WO2011097643A1 - Selective reduction of allelic variants - Google Patents

Selective reduction of allelic variants Download PDF

Info

Publication number
WO2011097643A1
WO2011097643A1 PCT/US2011/024103 US2011024103W WO2011097643A1 WO 2011097643 A1 WO2011097643 A1 WO 2011097643A1 US 2011024103 W US2011024103 W US 2011024103W WO 2011097643 A1 WO2011097643 A1 WO 2011097643A1
Authority
WO
WIPO (PCT)
Prior art keywords
wing
modified
compound
modified oligonucleotide
sugar
Prior art date
Application number
PCT/US2011/024103
Other languages
French (fr)
Inventor
C. Frank Bennett
Susan M. Freier
Sarah Greenlee
Eric E Swayze
Original Assignee
Isis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=44355846&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011097643(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to DK11740542.3T priority Critical patent/DK2534248T3/en
Priority to EP19164928.4A priority patent/EP3561060A1/en
Priority to CA2789005A priority patent/CA2789005A1/en
Priority to EP11740542.3A priority patent/EP2534248B1/en
Application filed by Isis Pharmaceuticals, Inc. filed Critical Isis Pharmaceuticals, Inc.
Priority to US13/577,616 priority patent/US8957040B2/en
Priority to AU2011213562A priority patent/AU2011213562B2/en
Priority to JP2012552932A priority patent/JP6006120B2/en
Priority to EP17206749.8A priority patent/EP3321361B1/en
Publication of WO2011097643A1 publication Critical patent/WO2011097643A1/en
Priority to IL221272A priority patent/IL221272A/en
Priority to US14/581,235 priority patent/US20150329859A1/en
Priority to AU2016234914A priority patent/AU2016234914B2/en
Priority to IL254191A priority patent/IL254191B/en
Priority to US15/961,567 priority patent/US20190002877A1/en
Priority to AU2018260866A priority patent/AU2018260866A1/en
Priority to US17/577,832 priority patent/US12110491B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/08—Drugs for disorders of the urinary system of the prostate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/22—Anxiolytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A61P27/12—Ophthalmic agents for cataracts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/34—Allele or polymorphism specific uses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/35—Special therapeutic applications based on a specific dosage / administration regimen

Definitions

  • Embodiments of the present invention provide methods, compounds, and compositions for selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate diseases.
  • SNP single nucleotide polymorphism
  • HD Huntington's Disease
  • CAG polymorphic trinucleotide
  • HIT polymorphic trinucleotide
  • the average CAG tract size in the general population is 17-26 repeats (wild type allele), however, in HD patients the CAG tract has expanded to 36 repeats or more (mutant allele) (Huntington's Disease Collaborative Research Group 1993. Cell 72(6):971-83).
  • the ⁇ gene encodes the HTT protein and the expanded CAG tract results in a pathological increase in the polyglutamine repeats near the N-terminal of the protein. Individuals carry two copies of the HTT gene and one mutant allele is sufficient to result in HD.
  • HTT protein appears to have a role during development of the nervous system and a protective role in cells.
  • constitutive knockout of the HTT gene is lethal during embryonic development (Nasir et al 1995. Cell 81(5): 811-23), while adult inactivation of the HTT gene leads to progressive cell death in the brain and the testes (Dragatsis et al 2000. Nat. Genet 26:300-306).
  • Reduction of huntingtin expression from the wild type allele may, therefore, have negative consequences.
  • Like HD there are disorders for which a strategy of selective reduction of a mutant allele would be beneficial.
  • there remains an unmet need to selectively reduce expression of mutant allelic variants like that of HTT which are causative of disease, over the wild type variant, which appears to be necessary for normal cellular processes.
  • Figure 1 provides the mRNA and genomic HTT sequence showing SNP positions.
  • SNPs may be associated with a mutant allele, the expression of which causes disease.
  • the expressed gene product of a mutant allele results in aggregation of the mutant proteins causing disease.
  • the expressed gene product of a mutant allele results in gain of function causing disease.
  • selective reduction of mRNA and protein expression of a mutant allele is achieved by targeting a SNP located on the mutant allele with an antisense compound.
  • the antisense compound is an antisense oligonucleotide
  • antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on potency and selectivity of the antisense compound as well as population genetics.
  • 2'-0-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2'-0-methoxyethyl nucleotide means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5' position.
  • a 5-methylcytosine is a modified nucleobase.
  • Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual.
  • an antisense oligonucleotide targeted to an allelic variant is an active pharmaceutical agent.
  • Active target region or “target region” means a region to which one or more active antisense compounds is targeted.
  • Active antisense compounds means antisense compounds that reduce target nucleic acid levels or protein levels.
  • administering concomitantly refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
  • Allelic pair is one member of a pair of genes or one member of a series of different forms of a DNA sequences that can exist at a single locus or marker on a specific chromosome. For a diploid organism or cell or for autosomal chromosomes, each allelic pair will normally occupy
  • Major allele refers to an allele containing the nucleotide present in a statistically significant proportion of individuals in the human population.
  • Minor allele refers to an allele containing the nucleotide present in a relatively small proportion of individuals in the human population.
  • Wild type allele refers to the genotype typically not associated with disease or dysfunction of the gene product.
  • Motant allele refers to the genotype associated with disease or dysfunction of the gene product.
  • allelic variant refers to one of the pair of genes or DNA sequence existing at a single locus.
  • an allelic variant may refer to either the major allele or the minor allele.
  • “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • Antisense inhibition means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • Bicyclic sugar means a furosyl ring modified by the bridging of two ring atoms.
  • a bicyclic sugar is a modified sugar.
  • Bicyclic nucleoside means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system.
  • the bridge connects the 4 '-carbon and the 2 '-carbon of the sugar ring.
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • cEt or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4' -carbon and the 2' -carbon, wherein the bridge has the formula: 4'- CH(CH 3 )-0-2 ⁇
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0-methoxyethyl modifications.
  • Chimeric antisense compound means an antisense compound that has at least two chemically distinct regions.
  • Co-administration means administration of two or more pharmaceutical agents to an individual.
  • the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
  • Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
  • Co-administration encompasses parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • “Differentiating polymorphism” means a variation in a nucleotide sequence that permits differentiation between a wild type and a mutant allele of a nucleic acid sequence. Differentiating polymorphisms may include insertions or deletions of one or a few nucleotides in a sequence, or changes in one or a few nucleotides in a sequence. A differentiating polymorphism or polymorphic allele can be in linkage disequilibrium with one or more other polymorphisms or polymorphic alleles.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition may be a liquid, e.g. saline solution.
  • Dose means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period.
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
  • Effective amount means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • Gapmer means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the "gap” and the external regions may be referred to as the "wings.”
  • Gap- widened means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.
  • Gene product refers to a biochemical material, such as RNA or protein, resulting from expression of a gene.
  • Haplotype means a set of alleles of closely linked loci on a chromosome that are generally inherited together. For example, a polymorphic allele at a first site in a nucleic acid sequence on the chromosome may be found to be associated with another polymorphic allele at a second site on the same chromosome, at a frequency other than would be expected for a random associate (e.g.
  • a haplotype may comprise two, three, four, or more alleles.
  • the set of alleles in a haplotype along a given segment of a chromosome are generally transmitted to progeny together unless there has been a recombination event.
  • High-affinity sugar modification is a modified sugar moiety which when it is included in a nucleoside and said nucleoside is incorporated into an antisense oligonucleotide, the stability (as measured by Tm) of said antisense oligonucleotide: RNA duplex is increased as compared to the stability of a DNArRNA duplex.
  • High-affinity sugar-modified nucleoside is a nucleoside comprising a modified sugar moiety that when said nucleoside is incorporated into an antisense compound, the binding affinity (as measured by Tm) of said antisense compound toward a complementary RNA molecule is increased.
  • at least one of said sugar-modified high-affinity nucleosides confers a ATm of at least 1 to 4 degrees per nucleoside against a complementary RNA as determined in accordance with the methodology described in Freier et al., Nucleic Acids Res., 1997, 25, 4429-4443, which is incorporated by reference in its entirety.
  • At least one of the high-affinity sugar modifications confers about 2 or more, 3 or more, or 4 or more degrees per modification.
  • examples of sugar-modified high affinity nucleosides include, but are not limited to, (i) certain 2'-modified nucleosides, including 2'- subtstituted and 4' to 2' bicyclic nucleosides, and (ii) certain other non-ribofuranosyl nucleosides which provide a per modification increase in binding affinity such as modified tetrahydropyran and tricycloDNA nucleosides.
  • modifications that are sugar-modified high-affinity nucleosides see Freier et al., Nucleic Acids Res., 1997, 25, 4429-4443.
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Linked nucleosides means adjacent nucleosides which are bonded together.
  • mismatch or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
  • Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
  • a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, or a modified nucleobase.
  • Modified sugar refers to a substitution or change from a natural sugar.
  • Microtif means the pattern of chemically distinct regions in an antisense compound.
  • Naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
  • Natural sugar moiety means a sugar found in DNA (2'-H) or RNA (2' -OH).
  • Nuclease resistant modification means a sugar modification or modified internucleoside linkage which, when incorporated into an oligonucleotide, makes said oligonucleotide more stable to degradation under cellular nucleases (e.g. exo- or endo-nucleases).
  • nuclease resistant modifications include, but are not limited to, phosphorothioate internucleoside linkages, bicyclic sugar modifications, 2 '-modified nucleotides, or neutral internucleoside linkages.
  • Nucleic acid refers to molecules composed of monomelic nucleotides.
  • a nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.
  • Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only.
  • the tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Oligomer means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection or infusion.
  • Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
  • Peptide means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • Portion means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • allelic variant means reducing expression of one allele more than the other, differing allele among a set of alleles. For example, a mutant allele containing a single nucleotide polymorphism (SNP) may be reduced more than a wild type allele not containing the SNP.
  • SNP single nucleotide polymorphism
  • Side effects means physiological responses attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • Single nucleotide polymorphism or "SNP” means a single nucleotide variation between the genomes of individuals of the same species. In some cases, a SNP may be a single nucleotide deletion or insertion. In general, SNPs occur relatively frequently in genomes and thus contribute to genetic diversity. SNPs are thought to be mutationally more stable than other polymorphisms, lending their use in association studies in which linkage disequilibrium between markers and an unknown variant is used to map disease-causing mutations. The location of a SNP is generally flanked by highly conserved sequences. An individual may be homozygous or heterozygous for an allele at each SNP site.
  • a heterozygous SNP allele can be a differentiating polymorphism.
  • a SNP may be targeted with an antisense oligonucleotide, meaning that the SNP anneals to (or aligns with) position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the antisense oligonucleotide.
  • the remainder of the antisense oligonucleotide bases must have sufficient complementarity to the SNP site to facilitate hybridization.
  • Single nucleotide polymorphism position or “SNP position” refers to the nucleotide position of the SNP on a reference sequence.
  • Single nucleotide polymorphism site or “SNP site” refers to the nucleotides surrounding a SNP contained in a target nucleic acid to which an antisense compound is targeted.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Targeting or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid “Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • the target segment may be within the SNP site.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • “Treat” refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.
  • "Unmodified nucleotide” means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • Embodiments of the present invention provide methods, compounds, and compositions for selectively inhibiting mRNA and protein expression of an allelic variant of a gene or DNA sequence.
  • the allelic variant contains a single nucleotide polymorphism (SNP).
  • the SNP is a differentiating polymorphism.
  • a SNP is associated with a mutant allele.
  • a SNP is in linkage disequilibrium with another polymorphism that is associated with or is causative of disease.
  • a mutant allele is associated with disease.
  • mRNA and protein expression of a mutant allele is associated with disease.
  • the expressed gene product of a mutant allele results in
  • genes with an autosomal dominant mutation resulting in a toxic gain of function of the protein are the APP gene encoding amyloid precursor protein involved in Alzheimer's disease (Gene, 371: 68, 2006); the PrP gene encoding prion protein involved in Creutzfeldt- Jakob disease and in fatal familial insomnia (Nat. Med. 1997, 3: 1009 ); GFAP gene encoding glial fibrillary acidic protein involved in
  • Alexander disease J. Neurosci. 2006, 26:111623; alpha-synuclein gene encoding alpha-synuclein protein involved in Parkinson's disease (J. Clin. Invest. 2003, 111: 145); SOD-1 gene encoding the SOD-1 protein involved in amyotrophic lateral sclerosis (Science 1998, 281: 1851); atrophin-1 gene encoding atrophin-1 protein involved in dentato-rubral and pallido-luysian atrophy (DRPA) (Trends Mol. Med. 2001, 7: 479); SCA1 gene encoding ataxin-1 protein involved in spino-cerebellar ataxia- 1 (SCA1) (Protein Sci. 2003, 12: 953); PLP gene encoding proteolipid protein involved in
  • Pelizaeus-Merzbacher disease NeuroMol Med. 2007, 4: 73
  • DYT1 gene encoding torsinA protein involved in Torsion dystonia
  • alpha-B crystalline gene encoding alpha-B crystalline protein involved in protein aggregation diseases, including cardiomyopathy (Cell 2007, 130: 427); alphal -antitrypsin gene encoding alphal -antitrypsin protein involved in chronic obstructive pulmonary disease (COPD), liver disease and hepatocellular carcinoma (New Engl J Med.
  • COPD chronic obstructive pulmonary disease
  • Ltk gene encoding leukocyte tyrosine kinase protein involved in systemic lupus erythematosus (Hum. Mol. Gen. 2004, 13: 171); PCSK9 gene encoding PCSK9 protein involved in hypercholesterolemia (Hum Mutat. 2009, 30: 520); prolactin receptor gene encoding prolactin receptor protein involved in breast tumors (Proc. Natl. Assoc. Sci. 2008, 105: 4533); CCL5 gene encoding the chemokine CCL5 involved in COPD and asthma (Eur. Respir. J.
  • PTPN22 gene encoding PTPN22 protein involved in Type 1 diabetes, Rheumatoid arthritis, Graves disease, and SLE (Proc. Natl. Assoc. Sci. 2007, 104: 19767); androgen receptor gene encoding the androgen receptor protein involved in spinal and bulbar muscular atrophy or Kennedy's disease (J Steroid Biochem. Mol. Biol. 2008, 108: 245); CHMP4B gene encoding chromatin modifying protein-4B involved in progressive childhood posterior subcapsular cataracts (Am. J. Hum.
  • alpha-globin gene encoding alpha-globin protein involved in alpha-thallasemia (Science 2006, 312: 1215); httlpr gene encoding HTTLPR protein involved in obsessive compulsive disorder (Am. J. Hum. Genet. 2006, 78: 815); AVP gene encoding arginine vasopressin protein in stress-related disorders such as anxiety disorders and comorbid depression (CNS Neurol. Disord. Drug Targets 2006, 5: 167); GNAS gene encoding G proteins involved in congenital visual defects, hypertension, metabolic syndrome (Trends Pharmacol. Sci.
  • AChR gene encoding acetylcholine receptor involved in congential myasthenic syndrome (Neurology 2004, 62: 1090); P2Y12 gene encoding adenosine diphosphate (ADP) receptor protein involved in risk of peripheral arterial disease (Circulation 2003, 108: 2971); LQT1 gene encoding LQT1 protein involved in atrial fibrillation (Cardiology 2003, 100: 109); RET protooncogene encoding RET protein involved in sporadic pheochromocytoma (J. Clin. Endocrinol. Metab.
  • CA4 gene encoding carbonic anhydrase 4 protein, CRX gene encoding cone-rod homeobox transcription factor protein, FSCN2 gene encoding retinal fascin homolog 2 protein, IMPDH1 gene encoding inosine monophosphate dehydrogenase 1 protein, NR2E3 gene encoding nuclear receptor subfamily 2 group E3 protein, NRL gene encoding neural retina leucine zipper protein, PRPF3 (RP18) gene encoding pre-mRNA splicing factor 3 protein, PRPF8 (RP13) gene encoding pre-mRNA splicing factor 8 protein, PRPF31 (RP11) gene encoding pre-mRNA splicing factor 31 protein, RDS gene encoding peripherin 2 protein, ROM1 gene encoding rod outer membrane protein 1 protein, RHO gene encoding rhodopsin protein, RPl gene encoding RP1 protein, RPGR gene encoding retinitis pigmentosa GTP
  • selective reduction of mRNA and protein expression of a mutant allele is achieved by targeting a SNP located on the mutant allele with an antisense compound.
  • the antisense compound is an antisense oligonucleotide.
  • the antisense compound is not a ribozyme, a double stranded siRNA, or an shRNA.
  • the antisense oligonucleotide may have one or more modified sugar(s), nucleobase(s), or internucleoside linkage(s).
  • the antisense oligonucleotide is complementary to the SNP site.
  • the antisense oligonucleotide is at least 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the SNP site.
  • the antisense oligonucleotide is 100% complementary to the SNP site.
  • the SNP site is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
  • the SNP anneals to position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the antisense oligonucleotide.
  • antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on potency and selectivity of the antisense compound as well as population genetics.
  • selective reduction of mRNA and protein expression of an allelic variant of a gene containing a SNP occurs in a cell or tissue.
  • the cell or tissue is in an animal.
  • the animal is a human.
  • described herein are compounds comprising a modified antisense oligonucleotide consisting of 12 to 30 linked nucleosides targeted to a single nucleotide
  • the modified oligonucleotide comprises a wing-gap-wing motif with a 5' wing region positioned at the 5' end of a deoxynucleoside gap, and a 3' wing region positioned at the 3' end of the deoxynucleoside gap, wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, or positions 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
  • the single nucleotide polymorphism site is on a mutant allele that is associated with a disease. In certain embodiments, the single nucleotide polymorphism site contains a differentiating polymorphism.
  • the modified antisense oligonucleotide consists of 12 to 20 linked nucleosides. In certain embodiments, modified antisense oligonucleotide consists of 15 to 20 linked nucleosides. In certain embodiments, the modified antisense oligonucleotide consists of 15 to 19 linked nucleosides.
  • position 8, 9, or 10 of the modified oligonucleotide as counted from the 5' terminus of the modified oligonucleotide, or positions 4, 5, or 6 of the modified
  • oligonucleotide as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
  • the gap region is 7-11 nucleosides in length
  • the 5' wing region is 1- 6 nucleobases in length
  • the 3' wing region is 1-6 nucleobases in length.
  • the wing-gap- wing motif is any one of the group consisting of 5-10- 5, 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-3, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, and 6-9-2.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 4-9-5, and 4-11-4.
  • At least one intemucleoside linkage is a modified intemucleoside linkage.
  • each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • At least one nucleoside comprises a modified nucleobase.
  • the modified nucleobase is a 5'-methylcytosine.
  • At least one nucleoside of at least one of the wing regions comprises a modified sugar or sugar surrogate.
  • each of the nucleosides of each wing region comprises a modified sugar or sugar surrogate.
  • the sugar or sugar surrogate is a 2'-0-methoxyethyl modified sugar.
  • at least one of the wing regions comprises a 4' to 2' bicyclic nucleoside and at least one of the remaining wing nucleosides is a non-bicyclic 2'-modified nucleoside.
  • the non-bicyclic 2 '-modified nucleoside is a 2'-0-methoxyethyl nucleoside.
  • the 4' to 2' bicyclic nucleoside is 4'-CH(CH3)-0-2' bicyclic nucleoside.
  • the modified antisense oligonucleotide consisting of 17 linked nucleosides and wherein position 9 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
  • the wing-gap-wing motif is 2-9-6.
  • described herein are compounds comprising a modified
  • oligonucleotide consisting of 18 linked nucleosides and 90% complementary to a differentiating polymorphism
  • the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 9 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein the wing-gap- wing motif is 4-9-5.
  • described herein are compounds comprising a modified
  • oligonucleotide consisting of 19 linked nucleosides and 90% complementary to a differentiating polymorphism
  • the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 10 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein the wing-gap- wing motif is 4-11- 4.
  • described herein are compounds comprising a modified
  • oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a
  • the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification.
  • the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification.
  • the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligon
  • oligonucleotide is 100% complementary to the single nucleotide polymorphism site.
  • At least one of the wing regions comprises a Wgh-affinity sugar modification.
  • the high-affinity sugar modification is a bicyclic sugar.
  • the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
  • at least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide comprises the at least one high-affinity sugar modification.
  • oligonucleotide as counted from the 5' terminus of the modified oligonucleotide, comprises the at least one Wgh-afftnity sugar modification.
  • each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprise the at least one high-affinity sugar modification.
  • the Wgh-affinity sugar modification is a bicyclic sugar.
  • the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
  • the wing-gap-wing motif is any of the group consisting of 3-9-3, 4- 9-4, and 5-9-5.
  • described herein are compounds comprising a modified
  • oligonucleotide consisting of 15, 17, or 19 linked nucleosides and fully complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 6, 8, 10, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification.
  • At least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises the at least one high-affinity sugar modification.
  • the high-affinity sugar modification is a bicyclic sugar.
  • the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
  • the wing-gap- wing motif is any of the group consisting of 3-9-3, 4- 9-4, and 5-95.
  • described herein are compounds comprising a modified
  • the modified oligonucleotide consisting of 15 linked nucleosides and 90% complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 8 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification.
  • the modified oligonucleotide is 100% complementary to the differentiating polymorphism.
  • each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprise the at least one high-affinity sugar modification.
  • the high-affinity sugar modification is a bicyclic sugar.
  • the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
  • the wing-gap- wing motif is 3-9-3.
  • described herein are methods of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
  • the modified oligonucleotide is 90% complementary to the single differentiating polymorphism. In certain embodiments, the modified oligonucleotide is 95% complementary to the single nucleotide polymorphism site. In certain embodiments, the modified oligonucleotide is 100% complementary to the single nucleotide polymorphism site.
  • the single nucleotide polymorphism site is from 12 to 30 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is from 15 to 25 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is from 17 to 22 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 17 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 18 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 19 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 20 nucleobases in length.
  • the allelic variant is associated with disease. In certain embodiments, the allelic variant is associated with disease.
  • the disease is Huntington's Disease.
  • the modified oligonucleotide is a single-stranded oligonucleotide.
  • at least one intemucleoside linkage is a modified intemucleoside linkage.
  • each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • At least one nucleoside comprises a modified nucleobase.
  • the at least one modified nucleobase is a 5'-methylcytosine.
  • At least one nucleoside comprises a modified sugar.
  • the modified sugar is a Wgh-affinity sugar modification.
  • the high-affinity sugar is a bicyclic sugar.
  • each bicyclic sugar comprises a 4'- CH(CH 3 )-0-2' bridge.
  • nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, counting from the 5' terminus of the modified oligonucleotide comprises a nucleoside having a bicyclic sugar wherein the bicyclic sugar comprises a 4'-CH(CH 3 )-0-2' bridge.
  • each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, counting from the 5' terminus of the modified oligonucleotide, comprises a bicyclic sugar wherein the bicyclic sugar comprises a 4'-CH(CH 3 )-0-2' bridge.
  • the at least one modified sugar comprises a 2'-0-methoxyethyl.
  • each nucleoside positioned in a wing segment of the modified oligonucleotide comprises a 2'-0-methoxyethyl modification.
