WO2011098651A1

WO2011098651A1 - Synthetic sequence of nucleotides coding for bovine recombinant prochymosin a, expression vector comprising said sequence, escherichia coli cell converted by means of said vector, and the process of the obtainment of said bovine recombinant prochymosin a

Info

Publication number: WO2011098651A1
Application number: PCT/ES2011/070089
Authority: WO
Inventors: Umberto Bambozzi; Hugo Gabriel Menzella
Original assignee: Umberto Bambozzi; Hugo Gabriel Menzella
Priority date: 2010-02-11
Filing date: 2011-02-11
Publication date: 2011-08-18
Also published as: AR075403A1

Abstract

A synthetic sequence of nucleotides coding for bovine recombinant prochymosin A selected from the group comprising SeqID No. 2, SeqID No. 3, SeqID No. 4, SeqID No. 5, SeqID No. 6. An expression vector comprising the synthetic sequence of nucleotides of the present invention. A transgenic cell of Escherichia coli comprising said synthetic sequence of nucleotides and a process for the production of prochymosin A with said cell.

Description

SEQUENCE OF SYNTHETIC NUCLEOTID THAT CODIFIES FOR BOVINE RECOMBINANT, EXPRESSION VECTOR THAT INCLUDES SUCH SEQUENCE, TRANSFORMED COLOR ESCHERICHIA CELL WITH SUCH VECTOR AND PROCESS OF

OBTAINING SUCH PROCHEMOSINE A BOVINE RECOMBINANT.

Field of the invention: The present invention pertains to the field of recombinant proteins, in particular that of bovine recombinant chymosin A. More particularly, the present invention relates to synthetic nucleotide sequences encoding a recombinant bovine prochymosin A, expression vectors comprising said sequence, Escherichia coli cells transformed with said vector; and processes for obtaining said chymosin A.

State of the Art

The protein prochymosin A is produced by the main cells of the stomach of mammals. After its secretion this inactive precursor is exposed to pH gastric, where through a process of limited self-protection is transformed into the enzyme chymosin. This enzyme, also known as renin, is responsible for the proteolysis of milk k-caseins. This process results in coagulation of the same, which subsequently facilitates the action of other digestive enzymes. In calves, after 30 days of life, chymosin begins to be gradually replaced by pepsin, another protease that has different properties. Chymosin is a monomeric protein and has a molecular weight of 35.6 kDa and after removal of the propeptide has 323 amino acids. It belongs to the family of aspartyl proteases, characterized by having a large amount of acidic and hydroxylated residues and a low amount of basic waste. This family of proteases contains in its active site two aspartate residues essential for its activity and its catalytic efficiency is maximum at pH values between 2 and 3 (Foltman; 1966). There are two allelic variants called chymosin A and B. Variant A (SEQ ID No. 1) has a specific activity 20% higher than variant B, and is differentiated by having an aspartate residue at position 244 instead of a glycine residue. X-ray crystallography analysis of this protein revealed that it has a bilobular shape, with a central groove that houses the substrate peptide (Albert et al .; 1998, Neuman et al. , 1991; Nugent et al. , nineteen ninety six) . It is observed that it has a structure rich in beta sheet and a size of 6.5 x 5 x 4 nm.

Bovine rennet from calves under 30 days old, rich in chymosin, produces the best yields in cheese making. However, the sacrifice of such young animals has not been practiced for decades for economic reasons, which is why the cheese industry sought alternatives for the replacement of this precious product. Curds of adult animals, rich in pepsin, as well as different proteases of microbial origin were used as the main milk coagulating agent until the appearance of recombinant bovine chymosin in the market in 1990. It is produced in yeasts, filamentous fungi or Jan . coli and its use in the food industry has grown remarkably over the past decade. This product has been approved for use in human food in 1992 in the United States of America and since 1994 in England. Currently, most cheese producers in the world use this recombinant protein to obtain quality cheeses.

Recombinant prochymosin A accumulates in E. coli in inactive protein aggregates called inclusion bodies. The renaturation of the protein contained in these inclusion bodies has been carried out using different strategies for its implementation on an industrial scale at low cost (Marson et al .; 1984, Menzella et al .; 2002, Tang, et al .; 1994, Wei, et al .; 1999).

A common way to increase production levels by fermentation of a given protein is to increase the amount of mRNA available by using strong promoters or by using multiple copies of the coding gene. However, the increases in production obtained by these methods are limited by the translation efficiency of said mRNA molecules.

The genetic code is degenerated and each amino acid can be encoded by an average of three different codons. In this way, a sequence of 300 amino acids can be theoretically encoded by some 3 ³⁰⁰ different DNA sequences. The frequency with which different codons are used by different organisms varies significantly and correlates with the corresponding populations of tRNA (transfer RNA) in the cell. Because the presence of unusual codons is strictly associated with low levels of protein production and incorporation of erroneous amino acids, the use of codons has been identified as the most important factor in obtaining high levels of expression of heterologous sequences in microorganisms since it allows increase the efficiency of the translation process (Gustafsson, et al .;

2004).

At present, various attempts have been made to achieve the optimization of the expression of foreign proteins, in particular, of chymosin, as examples of the aforementioned can be cited: modification of microorganisms to increase the expression of foreign proteins, in particular chymosin: Nisshimori, et al .; 1984, Martson, et al .; 1984, Tichy, et al .; 1994, Menzella, et al .; 2002, Vallejo, et al .; 2008, Nemoto, et al .; 2009

There is a large number of documents in the state of the art in which alternative production methods of chymosin are disclosed, as examples of these are documents: EP0048521; EP0116778, EP0121775, GB2091271, WO2005094185, US4935369, US5525484, US5955297 and others. These documents mention different alternatives, such as modifications in the production processes, modifications in the expression vectors, modifications in the expression promoter sequences, to achieve improvements in the yield and production of chymosin, whether using expression systems for yeasts, filamentous fungi, bacteria and / or plants. These documents seek to solve the main problem that results from the limitation of expressing a nucleotide sequence of an organism in another microorganism, although none of them considers the optimization of the coding nucleotide sequence, this being a limiting factor in the expression of heterologous sequences in the search for optimal production levels.

Attempts have been made to obtain optimized nucleotide sequences for the expression of prochymosin in foreign microorganisms, either by modification or redesign of the coding nucleotide sequence, examples of which are the documents: EP1231272, GB2200118, GB2123005, EP0077109, US7390936. Patent document EP1231272, of Laboratorios Ovejero

SA, discloses a DNA sequence encoding chymosin where said sequence has been modified in 100% of the possible changes in its sequence with respect to the wild coding sequence of bovine chymosin. Through these modifications a synthetic sequence is obtained where the most abundant codon in Aspergillus Niger awamori variety has been selected for each amino acid to express said sequence in this filamentous fungus. This process, known as the "one codon - an amino acid" design strategy, has been shown to result in poor yields since a gene of these characteristics with a high level of transcription can generate an imbalance in the cellular tRNA pool which affects the growth and viability of the producing microorganism with the consequent decrease in the final production of the desired protein

(Gustafsson, et al .; 2004).

