising at least two or more single domain antibodies.

[Claim 6]

The method of claim 1, wherein the single domain antibody is a single domain antibody against MUC1, characterized in that the functional molecule is further bound.

[Claim 7]

VII. The single-domain antibody against C1 of claim 6, wherein the functional molecule is a chemical, peptide, polypeptide, nucleic acid, carbohydrate, lipid or inorganic particle.

[Claim 8]

The method of claim 7, wherein the functional molecule is a chemical substance methotrexate, doxorubicin, daunorubicin, cytosine arabinoside, etoposide, 5'- fluorouracil, melfaran, chlorambucil, cyclophosphamide, A single domain antibody against MUC1, characterized in that it is an anticancer agent selected from the group consisting of cisplatin, bindecine, mitomycin, bleomycin, tamoxifen and taxol.

[Claim 9]

The method of claim 7, wherein the functional molecule is a lysine, lysine as a polypeptide

A chain, Pseudomonas exotoxin, diphtheria toxin, pokeweed Antiviral Proteins, Abrin, Abrin A Chain, Cobra Venom Factor, Gelonin, Saporin, Modeccin, Volkensin, Viscumin , Clostridial Perpringens phospholipase C and Bovine pancreatic ribonuclease. A single domain antibody against MUC1.

[Claim 10]

10. The single domain antibody against MUC1 of claim 9, wherein the polypeptide is diphtheria toxin.

[Claim 111]

11. The single domain antibody to MUC1 of claim 10, wherein the diphtheria toxin is directly bound to a single domain antibody or indirectly through a linker.

[Claim 12]

The method of claim 11, wherein when the diphtheria toxin is directly bound to a single domain antibody, the single domain antibody is an amino acid sequence selected from the group consisting of amino acid sequences consisting of SEQ ID NO: 8 to 14 sequences Single domain antibody against MUC1.

[Claim 13]

The method of claim 11, wherein when the diphtheria toxin is indirectly coupled to a single domain antibody through a linker, the single domain antibody is MUC1 characterized in that the amino acid sequence selected from the group consisting of SEQ ID NO: 17 to 23 sequence Single domain antibody against.

[Claim 14]

8. The single domain antibody against MUC1 of claim 7, wherein the functional molecule is an inorganic particle, a contrast agent, a fluorescent marker, or a staining material.

[Claim 15]

A nucleic acid molecule encoding a single domain antibody against MUC1 of any one of the preceding claims.

[Claim 16]

A recombinant vector comprising the nucleic acid molecule of claim 15.

[Claim 17]

The host cell transformed with the recombinant vector of claim 16.

[Claim 18]

(a) a pharmaceutically effective amount of a single domain antibody against MUC1 of any one of claims 1-14; And (b) a pharmaceutically acceptable carrier.

[Claim 19]

A cancer diagnostic composition comprising a single domain antibody against MUC1 of any one of claims 1 to 14.