  • the wing-gap- wing motif is any of the group consisting of 2-9-6, 3-
  • the modified oligonucleotide is not a ribozyme, a double stranded siRNA, or an shRNA.
  • the single nucleotide polymorphism site is on a mutant allele that is associated with disease. In certain embodiments, the single nucleotide polymorphism site contains a differentiating polymorphism.
  • the modified antisense oligonucleotide consists of 12 to 20 linked nucleosides. In certain embodiments, the modified antisense oligonucleotide consists of 15 to 19 linked nucleosides.
  • the gap region is 7 to 11 nucleosides in length
  • the 5' wing region is 1 to 6 nucleobases in length
  • 3' wing region is 1 to 6 nucleobases in length.
  • at least one nucleoside of at least one of the wing regions comprises a modified sugar or sugar surrogate.
  • each of the nucleosides of each wing region comprises a modified sugar or sugar surrogate.
  • the sugar or sugar surrogate is a 2'-0- methoxyethyl modified sugar.
  • At least one of the wing regions comprises a 4' to 2' bicyclic nucleoside and at least one of the remaining wing nucleosides is a non-bicyclic 2 '-modified nucleoside.
  • the non-bicyclic 2'-modified nucleoside is a 2'-0-methoxyethyl nucleoside.
  • 4' to 2' bicyclic nucleoside is a 4'-CH(CH3)-0-2' bicyclic nucleoside.
  • described herein are methods of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
  • described herein are methods of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide aligns with the differentiating polymorphism; and wherein the allelic variant is a mutant allele.
  • the mutant allele is associated with any disease from the group consisting of Alzheimer's disease, Creutzfeldt- Jakob disease, fatal familial insomnia, Alexander disease, Parkinson's disease, amyotrophic lateral sclerosis, dentato-rubral and pallido-luysian atrophy DRPA, spino-cerebellar ataxia, Torsion dystonia, cardiomyopathy, chronic obstructive pulmonary disease (COPD), liver disease, hepatocellular carcinoma, systemic lupus erythematosus, hypercholesterolemia, breast cancer, asthma, Type 1 diabetes, Rheumatoid arthritis, Graves disease, SLE, spinal and bulbar muscular atrophy, Kennedy's disease, progressive childhood posterior subcapsular cataracts, cholesterol gallstone disease, arthrosclerosis, cardiovascular disease, primary hypercalciuria, alpha-thallasemia, obsessive compulsive disorder, Anxiety, comorbid depression, congenital visual defects, hypertension, metabolic syndrome,
  • any disease
  • described herein are methods of treating Huntington's Disease, comprising selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and complementary to differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with differentiating polymorphism; and wherein the allelic variant is associated with Huntington's Disease.
  • position 8, 9, or 10 of the modified oligonucleotide as counted fromt eh 5' terminus of the modified oligonucleotide, or positions 4, 5, or 6 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
  • SNPs Single Nucleotide Polymorphisms
  • Single-nucleotide polymorphisms are single base-pair alterations in the DNA sequence that represent a major source of genetic heterogeneity (Gene. 1999, 234:177). SNP genotyping is an important tool with which to investigate these genetic variants (Genome Res. 2000, 10:895; Trends Biotechnol. 2000, 18:77).
  • antisense compounds designed to selectively reduce an allelic variant of a gene containing an SNP were selected based on potency, selectivity and population genetics coverage.
  • antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on potency of the antisense compound.
  • Potency generally refers to how amenable the targeted sequence area is to antisense inhibition.
  • specific SNP sites may be particularly amenable to antisense inhibition.
  • Certain such highly amenable SNP sites may be targeted by antisense compounds for selectively reducing an allelic variant of a gene. Potency is demonstrated by the percent inhibition of mutant mRNA achieved by the antisense oligonucleotides targeting a SNP compared to the percent inhibition of mutant mRNA achieved by the benchmark oligonucleotide.
  • antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on selectivity of the antisense compound.
  • Selectivity generally refers to antisense compounds comprising a particular sequence, motif, and chemical modification(s) that preferentially target the one or more differentiating polymorphisms (SNPs) in the RNA encoding a mutant HTT protein compared to the RNA encoding a wild type HTT protein.
  • specific sequences, motifs, and chemical modification(s) are particularly selective in reducing an allelic variant of a gene containing a SNP. Certain such sequences, motifs, and chemical modification(s) are utilized to selectively reduce an allelic variant of a gene. Selectivity is demonstrated by the ability of the antisense oligonucleotide targeting a SNP to inhibit expression of the major allele or mutant allele preferentially compared to the minor allele or wild type allele.
  • antisense compounds designed to selectively reduce an allelic variant of a gene containing an SNP are created based on the population genetics of a population afflicted with disease.
  • Population genetics means the frequency at which the SNP appears in the disease chromosome of patients afflicted with a particular disease.
  • the disease is Huntington disease. Where potency and selectivity amongst antisense compounds is equal, SNP targets that have higher population genetics coverage are favored over SNPs that have a weaker association with disease chromosomes.
  • Oligomeric compounds may include, but are not limited to, oligonucleotides,
  • oligonucleosides oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
  • An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound is an antisense oligonucleotide. In certain embodiments, the antisense compound is not a ribozyme, a double stranded siRNA, or an shRNA.
  • an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • antisense compounds are 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits.
  • the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleosides.
  • antisense oligonucleotides targeted to a nucleic acid may be shortened or truncated.
  • a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation).
  • a shortened or truncated antisense compound targeted to a nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound.
  • the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
  • the additional subunit may be located at the 5' or 3' end of the antisense compound.
  • the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound.
  • the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
  • an antisense compound such as an antisense oligonucleotide
  • introduce mismatch bases without eliminating activity.
  • Gautschi et al demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
  • an allelic variant is optimized when the SNP contained in the target nucleic anneals to a complementary base in the antisense compound and not a mismatched base. Moreover, selectivity in general is increased when there are fewer mismatches between the SNP site and the antisense compound. However, a certain number of mismatches may be tolerated.
  • antisense compounds targeted to a nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an R A:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports R aseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • an antisense oligonucleotide for selectively reducing expression of an allelic variant of a gene containing a SNP the SNP anneals to a nucleobase within the gap segment.
  • the SNP anneals or is complementary to a nucleobase at position 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the antisense oligonucleotide, wherein position refers to the orientation of a nucleobase within the antisense oligonucleotide counting from the 5' terminus of the antisense oligonucleotide. For example, the 5' most nucleobase within the antisense oligonucleotide is in the first position of the antisense oligonucleotide.
  • the SNP anneals to a nucleobase at position 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the gap segment, wherein position refers to the orientation of a nucleobase within the gap segment counting from the 5' terminus of the gap segment. For example, the 5' most nucleobase within the gap segment is in the first position of the gap segment.
  • the SNP anneals to a nucleobase at position 4, 5, 6, or 7 counting from the 5' terminus of the gap segment.
  • the SNP anneals to a nucleobase at position 4 or 5 beginning from the 5' terminus of the gap segment.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • the bicyclic moiety may be a cEt having the formula 4'-CH(CH 3 )-0-2.'
  • wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5' wing region, "Y” represents the length of the gap region, and “Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no mtervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other
  • gapmers of the present invention include, but are not limited to, for example 1-10-1, 1-18-1, 2-8-2, 2-9-6, 2-10-2, 2- 13-5, 2-16-2, 3-9-3, 3-9-5, 3-10-3, 3-14-3, 4-8-4, 4-9-5, 4-10-5, 4-11-4, 4-12-3, 4-12-4, 5-8-5, 5-9-5, 5-10-4, 5-10-5, or 6-8-6.
  • the antisense compound has a "wingmer" motif, having a wing- gap or gap- wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration.
  • wingmer configurations of the present invention include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
  • antisense compounds targeted to a nucleic acid possess a 2-9-6 gapmer motif or a 6-9-2 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 3-9-3 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 3-9-5 gapmer motif or 5-9-3 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 4-9-5 gapmer motif or 5-9-4 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 4-10-5 gapmer motif or 5-10-4 gapmer motif. In certain embodiments, antisense compounds targeted to a nucleic acid possess a 4-11-4 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 5-9-5 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 5-8-6 gapmer motif or a 6-8-5 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 6-7-6 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 6-8-5 gapmer motif or a 5-8-6 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 3-9-4 gapmer motif or a 4-9-3 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 5-7-5 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 4-7-4 gapmer motif.
  • antisense compounds targeted to a nucleic acid possess a 5-10-5 gapmer motif.
  • an antisense compound targeted to a nucleic acid has a gap- widened motif.
  • the invention provides gapmer compounds wherein at least one nucleoside of one wing is differently modified compared to at least one other nucleoside of the same wing.
  • antisense compounds are referred to as mixed wing antisense compounds (see WO 2008/049085).
  • the modifications (or no modification) of one or more nucleosides of the 3' wing are different from those of one or more other nucleosides of the 3' wing.
  • Such antisense compounds may be referred to as 3' mixed wing gapmers.
  • the modifications (or no modification) of one or more nucleosides of the 5' wing are different from those of one or more other nucleosides of the 5' wing.
  • Such antisense compounds may be referred to as 5' mixed wing gapmers.
  • the modifications (or no modification) of one or more nucleosides of the 3' wing are different from those of one or more other nucleosides of the 3' wing and the modifications (or no modification) of one or more nucleosides of the 5' wing are different from those of one or more other nucleosides of the 5' wing.
  • Such antisense compounds may be referred to as 3', 5' mixed wing gapmers.
  • the modifications and combination of modifications at the 3' wing and at the 5' wing may be the same or they may be different.
  • mixed wing compounds have desirable properties.
  • Certain nucleoside modifications confer on the antisense compound a desirable property, for example increased affinity for a target or nuclease resistance, but also confer an undesirable property, for example increased toxicity.
  • Incorporation of certain other nucleoside modifications results in antisense compounds with different profiles of properties.
  • the wings of a mixed wing antisense compound comprise one or more nucleoside comprising a first modification that increases affinity of the antisense compound for a target nucleic acid compared to an antisense compound comprising unmodified nucleosides; and one or more nucleoside comprising a second modification that results in reduced toxicity compared to an antisense compound with wings comprising nucleosides that all comprise the first modification.
  • an antisense compound comprises at least one wing comprising at least one MOE substituted nucleoside and at least one high affinity modification.
  • the at least one MOE substituted nucleoside and the at least one high affinity are in the 3' wing.
  • the at least one MOE substituted nucleoside and the at least one high affinity are in the 5' wing.
  • an antisense compound comprises 1, 2 or 3 high affinity modifications in the 5' and/or 3' wings.
  • an allelic variant of huntingtin is selectively reduced.
  • Nucleotide sequences that encode huntingtin include, without limitation, the following: GENBANK Accession No. NT_006081.18, truncated from nucleotides 1566000 to 1768000 (replaced by GENBANK Accession No. NT_006051), incorporated herein as SEQ ID NO: 1, and NM_002111.6,
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for huntingtin can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels of a particular allelic variant.
  • the desired effect is reduction of levels of the protein encoded by the target nucleic acid or a phenotypic change associated with a particular alleleic variant.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
  • Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • the GM04281, GM02171, and GM02173B cell lines are used in experiments described herein below.
  • the GM04281 cell line has a wild-type HTT allele that contains 17 repeats and a mutant H7T allele that contains 69 repeats.
  • the cell line was derived from a patient both of whose parents were also affected by the disease.
  • the GM02171 cell line was chosen as a counter screen control to the GM04281. This cell line was derived from the daughter of parents, only one of whom had the disease. The daughter had not developed HD but was considered to be at risk.
  • the GM02173B cell line was also patient-derived and was used as a haplotype test control.
  • Table 1 provides SNPs found in the GM04281, GM02171, and GM02173B cell lines. Also provided are the allelic variants found at each SNP position, the genotype for each of the cell lines, and the percentage of HD patients having a particular allelic variant. For example, the two allelic variants for SNP rs6446723 are T and C. The GM02171 cell line is homozygous CC, the GM02173 cell line is heterozygous TC, and the GM04281 cell line is homozygous TT. Fifty percent of HD patients have a T at SNP position rs6446723.
  • hybridization occurs between an antisense compound disclosed herein and a SNP site.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with the nucleic acid of a particular allelic variant.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., selective reduction of a gene product of an allelic variant).
  • Non-complementary nucleobases between an antisense compound and a target nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a target nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target nucleic acid, a target region, target segment, SNP site, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, a SNP site, target region, target segment, or specified portion thereof.
  • "fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, SNP site, or specified portion thereof.
  • antisense oligonucleotides that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, SNP site, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment.
  • antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.
  • Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides. Chemically modified nucleosides may also be employed to increase selectivity in reducing expression the gene product of an allelic variant.
  • RNA and DNA The naturally occuring intemucleoside linkage of RNA and DNA is a 3' to 5'
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioate. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds comprise one or more modified
  • each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, increased selectivity for an allelic variant, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise a chemically modified ribofuranose ring moieties.
  • substitutent groups including 5' and 2' substituent groups
  • BNA bicyclic nucleic acids
  • Examples of chemically modified sugars include 2 -F- 5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2*-F, 2'-OCH3 and 2'-0(CH2)20CH3 substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4' to 2' bicyclic nucleoside.
  • 4' to 2' bicyclic nucleosides include but are not limited to one of the formulae: 4'-(CH 2 )-0-2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -0-2' (ENA); 4 ⁇ - ⁇ ( ⁇ 3 )-0-2' and 4'-CH(CH 2 0CH 3 )-0-2* (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH.3)(CH 3 )-0-2' (and analogs thereof see published International Application
  • bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L- ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • the bridge of a bicyclic sugar moiety is , -[C(R a )(R b )] n -,
  • the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4'-(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 - N(R)-0-2'- wherein each R is, independently, H, a protecting group or C ! -C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4'-2' methylene-oxy bridge may be in the a-L
  • bicyclic nucleosides include, but are not limited to, (A) a-L- Methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-Methyleneoxy (4'-CH 2 -0-2') BNA , (C) Ethyleneoxy (4'-(CH 2 )2-0-2') BNA , (D) Aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) Oxyamino (4'-CH 2 -N(R)-0- 2') BNA, and (F) Methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA, (G) methylene-thio (4'-CH 2 -S- 2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )- 2') BNA
  • Bx is a heterocyclic base moiety
  • Rc is C1-C12 alkyl or an amino protecting group
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleoside having Formula II having Formula II:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is C ! -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted Ci-Ce alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleoside having Formula IV having Formula IV:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Rd is Ci-C 6 alkyl, substituted C!-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and q d is, independently, H, halogen, Q-Q alkyl, substituted C!-C 6 alkyl, C 2 - C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl, Q-C 6 alkoxyl, substituted C ! -C 6 alkoxyl, acyl, substituted acyl, C C 6 aminoalkyl or substituted C C 6 aminoalkyl;
  • bicyclic nucleoside having Formula V having Formula V:
  • Bx is a heterocyclic base moiety
  • T a and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • qg and q h are each, independently, H, halogen, C ! -C 12 alkyl or substituted C ⁇ -C ⁇ 2 alkyl.
  • BNA methyleneoxy (4'-CH 2 -0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • bicyclic nucleoside having Formula VI having Formula VI:
  • Bx is a heterocyclic base moiety
  • 4'-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2'- substituent groups can also be selected from: C ⁇ - Ci2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000).
  • 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Helv. Chim.
  • a "modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA) or those compounds having Formula X:
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T 3 and T 4 is an
  • internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi, 3 ⁇ 42, 3, 3 ⁇ 44, q 5 > 3 ⁇ 46 and q 7 are each independently, H, Ci-C 6 alkyl, substituted Q-Q alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and
  • Ri and R 2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJA, SJi, N 3 , J 2 and CN, wherein X is O, S or NJi and each J l5 J 2 and J3 is, independently, H or -Ce alkyl.
  • the modified THP nucleosides of Formula X are provided wherein qm, qn, p, qr, qs, qt and q lake are each H. In certain embodiments, at least one of q m , q n , q p , q r , q s , qt and q u is other than H. In certain embodiments, at least one of q m , q n , q p , q r , q s , qt and q u is methyl. In certain embodiments, THP nucleosides of Formula X are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is fluoro and R 2 is H; Ri is methoxy and R 2 is H, and R is methoxyethoxy and R 2 is H.
  • 2'-modified or “2 '-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position.
  • 2'-OMe or “2'-OCH 3 " or “2'-0-methyl” each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (R A) and/or deoxyribonucleosides (DNA).
  • Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleotides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2'-MOE modified nucleotides are arranged in a gapmer motif.
  • the modified sugar moiety is a cEt.
  • the cEt modified nucleotides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity, increased selectivity for an allelic variant, or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5- me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine,
  • hypoxanthine 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
  • antisense compounds comprise one or more modified nucleobases.
  • gap-widened antisense oligonucleotides comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution, increased selectivity for an allelic variant, or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'- stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes.
  • Illustrative cell lines include GM04281, GM02171, and GM02173B cells.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN
  • concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with
  • LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line.
  • Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
  • target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
  • Probes and primers are designed to hybridize to target nucleic acids.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
  • Target protein levels can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme- linked immunosorbent assay (ELIS A), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence- activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human proteins are commercially available.
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to selectively reduce or inhibit expression of target gene product and produce phenotypic changes, such as, amelioration of a disease symptom. Testing may be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA or protein is isolated from tissue and changes in target nucleic acid or protein expression are measured.
  • the compounds and compositions described herein may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal), oral, pulmonary (including by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal) or parenteral, for example, by intravenous drip, intravenous injection or subcutaneous, intraperitoneal, intraocular, intravitreal, or intramuscular injection.
  • Administration may be topical (including ophthalmic, vaginal, rectal, intranasal), oral, pulmonary (including by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal) or parenteral, for example, by intravenous drip, intravenous injection or subcutaneous, intraperitoneal
  • the compounds and compositions as described herein are administered parenterally.
  • parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump. In certain embodiments, parenteral administration is by injection.
  • compounds and compositions are delivered to the CNS. In certain embodiments, compounds and compositions are delivered to the cerebrospinal fluid. In certain embodiments, compounds and compositions are administered to the brain parenchyma. In certain embodiments, compounds and compositions are delivered to an animal by intrathecal
  • intraparenchymal administration intrathecal administration, or intracerebroventricular
  • parenteral administration is by injection.
  • the injection may be delivered with a syringe or a pump.
  • the injection is a bolus injection.
  • the injection is administered directly to a tissue, such as striatum, caudate, cortex, hippocampus and cerebellum.
  • methods of specifically localizing a pharmaceutical agent decreases median effective concentration (EC50) by a factor of 20, 25, 30, 35, 40, 45 or 50.
  • EC50 median effective concentration
  • the pharmaceutical agent in an antisense compound as further described herein.
  • the targeted tissue is brain tissue.
  • the targeted tissue is striatal tissue.
  • decreasing EC50 is desirable because it reduces the dose required to achieve a pharmacological result in a patient in need thereof.
  • an antisense oligonucleotide is delivered by injection or infusion once every month, every two months, every 90 days, every 3 months, every 6 months, twice a year or once a year.
  • a mutant allele Provided herein are compounds and methods that provide potent inhibition and increased selectivity for a mutant allele. Potency is demonstrated by the percent inhibition of mutant mRNA achieved by the antisense oligonucleotides targeting a SNP compared to the percent inhibition of mutant mRNA achieved by the benchmark oligonucleotide. Selectivity is demonstrated by the ability of the antisense oligonucleotide targeting a SNP to inhibit expression of the major allele or mutant allele preferentially compared to the minor allele or wild type allele. The usage of three cell lines with different genotypes at each SNP position have facilitated the determination of design rules that provide for potent and selective SNP targeting antisense oligonucleotides.
  • the compounds are antisense oligonucleotides as further described herein.
  • the antisense oligonucleotides preferentially target a SNP or differentiating polymorphism. Oligonucleotides of various lengths were tested and certain lengths were determined to be beneficial for the targeting of SNPs.
  • the antisense oligonucleotides have a sequence that is 12-30 nucleobases in lenth. In certain embodiments, the antisense oligonucleotides have a sequence that is 12-25 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 12-21 nucleobases in length. In certain embodiments, the antisense
  • the antisense oligonucleotides have a sequence that is 12-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 13-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 14-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 15-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 12-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 13-19 nucleobases in length.
  • the antisense oligonucleotides have a sequence that is 14-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 15-19, nuceobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 16-19 nucleobases in lenth. In certain
  • the antisense oligonucleotides have a sequence that is 17-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleobases in length.
  • oligonucleotides of various lengths For oligonucleotides of various lengths, the position of the nucleoside complementary to the SNP position was shifted within the gap and the wings and the effect was tested. Certain positions within the antisense oligonucleotide are shown to be beneficial for targeting SNPs.
  • the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 6-15 counting from the 5' terminus of the antisense oligonuceotide and/or positions 1-9 counting from the 5' end of the gap.
  • the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 8-14 counting from the 5' terminus of the antisense oligonuceotide and/or positions 1-9 counting from the 5' end of the gap.
  • the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 6-15 counting from the 5' terminus of the antisense
  • the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 8-10 counting from the 5' terminus of the antisense oligonuceotide and/or positions 4-6 counting from the 5' end of the gap.
  • the SNP is complementary to position 8, 9, or 10 counting from the 5' terminus of the oligonucleotide or position 4, 5, or 6, counting from the 5' end of the gap.
  • the effect of the length of the gap, 5' wing, and 3' wing was tested.
  • wing-gap- wing combinations were shown to be beneficial for a SNP targeting antisense oligonucleotide.
  • the gap is 7-11 nucleobases in length and each wing is independently 1-6 nucleobases in length. In certain embodiments the gap is 7-11
  • the gap is 8-11 nucleobases in length and each wing is independently 2-6 nucleobases in length. In certain embodiments the gap is 9-11 nucleobases in length and each wing is independently 2-6 nucleobases in length. In certain embodiments the gap is 9 nucleobases in length and each wing is independently 2-6 nucleobases in length. In certain embodiments the gap is 10 nucleobases in length and each wing is independently 2-6 or 4-5 nucleobases in length. In certain embodiments the gap is 11 nucleobases in length and each wing is independently 2-6, or 4-5 nucleobases in length. In certain embodiments, the wing-gap-wing configuration is one of 4-7-4, 5-
  • each nucleoside of each wing of the modified antisense oligonucleotide has a 2'-MOE modification.
  • each nucleoside of each wing of the modified antisense oligonucleotide has a high affinity modification.
  • the antisense oligonucleotide is a mixed wing gapmer. In such embodiment, the modifications and combination of modifications at the 3' wing and at the 5' wing may be the same or they may be different.
  • the antisense oligonucleotide has one or more 2'-MOE modifications in the wings and/or one or more high affinity modifications in the wings.
  • the high affinity modification is a cEt modification.
  • the antisense oligonucleotide has a high affinity modification at positions 2, 3, 13, and 14 of the antisense oligonucleotide (counting from the 5' terminus).
  • the antisense oligonuceotide has one, two, three, or four high affinity modifications in at least one of the wings.
  • the antisense oligonuceotide has one, two, three, or four high affinity modifications in each of the 5' and 3' wings independently.