The document GB2200118, by Alellix Inc, discloses the coding sequences of prochymosin A that have been modified, partially or totally, by using the design system "a codon-an amino acid" mentioned above. This document proposes the expression of said sequences in yeast cells such as Saccharomyces cerevisiae and filamentous fungi such as Aspergillus sp. This paper does not show trials that confirm results in the optimization of the expression with respect to the wild sequence and it is observed that the final results would result in limitations such as those observed in the aforementioned modifications. In GB2123005, of Genex Corp, the inventors, taking into account the fact that the genetic code is degenerated, have theoretically disclosed all possible combinations that can be made in the nucleotide sequence encoding prochymosin A, so that the sequence be optimized for expression in Escherichia coli. No specific nucleotide sequence is defined in this document, nor is a sequence selection made, nor are trials disclosed that demonstrate improvements in expression levels of Prochymosin, therefore, does not anticipate or suggest the present invention in any way to a person skilled in the art.

US2006099588 discloses nucleotide sequences that code for bovine chymosin with new glycosylation sites so as to improve production yields, said new sequences modify the sequence with respect to the natural one in order to incorporate new glycosylation sites.

While the aforementioned documents disclose alternative nucleotide sequences in order to achieve improvements in the levels of prochymosin expression in various microorganisms, such documents do not suggest or anticipate results similar to those obtained by the synthetic nucleotide sequences of the present invention. , which allow an increase of up to about 70 percent in expression levels relative to the wild sequence in the production of recombinant bovine prochymosin A using Escherichia coli as an expression microorganism. The synthetic nucleotide sequence of the present invention meets the objective of achieving higher yields, decreasing the costs and time required in the production processes of recombinant proteins, in particular bovine recombinant prochymosin A. Brief Description of the Invention

The present invention aims to provide a synthetic nucleotide sequence encoding recombinant bovine prochymosin A selected from the set comprised of SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No.

5, SEQID No. 6. Preferably, said sequence is SEQID No. 2. In one embodiment, the sequence of the present invention is that sequence that has at least 95 percent homology with respect to SEQ ID No. 2. Recombinant bovine prochymosin A encoded by the synthetic nucleotide sequence of the present invention has the amino acid sequence of amino acids SEQID No. 8.

It is another object of the present invention to provide an expression vector comprising said synthetic nucleotide sequence of the present invention. In one embodiment, said synthetic nucleotide sequence is under the control of a promoter selected from the set comprised of lac promoter, tac promoter, PBAD promoter, present in said vector. In a more preferred embodiment, the expression vector of the present invention comprises the synthetic nucleotide sequence SEQID No. 2.

Another object of the present invention is to provide a transgenic Escherichia coli cell comprising the synthetic nucleotide sequence selected from the set comprised of the sequences SEQID No. 1, SEQID No. 2, SEQID

No. 3, SEQID No. 4, SEQID No. 5, SEQID No. 6. Preferably, said cell comprises the synthetic nucleotide sequence SEQID No. 2. In one embodiment the cell of the present invention comprises synthetic sequence of the present invention under the control of a promoter selected from the set comprised of lac promoter, tac promoter, PBAD promoter.

It is another object of the present invention to provide a polypeptide with aspartyl protease activity encoded by the nucleotide sequence selected from the set comprised of SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No. 5, SEQID No. 6. Preferably, said sequence is EQ ID No. 2. It is another object of the present invention to provide a process for obtaining a recombinant bovine prochymosin A characterized in that it comprises: i) - culturing said transgenic Escherichia coli cell transformed with an expression vector comprising a nucleotide sequence selected from the set comprising SEQID

No. 1, SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No. 5, SEQID No. 6; ii) - recover the prochymosin A expressed in step i) from the inclusion bodies; iii) - solubilize bovine recombinant prochymosin A; iv) - purify said recombinant bovine prochymosin. Said prochymosin A Recombinant bovine can be converted to chymosin A by proteolysis of prochymosin A obtained in step iv). In one embodiment, step i) of said process comprises transforming said cell with an expression vector comprising a nucleotide sequence selected from the set comprised of SEQID N ° 2, SEQID N ° 3, SEQID N ° 4, SEQID N No. 5, SEQID No. 6. Preferably, said sequence is EQ ID No. 2. In a preferred embodiment, step iv) the process for obtaining prochymosin A of the present invention is carried out by ion exchange chromatography. In another preferred form, the step of obtaining bovine recombinant chymosin A comprises reacting the prochymosin A obtainable from step iv) with an acid solution; preferably, said acid solution is a hydrochloric acid solution that is added until the pH reaches a value of 2. The recombinant bovine chymosin A obtainable by said process has the amino acid sequence SEQ ID No. 9.

The nucleotide sequence of the present invention increases the expression of bovine recombinant prochymosin A in Escherichia coli by at least 8% relative to the expression of the wild sequence. More preferably at least 20%; more preferably still at least 40%; more preferably still, at least 70% relative to the expression of the wild sequence. Another object of the present invention is the use of said synthetic nucleotide sequence of the present invention to obtain an Escherichia coli cell expressing said recombinant bovine prochymosin A; preferably, said nucleotide sequence is used for the construction of said expression vector comprising said sequence, which is then used for the transformation of said Escherichia coli cell.

Another object of the present invention is the use of said synthetic nucleotide sequence of the present invention in a process for obtaining bovine prochymosin A, which comprises the steps of expressing said nucleotide sequence in an Escherichia coli cell that contains it, recovering the expressed prochymosin A, from the inclusion bodies, solubilize said recombinant prochymosin A and purify it. Optionally, said method further comprises an activation step of said prochymosin A to obtain the commercially active form of said molecule, the recombinant bovine chymosin A. Another object of the present invention is the use of said

Escherichia Coli comprising said sequence of the invention in a process for obtaining recombinant bovine prochymosin A.

Furthermore, the present invention provides a recombinant bovine chymosin A obtainable by said process. Detailed description of the invention

The present invention is related to a synthetic nucleotide sequence coding for a prochymosin A, an expression vector containing said synthetic nucleotide sequence, likewise the present invention is related to an Escherichia coli cell comprising said expression vector. The present invention is also related to an alternative process for obtaining bovine recombinant prochymosin A. Said process comprises culturing said Escherichia coli cell transformed with said expression vector containing said synthetic nucleotide sequence encoding said bovine prochymosin A, then obtaining a biologically active chymosin A from said prochymosin A.