  • the antisense oligonucleotide has a high affinity modification at positions 2 and 3 in one or both of the 5' and 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing). In certain embodiments, the antisense oligonuceotide has a high affinity modification at positions 2, 3 and 4 in one or both of the 5' and 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing,). In certain embodiments, the antisense oligonuceotide has a high affinity
  • the antisense oligonuceotide has a high affinity modification at positions 1 of the 5' and 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing,) and at least one other position in the wing. In certain embodiments, the antisense oligonuceotide has alternating 2'-MOE and high affinity modification in at least one of the 5' and 3 'wings.
  • the compound comprises an antisense oligonucleotide
  • the compound comprises a modified antisense oligonucleotide consisting of 12 to 30 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 6-15 begining from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the single nucleotide polymorphism site contains a
  • the single nucleotide polymorphism site is on a mutant allele.
  • the mutant allele is associated with disease.
  • the wing-gap-wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6- 7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9-5, 5-9-5, 4-11-4,4- 10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap- wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 6-15 begining from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-14 begining from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-14 begining from the 5' terminus of the antisense oligonuceotide or positions 4-7 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 begining from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 12 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 begining from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 13 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 begining from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap- wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 14 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 beginning from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5- 9-3, 5-9-4, 4-9-5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 6-15 beginning from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap- wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5- 9_3, 5.9.4, 4-9-5, 5.9.5, 4.11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 beginning from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5- 9-3, 5-9-4, 4-9-5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisnese oligonucleotide comprises a wing-gap- wing motif, wherein position 6, 8, 9, 10, 11, or 14 beginning from the 5' terminus of the modified antisense
  • oligonucleotide aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 1, 4, 5, 6, 7, or 9 of the gap segment aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment has a modified sugar or sugar surrogate.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4- 9_5, 4-11-4, and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, or 12 of the modified antisense oligonucleotide aligns with the single nucleotide polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'- CH(CH3)-0-2' bridge.
  • the wing-gap- wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a single nucleotide
  • the modified antisense oligonucleotide comprises a wing-gap- wing motif, wherein position 3, 4, 5, 6, 7, 8 or 9 of the gap segment aligns with the single nucleotide polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'-CH(CH 3 )-0-2' bridge.
  • the wing-gap- wing motif is any one of the group consisting of 2-9- 6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • a compound comprising a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, or 12 of the modified antisense oligonucleotide aligns with the single nucleotide
  • the wing-gap- wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • a compound comprising a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 3, 4, 5, 6, 7, 8, or 9 of the gap segment aligns with the single nucleotide polymorphism; and positions 2, 3, 13, and 14 of the antisense antisense oligonucleotide comprise a 4'-CH(CH 3 )-0-2' bridge.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4- 9-5, 4-11-4, and 5-10-4.
  • the compound comprise a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 8, 9, or 10 of the modified antisense oligonucleotide aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 5, 6, or 7 of the gap segment aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4- 9-5, 4-11-4, and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap- wing motif, wherein position 8, 9, or 10 of the modified antisense oligonucleotide aligns with the single nucleotide polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'-CH(CH 3 )-0-2' bridge.
  • the wing-gap-wing motif is any one of the group consisting of 2-9- 6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • the compound comprises a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides and fully complementary to a single nucleotide
  • modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 5, 6, or 7 of the gap segment aligns with the single nucleotide
  • the wing-gap-wing motif is any one of the group consisting of 2-9- 6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
  • a compound comprising a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 8, 9, or 10 of the modified oligonucleotide aligns with the single nucleotide polymorphism; and positions 2, 3, 13, and 14 of the antisense antisense oligonucleotide comprise a 4'-CH(CH 3 )-0-2' bridge.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-
  • a compound comprising a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 5, 6, or 7 of the gap segment aligns with the single nucleotide polymorphism; and positions 2, 3, 13, and 14 of the antisense oligonucleotide comprise a 4'-CH(CH 3 )-0-2' bridge.
  • the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-
  • the antisense oligonucleotide is 11 to 20 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wings and 7 to 11 linked nucleosides in the gap.
  • the SNP is complementary to position 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 counting from the 5' terminus of the gap segment.
  • the antisense oligonucleotide is 15 to 19 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wings and 7 to 11 linked nucleosides in the gap.
  • the SNP is complementary to position 6, 7, 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 4, 5, 6, or 7 counting from the 5' terminus of the gap segment.
  • the antisense oligonucleotide is 17 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wing segments and 9 to 11 linked nucleosides in the gap segment.
  • the SNP is complementary to position 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 5, 6, or 7 (counting from the 5' terminus of the gap segment).
  • the antisense oligonucleotide is 18 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wing segments and 9 to 11 linked nucleosides in the gap segment.
  • the SNP is complementary to position 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 5, 6, or 7 (counting from the 5' terminus of the gap segment).
  • the antisense oligonucleotide is 19 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wing segments and 9 to 11 linked nucleosides in the gap segment.
  • the SNP is complementary to position 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 5, 6, or 7 (counting from the 5' terminus of the gap segment).
  • the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions described herein.
  • the individual has an allelic variant associated with a disease or disorder.
  • the pharmaceutical compositions provided herein preferentially target a SNP.
  • the SNP is a differentiating polymorphism.
  • the gene and associated disease are any of the following: APP gene encoding amyloid precursor protein involved in Alzheimer's disease (Gene, 371 : 68, 2006); the PrP gene encoding prion protein involved in Creutzfeldt- Jakob disease and in fatal familial insomnia (Nat. Med. 1997, 3: 1009 ); GFAP gene encoding glial fibrillary acidic protein involved in Alexander disease (J. Neurosci. 2006, 26:111623); alpha-synuclein gene encoding alpha-synuclein protein involved in Parkinson's disease (J. Clin. Invest.
  • SOD-1 gene encoding the SOD-1 protein involved in amyotrophic lateral sclerosis (Science 1998, 281: 1851); atrophin-1 gene encoding atrophin-1 protein involved in dentato-rubral and pallido-luysian atrophy (DRPA) (Trends Mol. Med. 2001, 7: 479); SCA1 gene encoding ataxin-1 protein involved in spino-cerebellar ataxia-1 (SCA1) (Protein Sci. 2003, 12: 953); PLP gene encoding proteolipid protein involved in Pelizaeus- Merzbacher disease (NeuroMol Med.
  • PCSK9 gene encoding PCSK9 protein involved in hypercholesterolemia (Hum Mutat. 2009, 30: 520); prolactin receptor gene encoding prolactin receptor protein involved in breast tumors (Proc. Natl. Assoc. Sci. 2008, 105: 4533); CCL5 gene encoding the chemokine CCL5 involved in COPD and asthma (Eur. Respir. J. 2008, 32: 327); PTPN22 gene encoding PTPN22 protein involved in Type 1 diabetes, Rheumatoid arthritis, Graves disease, and SLE (Proc. Natl. Assoc. Sci.
  • CaSR gene encoding the calcium sensing receptor protein involved in primary hypercalciuria (Kidney Int. 2007, 71 : 1155); alpha-globin gene encoding alpha-globin protein involved in alpha-thallasemia (Science 2006, 312: 1215); httlpr gene encoding HTTLPR protein involved in obsessive compulsive disorder (Am. J. Hum. Genet. 2006, 78: 815); AVP gene encoding arginine vasopressin protein in stress-related disorders such as anxiety disorders and comorbid depression (CNS Neurol. Disord.
  • AChR gene encoding acetylcholine receptor involved in congential myasthenic syndrome (Neurology 2004, 62: 1090); P2Y12 gene encoding adenosine diphosphate (ADP) receptor protein involved in risk of peripheral arterial disease (Circulation 2003, 108: 2971); LQT1 gene encoding LQT1 protein involved in atrial fibrillation (Cardiology 2003, 100: 109); RET protooncogene encoding RET protein involved in sporadic pheochromocytoma (J. Clin. Endocrinol. Metab.
  • CA4 gene encoding carbonic anhydrase 4 protein, CRX gene encoding cone-rod homeobox transcription factor protein, FSCN2 gene encoding retinal fascin homolog 2 protein, IMPDH1 gene encoding inosine monophosphate dehydrogenase 1 protein, NR2E3 gene encoding nuclear receptor subfamily 2 group E3 protein, NRL gene encoding neural retina leucine zipper protein, PRPF3 (RP18) gene encoding pre-mRNA splicing factor 3 protein, PRPF8 (RP13) gene encoding pre-mRNA splicing factor 8 protein, PRPF31 (RP11) gene encoding pre-mRNA splicing factor 31 protein, RDS gene encoding peripherin 2 protein, ROM1 gene encoding rod outer membrane protein 1 protein, RHO gene encoding rhodopsin protein, RPl gene encoding RP1 protein, RPGR gene encoding retinitis pigmentosa GTP
  • the disease is a neurodegenerative disorder.
  • the neurodegenerative disorder is Huntington's Disease.
  • the targeted SNP is one or more of: rs6446723, rs3856973, rs2285086, rs363092, rs916171, rs6844859, rs7691627, rs4690073, rs2024115, rsl l731237, rs362296, rsl0015979, rs7659144, rs363096, rs362273, rsl6843804, rs362271, rs362275, rs3121419, rs362272, rs3775061, rs34315806, rs363099, rs2298967, rs363088, rs363064, rs363102, rs2798235, rs363080, rs363072, rs363125,
  • administration of a therapeutically effective amount of an antisense compound targeted to the mutant huntingtin allele is accompanied by monitoring of expression of a gene product in an individual, to determine an individual's response to administration of the antisense compound.
  • the gene product is huntingtin mRNA or protein. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • administering results in reduction of mRNA or protein expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • the mutant nucleic acid is huntingtin nucleic acid
  • the mRNA is huntingtin mRNA
  • the protein is huntingtin protein.
  • compositions comprising an antisense compound targeted to a mutant allele are used for the preparation of a medicament for treating a patient suffering or susceptible to any of Huntington's Disease, Alzheimer's Disease, Crutzfeldt- Jakob Disease, Fatal Familial Insomnia, Huntington's Disease, Alexander Disease, Parkinson's Disease, Amyotrophic Lateral Sclerosis (ALS), Dentato-Rubral and Pallido-Luysian Atrophy, Spinocerebellar Ataxia 1, Pelizaeus-Merzbacher Disease, Torsion Dystonia, Cardiomyopathy, Chrome Obstructive Pulmonary Disease (COPD), liver disease and hepatocellular carcinoma, SLE, Hypercholesterolemia, breast tumors, Asthma, Type 1 Diabetes, Rheumatoid Arthritis, Graves Disease, Spinal and Bulbar Muscular Atrophy, Kennedy's Disease, progressive childhood posterior subcapsular cataracts, Cholesterol Gallstone Disease, Arthrosclerosis, cardiovascular disease, primary hypertension
  • one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents.
  • such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions of the present invention.
  • such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions of the present invention.
  • one or more pharmaceutical compositions of the present invention are coadministered with another pharmaceutical agent to treat an undesired effect of that other
  • one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to produce a synergistic effect.
  • one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
  • Example 1 Single nucleotide polymorphisms (SNPs) in the huntingtin (HTT) gene sequence
  • HTT genomic sequence designated herein as SEQ ID NO: 1 (NT_006081.18 truncated from nucleotides 1566000 to 1768000) was aligned with the HTTmRNA, designated herein as SEQ ID NO: 2 (NM_0021 11.6), using the EMBL-EBI sequence database (ClustalW2,
  • 'Reference SNP ID number' or 'RS number' is the number designated to each SNP from the Entrez SNP database at NCBI, incorporated herein by reference.
  • 'SNP position' refers to the nucleotide position of the SNP on SEQ ID NO: 1.
  • 'Polymorphism' indicates the nucleotide variants at that SNP position.
  • 'Major allele' indicates the nucleotide associated with the major allele, or the nucleotide present in a statistically significant proportion of individuals in the human population.
  • 'Minor allele' indicates the nucleotide associated with the minor allele, or the nucleotide present in a relatively small proportion of individuals in the human population.
  • SNPs Single Nuclear Polymorphisms
  • Example 2 Design of antisense oligonucleotides targeting huntingtin gene SNPs and inhibition of Hrr mRNA in Coriell fibroblast cell lines (GM04281, GM02171, and GM02173B)
  • Antisense oligonucleotides targeting nucleotides overlapping SNP positions presented in Table 1 were designed and tested for potency in three huntingtin patient-derived Coriell fibroblast cell lines, GM04281, GM02171, and GM02173B (from the Coriell Institute for Medical Research). Cultured GM04281 cells or GM02171 cells or GM02173B cells at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and H7 mRNA levels were measured by quantitative real time PCR using primer probe set RTS2617 (forward sequence
  • CTCCGTCCGGTAGACATGCT designated herein as SEQ ID NO: 3; reverse sequence
  • HTT rnRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN.
  • Results are presented as percent inhibition of H7 mRNA, relative to untreated control cells.
  • ISIS 387916 (TCTCTATTGCACATTCCAAG, 5-10-5 MOE (SEQ ID NO: 6)
  • ISIS 388816 (GCCGTAGCCTGGGACCCGCC, 5-10-5 MOE (SEQ ID NO: 7)) were included in each study as benchmark oligonucleotides against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
  • the chimeric antisense oligonucleotides in Tables 3 and 4 were designed as 5-9-5 MOE gapmers.
  • the gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleotides each.
  • Each nucleotide in the 5' wing segment and each nucleotide in the 3' wing segment has a 2' -MOE modification.
  • oligonucleotides are further described in Table 3.
  • the percent inhibition of H7TmRNA by the antisense oligonucleotides in each cell line is shown in Table 4.
  • 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele at the SNP position.
  • the number in parentheses indicates the nucleotide position in the gapmer opposite to the SNP position, starting from the 5'-terminus of the oligonucleotide.
  • 'Start site' indicates the 5'-most nucleotide to which the gapmer is targeted.
  • “Stop site” indicates the 3 '-most nucleotide to which the gapmer is targeted.
  • Each gapmer listed in Tables 3 and 4 is targeted to human H pre-mRNA, which is SEQ ID NO: 1.
  • Example 3 Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
  • Gapmers from the study described in Example 2 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Table 5, 6, and 7. After a treatment period of approximately 16 hours, RNA was isolated from the cells and H7 mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. H7 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC 50 values are also provided in Tables 5, 6, and 7.
  • Example 4 Dose-dependent antisense inhibition of human huntingtin mRNA levels in Corieil fibroblast cell lines
  • Gapmers from the study described in Example 2 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Table 8, 9, and 10. After a treatment period of approximately 16 hours, RNA was isolated from the cells and H7TmRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HTT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of H T mRNA relative to untreated control cells. 1 ⁇ 2 0 values are also provided in Tables 8, 9, and 10.
  • oligonucleotides were designed based on the gapmers selected from studies described in Example 4. These oligonucleotides were designed by creating gapmers shifted slightly upstream and downstream (i.e. "microwalk") of the original gapmers from Tables 8, 9, and 10.
  • Antisense oligonucleotides were also created with uniform MOE, as well as with various motifs, 2-9-6 MOE, 3-9-3 MOE, 3-9-4 MOE, 3-9-5 MOE, 4-10-5 MOE, 4-11-4 MOE, 4-7-4 MOE, 4-9-4 MOE, 4-9-5 MOE, 5-10-4 MOE, 5-7-5 MOE, 5-8-6 MOE, 5-9-3 MOE, 5-9-5 MOE, 6-7-6 MOE, 6-9-2 MOE, and 6-8-5 MOE.
  • antisense oligonucleotides were designed targeting SNP RS Nos. rs2857936, rsl2506200, rs762855, and rsl006798 (refer to Table 2).
  • the oligonucleotides were designed targeting either the major allele or the minor allele, and with the SNP position opposite either position 8 or position 10 of the gapmer.
  • ISIS 435869, ISIS 435870, ISIS 435874, ISIS 435879, and ISIS 435890, from which some of the newly designed gapmers were derived are marked with an asterisk (*) in the table.
  • ISIS 387916 was included in the study as a benchmark oligonucleotide against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
  • the uniform MOE oligonucleotides are 15 nucleotides in length.
  • the 2-9-6 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 2 nucleotides and on the 3' direction by a wing comprising 6 nucleotides.
  • the 3-9-3 gapmers are 15 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 3 nucleotides each.
  • the 3-9-4 gapmers are 16 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 3 nucleotides and on the 3' direction by a wing comprising 4 nucleotides.
  • the 3-9-5 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 3 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
  • the 4-10-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of ten 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 4 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
  • the 4-11-4 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of eleven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each.
  • the 4-7-4 gapmers are 15 nucleotides in length, wherein the central gap segment is comprised of seven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each.
  • the 4-9-4 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each.
  • the 4-9-5 gapmers are 18 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 4 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
  • the 5-10-4 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of ten 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 5 nucleotides and on the 3' direction by a wing comprising 4 nucleotides.
  • the 5-7-5 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of seven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 5 nucleotides each.
  • the 5-8-6 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of eight 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 5 nucleotides and on the 3' direction by a wing comprising 6 nucleotides.
  • the 5-9-3 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 5 nucleotides and on the 3' direction by a wing comprising 3 nucleotides.
  • the 5-9-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 5 nucleotides each.
  • the 6-7-6 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of seven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 6 nucleotides each.
  • the 6-9-2 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 6 nucleotides and on the 3' direction by a wing comprising 2 nucleotides.
  • the 6-8-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of eight 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 6 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
  • each nucleotide in the 5' wing segment and each nucleotide in the 3' wing segment has a 2'-MOE modification.
  • All cytosine nucleobases throughout each gapmer are 5- methylcytosines.
  • oligonucleotides are organized in tables according to the SNP they target.
  • Start site indicates the 5'-most nucleotide to which the gapmer is targeted.
  • Stop site indicates the 3'-most nucleotide to which the gapmer is targeted.
  • 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele. The number in parentheses indicates the position

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Obesity (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Immunology (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Pulmonology (AREA)

Abstract

Disclosed herein are antisense compounds and methods for selectively of reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and composition are useful to treat, prevent, or ameliorate diseases, including neurodegenerative, such as Huntington's Disease (HD).

Description

SELECTIVE REDUCTION OF ALLELIC VARIANTS
Sequence Listing
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0124WOSEQ.txt created February 7, 2011, which is 322 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
Field of the Invention
Embodiments of the present invention provide methods, compounds, and compositions for selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate diseases.
Background of the Invention
Genetic diseases are caused by abnormalities in genes or chromosomes. Such abnormalities may include insertions, deletions, and expansions. Huntington's Disease (HD) is one example of a genetic disease caused by an expansion. HD is a progressive neurodegenerative disorder that is inherited in a dominant fashion and results from a mutation that expands the polymorphic trinucleotide (CAG) tract in the huntingtin gene {HIT). The average CAG tract size in the general population is 17-26 repeats (wild type allele), however, in HD patients the CAG tract has expanded to 36 repeats or more (mutant allele) (Huntington's Disease Collaborative Research Group 1993. Cell 72(6):971-83). The ΉΤΤ gene encodes the HTT protein and the expanded CAG tract results in a pathological increase in the polyglutamine repeats near the N-terminal of the protein. Individuals carry two copies of the HTT gene and one mutant allele is sufficient to result in HD.
HTT protein appears to have a role during development of the nervous system and a protective role in cells. In mouse models, constitutive knockout of the HTT gene is lethal during embryonic development (Nasir et al 1995. Cell 81(5): 811-23), while adult inactivation of the HTT gene leads to progressive cell death in the brain and the testes (Dragatsis et al 2000. Nat. Genet 26:300-306). Reduction of huntingtin expression from the wild type allele may, therefore, have negative consequences. Like HD, there are disorders for which a strategy of selective reduction of a mutant allele would be beneficial. Thus, there remains an unmet need to selectively reduce expression of mutant allelic variants like that of HTT, which are causative of disease, over the wild type variant, which appears to be necessary for normal cellular processes.
Brief Description of the Invention
Figure 1 provides the mRNA and genomic HTT sequence showing SNP positions.
Summary of the Invention
Provided herein are methods, compounds, and compositions for selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate diseases. SNPs may be associated with a mutant allele, the expression of which causes disease. In certain embodiments, the expressed gene product of a mutant allele results in aggregation of the mutant proteins causing disease. In certain embodiments, the expressed gene product of a mutant allele results in gain of function causing disease.
In certain embodiments, selective reduction of mRNA and protein expression of a mutant allele is achieved by targeting a SNP located on the mutant allele with an antisense compound. In certain embodiments, the antisense compound is an antisense oligonucleotide
In certain embodiments, antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on potency and selectivity of the antisense compound as well as population genetics.
Detailed Description of the Invention
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Definitions
Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
"2'-0-methoxyethyl" (also 2'-MOE and 2'-0(CH2)2-OCH3) refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.
"2'-0-methoxyethyl nucleotide" means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety.
"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5' position. A 5-methylcytosine is a modified nucleobase.
"Active pharmaceutical agent" means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to an allelic variant is an active pharmaceutical agent.
"Active target region" or "target region" means a region to which one or more active antisense compounds is targeted. "Active antisense compounds" means antisense compounds that reduce target nucleic acid levels or protein levels. "Administered concomitantly" refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
"Administering" means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
"Allele" is one member of a pair of genes or one member of a series of different forms of a DNA sequences that can exist at a single locus or marker on a specific chromosome. For a diploid organism or cell or for autosomal chromosomes, each allelic pair will normally occupy
corresponding positions (loci) on a pair of homologous chromosomes, one inherited from the mother and one inherited from the father. If these alleles are identical, the organism or cell is said to be 'homozygous' for that allele; if they differ, the organism or cell is said to be 'heterozygous' for that allele. "Major allele" refers to an allele containing the nucleotide present in a statistically significant proportion of individuals in the human population. "Minor allele" refers to an allele containing the nucleotide present in a relatively small proportion of individuals in the human population. "Wild type allele" refers to the genotype typically not associated with disease or dysfunction of the gene product. "Mutant allele" refers to the genotype associated with disease or dysfunction of the gene product.
"Allelic variant" refers to one of the pair of genes or DNA sequence existing at a single locus. For example, an allelic variant may refer to either the major allele or the minor allele.
"Amelioration" refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
"Antibody" refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region. "Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
"Antisense compound" means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
"Antisense inhibition" means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
"Bicyclic sugar" means a furosyl ring modified by the bridging of two ring atoms. A bicyclic sugar is a modified sugar.
"Bicyclic nucleoside" means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4 '-carbon and the 2 '-carbon of the sugar ring.
"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.
"cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4' -carbon and the 2' -carbon, wherein the bridge has the formula: 4'- CH(CH3)-0-2\
"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0-methoxyethyl modifications.
"Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions.
"Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration. "Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
"Contiguous nucleobases" means nucleobases immediately adjacent to each other.
"Differentiating polymorphism" means a variation in a nucleotide sequence that permits differentiation between a wild type and a mutant allele of a nucleic acid sequence. Differentiating polymorphisms may include insertions or deletions of one or a few nucleotides in a sequence, or changes in one or a few nucleotides in a sequence. A differentiating polymorphism or polymorphic allele can be in linkage disequilibrium with one or more other polymorphisms or polymorphic alleles.
"Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition may be a liquid, e.g. saline solution.
"Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
"Effective amount" means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings."
"Gap- widened" means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleosides.
"Gene product" refers to a biochemical material, such as RNA or protein, resulting from expression of a gene.
"Haplotype" means a set of alleles of closely linked loci on a chromosome that are generally inherited together. For example, a polymorphic allele at a first site in a nucleic acid sequence on the chromosome may be found to be associated with another polymorphic allele at a second site on the same chromosome, at a frequency other than would be expected for a random associate (e.g.
"linkage equilibrium"). These two polymorphic alleles may be described as being in "linkage disequilibrium." A haplotype may comprise two, three, four, or more alleles. The set of alleles in a haplotype along a given segment of a chromosome are generally transmitted to progeny together unless there has been a recombination event.
"High-affinity sugar modification" is a modified sugar moiety which when it is included in a nucleoside and said nucleoside is incorporated into an antisense oligonucleotide, the stability (as measured by Tm) of said antisense oligonucleotide: RNA duplex is increased as compared to the stability of a DNArRNA duplex.
"High-affinity sugar-modified nucleoside" is a nucleoside comprising a modified sugar moiety that when said nucleoside is incorporated into an antisense compound, the binding affinity (as measured by Tm) of said antisense compound toward a complementary RNA molecule is increased. In certain embodiments of the invention at least one of said sugar-modified high-affinity nucleosides confers a ATm of at least 1 to 4 degrees per nucleoside against a complementary RNA as determined in accordance with the methodology described in Freier et al., Nucleic Acids Res., 1997, 25, 4429-4443, which is incorporated by reference in its entirety. In another aspect, at least one of the high-affinity sugar modifications confers about 2 or more, 3 or more, or 4 or more degrees per modification. In the context of the present invention, examples of sugar-modified high affinity nucleosides include, but are not limited to, (i) certain 2'-modified nucleosides, including 2'- subtstituted and 4' to 2' bicyclic nucleosides, and (ii) certain other non-ribofuranosyl nucleosides which provide a per modification increase in binding affinity such as modified tetrahydropyran and tricycloDNA nucleosides. For other modifications that are sugar-modified high-affinity nucleosides see Freier et al., Nucleic Acids Res., 1997, 25, 4429-4443.
"Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.
"Individual" means a human or non-human animal selected for treatment or therapy.
"Internucleoside linkage" refers to the chemical bond between nucleosides.
"Linked nucleosides" means adjacent nucleosides which are bonded together.
"Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
"Modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A "modified nucleoside" means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
"Modified oligonucleotide" means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, or a modified nucleobase.
"Modified sugar" refers to a substitution or change from a natural sugar.
"Motif means the pattern of chemically distinct regions in an antisense compound.
"Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.
"Natural sugar moiety" means a sugar found in DNA (2'-H) or RNA (2' -OH).
"Nuclease resistant modification" means a sugar modification or modified internucleoside linkage which, when incorporated into an oligonucleotide, makes said oligonucleotide more stable to degradation under cellular nucleases (e.g. exo- or endo-nucleases). Examples of nuclease resistant modifications include, but are not limited to, phosphorothioate internucleoside linkages, bicyclic sugar modifications, 2 '-modified nucleotides, or neutral internucleoside linkages. "Nucleic acid" refers to molecules composed of monomelic nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
"Nucleoside" means a nucleobase linked to a sugar.
"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)- C(=0)-0- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
"Oligomeric compound" or "oligomer" means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
"Parenteral administration" means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
"Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins. "Pharmaceutical composition" means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage (P=S) is a modified internucleoside linkage.
"Portion" means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
"Prevent" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
"Selectively reducing expression of an allelic variant" means reducing expression of one allele more than the other, differing allele among a set of alleles. For example, a mutant allele containing a single nucleotide polymorphism (SNP) may be reduced more than a wild type allele not containing the SNP.
"Side effects" means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
"Single nucleotide polymorphism" or "SNP" means a single nucleotide variation between the genomes of individuals of the same species. In some cases, a SNP may be a single nucleotide deletion or insertion. In general, SNPs occur relatively frequently in genomes and thus contribute to genetic diversity. SNPs are thought to be mutationally more stable than other polymorphisms, lending their use in association studies in which linkage disequilibrium between markers and an unknown variant is used to map disease-causing mutations. The location of a SNP is generally flanked by highly conserved sequences. An individual may be homozygous or heterozygous for an allele at each SNP site. A heterozygous SNP allele can be a differentiating polymorphism. A SNP may be targeted with an antisense oligonucleotide, meaning that the SNP anneals to (or aligns with) position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the antisense oligonucleotide. The remainder of the antisense oligonucleotide bases must have sufficient complementarity to the SNP site to facilitate hybridization.
"Single nucleotide polymorphism position" or "SNP position" refers to the nucleotide position of the SNP on a reference sequence.
"Single nucleotide polymorphism site" or "SNP site" refers to the nucleotides surrounding a SNP contained in a target nucleic acid to which an antisense compound is targeted.
"Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a complementary strand.
"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
"Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
"Target nucleic acid," "target RNA," and "target RNA transcript" all refer to a nucleic acid capable of being targeted by antisense compounds.
"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. For example, for the purposes of this patent application, the target segment may be within the SNP site. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.
"Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
"Treat" refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition. "Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).
Certain Embodiments
Embodiments of the present invention provide methods, compounds, and compositions for selectively inhibiting mRNA and protein expression of an allelic variant of a gene or DNA sequence. In certain embodiments, the allelic variant contains a single nucleotide polymorphism (SNP). In certain embodiments, the SNP is a differentiating polymorphism. In certain
embodiments, a SNP is associated with a mutant allele. In certain embodiments, a SNP is in linkage disequilibrium with another polymorphism that is associated with or is causative of disease. In certain embodiments, a mutant allele is associated with disease. In certain embodiments, mRNA and protein expression of a mutant allele is associated with disease.
In certain embodiments, the expressed gene product of a mutant allele results in
aggregation of the mutant proteins causing disease. In certain embodiments, the expressed gene product of a mutant allele results in gain of function causing disease. In certain embodiments, genes with an autosomal dominant mutation resulting in a toxic gain of function of the protein are the APP gene encoding amyloid precursor protein involved in Alzheimer's disease (Gene, 371: 68, 2006); the PrP gene encoding prion protein involved in Creutzfeldt- Jakob disease and in fatal familial insomnia (Nat. Med. 1997, 3: 1009 ); GFAP gene encoding glial fibrillary acidic protein involved in
Alexander disease (J. Neurosci. 2006, 26:111623); alpha-synuclein gene encoding alpha-synuclein protein involved in Parkinson's disease (J. Clin. Invest. 2003, 111: 145); SOD-1 gene encoding the SOD-1 protein involved in amyotrophic lateral sclerosis (Science 1998, 281: 1851); atrophin-1 gene encoding atrophin-1 protein involved in dentato-rubral and pallido-luysian atrophy (DRPA) (Trends Mol. Med. 2001, 7: 479); SCA1 gene encoding ataxin-1 protein involved in spino-cerebellar ataxia- 1 (SCA1) (Protein Sci. 2003, 12: 953); PLP gene encoding proteolipid protein involved in
Pelizaeus-Merzbacher disease (NeuroMol Med. 2007, 4: 73); DYT1 gene encoding torsinA protein involved in Torsion dystonia (Brain Res. 2000, 877: 379); and alpha-B crystalline gene encoding alpha-B crystalline protein involved in protein aggregation diseases, including cardiomyopathy (Cell 2007, 130: 427); alphal -antitrypsin gene encoding alphal -antitrypsin protein involved in chronic obstructive pulmonary disease (COPD), liver disease and hepatocellular carcinoma (New Engl J Med. 2002, 346: 45); Ltk gene encoding leukocyte tyrosine kinase protein involved in systemic lupus erythematosus (Hum. Mol. Gen. 2004, 13: 171); PCSK9 gene encoding PCSK9 protein involved in hypercholesterolemia (Hum Mutat. 2009, 30: 520); prolactin receptor gene encoding prolactin receptor protein involved in breast tumors (Proc. Natl. Assoc. Sci. 2008, 105: 4533); CCL5 gene encoding the chemokine CCL5 involved in COPD and asthma (Eur. Respir. J. 2008, 32: 327); PTPN22 gene encoding PTPN22 protein involved in Type 1 diabetes, Rheumatoid arthritis, Graves disease, and SLE (Proc. Natl. Assoc. Sci. 2007, 104: 19767); androgen receptor gene encoding the androgen receptor protein involved in spinal and bulbar muscular atrophy or Kennedy's disease (J Steroid Biochem. Mol. Biol. 2008, 108: 245); CHMP4B gene encoding chromatin modifying protein-4B involved in progressive childhood posterior subcapsular cataracts (Am. J. Hum. Genet 2007, 81 : 596); FXR /NR1H4 gene encoding Farnesoid X receptor protein involved in cholesterol gallstone disease, arthrosclerosis and diabetes (Mol. Endocrinol. 2007, 21 : 1769); ABCA1 gene encoding ABCA1 protein involved in cardiovascular disease (Transl. Res. 2007, 149: 205); CaSR gene encoding the calcium sensing receptor protein involved in primary hypercalciuria (Kidney Int. 2007, 71 : 1155); alpha-globin gene encoding alpha-globin protein involved in alpha-thallasemia (Science 2006, 312: 1215); httlpr gene encoding HTTLPR protein involved in obsessive compulsive disorder (Am. J. Hum. Genet. 2006, 78: 815); AVP gene encoding arginine vasopressin protein in stress-related disorders such as anxiety disorders and comorbid depression (CNS Neurol. Disord. Drug Targets 2006, 5: 167); GNAS gene encoding G proteins involved in congenital visual defects, hypertension, metabolic syndrome (Trends Pharmacol. Sci. 2006, 27: 260); APAF1 gene encoding APAF1 protein involved in a predisposition to major depression (Mol. Psychiatry 2006, 11: 76); TGF-betal gene encoding TGF-betal protein involved in breast cancer and prostate cancer (Cancer Epidemiol. Biomarkers Prev. 2004, 13: 759); AChR gene encoding acetylcholine receptor involved in congential myasthenic syndrome (Neurology 2004, 62: 1090); P2Y12 gene encoding adenosine diphosphate (ADP) receptor protein involved in risk of peripheral arterial disease (Circulation 2003, 108: 2971); LQT1 gene encoding LQT1 protein involved in atrial fibrillation (Cardiology 2003, 100: 109); RET protooncogene encoding RET protein involved in sporadic pheochromocytoma (J. Clin. Endocrinol. Metab. 2003, 88: 4911); filamin A gene encoding filamin A protein involved in various congenital malformations (Nat. Genet. 2003, 33: 487); TARDBP gene encoding TDP-43 protein involved in amyotrophic lateral sclerosis (Hum. Mol. Gene.t 2010, 19: 671); SCA3 gene encoding ataxin-3 protein involved in Machado- Joseph disease (PLoS One 2008, 3: e3341); SCA7 gene encoding ataxin-7 protein involved in spino-cerebellar ataxia-7 (PLoS One 2009, 4: e7232); and HTTgene encoding huntingtin protein involved in Huntington's disease (Neurobiol Dis. 1996, 3:183); and the CA4 gene encoding carbonic anhydrase 4 protein, CRX gene encoding cone-rod homeobox transcription factor protein, FSCN2 gene encoding retinal fascin homolog 2 protein, IMPDH1 gene encoding inosine monophosphate dehydrogenase 1 protein, NR2E3 gene encoding nuclear receptor subfamily 2 group E3 protein, NRL gene encoding neural retina leucine zipper protein, PRPF3 (RP18) gene encoding pre-mRNA splicing factor 3 protein, PRPF8 (RP13) gene encoding pre-mRNA splicing factor 8 protein, PRPF31 (RP11) gene encoding pre-mRNA splicing factor 31 protein, RDS gene encoding peripherin 2 protein, ROM1 gene encoding rod outer membrane protein 1 protein, RHO gene encoding rhodopsin protein, RPl gene encoding RP1 protein, RPGR gene encoding retinitis pigmentosa GTPase regulator protein, all of which are involved in Autosomal Dominant Retinitis Pigmentosa disease (Adv Exp Med Biol. 2008, 613:203)
In certain embodiments, selective reduction of mRNA and protein expression of a mutant allele is achieved by targeting a SNP located on the mutant allele with an antisense compound. In certain embodiments, the antisense compound is an antisense oligonucleotide. In certain
embodiments, the antisense compound is not a ribozyme, a double stranded siRNA, or an shRNA. In certain embodiments, the antisense oligonucleotide may have one or more modified sugar(s), nucleobase(s), or internucleoside linkage(s). In certain embodiments, the antisense oligonucleotide is complementary to the SNP site. In certain embodiments, the antisense oligonucleotide is at least 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the SNP site. In certain embodiments, the antisense oligonucleotide is 100% complementary to the SNP site. In certain embodiments, the SNP site is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length. In certain
embodiments, the SNP anneals to position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the antisense oligonucleotide.
In certain embodiments, antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on potency and selectivity of the antisense compound as well as population genetics.
In certain embodiments, selective reduction of mRNA and protein expression of an allelic variant of a gene containing a SNP occurs in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human.
In certain embodiments, described herein are compounds comprising a modified antisense oligonucleotide consisting of 12 to 30 linked nucleosides targeted to a single nucleotide
polymorphism site, wherein the modified oligonucleotide comprises a wing-gap-wing motif with a 5' wing region positioned at the 5' end of a deoxynucleoside gap, and a 3' wing region positioned at the 3' end of the deoxynucleoside gap, wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, or positions 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
In certain embodiments, the single nucleotide polymorphism site is on a mutant allele that is associated with a disease. In certain embodiments, the single nucleotide polymorphism site contains a differentiating polymorphism.
In certain embodiments, the modified antisense oligonucleotide consists of 12 to 20 linked nucleosides. In certain embodiments, modified antisense oligonucleotide consists of 15 to 20 linked nucleosides. In certain embodiments, the modified antisense oligonucleotide consists of 15 to 19 linked nucleosides.
In certain embodiments, position 8, 9, or 10 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, or positions 4, 5, or 6 of the modified
oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
In certain embodiments, the gap region is 7-11 nucleosides in length, the 5' wing region is 1- 6 nucleobases in length and the 3' wing region is 1-6 nucleobases in length.
In certain embodiments, the wing-gap- wing motif is any one of the group consisting of 5-10- 5, 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-3, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, and 6-9-2. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 4-9-5, and 4-11-4.
In certain embodiments, at least one intemucleoside linkage is a modified intemucleoside linkage. In certain embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
In certain embodiments, at least one nucleoside comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5'-methylcytosine.
In certain embodiments, at least one nucleoside of at least one of the wing regions comprises a modified sugar or sugar surrogate. In certain embodiments, each of the nucleosides of each wing region comprises a modified sugar or sugar surrogate. In certain embodiments, the sugar or sugar surrogate is a 2'-0-methoxyethyl modified sugar. In certain embodiments, at least one of the wing regions comprises a 4' to 2' bicyclic nucleoside and at least one of the remaining wing nucleosides is a non-bicyclic 2'-modified nucleoside.
In certain embodiments, the non-bicyclic 2 '-modified nucleoside is a 2'-0-methoxyethyl nucleoside.
In certain embodiments, the 4' to 2' bicyclic nucleoside is 4'-CH(CH3)-0-2' bicyclic nucleoside.
In certain embodiments, the modified antisense oligonucleotide consisting of 17 linked nucleosides and wherein position 9 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism. In certain embodiments, the wing-gap-wing motif is 2-9-6.
In certain embodiments, described herein are compounds comprising a modified
oligonucleotide consisting of 18 linked nucleosides and 90% complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 9 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein the wing-gap- wing motif is 4-9-5.
In certain embodiments, described herein are compounds comprising a modified
oligonucleotide consisting of 19 linked nucleosides and 90% complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 10 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein the wing-gap- wing motif is 4-11- 4.
In certain embodiments, described herein are compounds comprising a modified
oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a
differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification. In certain embodiments, the modified
oligonucleotide is 100% complementary to the single nucleotide polymorphism site.
In certain embodiments, at least one of the wing regions comprises a Wgh-affinity sugar modification. In certain embodiments, the high-affinity sugar modification is a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge. In certain embodiments, at least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises the at least one high-affinity sugar modification.
In certain embodiments, at least one of positions 2, 3, 13, and 14 of the modified
oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises the at least one Wgh-afftnity sugar modification.
In certain embodiments, each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprise the at least one high-affinity sugar modification.
In certain embodiments, the Wgh-affinity sugar modification is a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
In certain embodiments, the wing-gap-wing motif is any of the group consisting of 3-9-3, 4- 9-4, and 5-9-5.
In certain embodiments, described herein are compounds comprising a modified
oligonucleotide consisting of 15, 17, or 19 linked nucleosides and fully complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 6, 8, 10, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification.
In certain embodiments, at least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises the at least one high-affinity sugar modification.
In certain embodiments, the high-affinity sugar modification is a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
In certain embodiments, the wing-gap- wing motif is any of the group consisting of 3-9-3, 4- 9-4, and 5-95.
In certain embodiments, described herein are compounds comprising a modified
oligonucleotide consisting of 15 linked nucleosides and 90% complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 8 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; and at least one high-affinity sugar modification. In certain embodiments, the modified oligonucleotide is 100% complementary to the differentiating polymorphism.
In certain embodiments, each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprise the at least one high-affinity sugar modification.
In certain embodiments, the high-affinity sugar modification is a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
In certain embodiments, the wing-gap- wing motif is 3-9-3.
In certain embodiments, described herein are methods of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism. In certain embodiments, the modified oligonucleotide is 90% complementary to the single differentiating polymorphism. In certain embodiments, the modified oligonucleotide is 95% complementary to the single nucleotide polymorphism site. In certain embodiments, the modified oligonucleotide is 100% complementary to the single nucleotide polymorphism site.
In certain embodiments, the single nucleotide polymorphism site is from 12 to 30 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is from 15 to 25 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is from 17 to 22 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 17 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 18 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 19 nucleobases in length. In certain embodiments, the single nucleotide polymorphism site is 20 nucleobases in length.
In certain embodiments, the allelic variant is associated with disease. In certain
embodiments, the disease is Huntington's Disease.
In certain embodiments, the modified oligonucleotide is a single-stranded oligonucleotide. In certain embodiments, at least one intemucleoside linkage is a modified intemucleoside linkage. In certain embodiments, each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
In certain embodiments, at least one nucleoside comprises a modified nucleobase. In certain embodiments, the at least one modified nucleobase is a 5'-methylcytosine.
In certain embodiments, at least one nucleoside comprises a modified sugar. In certain embodiments, the modified sugar is a Wgh-affinity sugar modification. In certain embodiments, the high-affinity sugar is a bicyclic sugar. In certain embodiments, each bicyclic sugar comprises a 4'- CH(CH3)-0-2' bridge.
In certain embodiments, at least one of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, counting from the 5' terminus of the modified oligonucleotide, comprises a nucleoside having a bicyclic sugar wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
In certain embodiments, each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, counting from the 5' terminus of the modified oligonucleotide, comprises a bicyclic sugar wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
In certain embodiments, the at least one modified sugar comprises a 2'-0-methoxyethyl. In certain embodiments, each nucleoside positioned in a wing segment of the modified oligonucleotide comprises a 2'-0-methoxyethyl modification.
In certain embodiments, the wing-gap- wing motif is any of the group consisting of 2-9-6, 3-
9- 3, 3-9-4, 3-9-5, 4-7-4, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-
10- 5, 6-7-6, 6-8-5, and 6-9-2.
In certain embodiments, the modified oligonucleotide is not a ribozyme, a double stranded siRNA, or an shRNA.
In certain embodiments, the single nucleotide polymorphism site is on a mutant allele that is associated with disease. In certain embodiments, the single nucleotide polymorphism site contains a differentiating polymorphism.
In certain embodiments, the modified antisense oligonucleotide consists of 12 to 20 linked nucleosides. In certain embodiments, the modified antisense oligonucleotide consists of 15 to 19 linked nucleosides.
In certain embodiments, the gap region is 7 to 11 nucleosides in length, the 5' wing region is 1 to 6 nucleobases in length and 3' wing region is 1 to 6 nucleobases in length. In certain embodiments, wherein at least one nucleoside of at least one of the wing regions comprises a modified sugar or sugar surrogate.
In certain embodiments, each of the nucleosides of each wing region comprises a modified sugar or sugar surrogate. In certain embodiments, the sugar or sugar surrogate is a 2'-0- methoxyethyl modified sugar.
In certain embodiments, at least one of the wing regions comprises a 4' to 2' bicyclic nucleoside and at least one of the remaining wing nucleosides is a non-bicyclic 2 '-modified nucleoside.
In certain embodiments, the non-bicyclic 2'-modified nucleoside is a 2'-0-methoxyethyl nucleoside.
In certain embodiments, 4' to 2' bicyclic nucleoside is a 4'-CH(CH3)-0-2' bicyclic nucleoside.
In certain embodiments, described herein are methods of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
In certain embodiments, described herein are methods of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide aligns with the differentiating polymorphism; and wherein the allelic variant is a mutant allele.
In certain embodiments, the mutant allele is associated with any disease from the group consisting of Alzheimer's disease, Creutzfeldt- Jakob disease, fatal familial insomnia, Alexander disease, Parkinson's disease, amyotrophic lateral sclerosis, dentato-rubral and pallido-luysian atrophy DRPA, spino-cerebellar ataxia, Torsion dystonia, cardiomyopathy, chronic obstructive pulmonary disease (COPD), liver disease, hepatocellular carcinoma, systemic lupus erythematosus, hypercholesterolemia, breast cancer, asthma, Type 1 diabetes, Rheumatoid arthritis, Graves disease, SLE, spinal and bulbar muscular atrophy, Kennedy's disease, progressive childhood posterior subcapsular cataracts, cholesterol gallstone disease, arthrosclerosis, cardiovascular disease, primary hypercalciuria, alpha-thallasemia, obsessive compulsive disorder, Anxiety, comorbid depression, congenital visual defects, hypertension, metabolic syndrome, prostate cancer, congential myasthenic syndrome, peripheral arterial disease, atrial fibrillation, sporadic pheochromocytoma, congenital malformations, Machado- Joseph disease, Huntington's disease, and Autosomal Dominant Retinitis Pigmentosa disease.
In certain embodiments, described herein are methods of treating Huntington's Disease, comprising selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and complementary to differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with differentiating polymorphism; and wherein the allelic variant is associated with Huntington's Disease.
In certain embodiments, position 8, 9, or 10 of the modified oligonucleotide, as counted fromt eh 5' terminus of the modified oligonucleotide, or positions 4, 5, or 6 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
Single Nucleotide Polymorphisms (SNPs)
Single-nucleotide polymorphisms (SNPs) are single base-pair alterations in the DNA sequence that represent a major source of genetic heterogeneity (Gene. 1999, 234:177). SNP genotyping is an important tool with which to investigate these genetic variants (Genome Res. 2000, 10:895; Trends Biotechnol. 2000, 18:77). In certain embodiments, antisense compounds designed to selectively reduce an allelic variant of a gene containing an SNP were selected based on potency, selectivity and population genetics coverage.