The main object of the present invention is to provide a synthetic nucleotide sequence that codes for a recombinant bovine prochymosin A. Said sequence is selected from the set comprised of the sequences SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No.

5, SEQ ID No. 6. Said sequence results in surprisingly higher expression levels relative to expression levels relative to the wild sequence when used to transform an Escherichia coli cell for recombinant prochymosin production. Said increase in Expression levels are at least 8 percent, preferably 20 percent, more preferably 40 percent, more preferably still, 70 percent relative to the expression level of the wild nucleotide sequence.

The synthetic nucleotide sequence of the present invention comprises modifications in specific nucleotides at specific positions with respect to a particular codon in order to replace the codons that are rarely used in the host cell by synonymous codons. Unlike the "one codon - an amino acid" strategy, in the sequences described here the codon synonym for each particular amino acid is chosen from the group of codons that encodes said amino acid with a frequency similar to that found in the Escherichia coli genome . Thus, the modifications introduced in the nucleotide sequence do not imply a modification in the amino acid that encodes, as a result of the condition that the genetic code is degenerated and that some amino acids can be encoded by more than one codon, in this way they are generated silent modifications in the coding nucleotide sequence.

The synthetic nucleotide sequence of the present invention encodes the same protein as its natural counterpart, although it has been optimized to increase expression levels in Escherichia coli and thus reduce both costs and production times on an industrial scale. The present invention provides a synthetic nucleotide sequence encoding a bovine recombinant prochymosin A where said sequence exhibits surprisingly higher levels of expression than those obtained by wild nucleotide sequence expression and those reported in the state of the art such as optimized by the method of "a codon-an amino acid".

The synthetic nucleotide sequence object of the present invention has less than 85 percent homology with its natural counterpart. More preferably, the synthetic nucleotide sequence of the present invention has less than 77 percent homology with respect to the natural nucleotide sequence encoding bovine prochymosin A. Preferably, the synthetic nucleotide sequence of the present invention is selected from the set comprised of the sequences SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6; more preferably, the synthetic nucleotide sequence of the present invention is SEQ ID No. 2 which has a 76% homology with respect to its wild counterpart; It is noteworthy that the percentage of homology possessing the synthetic nucleotide sequence of the present invention with respect to its wild counterpart of bovine origin is similar to the percentage of homology possessed by said nucleotide sequence. synthetic with respect to homology than with buffalo chymosin with 76%, 74% with respect to sheep chymosin and 71% with respect to dromedary chymosin, according to alignment tests. The synthetic nucleotide sequence of the present invention encodes a polypeptide whose amino acid sequence is SEQ ID No. 8, identical to the natural bovine prochymosin A sequence. From said prochymosin A and by proteolytic treatment by adding HC1 by adjusting to the appropriate pH or by enzymatic digestion, the active recombinant bovine chymosin is obtained, whose sequence is SEQ ID N ° 9.

Another object of the present invention is to provide an expression vector comprising the synthetic nucleotide sequence of the present invention for expression in a microorganism, selected from the set comprising

Escherichia coli and Bacillus subtilis, preferably Escherichia coli. Said vector is selected from a wide variety of commercially available expression vectors for Escherichia coli cells. In a preferred embodiment, said vector further comprises a promoter that controls the expression of the synthetic nucleotide sequence of the present invention. Preferably, the vector used for cloning and expression of the synthetic nucleotide sequence of the present invention is selected from those vectors in which the sequence Synthetic of the invention is under control of the promoters selected from the set comprised of Plac, Ptac, PBAD.

It is another object of the present invention to provide a transgenic Escherichia coli cell; preferably, a transgenic Escherichia coli cell expressing bovine recombinant prochymosin A; more preferably the Escherichia coli cells of the present invention express a recombinant bovine prochymosin A encoded by the synthetic nucleotide sequence selected from the set comprised of the sequences SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No. 5 , SEQID N ° 6; more preferably, the Escherichia coli cell of the present invention expresses a recombinant bovine prochymosin A encoded by the synthetic nucleotide sequence SEQID No. 2.

The transgenic Escherichia coli cell of the present invention comprises an expression vector for cells of

Escherichia coli where said synthetic nucleotide sequence is cloned and placed under control of at least one promoter of those known promoters for commercial use.

More preferably, said transgenic Escherichia coli cell comprises a vector where said vector has been selected those vectors in which the synthetic sequence is under control of the promoters selected from the set comprised of Plac, Ptac, PBAD. In a more preferred embodiment, said cell of

Escherichia coli is the W 3110.

A process for obtaining the Escherichia coli cells of the present invention is described below: said process comprises the steps of: a) cloning a synthetic nucleotide sequence of the present invention into a suitable expression vector; b) transform an Escherichia coli cell with the expression vector obtained in step a). In a preferred embodiment, said step a) comprises cloning the synthetic nucleotide sequence into a suitable vector, wherein said sequence has been selected from the set comprised of SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No. 5, SEQID N ° 6. Preferably, said sequence is the sequence SEQID N ° 2. Said synthetic nucleotide sequence is cloned into an expression vector for commercial use for Escherichia coli cells; preferably, said vector is selected from the set of those vectors in which the synthetic sequence of the invention is under control of the promoters selected from the set comprised of Plac, Ptac, PBAD.

The recombinant bovine prochymosin A expressed by the Escherichia coli cells of the present invention has the amino acid sequence SEQ ID 8; from said prochymosin A and by proteolytic treatment, according to methods known in the state of the art, such as Acidic treatment or enzymatic digestion can be obtained from recombinant bovine chymosin A, whose amino acid sequence is SEQ ID N ° 9.

Another object of the present invention is to provide a process for obtaining recombinant bovine prochymosin A, said process comprises the steps of: i) culturing the transformed Escherichia coli cell of the present invention with the expression vector of the present invention; ii) recover prochymosin A expressed in step i) from the inclusion bodies; iii) solubilize prochymosin

A recombinant bovine; iv) purifying said prochymosin A. In addition, by recombinant prochymosin A treatment obtained by step iv) recombinant bovine chymosin A is obtained. In a preferred embodiment the cells of

Escherichia coli of said process are obtained by a step of cloning the synthetic nucleotide sequence of the present invention into a suitable vector, where said sequence has been selected from the set comprised of SEQID No. 2, SEQID No. 3, SEQID No. 4 , SEQID N ° 5, SEQID N ° 6.