Potency In certain embodiments, antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on potency of the antisense compound.
Potency generally refers to how amenable the targeted sequence area is to antisense inhibition. In certain embodiments, specific SNP sites may be particularly amenable to antisense inhibition.
Certain such highly amenable SNP sites may be targeted by antisense compounds for selectively reducing an allelic variant of a gene. Potency is demonstrated by the percent inhibition of mutant mRNA achieved by the antisense oligonucleotides targeting a SNP compared to the percent inhibition of mutant mRNA achieved by the benchmark oligonucleotide.
Selectivity
In certain embodiments, antisense compounds designed to selectively reduce an allelic variant of a gene containing a SNP are created based on selectivity of the antisense compound. Selectivity generally refers to antisense compounds comprising a particular sequence, motif, and chemical modification(s) that preferentially target the one or more differentiating polymorphisms (SNPs) in the RNA encoding a mutant HTT protein compared to the RNA encoding a wild type HTT protein. In certain embodiments, specific sequences, motifs, and chemical modification(s) are particularly selective in reducing an allelic variant of a gene containing a SNP. Certain such sequences, motifs, and chemical modification(s) are utilized to selectively reduce an allelic variant of a gene. Selectivity is demonstrated by the ability of the antisense oligonucleotide targeting a SNP to inhibit expression of the major allele or mutant allele preferentially compared to the minor allele or wild type allele.
Population Genetics
In certain embodiments, antisense compounds designed to selectively reduce an allelic variant of a gene containing an SNP are created based on the population genetics of a population afflicted with disease. Population genetics means the frequency at which the SNP appears in the disease chromosome of patients afflicted with a particular disease. In certain embodiments, the disease is Huntington disease. Where potency and selectivity amongst antisense compounds is equal, SNP targets that have higher population genetics coverage are favored over SNPs that have a weaker association with disease chromosomes.
Antisense Compounds Oligomeric compounds may include, but are not limited to, oligonucleotides,
oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
In certain embodiments, an antisense compound is an antisense oligonucleotide. In certain embodiments, the antisense compound is not a ribozyme, a double stranded siRNA, or an shRNA.
In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
In certain embodiments, antisense compounds are 12 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked subunits. In certain such embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleosides.
In certain embodiments antisense oligonucleotides targeted to a nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
However, selective reduction of expression of an allelic variant is optimized when the SNP contained in the target nucleic anneals to a complementary base in the antisense compound and not a mismatched base. Moreover, selectivity in general is increased when there are fewer mismatches between the SNP site and the antisense compound. However, a certain number of mismatches may be tolerated.
Antisense Compound Motifs
In certain embodiments, antisense compounds targeted to a nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an R A:DNA duplex.
Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports R aseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In the case of an antisense oligonucleotide for selectively reducing expression of an allelic variant of a gene containing a SNP, the SNP anneals to a nucleobase within the gap segment.
In certain embodiments, the SNP anneals or is complementary to a nucleobase at position 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the antisense oligonucleotide, wherein position refers to the orientation of a nucleobase within the antisense oligonucleotide counting from the 5' terminus of the antisense oligonucleotide. For example, the 5' most nucleobase within the antisense oligonucleotide is in the first position of the antisense oligonucleotide. In certain embodiments, the SNP anneals or is complementary to a nucleobase at position 6, 7, 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus). In certain embodiments, the SNP anneals or is complementary to a nucleobase at position 9 or 10 of the antisense oligonucleotide (counting from the 5' terminus).
In certain embodiments, the SNP anneals to a nucleobase at position 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the gap segment, wherein position refers to the orientation of a nucleobase within the gap segment counting from the 5' terminus of the gap segment. For example, the 5' most nucleobase within the gap segment is in the first position of the gap segment. In certain embodiments, the SNP anneals to a nucleobase at position 4, 5, 6, or 7 counting from the 5' terminus of the gap segment. In certain embodiments, the SNP anneals to a nucleobase at position 4 or 5 beginning from the 5' terminus of the gap segment.
In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D- deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE, and 2'-0-ϋ¼, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4'-(Ο¾)η-0-2' bridge, where n=l or n=2). The bicyclic moiety may be a cEt having the formula 4'-CH(CH3)-0-2.'
The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing region, "Y" represents the length of the gap region, and "Z" represents the length of the 3' wing region. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap segment is positioned immediately adjacent to each of the 5' wing segment and the 3' wing segment. Thus, no mtervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3' wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other
embodiments they are different. In certain embodiments, Y is between 8 and 15 nucleotides. In certain embodiments, Y is comprised of deoxynucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers of the present invention include, but are not limited to, for example 1-10-1, 1-18-1, 2-8-2, 2-9-6, 2-10-2, 2- 13-5, 2-16-2, 3-9-3, 3-9-5, 3-10-3, 3-14-3, 4-8-4, 4-9-5, 4-10-5, 4-11-4, 4-12-3, 4-12-4, 5-8-5, 5-9-5, 5-10-4, 5-10-5, or 6-8-6.
In certain embodiments, the antisense compound has a "wingmer" motif, having a wing- gap or gap- wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations of the present invention include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 2-9-6 gapmer motif or a 6-9-2 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 3-9-3 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 3-9-5 gapmer motif or 5-9-3 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 4-9-5 gapmer motif or 5-9-4 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 4-10-5 gapmer motif or 5-10-4 gapmer motif. In certain embodiments, antisense compounds targeted to a nucleic acid possess a 4-11-4 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 5-9-5 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 5-8-6 gapmer motif or a 6-8-5 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 6-7-6 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 6-8-5 gapmer motif or a 5-8-6 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 3-9-4 gapmer motif or a 4-9-3 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 5-7-5 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 4-7-4 gapmer motif.
In certain embodiments, antisense compounds targeted to a nucleic acid possess a 5-10-5 gapmer motif.
In certain embodiments, an antisense compound targeted to a nucleic acid has a gap- widened motif.
Certain Mixed Wings
In certain embodiments, the invention provides gapmer compounds wherein at least one nucleoside of one wing is differently modified compared to at least one other nucleoside of the same wing. Such antisense compounds are referred to as mixed wing antisense compounds (see WO 2008/049085). In certain embodiments, the modifications (or no modification) of one or more nucleosides of the 3' wing are different from those of one or more other nucleosides of the 3' wing. Such antisense compounds may be referred to as 3' mixed wing gapmers. In certain embodiments, the modifications (or no modification) of one or more nucleosides of the 5' wing are different from those of one or more other nucleosides of the 5' wing. Such antisense compounds may be referred to as 5' mixed wing gapmers. In certain embodiments, the modifications (or no modification) of one or more nucleosides of the 3' wing are different from those of one or more other nucleosides of the 3' wing and the modifications (or no modification) of one or more nucleosides of the 5' wing are different from those of one or more other nucleosides of the 5' wing. Such antisense compounds may be referred to as 3', 5' mixed wing gapmers. In such embodiment, the modifications and combination of modifications at the 3' wing and at the 5' wing may be the same or they may be different.
In certain embodiments, mixed wing compounds have desirable properties. Certain nucleoside modifications confer on the antisense compound a desirable property, for example increased affinity for a target or nuclease resistance, but also confer an undesirable property, for example increased toxicity. Incorporation of certain other nucleoside modifications results in antisense compounds with different profiles of properties. In certain embodiments, one may combine modifications in one or both wings to optimize desirable characteristics and/or minimize undesirable characteristics. In certain embodiments, the wings of a mixed wing antisense compound comprise one or more nucleoside comprising a first modification that increases affinity of the antisense compound for a target nucleic acid compared to an antisense compound comprising unmodified nucleosides; and one or more nucleoside comprising a second modification that results in reduced toxicity compared to an antisense compound with wings comprising nucleosides that all comprise the first modification.
In certain embodiments, an antisense compound comprises at least one wing comprising at least one MOE substituted nucleoside and at least one high affinity modification. In certain such embodiments, the at least one MOE substituted nucleoside and the at least one high affinity are in the 3' wing. In certain such embodiments, the at least one MOE substituted nucleoside and the at least one high affinity are in the 5' wing.
In certain embodiments, an antisense compound comprises 1, 2 or 3 high affinity modifications in the 5' and/or 3' wings.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
In certain embodiments, an allelic variant of huntingtin is selectively reduced. Nucleotide sequences that encode huntingtin include, without limitation, the following: GENBANK Accession No. NT_006081.18, truncated from nucleotides 1566000 to 1768000 (replaced by GENBANK Accession No. NT_006051), incorporated herein as SEQ ID NO: 1, and NM_002111.6,
incorporated herein as SEQ ID NO: 2. It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for huntingtin can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.
Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels of a particular allelic variant. In certain embodiments, the desired effect is reduction of levels of the protein encoded by the target nucleic acid or a phenotypic change associated with a particular alleleic variant.
A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
Cell Lines
In certain embodiments, the GM04281, GM02171, and GM02173B cell lines are used in experiments described herein below. The GM04281 cell line has a wild-type HTT allele that contains 17 repeats and a mutant H7T allele that contains 69 repeats. The cell line was derived from a patient both of whose parents were also affected by the disease. The GM02171 cell line was chosen as a counter screen control to the GM04281. This cell line was derived from the daughter of parents, only one of whom had the disease. The daughter had not developed HD but was considered to be at risk. The GM02173B cell line was also patient-derived and was used as a haplotype test control.
Table 1 provides SNPs found in the GM04281, GM02171, and GM02173B cell lines. Also provided are the allelic variants found at each SNP position, the genotype for each of the cell lines, and the percentage of HD patients having a particular allelic variant. For example, the two allelic variants for SNP rs6446723 are T and C. The GM02171 cell line is homozygous CC, the GM02173 cell line is heterozygous TC, and the GM04281 cell line is homozygous TT. Fifty percent of HD patients have a T at SNP position rs6446723.
Table 1
Allelic Variations for SNPs Associated with HD
SNP Variation GM02171 GM02173 GM04281 TargetPOP allele
rs6446723 T/C CC TC TT 0.50 T rs3856973 A/G AA AG GG 0.50 G rs2285086 A/G GG AG AA 0.50 A rs363092 A/C AA AC CC 0.49 C rs916171 C/G GG GC CC 0.49 C rs6844859 T/C CC TC TT 0.49 T rs7691627 A/G AA AG GG 0.49 G rs4690073 A/G AA AG GG 0.49 G rs2024115 A/G GG AG AA 0.48 A rsl 1731237 T/C CC TC TT 0.43 T rs362296 A/C AC AC AC 0.42 C rsl0015979 A/G AA AG GG 0.42 G rs7659144 C/G CG CG CC 0.41 C rs363096 T/C CC TC TT 0.40 T rs362273 A/G AG AG AA 0.39 A rsl6843804 T/C TC TC CC 0.38 C rs362271 A G AG AG GG 0.38 G rs362275 T/C TC TC CC 0.38 C rs3121419 T/C TC TC CC 0.38 C rs362272 A/G — AG GG 0.38 G rs3775061 A/G AG AG AA 0.38 A rs34315806 T/C TC TC CC 0.38 C rs363099 T/C TC TC CC 0.38 C rs2298967 T/C TC TC TT 0.38 T rs363088 A/T TA TA AA 0.38 A rs363064 T/C TC TC CC 0.35 c rs363102 A/G AA AA AA 0.23 G rs2798235 A/G GG GG GG 0.21 A rs363080 T/C CC CC CC 0.21 T rs363072 A/T TA AA AA 0.13 A rs363125 A/C AC CC CC 0.12 C rs362303 T/C TC CC CC 0.12 C rs362310 T/C TC CC CC 0.12 C rsl0488840 A/G AG GG GG 0.12 G rs362325 T/C TC TT TT 0.11 T rs35892913 A/G GG GG GG 0.10 A rs363102 A/G AA AA AA 0.09 A rs363096 T/C CC TC TT 0.09 C rsl 1731237 T/C CC TC TT 0.09 C rsl0015979 A/G AA AG GG 0.08 A rs363080 T/C CC CC CC 0.07 C rs2798235 A/G GG GG GG 0.07 G rsl 936032 C/G CC CC CC 0.06 C rs2276881 A/G GG GG GG 0.06 G rs363070 A/G AA AA AA 0.06 A rs35892913 A/G GG GG GG 0.04 G rsl 2502045 T/C CC CC CC 0.04 C rs6446723 T/C CC TC TT 0.04 C rs7685686 A/G GG AG AA 0.04 G rs3733217 T/C CC CC CC 0.03 C rs6844859 T/C CC TC TT 0.03 C rs362331 T/C CC TC TT 0.03 C
Hybridization
In some embodiments, hybridization occurs between an antisense compound disclosed herein and a SNP site. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
In certain embodiments, the antisense compounds provided herein are specifically hybridizable with the nucleic acid of a particular allelic variant.
Complementarity
An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., selective reduction of a gene product of an allelic variant).
Non-complementary nucleobases between an antisense compound and a target nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a target nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target nucleic acid, a target region, target segment, SNP site, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, a SNP site, target region, target segment, or specified portion thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, SNP site, or specified portion thereof.
In certain embodiments, antisense oligonucleotides that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, SNP site, or specified portion thereof.
The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
Identity
The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Modifications
A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.
Modifications to antisense compounds encompass substitutions or changes to
intemucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides. Chemically modified nucleosides may also be employed to increase selectivity in reducing expression the gene product of an allelic variant.
Modified Intemucleoside Linkages
The naturally occuring intemucleoside linkage of RNA and DNA is a 3' to 5'
phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioate. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
In certain embodiments, antisense compounds comprise one or more modified
intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.
Modified Sugar Moieties
Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, increased selectivity for an allelic variant, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R)2 (R = H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2 -F- 5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2*-F, 2'-OCH3 and 2'-0(CH2)20CH3 substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-CI-CIO alkyl, OCF3, 0(CH2)2SCH3, 0(CH2)2-0-N(Rm)(Rn), and 0-CH2-C(=0)- N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted CI -CIO alkyl.
As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4' to 2' bicyclic nucleoside. Examples of such 4' to 2' bicyclic nucleosides, include but are not limited to one of the formulae: 4'-(CH2)-0-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-0-2' (ENA); 4·-ΟΗ(ΟΗ3)-0-2' and 4'-CH(CH20CH3)-0-2* (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH.3)(CH3)-0-2' (and analogs thereof see published International Application
WO/2009/006478, published January 8, 2009); 4'-CH2-N(OCH3)-2' (and analogs thereof see published International Application WO/2008/150729, published December 11, 2008); 4'-CH2-0- N(CH3)-2' (see published U.S. Patent Application US2004-0171570, published September 2, 2004 ); 4'-CH2-N(R)-0-2', wherein R is H, C!-C12 alkyl, or a protecting group (see U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya, et al, J. Org.
Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof see published International Application WO 2008/154401, published on December 8, 2008). See, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. , 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al, J. Am. Chem. Soc, 129(26) 8362-8379 (Jul. 4, 2007); U.S. Patent Nos. 7,053,207; 6,268,490; 6,770,748; 6,794,499; 7,034,133; and 6,525,191; Elayadi et al, Curr. Opinion Invens. Drugs, 2001, 2, 558- 561; Braasch et al, Chem. Biol, 2001, 8, 1-7; and Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; and U.S. 6,670,461; International applications WO 2004/106356; WO 94/14226; WO 2005/021570; U.S. Patent Publication Nos. US2004-0171570; US2007-0287831; US2008-0039618; U.S. Patent Nos. 7,399,845; U.S. Patent Serial Nos. 12/129,154; 60/989,574; 61/026,995;
61/026,998; 61/056,564; 61/086,231; 61/097,787; 61/099,844; PCT International Applications Nos. PCT/US2008/064591; PCT/US2008/066154; PCT/US2008/068922; and Published PCT
International Applications WO 2007/134181. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L- ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ra)(Rb)]„-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=0)-, -C(=S)-, -0-, -Si(Ra)2-, -S(=0)x-, and -N(Ra)-;
wherein:
x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each Ra and Rt> is, independently, H, a protecting group, hydroxyl, C C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted Cs-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1} NJ1J2, SJi, N3, COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=O)2-J , or sulfoxyl (S(O)-J ; and
each Ji and J2 is, independently, H, C]-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-Ci2 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5- C2o aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, CrC12 aminoalkyl, substituted CpC12 aminoalkyl or a protecting group.
In certain embodiments, the bridge of a bicyclic sugar moiety is , -[C(Ra)(Rb)]n-,
-[C(Ra)(Rb)]n-0-, -C(RaRb)-N(R)-0- or -C(RaRb)-0-N(R)-. In certain embodiments, the bridge is 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-0-2', 4'-(CH2)2-0-2', 4'-CH2-0-N(R)-2' and 4'-CH2- N(R)-0-2'- wherein each R is, independently, H, a protecting group or C!-C12 alkyl. In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the a-L
configuration or in the β-D configuration. Previously, a-L-methyleneoxy (4'-Ο¼-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L- Methyleneoxy (4'-CH2-0-2') BNA , (B) β-D-Methyleneoxy (4'-CH2-0-2') BNA , (C) Ethyleneoxy (4'-(CH2)2-0-2') BNA , (D) Aminooxy (4'-CH2-0-N(R)-2') BNA, (E) Oxyamino (4'-CH2-N(R)-0- 2') BNA, and (F) Methyl(methyleneoxy) (4'-CH(CH3)-0-2') BNA, (G) methylene-thio (4'-CH2-S- 2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH2-CH(CH3)- 2') BNA, (J) propylene carbocyclic (4'-(CH2)3-2') BNA, and (K) ethylene carbocyclic (4'-CH2- CH2-2') (carba LNA or "cLNA") as depicted below.
Figure imgf000040_0001
wherein Bx is the base moiety and R is independently H, a protecting group or C -Cn alkyl. In certain embodiments, bicyclic nucleoside having Formula I:
Figure imgf000041_0001
wherein:
Bx is a heterocyclic base moiety;
-Qa-Qb-Qc- is -CH2-N(Rc)-CH2-, -C(=0)-N(Rc)-CH2-, -CH2-0-N(Rc)-, -CH2-N(Rc)-0- or - N(Rc)-0-CH2;
Rc is C1-C12 alkyl or an amino protecting group; and
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
In certain embodiments, bicyclic nucleoside having Formula II:
Figure imgf000041_0002
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Za is C!-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted Ci-Ce alkyl, substituted C2-C6 alkenyl, substituted C2-C alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJJd, SJc, N3, OC(=X)Jc, and NJeC(=X)NJcJd, wherein each Jc, Jd and Je is, independently, H, C C6 alkyl, or substituted C C6 alkyl and X is O or NJC.
In certain embodiments, bicyclic nucleoside having Formula III:
Figure imgf000042_0001
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Zb is C!-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted Q-Q alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(=0)-).
In certain embodiments, bicyclic nucleoside having Formula IV:
Figure imgf000042_0002
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Rdis Ci-C6 alkyl, substituted C!-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
each qa, qb, qc and qd is, independently, H, halogen, Q-Q alkyl, substituted C!-C6 alkyl, C2- C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, Q-C6 alkoxyl, substituted C!-C6 alkoxyl, acyl, substituted acyl, C C6 aminoalkyl or substituted C C6 aminoalkyl;
In certain embodiments, bicyclic nucleoside having Formula V:
Figure imgf000043_0001
wherein:
Bx is a heterocyclic base moiety;
Ta and T are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
¾a, qb, qe and qf are each, independently, hydrogen, halogen, C!-C12 alkyl, substituted CrC12 alkyl, C2-C12 alkenyl, substituted C2-Cj2 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C\-Cn alkoxy, substituted Ci-Ci2 alkoxy, OJj, SJj, SOJj, S02Jj, NJjJk, N3, CN, C(=0)OJj5 C(=0)NJjJk, C(=0)Jj, 0-C(=0)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJk orN(H)C(=S)NJjJk;
or qe and qf together are -C(qg)(qj,);
qg and qh are each, independently, H, halogen, C!-C12 alkyl or substituted C\-C\2 alkyl.
The synthesis and preparation of the methyleneoxy (4'-CH2-0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.
Analogs of methyleneoxy (4'-CH2-0-2') BNA, methyleneoxy (4'-CH2-0-2') BNA and 2*- thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226 ). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035- 10039). In addition, 2'-Amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.
In certain embodiments, bicyclic nucleoside having Formula VI:
Figure imgf000044_0001
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each qi, ¾, qk and qi is, independently, H, halogen, Ci-C12 alkyl, substituted C1-C12 alkyl, C2- C12 alkenyl, substituted C2-C!2 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted C C12 alkoxyl, OJj, SJj, SOJj, S02Jj, NJjJk, N3, CN, C(=0)OJj, C(=0)NJjJk, C(=0)¾, O- C(=0)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJkorN(H)C(=S)NJjJk; and
qi and qj or qi and qk together are =C(qg)(qh), wherein qg and q are each, independently, H, halogen, C1-C12 alkyl or substituted Ci-C12 alkyl.
One carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and the alkenyl analog bridge 4'-CH=CH-CH2-2' have been described (Frier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al, J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH2)nO]mCH3, 0(CH2)nNH2, 0(CH2)nCH3, 0(CH2)nONH2, OCH2C(=0)N(H)CH3, and 0(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: C\- Ci2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, S02CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA) or those compounds having Formula X:
Formul
Figure imgf000045_0001
X
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula X:
Bx is a heterocyclic base moiety; T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T3 and T4 is an
internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
qi, ¾2, 3, ¾4, q5> ¾6 and q7 are each independently, H, Ci-C6 alkyl, substituted Q-Q alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and
one of Ri and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJA, SJi, N3,
Figure imgf000046_0001
J2 and CN, wherein X is O, S or NJi and each Jl5 J2 and J3 is, independently, H or -Ce alkyl.
In certain embodiments, the modified THP nucleosides of Formula X are provided wherein qm, qn, p, qr, qs, qt and q„ are each H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt and qu is other than H. In certain embodiments, at least one of qm, qn, qp, qr, qs, qt and qu is methyl. In certain embodiments, THP nucleosides of Formula X are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is fluoro and R2 is H; Ri is methoxy and R2 is H, and R is methoxyethoxy and R2 is H.
As used herein, "2'-modified" or "2 '-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non- bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-Q-Qo alkyl, -OCF3, 0-(CH2)2- O-CH3, 2'-0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn), or 0-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted Q-do alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.
As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position.
As used herein, "2'-OMe" or "2'-OCH3" or "2'-0-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2' position of the sugar ring.
As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-0-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH2CH2OCH3 group at the 2' position of the sugar ring. As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (R A) and/or deoxyribonucleosides (DNA).
Many other bicyclo and tricyclo sugar surrogate ring systems are also know in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).
Such ring systems can undergo various additional substitutions to enhance activity.
Methods for the preparations of modified sugars are well known to those skilled in the art.
In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
In certain embodiments, antisense compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleotides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a cEt. In certain embodiments, the cEt modified nucleotides are arranged throughout the wings of a gapmer motif.
Modified Nucleobases
Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity, increased selectivity for an allelic variant, or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5- me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and
Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
In certain embodiments, antisense compounds comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
Compositions and Methods for Formulating Pharmaceutical Compositions
Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
An antisense compound can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A
pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide. Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
Conjugated Antisense Compounds
Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution, increased selectivity for an allelic variant, or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5'- stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.
Cell culture and antisense compounds treatment
The effects of antisense compounds on the level, activity or expression target nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors {e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life
Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes. Illustrative cell lines include GM04281, GM02171, and GM02173B cells.
In vitro testing of antisense oligonucleotides
Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN
concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with
LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
The concentration of antisense oligonucleotide used varies from cell line to cell line.
Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using
electroporation.
RNA Isolation
RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
Analysis of inhibition of target levels or expression
Reduction, inhibition, or expression of a target nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
Quantitative Real-Time PCR Analysis of Target RNA Levels
Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
Probes and primers are designed to hybridize to target nucleic acids. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
Analysis of Protein Levels
Reduction, inhibition, or expression of target nucleic acids can be assessed by measuring target protein levels. Target protein levels can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme- linked immunosorbent assay (ELIS A), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence- activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of mouse, rat, monkey, and human proteins are commercially available.
In vivo testing of antisense compounds
Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to selectively reduce or inhibit expression of target gene product and produce phenotypic changes, such as, amelioration of a disease symptom. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA or protein is isolated from tissue and changes in target nucleic acid or protein expression are measured.
Administration
In certain embodiments, the compounds and compositions described herein may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal), oral, pulmonary (including by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal) or parenteral, for example, by intravenous drip, intravenous injection or subcutaneous, intraperitoneal, intraocular, intravitreal, or intramuscular injection.
In certain embodiments, the compounds and compositions as described herein are administered parenterally.
In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump. In certain embodiments, parenteral administration is by injection.
In certain embodiments, compounds and compositions are delivered to the CNS. In certain embodiments, compounds and compositions are delivered to the cerebrospinal fluid. In certain embodiments, compounds and compositions are administered to the brain parenchyma. In certain embodiments, compounds and compositions are delivered to an animal by intrathecal
administration, or intracerebroventricular administration. Broad distribution of compounds and compositions, described herein, within the central nervous system may be achieved with
intraparenchymal administration, intrathecal administration, or intracerebroventricular
administration.
In certain embodiments, parenteral administration is by injection. The injection may be delivered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue, such as striatum, caudate, cortex, hippocampus and cerebellum.
In certain embodiments, methods of specifically localizing a pharmaceutical agent, such as by bolus injection, decreases median effective concentration (EC50) by a factor of 20, 25, 30, 35, 40, 45 or 50. In certain embodiments, the pharmaceutical agent in an antisense compound as further described herein. In certain embodiments, the targeted tissue is brain tissue. In certain embodiments the targeted tissue is striatal tissue. In certain embodiments, decreasing EC50 is desirable because it reduces the dose required to achieve a pharmacological result in a patient in need thereof.
In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every month, every two months, every 90 days, every 3 months, every 6 months, twice a year or once a year.
Certain Compounds and Indications
Provided herein are compounds and methods that provide potent inhibition and increased selectivity for a mutant allele. Potency is demonstrated by the percent inhibition of mutant mRNA achieved by the antisense oligonucleotides targeting a SNP compared to the percent inhibition of mutant mRNA achieved by the benchmark oligonucleotide. Selectivity is demonstrated by the ability of the antisense oligonucleotide targeting a SNP to inhibit expression of the major allele or mutant allele preferentially compared to the minor allele or wild type allele. The usage of three cell lines with different genotypes at each SNP position have facilitated the determination of design rules that provide for potent and selective SNP targeting antisense oligonucleotides.
In certain embodiments, the compounds are antisense oligonucleotides as further described herein. The antisense oligonucleotides preferentially target a SNP or differentiating polymorphism. Oligonucleotides of various lengths were tested and certain lengths were determined to be beneficial for the targeting of SNPs.
In certain embodiments, the antisense oligonucleotides have a sequence that is 12-30 nucleobases in lenth. In certain embodiments, the antisense oligonucleotides have a sequence that is 12-25 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 12-21 nucleobases in length. In certain embodiments, the antisense
oligonucleotides have a sequence that is 12-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 13-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 14-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 15-20 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 12-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 13-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 14-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 15-19, nuceobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 16-19 nucleobases in lenth. In certain
embodiments, the antisense oligonucleotides have a sequence that is 17-19 nucleobases in length. In certain embodiments, the antisense oligonucleotides have a sequence that is 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleobases in length.
For oligonucleotides of various lengths, the position of the nucleoside complementary to the SNP position was shifted within the gap and the wings and the effect was tested. Certain positions within the antisense oligonucleotide are shown to be beneficial for targeting SNPs.
In certain embodiments, the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 6-15 counting from the 5' terminus of the antisense oligonuceotide and/or positions 1-9 counting from the 5' end of the gap. In certain embodiments, the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 8-14 counting from the 5' terminus of the antisense oligonuceotide and/or positions 1-9 counting from the 5' end of the gap. In certain embodiments, the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is
complementary to positions 8-14 counting from the 5' terminus of the antisense oligonuceotide and/or positions 4-7 counting from the 5' end of the gap. In certain embodiments, the antisense oligonucleotide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18 or at least 19 nucleobases in length and the SNP is complementary to positions 8-10 counting from the 5' terminus of the antisense oligonuceotide and/or positions 4-6 counting from the 5' end of the gap.
In certain embodiments, the SNP is complementary to position 8, 9, or 10 counting from the 5' terminus of the oligonucleotide or position 4, 5, or 6, counting from the 5' end of the gap. For oligonucleotides of various lengths, the effect of the length of the gap, 5' wing, and 3' wing was tested.
Certain wing-gap- wing combinations were shown to be beneficial for a SNP targeting antisense oligonucleotide. In certain embodiments the gap is 7-11 nucleobases in length and each wing is independently 1-6 nucleobases in length. In certain embodiments the gap is 7-11
nucleobases in length and each wing is independently 2-6 nucleobases in length.In certain embodiments the gap is 8-11 nucleobases in length and each wing is independently 2-6 nucleobases in length. In certain embodiments the gap is 9-11 nucleobases in length and each wing is independently 2-6 nucleobases in length. In certain embodiments the gap is 9 nucleobases in length and each wing is independently 2-6 nucleobases in length. In certain embodiments the gap is 10 nucleobases in length and each wing is independently 2-6 or 4-5 nucleobases in length. In certain embodiments the gap is 11 nucleobases in length and each wing is independently 2-6, or 4-5 nucleobases in length. In certain embodiments, the wing-gap-wing configuration is one of 4-7-4, 5-
8- 6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5, 5-9-3, 5-9-4, 4-9-5, 5-
9- 5, 4-11-4, 4-10-5 and 5-10-4.
For oligonucleotides of various lengths, the effect of certain chemistries was tested.
Certain chemistry modifications were shown to be beneficial for a SNP targeting antisense oligonucleotide. In certain embodiments, each nucleoside of each wing of the modified antisense oligonucleotide has a 2'-MOE modification. In certain embodiments, each nucleoside of each wing of the modified antisense oligonucleotide has a high affinity modification. In certain embodiments, the antisense oligonucleotide is a mixed wing gapmer. In such embodiment, the modifications and combination of modifications at the 3' wing and at the 5' wing may be the same or they may be different. In certain embodiments, the antisense oligonucleotide has one or more 2'-MOE modifications in the wings and/or one or more high affinity modifications in the wings. In certain embodiments, the high affinity modification is a cEt modification. In certain embodiments, the antisense oligonucleotide has a high affinity modification at positions 2, 3, 13, and 14 of the antisense oligonucleotide (counting from the 5' terminus). In certain embodiments, the antisense oligonuceotide has one, two, three, or four high affinity modifications in at least one of the wings. In certain embodiments, the antisense oligonuceotide has one, two, three, or four high affinity modifications in each of the 5' and 3' wings independently. In certain embodiments, the antisense oligonucleotide has a high affinity modification at positions 2 and 3 in one or both of the 5' and 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing). In certain embodiments, the antisense oligonuceotide has a high affinity modification at positions 2, 3 and 4 in one or both of the 5' and 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing,). In certain embodiments, the antisense oligonuceotide has a high affinity
modification at positions 1 of the 5' and/or 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing,). In certain embodiments, the antisense oligonuceotide has a high affinity modification at positions 1 of the 5' and 3' wings (counting from the 5' terminus of the 5' wing and the 3' terminus of the 3'wing,) and at least one other position in the wing. In certain embodiments, the antisense oligonuceotide has alternating 2'-MOE and high affinity modification in at least one of the 5' and 3 'wings.
In certain embodiments, the compound comprises an antisense oligonucleotide
incorporating one or more of the design rules provided above.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 12 to 30 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 6-15 begining from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments the single nucleotide polymorphism site contains a
differentiating polymorphism. In certain embodiments, the single nucleotide polymorphism site is on a mutant allele. In certain embodiments, the mutant allele is associated with disease. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6- 7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9-5, 5-9-5, 4-11-4,4- 10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap- wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 6-15 begining from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-14 begining from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-14 begining from the 5' terminus of the antisense oligonuceotide or positions 4-7 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 12 to 20 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 begining from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 12 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 begining from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 13 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 begining from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap- wing motif is any one of the group consisting of 4- 7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5-9-3, 5-9-4, 4-9- 5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 14 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 beginning from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5- 9-3, 5-9-4, 4-9-5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 6-15 beginning from the 5' terminus of the antisense oligonuceotide or positions 1-9 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap- wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5- 9_3, 5.9.4, 4-9-5, 5.9.5, 4.11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein the single nucleotide polymorphism aligns with any one of positions 8-10 beginning from the 5' terminus of the antisense oligonuceotide or positions 4-6 begining from the 5' end of the gap of the modified antisense oligonucleotide; and wherein each nucleoside of each wing has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 4-7-4, 5-8-6, 6-8-5, 6-7-6, 5-7-5. 6-8-5, 5-8-6, 3-9-4, 4-9-3, 2-9-6, 6,9,2,3-9-3, 3-9-5,5- 9-3, 5-9-4, 4-9-5, 5-9-5, 4-11-4,4-10-5 and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisnese oligonucleotide comprises a wing-gap- wing motif, wherein position 6, 8, 9, 10, 11, or 14 beginning from the 5' terminus of the modified antisense
oligonucleotide aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 1, 4, 5, 6, 7, or 9 of the gap segment aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment has a modified sugar or sugar surrogate. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4- 9_5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, or 12 of the modified antisense oligonucleotide aligns with the single nucleotide polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'- CH(CH3)-0-2' bridge. In certain embodiments, the wing-gap- wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a single nucleotide
polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap- wing motif, wherein position 3, 4, 5, 6, 7, 8 or 9 of the gap segment aligns with the single nucleotide polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'-CH(CH3)-0-2' bridge. In certain embodiments, the wing-gap- wing motif is any one of the group consisting of 2-9- 6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
A compound comprising a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, or 12 of the modified antisense oligonucleotide aligns with the single nucleotide
polymorphism; and positions 2, 3, 13, and 14 of the antisense oligonucleotide comprise a 4'- CH(CH3)-0-2' bridge.. In certain embodiments, the wing-gap- wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
A compound comprising a modified antisense oligonucleotide consisting of 15 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 3, 4, 5, 6, 7, 8, or 9 of the gap segment aligns with the single nucleotide polymorphism; and positions 2, 3, 13, and 14 of the antisense antisense oligonucleotide comprise a 4'-CH(CH3)-0-2' bridge. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4- 9-5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprise a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 8, 9, or 10 of the modified antisense oligonucleotide aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 5, 6, or 7 of the gap segment aligns with the single nucleotide polymorphism; and wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar. In certain
embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4- 9-5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides, fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap- wing motif, wherein position 8, 9, or 10 of the modified antisense oligonucleotide aligns with the single nucleotide polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'-CH(CH3)-0-2' bridge. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9- 6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
In certain embodiments, the compound comprises a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides and fully complementary to a single nucleotide
polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 5, 6, or 7 of the gap segment aligns with the single nucleotide
polymorphism; and positions 2 and 3 of the 5' and 3' wing segments comprise a 4'-CH(CH3)-0-2' bridge. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9- 6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-10-4.
A compound comprising a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 8, 9, or 10 of the modified oligonucleotide aligns with the single nucleotide polymorphism; and positions 2, 3, 13, and 14 of the antisense antisense oligonucleotide comprise a 4'-CH(CH3)-0-2' bridge.. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-
9- 5, 4-9-5, 4-11-4, and 5-10-4.
A compound comprising a modified antisense oligonucleotide consisting of 17 to 19 linked nucleosides and fully complementary to a single nucleotide polymorphism site, wherein the modified antisense oligonucleotide comprises a wing-gap-wing motif, wherein position 5, 6, or 7 of the gap segment aligns with the single nucleotide polymorphism; and positions 2, 3, 13, and 14 of the antisense oligonucleotide comprise a 4'-CH(CH3)-0-2' bridge. In certain embodiments, the wing-gap-wing motif is any one of the group consisting of 2-9-6, 3-9-3, 3-9-5, 4-9-5, 4-11-4, and 5-
10- 4.
In a certain embodiment, the antisense oligonucleotide is 11 to 20 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wings and 7 to 11 linked nucleosides in the gap. The SNP is complementary to position 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 counting from the 5' terminus of the gap segment.
In a certain embodiment, the antisense oligonucleotide is 15 to 19 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wings and 7 to 11 linked nucleosides in the gap. The SNP is complementary to position 6, 7, 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 4, 5, 6, or 7 counting from the 5' terminus of the gap segment.
In a certain embodiment, the antisense oligonucleotide is 17 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wing segments and 9 to 11 linked nucleosides in the gap segment. The SNP is complementary to position 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 5, 6, or 7 (counting from the 5' terminus of the gap segment).
In a certain embodiment, the antisense oligonucleotide is 18 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wing segments and 9 to 11 linked nucleosides in the gap segment. The SNP is complementary to position 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 5, 6, or 7 (counting from the 5' terminus of the gap segment).
In a certain embodiment, the antisense oligonucleotide is 19 linked nucleosides in length and has, independently, 2 to 5 linked nucleosides in the 5' and 3' wing segments and 9 to 11 linked nucleosides in the gap segment. The SNP is complementary to position 8, 9, or 10 of the antisense oligonucleotide (counting from the 5' terminus of the antisense oligonucleotide) or position 5, 6, or 7 (counting from the 5' terminus of the gap segment).
In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has an allelic variant associated with a disease or disorder. The pharmaceutical compositions provided herein preferentially target a SNP. In certain embodiments, the SNP is a differentiating polymorphism.
Methods have been described for determining whether a SNP is specific to a disease associated allele and more specifically whether a SNP variant of an allele of a heterozygous patient is on the same allele as a disease-causing mutation that is at a remote region of the gene's mRNA (WO 2008/147930 and WO 2008/143774).
Diseases associated with SNPs have been described for certain genes. In certain embodiments, the gene and associated disease are any of the following: APP gene encoding amyloid precursor protein involved in Alzheimer's disease (Gene, 371 : 68, 2006); the PrP gene encoding prion protein involved in Creutzfeldt- Jakob disease and in fatal familial insomnia (Nat. Med. 1997, 3: 1009 ); GFAP gene encoding glial fibrillary acidic protein involved in Alexander disease (J. Neurosci. 2006, 26:111623); alpha-synuclein gene encoding alpha-synuclein protein involved in Parkinson's disease (J. Clin. Invest. 2003, 111 : 145); SOD-1 gene encoding the SOD-1 protein involved in amyotrophic lateral sclerosis (Science 1998, 281: 1851); atrophin-1 gene encoding atrophin-1 protein involved in dentato-rubral and pallido-luysian atrophy (DRPA) (Trends Mol. Med. 2001, 7: 479); SCA1 gene encoding ataxin-1 protein involved in spino-cerebellar ataxia-1 (SCA1) (Protein Sci. 2003, 12: 953); PLP gene encoding proteolipid protein involved in Pelizaeus- Merzbacher disease (NeuroMol Med. 2007, 4: 73); DYTl gene encoding torsinA protein involved in Torsion dystonia (Brain Res. 2000, 877: 379); and alpha-B crystalline gene encoding alpha-B crystalline protein involved in protein aggregation diseases, including cardiomyopathy (Cell 2007, 130: 427); alpha 1 -antitrypsin gene encoding alpha 1 -antitrypsin protein involved in chronic obstructive pulmonary disease (COPD), liver disease and hepatocellular carcinoma (New Engl J Med. 2002, 346: 45); Ltk gene encoding leukocyte tyrosine kinase protein involved in systemic lupus erythematosus (Hum. Mol. Gen. 2004, 13: 171); PCSK9 gene encoding PCSK9 protein involved in hypercholesterolemia (Hum Mutat. 2009, 30: 520); prolactin receptor gene encoding prolactin receptor protein involved in breast tumors (Proc. Natl. Assoc. Sci. 2008, 105: 4533); CCL5 gene encoding the chemokine CCL5 involved in COPD and asthma (Eur. Respir. J. 2008, 32: 327); PTPN22 gene encoding PTPN22 protein involved in Type 1 diabetes, Rheumatoid arthritis, Graves disease, and SLE (Proc. Natl. Assoc. Sci. 2007, 104: 19767); androgen receptor gene encoding the androgen receptor protein involved in spinal and bulbar muscular atrophy or Kennedy's disease (J Steroid Biochem. Mol. Biol. 2008, 108: 245); CHMP4B gene encoding chromatin modifying protein-4B involved in progressive childhood posterior subcapsular cataracts (Am. J. Hum. Genet 2007, 81 : 596); FXR / NR1H4 gene encoding Farnesoid X receptor protein involved in cholesterol gallstone disease, arthrosclerosis and diabetes (Mol. Endocrinol. 2007, 21: 1769); ABCA1 gene encoding ABCA1 protein involved in cardiovascular disease (Transl. Res. 2007, 149: 205); CaSR gene encoding the calcium sensing receptor protein involved in primary hypercalciuria (Kidney Int. 2007, 71 : 1155); alpha-globin gene encoding alpha-globin protein involved in alpha-thallasemia (Science 2006, 312: 1215); httlpr gene encoding HTTLPR protein involved in obsessive compulsive disorder (Am. J. Hum. Genet. 2006, 78: 815); AVP gene encoding arginine vasopressin protein in stress-related disorders such as anxiety disorders and comorbid depression (CNS Neurol. Disord. Drug Targets 2006, 5: 167); GNAS gene encoding G proteins involved in congenital visual defects, hypertension, metabolic syndrome (Trends Pharmacol. Sci. 2006, 27: 260); APAFl gene encoding APAF1 protein involved in a predisposition to major depression (Mol. Psychiatry 2006, 11 : 76); TGF-betal gene encoding TGF-betal protein involved in breast cancer and prostate cancer (Cancer Epidemiol. Biomarkers Prev. 2004, 13: 759); AChR gene encoding acetylcholine receptor involved in congential myasthenic syndrome (Neurology 2004, 62: 1090); P2Y12 gene encoding adenosine diphosphate (ADP) receptor protein involved in risk of peripheral arterial disease (Circulation 2003, 108: 2971); LQT1 gene encoding LQT1 protein involved in atrial fibrillation (Cardiology 2003, 100: 109); RET protooncogene encoding RET protein involved in sporadic pheochromocytoma (J. Clin. Endocrinol. Metab. 2003, 88: 4911); filamin A gene encoding filamin A protein involved in various congenital malformations (Nat. Genet. 2003, 33: 487); TARDBP gene encoding TDP-43 protein involved in amyotrophic lateral sclerosis (Hum. Mol. Gene.t 2010, 19: 671); SCA3 gene encoding ataxin-3 protein involved in Machado- Joseph disease (PLoS One 2008, 3: e3341); SCA7 gene encoding ataxin-7 protein involved in spino-cerebellar ataxia-7 (PLoS One 2009, 4: e7232); HTT gene encoding huntingtin protein involved in Huntington's disease (Neurobiol Dis. 1996, 3:183); and the CA4 gene encoding carbonic anhydrase 4 protein, CRX gene encoding cone-rod homeobox transcription factor protein, FSCN2 gene encoding retinal fascin homolog 2 protein, IMPDH1 gene encoding inosine monophosphate dehydrogenase 1 protein, NR2E3 gene encoding nuclear receptor subfamily 2 group E3 protein, NRL gene encoding neural retina leucine zipper protein, PRPF3 (RP18) gene encoding pre-mRNA splicing factor 3 protein, PRPF8 (RP13) gene encoding pre-mRNA splicing factor 8 protein, PRPF31 (RP11) gene encoding pre-mRNA splicing factor 31 protein, RDS gene encoding peripherin 2 protein, ROM1 gene encoding rod outer membrane protein 1 protein, RHO gene encoding rhodopsin protein, RPl gene encoding RP1 protein, RPGR gene encoding retinitis pigmentosa GTPase regulator protein, all of which are involved in Autosomal Dominant Retinitis Pigmentosa disease (Adv Exp Med Biol. 2008, 613:203)
In certain embodiments, the disease is a neurodegenerative disorder. In certain
embodiments, the neurodegenerative disorder is Huntington's Disease. In certain embodiments, the targeted SNP is one or more of: rs6446723, rs3856973, rs2285086, rs363092, rs916171, rs6844859, rs7691627, rs4690073, rs2024115, rsl l731237, rs362296, rsl0015979, rs7659144, rs363096, rs362273, rsl6843804, rs362271, rs362275, rs3121419, rs362272, rs3775061, rs34315806, rs363099, rs2298967, rs363088, rs363064, rs363102, rs2798235, rs363080, rs363072, rs363125, rs362303, rs362310, rsl0488840, rs362325, rs35892913, rs363102, rs363096, rsl l731237, rsl0015979, rs363080, rs2798235, rsl 936032, rs2276881, rs363070, rs35892913, rsl2502045, rs6446723, rs7685686, rs3733217, rs6844859, rs362331, rsl 143646, rs2285086, rs2298969, rs4690072, rs916171, rs3025849, rs7691627, rs4690073, rs3856973, rs363092, rs362310, rs362325, rs363144, rs362303, rs34315806, rs363099, rs363081, rs3775061, rs2024115, rsl0488840, rs363125, rs362296, rs2298967, rs363088, rs363064, rs362275, rs3121419, rs3025849, rs363070, rs362273, rs362272, rs362306, rs362271, rs363072, rsl6843804, rs7659144, rs363120, and rsl2502045. In certain embodiments the compounds areISIS460065, ISIS 459978, ISIS 460028, ISIS 460209, ISIS 460208, and ISIS 460206.
Therapeutically Effective Dosages
In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to the mutant huntingtin allele is accompanied by monitoring of expression of a gene product in an individual, to determine an individual's response to administration of the antisense compound. In certain embodiments, the gene product is huntingtin mRNA or protein. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
In certain embodiments, administration of an antisense compound targeted to a mutant nucleic acid results in reduction of mRNA or protein expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, the mutant nucleic acid is huntingtin nucleic acid, the mRNA is huntingtin mRNA, and the protein is huntingtin protein.