Preferably, said sequence is the sequence SEQID N ° 2.

In another preferred embodiment, the step of obtaining chymosin A comprises subjecting the recombinant bovine prochymosin A to proteolysis, wherein said proteolysis treatment can be carried out by self-protection. by treating said recombinant bovine prochymosin A with an acid solution, preferably HC1 pH = 2. Another alternative treatment for the production of bovine recombinant chymosin A comprises treating the bovine recombinant prochymosin A obtained by the process of the present invention with a proteolytic enzyme such as chymosin itself. Said recombinant bovine chymosin A is derived from recombinant bovine prochymosin A encoded by the synthetic nucleotide sequence selected from the set comprised of SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No. 5,

SEQID N ° 6. Preferably, said sequence is the sequence SEQID N ° 2.

A preferred process of producing the recombinant prochymosin A and recombinant bovine chymosin A of the present invention is described below: the synthetic nucleotide sequence of the present invention can be synthesized from oligonucleotides of approximately 40 nucleotides where the desired modifications are introduced , said overlapping oligonucleotides are then assembled by a process called PCA (polymerase cycling assembly) (Smith, et al .; 2003) that allows to obtain the synthetic nucleotide sequence of the present invention. It is important to note that the codon usage optimization can be carried out by multiple methods using different computer programs or even in manually according to frequency tables available in public databases similar to Table II.

The process for obtaining bovine recombinant prochymosin A of the present invention comprises cloning said synthetic nucleotide sequence of the present invention into a suitable expression vector, then transforming an Escherichia coli cell with said vector and sowing in a suitable culture medium said Escherichia coli strain transformed with said expression vector comprising the synthetic nucleotide sequence of the present invention; fermenting the strain of transgenic Escherichia coli obtained, said fermentation step can be carried out for a period of between 20 to 24 hours; then an inducer is added to said culture, which according to the expression vector used can be IPTG or L-arabinose, the culture conditions are maintained for a period of between 5 to 15 hours in order to induce the expression of prochymosin A, preferably 10 hours. After this period the culture is centrifuged at a speed of between 8,000 and 12,000 g for 15 min at a temperature of 4 ° C. Then, the cells are resuspended in a suitable medium such as 10 mM EDTA or 50 mM Tris pH = 8, preferably 50mM Tris pH = 8; and Used for example by treatment with an alkaline solution and centrifuged at 10,000 g for 10 to 20 min at 4 ° C where the insoluble fraction is collected and washed one or more times, preferably two, with an HM solution [2 M urea, 10 mM

EDTA pH = 8, 1% Triton X100] or a 50mM glycine solution pH = 8. The inclusion bodies obtained are dissolved in 8M deionized urea prepared in 50 mM KH2P04 pH = 10.5. The resulting solution is incubated for a period of between 1 to

3 hours, preferably 2 hours, at 30 ° C and then centrifuged at 10,000 g for 15 min at 20 ° C. Renchymalization of prochymosin is carried out by dilution of the denatured protein solution, at a concentration of between 1.5 and 2.5 mg / mL, preferably of

2.0 mg / ml, in 1 L of 50mM KH2P04 solution pH = 10.5. The resulting solution is incubated at 4 ° C for 12 hours and brought to pH = 8 by addition of 1 N HC1. The solution is then dialyzed against 50 mM Tris pH = 8 for 12 hours at a temperature of 4 ° C. Finally, bovine recombinant prochymosin A is purified by either ion exchange chromatography, affinity chromatography; preferably ion exchange chromatography. The solution of pure bovine recombinant prochymosin A recovered from the chromatographic column is treated to obtain chymosin A, said treatment is carried out by a process comprising at least one step of contacting said solution of prochymosin A with an acid solution until obtaining a pH = 2 by adding HC1 so that, through a process of self-protection, it is transformed into its biologically active chymosin A form. Finally, the pH is brought to 6.3 and a stabilizer such as sodium benzoate is added or lyophilized.

The process described in the present invention, using the synthetic nucleotide sequence of the present invention allows to obtain higher yields compared to a production process of bovine recombinant chymosin A using the wild sequence. Expression levels from transgenic Escherichia coli strains with an expression vector such as those of the present invention allow for a higher yield at the same time of expression, the same being 8% higher with respect to its wild counterpart; preferably 19%; more preferably 40%; more preferably still, 70% higher using the nucleotide sequence of the present invention with respect to its wild counterpart.

Expression levels obtained during the production process of bovine recombinant prochymosin A by expression of the synthetic nucleotide sequence of the present invention show higher levels, up to 76%, with respect to those optimized sequences known in the state of the art.

This invention is best illustrated according to the following examples, which should not be construed as a limitation imposed on the scope thereof. On the contrary, it should be clearly understood that recourse can be made to Other embodiments, modifications and equivalents thereof that after reading the present description, may suggest to those understood in the subject without departing from the spirit of the present invention and / or scope of the appended claims.

Examples

Example 1

Obtaining the synthetic nucleotide sequence SEQID a 2. For the construction of the synthetic nucleotide sequences of the present invention the GeMS program was used, this program generates the synthetic DNA sequences and, automatically, the sequences of the overlapping oligonucleotides of 40 bases that were used as material for the synthesis of both strands of the final sequences by means of the assembly process called PCA (polymerase cycling assembly) (Smith, et al .; 2003). Once the natural sequence has been entered into the GeMS program, it can provide multiple sequences with synonyms codons from the frequencies requested for each of the codons, according to Table II.

To carry out the synthesis of each gene, the process was divided into an assembly reaction and an amplification reaction. The assembly reaction was carried out by mixing 2 ul of a 100 uM solution of each oligonucleotide with 48 μΐ of a solution containing 0.5 μΐ of Expand High Fidelity polymerase (5 units / μΐ, Roche), 1.0 μΐ of 10 mM dNTPs, 5.0 μΐ of 10x PCR buffer, 3.0 μΐ of MgCl ₂ 25 mM, and 38.5 μΐ of water. The mixture was incubated in a thermal cycler using the following program: 5 minutes of denaturation at 95 ° C and 25 cycles of 95 ° C for 30 s, 50 ° C for 30 s, and 72 ° C for 90 s.