In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to a mutant allele are used for the preparation of a medicament for treating a patient suffering or susceptible to any of Huntington's Disease, Alzheimer's Disease, Crutzfeldt- Jakob Disease, Fatal Familial Insomnia, Huntington's Disease, Alexander Disease, Parkinson's Disease, Amyotrophic Lateral Sclerosis (ALS), Dentato-Rubral and Pallido-Luysian Atrophy, Spinocerebellar Ataxia 1, Pelizaeus-Merzbacher Disease, Torsion Dystonia, Cardiomyopathy, Chrome Obstructive Pulmonary Disease (COPD), liver disease and hepatocellular carcinoma, SLE, Hypercholesterolemia, breast tumors, Asthma, Type 1 Diabetes, Rheumatoid Arthritis, Graves Disease, Spinal and Bulbar Muscular Atrophy, Kennedy's Disease, progressive childhood posterior subcapsular cataracts, Cholesterol Gallstone Disease, Arthrosclerosis, cardiovascular disease, primary hypercalciuria, alpha-thallasemia, OCD, stress-related disorders (including anxiety disorders and comorbid depression), congential visual defects, hypertension, metabolic syndrome, major depression, breast cancer, prostate cancer, congenital myasthenic syndrome, peripheral arterial syndrome, atrial fibrillation, sporadic pheochromocytoma, congenital malformations, NJD, SCA7, and autosomal dominant retinitis pigmentosa adRP. Certain Combination Therapies
In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions of the present invention. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions of the present invention. In certain embodiments, one or more pharmaceutical compositions of the present invention are coadministered with another pharmaceutical agent to treat an undesired effect of that other
pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions of the present invention are co-administered with another pharmaceutical agent to produce a synergistic effect.
In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions of the present invention and one or more other pharmaceutical agents are prepared separately.
EXAMPLES
Non-limiting disclosure and incorporation by reference
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the patents, applications, printed publications, and other published documents mentioned or referred to in this specification are herein incorporated by reference in their entirety.
Example 1: Single nucleotide polymorphisms (SNPs) in the huntingtin (HTT) gene sequence
The HTT genomic sequence, designated herein as SEQ ID NO: 1 (NT_006081.18 truncated from nucleotides 1566000 to 1768000) was aligned with the HTTmRNA, designated herein as SEQ ID NO: 2 (NM_0021 11.6), using the EMBL-EBI sequence database (ClustalW2,
http://www.ebi.ac.uk/Tools/clustalw2/index.htmn, and the output is presented in Figure 1. SNP positions (identified by Hayden et al, WO/2009/135322) associated with the HTT gene were mapped to the two sequences and have been demarcated in Figure 1 by their reference SNP ID number from the Entrez SNP database at the National Center for Biotechnology Information (NCBI,
http://www.ncbi.nlm.nih.gov/sites/entrez?db=snp), incorporated herein by reference. Table 2 furnishes further details on each SNP. The 'Reference SNP ID number' or 'RS number' is the number designated to each SNP from the Entrez SNP database at NCBI, incorporated herein by reference. 'SNP position' refers to the nucleotide position of the SNP on SEQ ID NO: 1.
'Polymorphism' indicates the nucleotide variants at that SNP position. 'Major allele' indicates the nucleotide associated with the major allele, or the nucleotide present in a statistically significant proportion of individuals in the human population. 'Minor allele' indicates the nucleotide associated with the minor allele, or the nucleotide present in a relatively small proportion of individuals in the human population.
Table 2
Single Nuclear Polymorphisms (SNPs) and their positions on SEQ ID NO: 1
SNP Major Minor
RS No. Polymorphism
position allele allele rs2857936 1963 C/T C T
rsl2506200 3707 A/G G A
rs762855 14449 A/G G A rs3856973 19826 G/A G A
rs2285086 28912 G/A A G
rs7659144 37974 C/G C G
rsl6843804 44043 C/T C T
rs2024115 44221 G/A A G
rsl0015979 49095 A G A G
rs7691627 51063 A/G G A rs2798235 54485 G/A G A
rs4690072 62160 G/T T G
rs6446723 66466 C/T T C
rs363081 73280 G/A G A rs363080 73564 T/C C T rs363075 77327 G/A G A
rs363064 81063 T/C C T rs3025849 83420 A G A G
rs6855981 87929 A/G G A
rs363102 88669 G/A A G rsl 1731237 91466 C/T C T
rs4690073 99803 A/G G A
rs363144 100948 T/G T G rs3025838 101099 C/T C T
rs34315806 101687 A/G G A
rs363099 101709 T/C C T rs363096 119674 T/C T C rs2298967 125400 C/T T c
rs2298969 125897 A/G G A
rs6844859 130139 C/T T C
rs363092 135682 C/A c A rs7685686 146795 A/G A G
rs363088 149983 A/T A T rs362331 155488 C/T T C rs916171 156468 G/C c G rs362322 161018 A/G A G rs362275 164255 T/C C T rs362273 167080 A/G A G rs2276881 171314 G/A G A
rs3121419 171910 T/C C T
rs362272 174633 G/A G A rs362271 175171 G/A G A rs3775061 178407 C/T C T
rs362310 179429 A/G G A rs362307 181498 T/C C T rs362306 181753 G/A G A rs362303 181960 T/C C T rs362296 186660 C/A C A rsl 006798 198026 A/G A G
Example 2: Design of antisense oligonucleotides targeting huntingtin gene SNPs and inhibition of Hrr mRNA in Coriell fibroblast cell lines (GM04281, GM02171, and GM02173B)
Antisense oligonucleotides targeting nucleotides overlapping SNP positions presented in Table 1 were designed and tested for potency in three huntingtin patient-derived Coriell fibroblast cell lines, GM04281, GM02171, and GM02173B (from the Coriell Institute for Medical Research). Cultured GM04281 cells or GM02171 cells or GM02173B cells at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and H7 mRNA levels were measured by quantitative real time PCR using primer probe set RTS2617 (forward sequence
CTCCGTCCGGTAGACATGCT, designated herein as SEQ ID NO: 3; reverse sequence
GGAAATCAGAACCCTCAAAATGG, designated herein as SEQ ID NO: 4; probe sequence TGAGCACTGTTCAACTGTGGATATCGGGAX, designated herein as SEQ ID NO: 5). HTT rnRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN.
Results are presented as percent inhibition of H7 mRNA, relative to untreated control cells.
ISIS 387916 (TCTCTATTGCACATTCCAAG, 5-10-5 MOE (SEQ ID NO: 6)) and ISIS 388816 (GCCGTAGCCTGGGACCCGCC, 5-10-5 MOE (SEQ ID NO: 7)) were included in each study as benchmark oligonucleotides against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
The chimeric antisense oligonucleotides in Tables 3 and 4 were designed as 5-9-5 MOE gapmers. The gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both sides (in the 5' and 3' directions) by wings comprising five nucleotides each. Each nucleotide in the 5' wing segment and each nucleotide in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each gapmer are 5-methylcytosines.
The oligonucleotides are further described in Table 3. The percent inhibition of H7TmRNA by the antisense oligonucleotides in each cell line is shown in Table 4. 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele at the SNP position. The number in parentheses indicates the nucleotide position in the gapmer opposite to the SNP position, starting from the 5'-terminus of the oligonucleotide. 'Start site' indicates the 5'-most nucleotide to which the gapmer is targeted. "Stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted. Each gapmer listed in Tables 3 and 4 is targeted to human H pre-mRNA, which is SEQ ID NO: 1. Table 3
Chimeric oligonucleotides targeting SNP positions on the HTT ge e
Figure imgf000071_0001
435351 rs363075 Minor (8) TGAGCCCTTCTGTGTAAGT 77316 77334 43
435918 rs363075 Major (9) ATGAGCCCCTCTGTGTAAG 77317 77335 44
435930 rs363075 Minor (9) ATGAGCCCTTCTGTGTAAG 77317 77335 45
435297 rs363075 Major (10) GATGAGCCCCTCTGTGTAA 77318 77336 46
435315 rs363075 Minor (10) GATGAGCCCTTCTGTGTAA 77318 77336 47
435920 rs363075 Major (11) TGATGAGCCCCTCTGTGTA 77319 77337 48
435932 rs363075 Minor (11) TGATGAGCCCTTCTGTGTA 77319 77337 49
435366 rs363075 Major (12) ATGATGAGCCCCTCTGTGT 77320 77338 50
435924 rs363075 Minor (12) ATGATGAGCCCTTCTGTGT 77320 77338 51
435922 rs363075 Major (14) TAATGATGAGCCCCTCTGT 77322 77340 52
435934 rs363075 Minor (14) TAATGATGAGCCCTTCTGT 77322 77340 53
435334 rs363064 Major (8) AGAATACGGGTAACATTTT 81052 81070 54
435352 rs363064 Minor (8) AGAATACAGGTAACATTTT 81052 81070 55
435298 rs363064 Major (10) GGAGAATACGGGTAACATT 81054 81072 56
435316 rs363064 Minor (10) GGAGAATACAGGTAACATT 81054 81072 57
435335 rs3025849 Major (8) TTAGTAATCAATTTTAATG 83409 83427 58
435353 rs3025849 Minor (8) TTAGTAACCAATTTTAATG 83409 83427 59
435299 rs3025849 Major (10) AGTTAGTAATCAATTTTAA 83411 83429 60
435317 rs3025849 Minor (10) AGTTAGTAACCAATTTTAA 83411 83429 61
435877 rs6855981 Major (10) GAAGGAATGCTTTTACTAG 87920 87938 62
435902 rs6855981 Minor (10) GAAGGAATGTTTTTACTAG 87920 87938 63
435336 rs363102 Major (8) CTAAAACTAACTTGAGAAT 88658 88676 64
435354 rs363102 Minor (8) CTAAAACCAACTTGAGAAT 88658 88676 65
435300 rs363102 Major (10) ATCTAAAACTAACTTGAGA 88660 88678 66
435318 rs363102 Minor (10) ATCTAAAACCAACTTGAGA 88660 88678 67
435884 rsl 1731237 Major (10) GGTGGGCAGGAAGGACTGA 91457 91475 68
435909 rsl 1731237 Minor (10) GGTGGGCAGAAAGGACTGA 91457 91475 69
435337 rs4690073 Major (8) CCTAAATCAATCTACAAGT 99792 99810 70
435355 rs4690073 Minor (8) CCTAAATTAATCTACAAGT 99792 99810 71
435301 rs4690073 Major (10) TCCCTAAATCAATCTACAA 99794 99812 72
435319 rs4690073 Minor (10) TCCCTAAATTAATCTACAA 99794 99812 73
435883 rs363144 Major (10) GAAAATGTGAGTGGATCTA 100939 100957 74
435908 rs363144 Minor (10) GAAAATGTGCGTGGATCTA 100939 100957 75
435338 rs3025838 Major (8) GTAAGGCGAGACTGACTAG 101088 101106 76
435356 rs3025838 Minor (8) GTAAGGCAAGACTGACTAG 101088 101106 77
435302 rs3025838 Major (10) AGGTAAGGCGAGACTGACT 101090 101108 78
435320 rs3025838 Minor (10) AGGTAAGGCAAGACTGACT 101090 101108 79
435339 rs363099 Major (8) CTGAGCGGAGAAACCCTCC 101698 101716 80
435357 rs363099 Minor (8) CTGAGCGAAGAAACCCTCC 101698 101716 81
435303 rs363099 Major (10) GGCTGAGCGGAGAAACCCT 101700 101718 82
435321 rs363099 Minor (10) GGCTGAGCGAAGAAACCCT 101700 101718 83
435367 rs363099 Major (12) AAGGCTGAGCGGAGAAACC 101702 101720 84 435340- rs363096 Major (8) TTCCCTAAAAACAAAAACA 119663 119681 85
435358 rs363096 Minor (8) TTCCCTAGAAACAAAAACA 119663 119681 86
435304 rs363096 Major (10) GATTCCCTAAAAACAAAAA 119665 119683 87
435322 rs363096 Minor (10) GATTCCCTAGAAACAAAAA 119665 119683 88
435341 rs2298967 Major (8) CTTTTCTATTGTCTGTCCC 125389 125407 89
435359 rs2298967 Minor (8) CTTTTCTGTTGTCTGTCCC 125389 125407 90
435305 rs2298967 Major (10) TGCTTTTCTATTGTCTGTC 125391 125409 91
435323 rs2298967 Minor (10) TGCTTTTCTGTTGTCTGTC 125391 125409 92
435865 rs2298969 Major (10) AAGGGATGCCGACTTGGGC 125888 125906 93
435890 rs2298969 Minor (10) AAGGGATGCTGACTTGGGC 125888 125906 94
435876 rs6844859 Major (10) ACCTTCCTCACTGAGGATG 130130 130148 95
435901 rs6844859 Minor (10) ACCTTCCTCGCTGAGGATG 130130 130148 96
435872 rs363092 Major (10) CAAACCACTGTGGGATGAA 135673 135691 97
435897 rs363092 Minor (10) CAAACCACTTTGGGATGAA 135673 135691 98
435879 rs7685686 Major (10) AATAAATTGTCATCACCAG 146786 146804 99
435904 rs7685686 Minor (10) AATAAATTGCCATCACCAG 146786 146804 100
435871 rs363088 Major (10) TCACAGCTATCTTCTCATC 149974 149992 101
435896 rs363088 Minor (10) TCACAGCTAACTTCTCATC 149974 149992 102
435870 rs362331 Major (10) GCACACAGTAGATGAGGGA 155479 155497 103
435895 rs362331 Minor (10) GCACACAGTGGATGAGGGA 155479 155497 104
435881 rs916171 Major (10) CAGAACAAAGAGAAGAATT 156459 156477 105
435906 rs916171 Minor (10) CAGAACAAACAGAAGAATT 156459 156477 106
435342 rs362322 Major (8) GCTTACATGCCTTCAGTGA 161007 161025 107
435360 rs362322 Minor (8) GCTTACACGCCTTCAGTGA 161007 161025 108
435306 rs362322 Major (10) CAGCTTACATGCCTTCAGT 161009 161027 109
435324 rs362322 Minor (10) CAGCTTACACGCCTTCAGT 161009 161027 110
435868 rs362275 Major (10) AAGAAGCCTGATAAAATCT 164246 164264 111
435893 rs362275 Minor (10) AAGAAGCCTAATAAAATCT 164246 164264 112
435343 rs2276881 Major (8) CATACATCAGCTCAAACTG 171303 171321 113
435361 rs2276881 Minor (8) CATACATTAGCTCAAACTG 171303 171321 114
435307 rs2276881 Major (10) CACATACATCAGCTCAAAC 171305 171323 115
435325 rs2276881 Minor (10) CACATACATTAGCTCAAAC 171305 171323 116
435368 rs2276881 Major (12) GTCACATACATCAGCTCAA 171307 171325 117
435866 rs3121419 Major (10) GAGACTATAGCACCCAGAT 171901 171919 118
435891 rs3121419 Minor (10) GAGACTATAACACCCAGAT 171901 171919 119
435344 rs362272 Major (8) TAGAGGACGCCGTGCAGGG 174622 174640 120
435362 rs362272 Minor (8) TAGAGGATGCCGTGCAGGG 174622 174640 121
435308 rs362272 Major (10) CATAGAGGACGCCGTGCAG 174624 174642 122
435326 rs362272 Minor (10) CATAGAGGATGCCGTGCAG 174624 174642 123
435369 rs362272 Major (12) CACATAGAGGACGCCGTGC 174626 174644 124
435867 rs362271 Major (10) ACGTGTGTACAGAACCTGC 175162 175180 125
435892 rs362271 Minor (10) ACGTGTGTATAGAACCTGC 175162 175180 126 435873 rs3775061 Major (10) TGTTCAGAATGCCTCATCT 178398 178416 127
435898 rs3775061 Minor (10) TGTTCAGAACGCCTCATCT 178398 178416 128
435345 rs362310 Major (8) AAACGGCGCAGCGGGAAGG 179418 179436 129
435363 rs362310 Minor (8) AAACGGCACAGCGGGAAGG 179418 179436 130
435309 rs362310 Major (10) AGAAACGGCGCAGCGGGAA 179420 179438 131
435327 rs362310 Minor (10) AGAAACGGCACAGCGGGAA 179420 179438 132
435915 rs362307 Major (6) AGGGCGCAGACTTCCAAAG 181485 181503 133
435927 rs362307 Minor (6) AGGGCACAGACTTCCAAAG 181485 181503 134
435917 rs362307 Major (7) AAGGGCGCAGACTTCCAAA 181486 181504 135
435929 rs362307 Minor (7) AAGGGCACAGACTTCCAAA 181486 181504 136
435346 rs362307 Major (8) CAAGGGCGCAGACTTCCAA 181487 181505 137
435364 rs362307 Minor (8) CAAGGGCACAGACTTCCAA 181487 181505 138
435919 rs362307 Major (9) ACAAGGGCGCAGACTTCCA 181488 181506 139
435931 rs362307 Minor (9) ACAAGGGCACAGACTTCCA 181488 181506 140
435310 rs362307 Major (10) CACAAGGGCGCAGACTTCC 181489 181507 141
435328 rs362307 Minor (10) CACAAGGGCACAGACTTCC 181489 181507 142
435921 rs362307 Major (11) GCACAAGGGCGCAGACTTC 181490 181508 143
435933 rs362307 Minor (11) GCACAAGGGCACAGACTTC 181490 181508 144
435370 rs362307 Major (12) GGCACAAGGGCGCAGACTT 181491 181509 145
435925 rs362307 Minor (12) GGCACAAGGGCACAGACTT 181491 181509 146
435923 rs362307 Major (14) AGGGCACAAGGGCGCAGAC 181493 181511 147
435935 rs362307 Minor (14) AGGGCACAAGGGCACAGAC 181493 181511 148
435869 rs362306 Major (10) GAGCAGCTGCAACCTGGCA 181744 181762 149
435894 rs362306 Minor (10) GAGCAGCTGTAACCTGGCA 181744 181762 150
435347 rs362303 Major (8) TGGTGCCGGGTGTCTAGCA 181949 181967 151
435365 rs362303 Minor (8) TGGTGCCAGGTGTCTAGCA 181949 181967 152
435311 rs362303 Major (10) AATGGTGCCGGGTGTCTAG 181951 181969 153
435329 rs362303 Minor (10) AATGGTGCCAGGTGTCTAG 181951 181969 154
435882 rs362296 Major (10) GGGGACAGGGTGTGCTCTC 186651 186669 155
435907 rs362296 Minor (10) GGGGACAGGTTGTGCTCTC 186651 186669 156
Table 4
Comparison of inhibition of HTT mRNA levels by ISIS 387916 and ISIS 388816 with that by chimeric oligonucleotides targeting SNP positions on the HTT gene (SEQ ED NO: 1)
SNP RS Target % inhibition SEQ
ISIS No ID
No. allele GM04281 GM02171 GM02173B NO
387916 n/a n/a 96 96 98 6
388816 n/a n a 76 88 85 7
435330 rs3856973 Major (8) 64 51 36 8
435348 rs3856973 Minor (8) 50 88 80 9
435294 rs3856973 Major (10) 54 46 54 10
435312 rs3856973 Minor (10) 20 82 58 11 435864 rs2285086 Major (10) 54 28 26 12
435889 rs2285086 Minor (10) 17 43 41 13
435878 rs7659144 Major (10) 43 32 39 14
435903 rs7659144 Minor (10) 16 37 29 15
435863 rsl 6843804 Major (10) 63 78 81 16
435888 rsl 6843804 Minor (10) 58 75 77 17
435331 rs2024115 Major (8) 56 27 56 18
435349 rs2024115 Minor (8) 26 91 66 19
435295 rs2024115 Major (10) 53 57 62 20
435313 rs2024115 Minor (10) 25 87 53 21
435862 rsl0015979 Major (10) 8 51 40 22
435887 rsl0015979 Minor (10) 40 22 28 23
435880 rs7691627 Major (10) 43 17 21 24
435905 rs7691627 Minor (10) 13 27 15 25
435885 rs2798235 Major (10) 38 39 30 26
435910 rs2798235 Minor (10) 17 30 16 27
435874 rs4690072 Major (10) 61 34 48 28
435899 rs4690072 Minor (10) 50 41 45 29
435875 rs6446723 Major (10) 28 13 35 30
435900 rs6446723 Minor (10) 24 56 37 31
435332 rs363081 Major (8) 76 95 88 32
435350 rs363081 Minor (8) 27 61 43 33
435296 rs363081 Major (10) 59 77 66 34
435314 rs363081 Minor (10) 38 66 40 35
435886 rs363080 Major (10) 74 72 79 36
435911 rs363080 Minor (10) 57 58 54 37
435914 rs363075 Major (6) 95 92 95 38
435926 rs363075 Minor (6) 88 81 79 39
435916 rs363075 Major (7) 90 92 94 40
435928 rs363075 Minor (7) 83 79 85 41
435333 rs363075 Major (8) 86 97 91 42
435351 rs363075 Minor (8) 59 80 58 43
435918 rs363075 Major (9) 83 90 91 44
435930 rs363075 Minor (9) 29 49 49 45
435297 rs363075 Major (10) 74 84 83 46
435315 rs363075 Minor (10) 47 63 45 47
435920 rs363075 Major (11) 78 66 83 48
435932 rs363075 Minor (11) 39 20 19 49
435366 rs363075 Major (12) 80 91 85 50
435924 rs363075 Minor (12) 37 49 58 51
435922 rs363075 Major (14) 80 90 91 52
435934 rs363075 Minor (14) 63 70 80 53 435334 rs363064 Major (8) 50 59 44 54
435352 rs363064 Minor (8) 12 37 48 55
435298 rs363064 Major (10) 81 92 87 56
435316 rs363064 Minor (10) 69 90 80 57
435335 rs3025849 Major (8) 0 40 37 58
435353 rs3025849 Minor (8) 0 29 18 59
435299 rs3025849 Major (10) 0 34 67 60
435317 rs3025849 Minor (10) 0 38 34 61
435877 rs6855981 Major (10) 31 59 58 62
435902 rs6855981 Minor (10) 0 43 27 63
435336 rs363102 Major (8) 0 21 19 64
435354 rs363102 Minor (8) 0 36 33 65
435300 rs363102 Major (10) 0 34 24 66
435318 rs363102 Minor (10) 0 30 20 67
435884 rsl 1731237 Major (10) 7 46 51 68
435909 rsl 1731237 Minor (10) 30 47 41 69
435337 rs4690073 Major (8) 12 0 12 70
435355 rs4690073 Minor (8) 0 26 33 71
435301 rs4690073 Major (10) 23 0 10 72
435319 rs4690073 Minor (10) 0 45 53 73
435883 rs363144 Major (10) 24 23 39 74
435908 rs363144 Minor (10) 27 20 22 75
435338 rs3025838 Major (8) 31 46 69 76
435356 rs3025838 Minor (8) 3 25 17 77
435302 rs3025838 Major (10) 39 73 67 78
435320 rs3025838 Minor (10) 21 49 32 79
435339 rs363099 Major (8) 84 87 76 80
435357 rs363099 Minor (8) 71 91 90 81
435303 rs363099 Major (10) 83 92 85 82
435321 rs363099 Minor (10) 84 95 89 83
435367 rs363099 Major (12) 76 82 72 84
435340 rs363096 Major (8) 0 47 52 85
435358 rs363096 Minor (8) 0 25 35 86
435304 rs363096 Major (10) 5 33 36 87
435322 rs363096 Minor (10) 2 30 32 88
435341 rs2298967 Major (8) 54 72 56 89
435359 rs2298967 Minor (8) 25 59 63 90
435305 rs2298967 Major (10) 66 80 78 91
435323 rs2298967 Minor (10) 36 79 66 92
435865 rs2298969 Major (10) 53 72 79 93
435890 rs2298969 Minor (10) 65 46 54 94
435876 rs6844859 Major (10) 70 67 77 95 435901 rs6844859 Minor (10) 39 83 80 96
435872 rs363092 Major (10) 46 41 54 97
435897 rs363092 Minor (10) 37 69 57 98
435879 rs7685686 Major (10) 83 31 70 99
435904 rs7685686 Minor (10) 30 92 72 100
435871 rs363088 Major (10) 70 55 70 101
435896 rs363088 Minor (10) 66 74 80 102
435870 rs362331 Major (10) 88 74 88 103
435895 rs362331 Minor (10) 78 92 86 104
435881 rs916171 Major (10) 0 57 51 105
435906 rs916171 Minor (10) 14 26 17 106
435342 rs362322 Major (8) 47 74 67 107
435360 rs362322 Minor (8) 17 58 52 108
435306 rs362322 Major (10) 50 77 65 109
435324 rs362322 Minor (10) 42 61 64 110
435868 rs362275 Major (10) 54 35 43 111
435893 rs362275 Minor (10) 3 27 33 112
435343 rs2276881 Major (8) 59 76 65 113
435361 rs2276881 Minor (8) 58 44 20 114
435307 rs2276881 Major (10) 69 82 81 115
435325 rs2276881 Minor (10) 17 47 43 116
435368 rs2276881 Major (12) 84 96 92 117
435866 rs3121419 Major (10) 67 61 64 118
435891 rs3121419 Minor (10) 53 76 73 119
435344 rs362272 Major (8) 35 46 36 120
435362 rs362272 Minor (8) 34 68 57 121
435308 rs362272 Major (10) 26 30 35 122
435326 rs362272 Minor (10) 29 50 39 123
435369 rs362272 Major (12) 66 74 65 124
435867 rs362271 Major (10) 73 74 75 125
435892 rs362271 Minor (10) 52 74 79 126
435873 rs3775061 Major (10) 40 32 47 127
435898 rs3775061 Minor (10) 13 20 24 128
435345 rs362310 Major (8) 38 55 52 129
435363 rs362310 Minor (8) 45 67 60 130
435309 rs362310 Major (10) 33 44 56 131
435327 rs362310 Minor (10) 33 71 61 132
435915 rs362307 Major (6) 61 54 58 133
435927 rs362307 Minor (6) 31 35 44 134
435917 rs362307 Major (7) 67 76 66 135
435929 rs362307 Minor (7) 33 34 55 136
435346 rs362307 Major (8) 67 89 66 137 435364 rs362307 Minor (8) 46 72 66 138
435919 rs362307 Major (9) 84 79 70 139
435931 rs362307 Minor (9) 74 74 86 140
435310 rs362307 Major (10) 74 81 71 141
435328 rs362307 Minor (10) 47 69 75 142
435921 rs362307 Major (11) 74 77 69 143
435933 rs362307 Minor (11) 38 47 74 144
435370 rs362307 Major (12) 64 74 38 145
435925 rs362307 Minor (12) 60 66 80 146
435923 rs362307 Major (14) 73 66 71 147
435935 rs362307 Minor (14) 68 75 87 148
435869 rs362306 Major (10) 82 77 81 149
435894 rs362306 Minor (10) 28 79 72 150
435347 rs362303 Major (8) 68 74 71 151
435365 rs362303 Minor (8) 69 83 76 152
435311 rs362303 Major (10) 46 56 72 153
435329 rs362303 Minor (10) 49 62 39 154
435882 rs362296 Major (10) 29 48 56 155
435907 rs362296 Minor (10) 42 56 52 156
Example 3: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
Gapmers from the study described in Example 2 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Table 5, 6, and 7. After a treatment period of approximately 16 hours, RNA was isolated from the cells and H7 mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. H7 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC50 values are also provided in Tables 5, 6, and 7.