For the amplification reaction, 2 ul of the assembly reaction and 48 μΐ of a solution containing 0.5 μΐ of Expand High Fidelity polymerase (5 units / μΐ,

Roche), 1.0 μΐ of 10 mM dNTPs, 5.0 μΐ of 10x PCR buffer, 3.0 μΐ of 25 mM MgCl ₂ , 39. μΐ of water, and 1.0 μΐ of external oligonucleotides. The sequence of the upper external oligonucleotide is formed in all cases by the first 16 bases of each sequence and the sequence of the lower external oligonucleotide is formed in all cases by the complementary reverse sequence of the last 16 bases of each sequence. The mixture was incubated in a thermal cycler using the following program: 5 minutes of denaturation at 95 ° C and 30 cycles of 95 ° C for 30 s, 60 ° C for 30 s, and 72 ° C for 90 s. The oligonucleotides used to obtain the synthetic nucleotide sequence of the present invention are listed below. Table I: List of oligonucleotides used to synthesize the sequence SEQ ID No. 2. The sequences are shown in the 5 ^{^'-3'.} The lowercase sequence corresponds to an extra non-coding sequence added to complete the oligonucleotides. R, oligonucleotides gone for the negative strand. F, oligonucleotides for the positive strand:

F380 GGCTCCATGCAAGGCATTCTGGGTTATGACACAGT (SEQ ID No. 31)

R396 TCAACAATATTGGACACAGTCACTGTGTCATAACCCAGAA (SEQ ID No. 32)

F415 GACTGTGTCCAATATTGTTGATATTCAACAAACTGTGGGC (SEQ ID N ° 33)

R436 GTTCCTGGGTGCTCAGGCCCACAGTTTGTTGAATA (SEQ ID No. 34)

F455 CTGAGCACCCAGGAACCAGGTGACGTATTCACGTA (SEQ ID No. 35)

R471 AGAATACCATCAAATTCTGCGTACGTGAATACGTCACCTG (SEQ ID No. 36)

F490 CGCAGAATTTGATGGTATTCTGGGCATGGCGTATCCG (SEQ ID No. 37)

R511 TATTCGCTCGCCAGAGACGGATACGCCATGCCC (SEQ ID No. 38)

F527 TCTCTGGCGAGCGAATATAGCATACCGGTGTTTGA (SEQ ID No. 39)

R544 GGTGACGGTTCATCATGTTATCAAACACCGGTATGCTA (SEQ ID No. 40)

F562 TAACATGATGAACCGTCACCTGGTGGCTCAGGATCT (SEQ ID No. 41)

R582 CGATCCATGTAAACCGAAAAGAGATCCTGAGCCACCA (SEQ ID No. 42)

F598 CTTTTCGGTTTACATGGATCGCAACGGCCAGGAATCA (SEQ ID No. 43)

R619 CCCCCAACGTCAGCATTGATTCCTGGCCGTTG (SEQ ID No. 44)

F635 ATGCTGACGTTGGGGGCGATCGACCCGTCATATTA (SEQ ID No. 45)

R651 GTGCAAACTCCCCGTGTAATATGACGGGTCGATCG (SEQ ID No. 46)

F670 CACGGGGAGTTTGCACTGGGTCCCGGTTACGG (SEQ ID No. 47)

R686 TGCCAGTACTGCTGCACCGTAACCGGGACCCA (SEQ ID No. 48)

F702 TGCAGCAGTACTGGCAGTTTACCGTAGATTCTGTTACCA (SEQ ID No. 49)

R718 CCACCACAACGTCACTGATGGTAACAGAATCTACGGTAAAC (SEQ ID No. 50)

F741 TCAGTGACGTTGTGGTGGCTTGCGAAGGCGGCTG (SEQ ID No. 51)

R759 TATCCAGGATTGCCTGGCAGCCGCCTTCGCAAG (SEQ ID No. 52)

F775 CCAGGCAATCCTGGATACCGGCACCAGCAAACT (SEQ ID No. 53)

R792 TGAGCTAGGCCCCACAAGTTTGCTGGTGCCGG (SEQ ID No. 54)

F808 TGTGGGGCCTAGCTCAGATATTCTCAACATTCAGCAAGC (SEQ ID No. 55)

R824 CTGGGTGGCGCCGATGGCTTGCTGAATGTTGAGAATATC (SEQ ID No. 56)

F847 CATCGGCGCCACCCAGAATCAGTATGGTGAGTTTGATATC (SEQ ID No. 57)

R863 GTACGACAGGTTATCACAATCGATATCAAACTCACCATACTGATT (SEQ ID N ° 58)

F887 GATTGTGATAACCTGTCGTACATGCCTACCGTCGTATTC (SEQ ID No. 59)

R908 CGGATACATCTTTCCATTAATTTCGAATACGACGGTAGGCAT (SEQ ID No. 60) F926 GAAATTAATGGAAAGATGTATCCGTTGACCCCGTCAGCATA (SEQ ID No. 61)

R950 CTTGGTCCTGGCTTGTATATGCTGACGGGGTCAA (SEQ ID No. 62)

F967 TACAAGCCAGGACCAAGGTTTTTGTACTTCGGGTTTTC (SEQ ID No. 63)

R984 TGAGAGTGATTCTCGGACTGAAAACCCGAAGTACAAAAAC (SEQ ID No. 64)

F1005 AGTCCGAGAATCACTCTCAAAAATGGATTCTGGGAGACGTA (SEQ ID No. 65)

R1024 ACGGAATAATATTCACGAATGAATACGTCTCCCAGAATCCATTTT (SEQ ID No. 66)

F1046 TTCATTCGTGAATATTATTCCGTCTTTGATCGGGCGAACA (SEQ ID No. 67)

R1069 GCCAGACCGACCAAATTGTTCGCCCGATCAAAG (SEQ ID No. 68)

F1086 ATTTGGTCGGTCTGGCCAAAGCGATCCTGTTCAG (SEQ ID No. 69)

R1102 CTGAACAGGATCGCTTTG (SEQ ID No. 70)

The sequence thus obtained was inserted into the expression vectors as described in example 2.

Table II: codon frequency in Escherichia coli W3110. The table shows: [triplet] [amino acid] [fraction] [frequency: every thousand] ([number])

Example 2

Construction of expression vectors with the PlacUV5, Ptac and PBAD promoters, the sequences SEQ ID N ^≤ 7, SEQ ID N ^≤ 2 and SEQ ID 21. For the different comparative tests of expression levels and biological activity, the sequence was also used. from wild nucleotides SEQ ID No. 1 and a sequence obtained by the "one codon-an amino acid" optimization method, SEQ ID No. 7. Various expression systems were constructed in order to compare expression levels, and enzymatic activity of the chymosin obtained by said systems from the synthetic nucleotide sequence SEQ ID No. 2, the sequence SEQ ID No. 7 and the wild sequence SEQ ID No. 1. Likewise, three different expression vectors were used in which said sequences were left under the control of the PlacUV5 and Ptac promoters, vectors induced by IPTG and the PBAD vector induced by L-arabinose.

For the expression of prochymosin A under the control of the pBAD promoters in strain W3110, the coding sequences were inserted into the vector pBAD 18 (Guzman, et al .; 1995) to obtain the plasmids pVUl (containing the sequence SEQ ID No. 7) and pVU2 (containing the sequence SE ID N ° 2) and pVU3 containing the wild nucleotide sequence of the bovine prochymosin, SEQ ID No. 1. For the expression of prochymosin A under control of the tac and lacuv5 promoters in strain W3110, the sequence containing the araC regulator and the pBAD promoter of the plasmids pVU2 and pVU3 was replaced by a synthetic DNA fragment containing the lacUV5 promoter (to obtain the plasmids pVU2 * and pVU3 *), or the tac promoter (to obtain plasmids pUV2 ** and pVU3 **).

To express the genes under control of the pBAD promoter, the corresponding sequences were amplified by PCR with specific oligonucleotides overlapping the first and last 16 bases of each reading frame flanked with the TCTAGAAGGAGATATACAT sequences, containing an Xbal site and a ribosome binding site and AAGCTT, containing a HinDIII site. The resulting amplification product and pBAD 18 vector were digested for 1 hour with the enzymes Xbal and HinDIII (New England Biolabs) and separated and purified on agarose gel. The resulting DNA fragments were ligated using T4 DNA ligase (New England Biolabs) and the resulting ligation mixture was used to electroporate the DH5a strain. The transforming colonies were selected in LB medium supplemented with ampicillin and subsequently grown in liquid LB medium to obtain plasmid preparations. The identity of the plasmids obtained was verified first by digestion with the enzymes Xbal and HinDIII and then by sequencing. To express the genes under control of the lacUV5 and tac promoters, the corresponding sequences were amplified by PCR with specific oligonucleotides overlapping the first 16 bases of each reading frame containing extensions at the 5 ^' end to incorporate: a recognition site for the enzyme of BglII restriction, the corresponding promoter (tac or lacUV5) and a ribosome binding site.

The extension of the upper oligonucleotide used for in the case of the tac promoter was as follows:

5 'AGATCTTTGACAGCGCACCGGGCTTTGTGTATAATCTTCTGGCGTCGACCAGCAGGAGG AGCGCGACA-3 ^'

The extension of the upper oligonucleotide used in the case of the lacUV5 promoter was as follows:

5 'AGATCTTTTACAGCGCACCGGGCTTTGTGTATAATCTTCTGGCGTCGACCAGCAGGAGG AGCGCGACA-3 ^'

The lower oligonucleotide overlaps the last 16 bases of each reading frame and in both cases has a HinDIII site added to the 3 ^' end immediately after the termination codon. The amplification products containing each of the promoters and the pET 21b vector were digested with BgLII and HinDIII (New England Biolabs) for 1 hour with and separated and purified on agarose gel. The resulting DNA fragments were ligated using T4 DNA ligase (New England Biolabs) and the resulting ligation mixture was used to electroporate the strain DH5V. The transforming colonies were selected in LB medium supplemented with kanamycin and subsequently grown in liquid LB medium to obtain plasmid preparations. The identity of the plasmids obtained was verified first by digestion with the enzymes Xbal and HinDIII and then by sequencing.

The constructed vectors were introduced in all cases into the Escherichia coli W3110 strain by electroporation and the recombinant clones selected in LB plates supplemented with ampicillin or kanamycin.

Example 3

Production and assays of bovine recombinant chymosin A activity from the strains selected from the previous example a) - Production of bovine recombinant prochymosin A from a culture of Escherichia coli

From the cells obtained from the previous example, they were grown in a medium such as that described in the table Table III- Culture medium

Composition of trace elements in g / L of HC1 5 M: S04Fe 10

M, ZnS04.7H20 2.5 M, CuS04.5H20 1 M, MnS04.5H20 1 M,

Na2B407.10H2O 0.2 M, CaC12.2 H20 5 M, NaMo04.2H20 1 M, COC12.6H20 1 M.

The cultures were grown at 30 ° C in 100 ml capacity erlenmeyer containing 10 mL of HM medium to a OD ₅ 90 = 0.5 and then induced by aggregate of L-arabinose (0.2%) or IPTG (lmM) for a period of 10 hours. b) - Recovery of prochymosin from the inclusion bodies:

To obtain soluble prochymosin A from inclusion bodies produced in Escherichia coli, 100 mL of cultures were centrifuged in every case at 10,000 g for 15 minutes at a temperature of 4 ° C. The cells were resuspended in 5 mL of 50 mM Tris pH = 8 and lysed through 5 compression-decompression cycles using a Frenen press with a working pressure of 900 psi. The cultures used were centrifuged at 10,000 g for 15 min at 4 ° C and the insoluble fraction collected was washed twice with HM solution [2 M urea, 10 mM EDTA pH = 8, 1% Triton X100]. The inclusion bodies obtained were dissolved in 8M deionized urea prepared in 50 mM KH2P04 pH = 10.5. The resulting solution was incubated for 2 h at 30 ° C and centrifuged at 10,000 g for 15 min at 20 ° C. In all cases it was proved, by analysis by denaturing polyacrylamide gels followed by densitometry, that more than 95% of the protein present in the solution obtained was prochymosin. The renaturation of prochymosin A was carried out by diluting 40 mL of denatured protein solution, at a concentration equal to 20 mg / mL, in 1 L of 50mM KH2P04 solution pH = 10.5. The resulting solution was incubated at 4 ° C for 12 h and then brought to pH = 8 by addition of 1 N HC1. The solution was then dialyzed against 50 mM Tris pH = 8 for

12 h at a temperature of 4 ° C. Finally, the prochymosin A contained in each sample was purified by ion exchange chromatography as described by Tichy et al. (Tichy, et al.; 1993). c) - Activation of prochymosin A to chymosin A: The pure prochymosin A solution recovered from the chromatographic column was acidified to pH = 2 by addition of HC1 and incubated 15 min at 20 ° C so that, by a process of self-protection, it was transformed into chymosin A. The pH was then brought to 6.3 to measure enzyme activity. d) - Enzyme activity measurement tests

The activity of the chymosin obtained in the previous step was measured on a suspension of 12% skimmed milk powder containing 10 mM CaCl and 20 mM KH2P04 pH = 6.3, determining the coagulation time thereof at 30 ° C. Purified natural bovine chymosin (Sigma) was used as a control. One unit of activity is defined as the amount of enzyme capable of coagulating 10 mL of milk in one minute at 30 ° C (Foltman; 1966). e) - Comparative test of the amount of protein recovered recovered prochymosin.

For protein quantification, cultures were grown in all cases as described in example 3 and induced by the addition of IPTG in the cases of lacUV5 and tac or L-arabinose promoters in the case of the pBAD promoter. The cellular extracts obtained by sonication were separated in 12% polyacrylamide gels in the presence of SDS and taken using Sypro (Molecular Probes, USA). The Gels were scanned using a Typhoon scanner and bands quantified using known amounts of albumin coil as standard.

Table IV - Comparison of the amount of protein recovered as inclusion bodies and coagulant activity and specific activity of each sample.

a, b and c: values obtained from five independent experiments. In all cases the standard deviation was less than 3%. From the data shown in Table IV, an increase of approximately 71% in the expression of recombinant prochymosin A is observed when the synthetic nucleotide sequence of the present invention is used with respect to expression using the wild nucleotide sequence of the bovine prochymosin. From the measurement of the coagulant activity per liter of culture, it is observed that the recombinant product obtained from the synthetic nucleotide sequence of the present invention exhibits enzymatic activity, demonstrating biological recovery characteristics of the inclusion bodies identical to those obtained by the product obtainable from the wild sequence. It can also be seen from the values obtained from the VUl sequence, that obtained by the optimization system "a codon-an amino acid", does not result in improvements in the expression and obtaining of recombinant bovine prochymosin A.

Example 4

Quantification of recombinant prochymosin A expression levels encoded by the sequences SEQ ID N ² 2, SEQ ID 23, SEQ ID N≤4, SEQ ID N≤5, SEQ ID ≤6 and SEQ ID ≤7 relative to the levels obtained by the wild sequence SEQ ID 21. Following the same procedure described in Example 1, the sequences were obtained: SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6.

For quantification of expression levels, cultures were grown in all cases as described in example 3 and induced by the addition of L-arabinose. The cellular extracts obtained by sonication were separated in 12% polyacrylamide gels in the presence of SDS and taken using Sypro (Molecular Probes, USA). The gels were scanned using a Typhoon scanner and the intensity of the bands quantified by densitometry using the scanner software. All densitometry values obtained were divided by the value obtained for SEQ ID No. 1 to obtain the normalized values shown in Table V.

Table V - Expression levels relative to the wild sequence

Example 5

Comparison of codon usage between the sequences SEQ ID ≤7 and SEQ ID ≤2:

Below is the frequency of codon use between the sequences SEQ ID No. 7 and SEQ ID No. 2, the first is a nucleotide sequence optimized for expression in Escherichia coli by the method of "a codon-an amino acid" ; the second is the nucleotide sequence of the present invention.

Table VI: Frequency of codon usage

From this table, it is observed that the codons used for the construction of the nucleotide sequence SEQID No. 7 (VU1), a nucleotide sequence that uses a single codon for each amino acid, this being the most frequently found in the genome of the Escherichia coli bacteria and the codons used in the sequence SEQID No. 2 (VU2). From this comparison it is observed that according to previous documents the results of expression of the invention sequence would not be expected since the codon selection is not optimal for its expression in Escherichia coli.

References

- Albert, A., Blundell, T. L. , Dhanaraj, V., Dónate, L. E. Groves, M. , Guruprasad, K., Nugent, P. G., Orprayoon, P., Pitts, J. E., Rufino, S., Srinivasan, N., Williams, M., & Wilsher, J. (1998) Protein engineering aspartic proteinases. Site-directed mutagenesis, biochemical characterization, and X-ray analysis of chymosins with substituted single amino acid substitutions and loop replacements. Adv. Exp. Med. Biol, 436: 169-177.

- Andrianantoandro E, Basu S, Karig DK, Weiss R. Synthetic biology: new engineering rules for an emerging discipline (2006) Molecular Systems Biology 2: 2006.

- Bhandari P and Gowrishankar J. An Escherichia coli strain useful for efficient overproduction of cloned genes product with NaCl as inducer. (1997) J Bacteriol. 179: 4403-4406.

- Cardoza RE, Gutiérrez S, Ortega N, Colina A, Casqueiro J, Martin JF. (2003). Expression of a synthetic copy of the bovine chymosin gene in Aspergillus awamori from constitutive and pH-regulated promoters and secretion using two different pre-pro sequences. Biotechnol Bioeng. 83: 249-259.

- Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. (2000). Proc Nati Acad Sci U S A. 97: 6640-6645.

- Foltman, B. (1966) A review on prorennin and rennin. Trav Lab Carlsberg. 35: 143-231.

- Gustafsson C, Govindarajan S, Minshull J. (2004) Codon bias and heterologous protein expression. Trends Biotechnol.

22: 346-353

- Guzman LM, Belin D, Carson MJ, Beckwith J.Tight regulation, modulation, and high-level expression by vectors containing

42

REPLACEMENT SHEET (Rule 26) the arabinose PBAD promoter. (1995) J Bacteriol. 177: 4121-4130.

- Jáyaraj, S., Reid, R. and Santi D. GeMS: an advanced software package for designing synthetic genes. Nucleic Acids Res. 2005; 33: 3011-3016

- Khlebnikov A, Datsenko KA, Skaug T, Wanner BL, Keasling JD. Homogeneous expression of the P (BAD) promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. (2001) Microbiology. 147: 3241-3247.

- Kodumal SJ, Patel KG, Reid R, Menzella HG, Welch, Santi DV. Total synthesis of long DNA sequences: synthesis of a contiguous 32-kb polyketide synthase gene cluster. (2004) Proc Nati Acad Sci U S A. 101: 15573-15578.

- Makrides SC. Strategies for achieving high level expression of genes in E. coli. (1996) Microbiol Rev. 60: 512-38

- arston, F. A., Lowe, P. A., Doel, M. T., Schoemaker, J.. , White, S., & Angal, S. (1984) Purification of calf prochymosin (prorennin) synthesized in Escherichia coli. Biotechnology (N. Y.), 2: 800-804.

- Menzella, HG, Ceccarelli, EA, Gramajo, HC. Novel Escherichia coli strain allows efficient recombinant protein production using lactose as inducer. (2003) Biotechnol Bioeng. 82: 809-17.

- Menzella, HG, Gramajo, H, Ceccarelli EA. (2002) High recovery of prochymosin from inclusion bodies using controlled air oxidation. Protein Expression and Purification. 25: 248-255

- Newman,. , Safro, M. , Frazao, C., Khan, G., Zdanov, A., Tickle, I. J., Blundell, T. L. , & Andreeva, N. (1991) X-ray analyzes of aspartic proteinases. IV. Structure and refinement

43

REPLACEMENT SHEET (Rule 26) at 2.2 A resolution of bovine chymosin. J Mol. Biol, 221:

1295-1309.

- Nemoto T, Watanabe T, Mizogami Y, Maruyama J, Kitamoto K. (2009) Isolation of Aspergillus oryzae mutants for

heterologous protein production from a double proteinase gene disruptant. Appl Microbiol Biotechnol. 82: 1105-14.

- Nishimori K, Shimizu N, Kawaguchi Y, Hidaka M, Uozumi T, Beppu T. (1984) Expression of cloned calf prochymosin cDNA under control of the tryptophan promoter. Gene 1: 41-49.

- Nugent, P. G., Albert, A., Orprayoon, P., Wilsher, J.,

Pitts, J. E. , Blundell, T. L., & Dhanaraj, V. (1996) Protein engineering loops in aspartic proteinases: site-directed mutagenesis, biochemical characterization and X-ray analysis of chymosin with a replaced loop from rhizopuspepsin. Protein Eng, 9: 885-893.

- Patnaik R. Engineering Complex Phenotypes in Industrial Strains. (2008) Biotechnol Prog. 1: 38-47

- Reisinger, S., Patel, K. and Santi D. Total synthesis of multi-kilobase DNA sequences from oligonucleotides. (2006) Nat Protocols. 1: 2596-2600

- Siegele DA, Hu JC. Gene expression from plasmids containing the araBAD promoter at subsaturating inducer concentrations represent mixed populations. (1997). Proc Nati Acad Sci U S A. 94: 8168-8172.

- Smith HO, Hutchison CA 3rd, Pfannkoch C, Venter JC ..

Generating a synthetic genome by whole genome assembly:

phiX174 bacteriophage from synthetic oligonucleotides. (2003) Proc Nati Acad Sci U S A. 100: 15440-15445

- Tang, B., Zhang, S., & Yang, K. (1994) Assisted refolding of recombinant prochymosin with the aid of protein disulphide isomerase. Biochem J, 301: 17-20.

44

REPLACEMENT SHEET (Rule 26) - Tian J, Gong H, Sheng N, Z ou X, Gulari E, Gao X, Church G. Accurate multiplex gene synthesis from programmable DNA microchips. (2004) Nature, 432: 1050-1054.

- Tichy PJ, Kaprálek F, Jecmen P. Improved procedure for a high-yield recovery of enzymatically active recombinant calf chymosin from Escherichia coli inclusion bodies. (1993).

Protein Expr Purif. 4: 59-63.

- Villalobos A, Ness JE, Gustafsson C, inshull J,

Govindarajan S. Gene Designer: a synthetic biology tool for constructing artificial DNA segments. (2006). BMC

Bioinformatics 7: 285-289.

- Vallejo JA, Ageitos JM, Poza M, Villa TG. (2008). Cloning and expression of buffalo active chymosin in Pichia pastoris. J Agrie Food Chem. 56: 10606-10.

- Wei, C, Tang, B., Zhang, Y., & Yang, K. (1999) Oxidative refolding of recombinant prochymosin. Biochem J, 340, 345-351.

Four. Five

REPLACEMENT SHEET (Rule 26)

Claims

1/098651

Claims:

Described that the invention has been and the way to put it into practice is declared to claim as its own:

A synthetic nucleotide sequence encoding recombinant bovine prochymosin A characterized in that said sequence is selected from the set comprised of SEQID No. 2, SEQID No. 3, SEQID No. 4, SEQID No. 5, SEQID No. 6.

The synthetic nucleotide sequence according to claim 1 characterized in that said sequence is SEQID No. 2.

The synthetic nucleotide sequence according to claim 1, characterized in that it has at least 95 percent homology with respect to SEQ ID No. 2.

A polypeptide with aspartyl protease activity characterized in that it is encoded by the nucleotide sequence according to claim 1.

A recombinant bovine prochymosin A characterized in that it is encoded by the synthetic nucleotide sequence of claim 1.

The recombinant prochymosin A according to claim 5 characterized in that it has the amino acid sequence according to the sequence SEQID No. 8.

7- An expression vector characterized in that it comprises the synthetic nucleotide sequence of claim 1.

8- The expression vector according to claim 7 characterized in that said nucleotide sequence

46

REPLACEMENT SHEET (Rule 26) Synthetic is under the control of a promoter selected from the set comprised of lac promoter, tac promoter, PBAD promoter.

A transgenic Escherichia coli cell, characterized in that said cell comprises the synthetic nucleotide sequence of claim 1.

The cell according to claim 9 characterized in that said synthetic sequence is in an expression vector under the control of a promoter selected from the set comprised of lac promoter, tac promoter, PBAD promoter.

The cell according to claim 10 characterized in that said cell is Escherichia coli derived from strain W3110.

A process for obtaining a recombinant bovine prochymosin A characterized in that it comprises:

i) - culturing a transgenic Escherichia coli cell transformed with an expression vector comprising a nucleotide sequence according to claim 1; ii) - recover the prochymosin A expressed in step i) from the inclusion bodies iii) - solubilize the recombinant bovine prochymosin A obtained in ii); iv) - purify said bovine recombinant prochymosin A.

47

REPLACEMENT SHEET (Rule 26) 13- The process according to claim 12 characterized in that step i) comprises transforming said cell with an expression vector according to claim 8. 14- The process according to claim 12, characterized in that step iv) is carried out by ion exchange chromatography.

15. The process for obtaining bovine recombinant prochymosin A according to claim 12, characterized in that it further comprises a step where the prochymosin A obtained in step iv) is subjected to proteolysis with an acid solution to obtain chymosin A.

16- The process according to claim 15 characterized in that said acid solution is a hydrochloric acid solution that is added until the pH reaches a value of 2.

17- The recombinant bovine chymosin A obtainable by the process according to claim 15, characterized in that said chymosin has the amino acid sequence SEQ ID No. 9.

18- The nucleotide sequence according to claim 1 characterized in that it increases the expression of bovine recombinant prochymosin in Escherichia coli by at least 8% relative to the expression of the wild sequence.

19- The nucleotide sequence according to claim 1 characterized in that it increases the expression of bovine recombinant prochymosin A in

48

REPLACEMENT SHEET (Rule 26) Escherichia coli by at least 20% relative to the expression of the wild sequence.

20- The nucleotide sequence according to claim 1 characterized in that it increases the expression of bovine recombinant prochymosin A in

Escherichia coli by at least 40% relative to the expression of the wild sequence.

21- The nucleotide sequence according to claim 1 characterized in that it increases the expression of bovine recombinant prochymosin A in

Escherichia coli by at least 70% relative to the expression of the wild sequence.

49

REPLACEMENT SHEET (Rule 26)