Table 5
Dose-dependent antisense inhibition of human HTT in GM04281 cells
Figure imgf000078_0001
435330 24 49 50 73 85 2.5
435331 23 38 64 72 74 2.4
435868 3 17 7 29 63 6.7
435870 53 73 77 86 93 0.6
435871 28 51 52 78 89 1.7
435874 14 21 28 64 82 3.3
435879 42 57 57 81 91 1.1
435890 48 56 62 76 91 0.9
435929 10 0 5 12 48 13.8
435931 20 17 53 62 81 2.9
435933 0 7 24 43 49 10.7
435935 0 38 38 62 29 4.2
Table 6
Dose-dependent antisense inhibition of human HTTm GM02171 cells
Figure imgf000079_0001
Table 7
Dose-dependent antisense inhibition of human HTT GM02173B cells
Figure imgf000079_0002
435879 39 44 42 60 64 2.5
435890 38 36 50 65 73 3.1
435929 19 17 19 42 35 7.7
435931 40 19 31 48 71 5.8
435933 35 24 47 52 59 4.4
435935 25 23 40 73 77 3.7
Example 4: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Corieil fibroblast cell lines
Gapmers from the study described in Example 2 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Table 8, 9, and 10. After a treatment period of approximately 16 hours, RNA was isolated from the cells and H7TmRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HTT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of H T mRNA relative to untreated control cells. ½0 values are also provided in Tables 8, 9, and 10.
Table 8
Dose-dependent antisense inhibition of human HTT in GM04281 cells
Figure imgf000080_0001
435931 22 24 40 59 90 3.8
Table 9
Dose-dependent antisense inhibition of human HTTm GM02171 cells
Figure imgf000081_0001
Table 10
Dose-dependent antisense inhibition of human HTTm GM02173B cells
Figure imgf000081_0002
Example 5: Antisense inhibition of human HTT in GM04281 cells
Additional antisense oligonucleotides were designed based on the gapmers selected from studies described in Example 4. These oligonucleotides were designed by creating gapmers shifted slightly upstream and downstream (i.e. "microwalk") of the original gapmers from Tables 8, 9, and 10. Antisense oligonucleotides were also created with uniform MOE, as well as with various motifs, 2-9-6 MOE, 3-9-3 MOE, 3-9-4 MOE, 3-9-5 MOE, 4-10-5 MOE, 4-11-4 MOE, 4-7-4 MOE, 4-9-4 MOE, 4-9-5 MOE, 5-10-4 MOE, 5-7-5 MOE, 5-8-6 MOE, 5-9-3 MOE, 5-9-5 MOE, 6-7-6 MOE, 6-9-2 MOE, and 6-8-5 MOE.
In addition, antisense oligonucleotides were designed targeting SNP RS Nos. rs2857936, rsl2506200, rs762855, and rsl006798 (refer to Table 2). The oligonucleotides were designed targeting either the major allele or the minor allele, and with the SNP position opposite either position 8 or position 10 of the gapmer.
These gapmers were tested in vitro. Cultured GM04281 cells at a density of 25,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real-time PCR. H7 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented in Tables 11-19 as percent inhibition of HTT mRNA, relative to untreated control cells.
The gapmers, ISIS 435869, ISIS 435870, ISIS 435874, ISIS 435879, and ISIS 435890, from which some of the newly designed gapmers were derived are marked with an asterisk (*) in the table. ISIS 387916 was included in the study as a benchmark oligonucleotide against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
The uniform MOE oligonucleotides are 15 nucleotides in length.
The 2-9-6 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 2 nucleotides and on the 3' direction by a wing comprising 6 nucleotides. The 3-9-3 gapmers are 15 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 3 nucleotides each.
The 3-9-4 gapmers are 16 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 3 nucleotides and on the 3' direction by a wing comprising 4 nucleotides.
The 3-9-5 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 3 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
The 4-10-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of ten 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 4 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
The 4-11-4 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of eleven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each.
The 4-7-4 gapmers are 15 nucleotides in length, wherein the central gap segment is comprised of seven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each.
The 4-9-4 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each.
The 4-9-5 gapmers are 18 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 4 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
The 5-10-4 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of ten 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 5 nucleotides and on the 3' direction by a wing comprising 4 nucleotides. The 5-7-5 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of seven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 5 nucleotides each.
The 5-8-6 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of eight 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 5 nucleotides and on the 3' direction by a wing comprising 6 nucleotides.
The 5-9-3 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 5 nucleotides and on the 3' direction by a wing comprising 3 nucleotides.
The 5-9-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 5 nucleotides each.
The 6-7-6 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of seven 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 6 nucleotides each.
The 6-9-2 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 6 nucleotides and on the 3' direction by a wing comprising 2 nucleotides.
The 6-8-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of eight 2'-deoxynucleotides and is flanked on the 5' direction by a wing comprising 6 nucleotides and on the 3' direction by a wing comprising 5 nucleotides.
For each of the motifs, each nucleotide in the 5' wing segment and each nucleotide in the 3' wing segment has a 2'-MOE modification. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each gapmer are 5- methylcytosines.
The oligonucleotides are organized in tables according to the SNP they target. "Start site" indicates the 5'-most nucleotide to which the gapmer is targeted. "Stop site" indicates the 3'-most nucleotide to which the gapmer is targeted. 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele. The number in parentheses indicates the position
oligonucleotide opposite to the SNP position.
Table 11
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2857936 (nucleobases 1952 to 1972 of SEQ ID NO: 1)
Figure imgf000085_0001
Table 12
Comparison of inhibition of human Hr mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rsl2506200 (nucleobases 3695 to 3715 of SEQ Π) NO: 1)
Figure imgf000085_0002
Table 13
Comparison of inhibition of human H JmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs762855 (nucleobases 14437 to 14457 of SEQ Π) NO: 1)
Figure imgf000085_0003
Table 14
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs4690072 (nucleobases 62147 to 62173 of SEQ ID NO: 1)
Figure imgf000086_0001
Table 15
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2298969 (nucleobases 125883 to 125911 of SEQ ID NO: 1)
% SEQ
Start Stop Target
ISIS No. Sequence Motif inhibitio ID Site Site allele
n NO
145466 145485 n/a 387916 TCTCTATTGCACATTCCAAG 5-10-5 98 6
125883 125901 Minor (5) 460166 ATGCTGACTTGGGCCATTC 5-9-5 83 181
125884 125902 Minor (6) 460165 GATGCTGACTTGGGCCATT 5-9-5 88 182
125885 125903 Minor (7) 460164 GGATGCTGACTTGGGCCAT 5-9-5 68 183 125886 125904 Minor (8) 460163 GGGATGCTGACTTGGGCCA 5-9-5 73 184
125887 125905 Minor (9) 460162 AGGGATGCTGACTTGGGCC 5-9-5 88 185
125888 125906 Minor (10) *435890 AAGGGATGCTGACTTGGGC 5-9-5 83 94
125888 125906 Minor (10) 460026 AAGGGATGCTGACTTGGGC 4-10-5 90 94
125888 125906 Minor (10) 460037 AAGGGATGCTGACTTGGGC 4-11-4 86 94
125888 125905 Minor (9) 460068 AGGGATGCTGACTTGGGC 4-9-5 90 186
125888 125906 Minor (10) 460076 AAGGGATGCTGACTTGGGC 5-10-4 90 94
125888 125906 Minor (10) 460096 AAGGGATGCTGACTTGGGC 5-8-6 88 94
125888 125906 Minor (10) 460171 AAGGGATGCTGACTTGGGC 6-7-6 87 94
125888 125906 Minor (10) 460190 AAGGGATGCTGACTTGGGC 6-8-5 69 94
125889 125905 Minor (9) 459983 AGGGATGCTGACTTGGG 2-9-6 80 187
125889 125904 Minor (8) 460005 GGGATGCTGACTTGGG 3-9-4 80 284
125889 125905 Minor (9) 460016 AGGGATGCTGACTTGGG 3-9-5 90 187
125889 125905 Minor (9) 460057 AGGGATGCTGACTTGGG 4-9-4 86 187
125889 125905 Minor (9) 460087 AGGGATGCTGACTTGGG 5-7-5 86 187
125889 125905 Minor (9) 460107 AGGGATGCTGACTTGGG 5-9-3 79 187
125889 125907 Major (11) 460157 CAAGGGATGCTGACTTGGG 5-9-5 88 188
125889 125905 Minor (9) 460181 AGGGATGCTGACTTGGG 6-9-2 62 187
125890 125904 Minor (8) 459972 GGGATGCTGACTTGG Uniform 18 189
125890 125904 Minor (8) 459992 GGGATGCTGACTTGG 3-9-3 90 189
125890 125904 Minor (8) 460046 GGGATGCTGACTTGG 4-7-4 59 189
125890 125908 Major (12) 460158 CCAAGGGATGCTGACTTGG 5-9-5 79 190
125891 125909 Major (13) 460159 GCCAAGGGATGCTGACTTG 5-9-5 82 191
125892 125910 Major (14) 460160 TGCCAAGGGATGCTGACTT 5-9-5 87 192
125893 125911 Major (15) 460161 CTGCCAAGGGATGCTGACT 5-9-5 78 193
Table 16
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs7685686 (nucleobases 146781 to 146809 of SEQ ID NO: 1)
SEQ
Start Stop Target ISIS %
Sequence Motif ID Site Site allele No. inhibition
NO
145466 145485 n/a 387916 TCTCTATTGCACATTCCAAG 5-10-5 98 6
146781 146799 Major (5) 460156 ATTGTCATCACCAGAAAAA 5-9-5 88 194
146782 146800 Major (6) 460155 AATTGTCATCACCAGAAAA 5-9-5 89 195
146783 146801 Major (7) 460154 AAATTGTCATCACCAGAAA 5-9-5 89 196
146784 146802 Major (8) 460153 TAAATTGTCATCACCAGAA 5-9-5 93 197
146785 146803 Major (9) 460152 ATAAATTGTCATCACCAGA 5-9-5 95 198
146786 146804 Major (10) *435879 AATAAATTGTCATCACCAG 5-9-5 94 99
146786 146804 Major (10) 460024 AATAAATTGTCATCACCAG 4-10-5 88 99
146786 146804 Major (10) 460035 AATAAATTGTCATCACCAG 4-11-4 91 99
146786 146803 Major (9) 460065 ATAAATTGTCATCACCAG 4-9-5 96 199
146786 146804 Major (10) 460074 AATAAATTGTCATCACCAG 5-10-4 94 99 146786 146804 Major (10) 460095 AATAAATTGTCATCACCAG 5-8-6 92 99
146786 146804 Major (10) 460170 AATAAATTGTCATCACCAG 6-7-6 91 99
146786 146804 Major (10) 460189 AATAAATTGTCATCACCAG 6-8-5 94 99
146787 146803 Major (9) 459981 ATAAATTGTCATCACCA 2-9-6 85 200
146787 146802 Major (8) 460002 TAAATTGTCATCACCA 3-9-4 86 201
146787 146803 Major (9) 460014 ATAAATTGTCATCACCA 3-9-5 91 200
146787 146803 Major (9) 460055 ATAAATTGTCATCACCA 4-9-4 90 200
146787 146803 Major (9) 460085 ATAAATTGTCATCACCA 5-7-5 94 200
146787 146803 Major (9) 460104 ATAAATTGTCATCACCA 5-9-3 93 200
146787 146805 Major (11) 460147 TAATAAATTGTCATCACCA 5-9-5 91 202
146787 146803 Major (9) 460180 ATAAATTGTCATCACCA 6-9-2 91 200
146788 146802 Major (8) 459970 TAAATTGTCATCACC Uniform 9 203
146788 146802 Major (8) 459990 TAAATTGTCATCACC 3-9-3 67 203
146788 146802 Major (8) 460045 TAAATTGTCATCACC 4-7-4 84 203
146788 146806 Major (12) 460148 TTAATAAATTGTCATCACC 5-9-5 88 204
146789 146807 Major (13) 460149 ATTAATAAATTGTCATCAC 5-9-5 32 205
146790 146808 Major (14) 460150 TATTAATAAATTGTCATCA 5-9-5 29 206
146791 146809 Major (15) 460151 CTATTAATAAATTGTCATC 5-9-5 33 207
Table 17
Comparison of inhibition of human H7TmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362331 (nucleobases 155474 to 155502 of SEQ Π) NO: 1)
SEQ
Start Stop Target %
ISIS No. Sequence Motif ID Site Site allele inhibition
NO
145466 145485 n/a 387916 TCTCTATTGCACATTCCAAG 5-10-5 98 6
155474 155492 Major (5) 460136 CAGTAGATGAGGGAGCAGG 5-9-5 81 208
155475 155493 Major (6) 460135 ACAGTAGATGAGGGAGCAG 5-9-5 84 209
155476 155494 Major (7) 460134 CACAGTAGATGAGGGAGCA 5-9-5 87 210
155477 155495 Major (8) 460133 ACACAGTAGATGAGGGAGC 5-9-5 85 211
155478 155496 Major (9) 460132 CACACAGTAGATGAGGGAG 5-9-5 86 212
155479 155497 Major (10) *435870 GCACACAGTAGATGAGGGA 5-9-5 91 103
155479 155497 Major (10) 460019 GCACACAGTAGATGAGGGA 4-10-5 92 103
155479 155497 Major (10) 460031 GCACACAGTAGATGAGGGA 4-11-4 95 103
155479 155496 Major (9) 460061 CACACAGTAGATGAGGGA 4-9-5 87 213
155479 155497 Major (10) 460071 GCACACAGTAGATGAGGGA 5-10-4 94 103
155479 155497 Major (10) 460090 GCACACAGTAGATGAGGGA 5-8-6 86 103
155479 155497 Major (10) 460168 GCACACAGTAGATGAGGGA 6-7-6 84 103
155479 155497 Major (10) 460187 GCACACAGTAGATGAGGGA 6-8-5 89 103
155480 155496 Major (9) 459977 CACACAGTAGATGAGGG 2-9-6 90 214
155480 155495 Major (8) 459996 ACACAGTAGATGAGGG 3-9-4 37 215
155480 155496 Major (9) 460009 CACACAGTAGATGAGGG 3-9-5 90 214
155480 155496 Major (9) 460051 CACACAGTAGATGAGGG 4-9-4 73 214 155480 155496 Major (9) 460081 CACACAGTAGATGAGGG 5-7-5 77 214
155480 155496 Major (9) 460101 CACACAGTAGATGAGGG 5-9-3 84 214
155480 155498 Major (11) 460127 TGCACACAGTAGATGAGGG 5-9-5 89 216
155480 155496 Major (9) 460178 CACACAGTAGATGAGGG 6-9-2 92 214
155481 155495 Major (8) 459967 ACACAGTAGATGAGG Uniform 81 217
155481 155495 Major (8) 459987 ACACAGTAGATGAGG 3-9-3 18 217
155481 155495 Major (8) 460041 ACACAGTAGATGAGG 4-7-4 54 217
155481 155499 Major (12) 460128 GTGCACACAGTAGATGAGG 5-9-5 73 218
155482 155500 Major (13) 460129 AGTGCACACAGTAGATGAG 5-9-5 86 219
155483 155501 Major (14) 460130 AAGTGCACACAGTAGATGA 5-9-5 60 220
155484 155502 Major (15) 460131 GAAGTGCACACAGTAGATG 5-9-5 73 221
Table 18
Comparison of inhibition of humanH TmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362306 (nucleobases 181739 to 181767 of SEQ ID NO: 1)
SEQ
Start Stop Target %
ISIS No. Sequence Motif ID Site Site allele inhibition
NO
145466 145485 n/a 387916 TCTCTATTGCACATTCCAAG 5-10-5 98 6
181739 181757 Major (5) 460126 GCTGCAACCTGGCAACAAC 5-9-5 87 222
181740 181758 Major (6) 460125 AGCTGCAACCTGGCAACAA 5-9-5 70 223
181741 181759 Major (7) 460123 CAGCTGCAACCTGGCAACA 5-9-5 83 224
181742 181760 Major (8) 460121 GCAGCTGCAACCTGGCAAC 5-9-5 47 225
181743 181761 Major (9) 460118 AGCAGCTGCAACCTGGCAA 5-9-5 75 226
181744 181762 Major (10) *435869 GAGCAGCTGCAACCTGGCA 5-9-5 91 149
181744 181762 Major (10) 460018 GAGCAGCTGCAACCTGGCA 4-10-5 86 149
181744 181762 Major (10) 460028 GAGCAGCTGCAACCTGGCA 4-11-4 89 149
181744 181761 Major (9) 460058 AGCAGCTGCAACCTGGCA 4-9-5 85 227
181744 181762 Major (10) 460069 GAGCAGCTGCAACCTGGCA 5-10-4 91 149
181744 181762 Major (10) 460089 GAGCAGCTGCAACCTGGCA 5-8-6 54 149
181744 181762 Major (10) 460167 GAGCAGCTGCAACCTGGCA 6-7-6 85 149
181744 181762 Major (10) 460186 GAGCAGCTGCAACCTGGCA 6-8-5 84 149
181745 181761 Major (9) 459975 AGCAGCTGCAACCTGGC 2-9-6 86 228
181745 181760 Major (8) 459995 GCAGCTGCAACCTGGC 3-9-4 87 229
181745 181761 Major (9) 460008 AGCAGCTGCAACCTGGC 3-9-5 83 228
181745 181761 Major (9) 460049 AGCAGCTGCAACCTGGC 4-9-4 88 228
181745 181761 Major (9) 460079 AGCAGCTGCAACCTGGC 5-7-5 46 228
181745 181761 Major (9) 460099 AGCAGCTGCAACCTGGC 5-9-3 44 228
181745 181763 Major (11) 460108 AGAGCAGCTGCAACCTGGC 5-9-5 50 230
181745 181761 Major (9) 460177 AGCAGCTGCAACCTGGC 6-9-2 67 228
181746 181760 Major (8) 459966 GCAGCTGCAACCTGG Uniform 26 231
181746 181760 Major (8) 459985 GCAGCTGCAACCTGG 3-9-3 69 231
181746 181760 Major (8) 460039 GCAGCTGCAACCTGG 4-7-4 56 231 181746 181764 Major (12) 460110 AAGAGCAGCTGCAACCTGG 5-9-5 75 232
181747 181765 Major (13) 460113 CAAGAGCAGCTGCAACCTG 5-9-5 36 233
181748 181766 Major (14) 460115 GCAAGAGCAGCTGCAACCT 5-9-5 78 234
181749 181767 Major (15) 460117 TGCAAGAGCAGCTGCAACC 5-9-5 73 235
Table 19
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rsl006798 (nucleobases 198015 to 198035 of SEQ ID NO: 1)
Figure imgf000090_0001
Example 6: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
Gapmers from the studies described in Example 5 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Tables 20, 21, and 22. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real-time PCR. Human HIT primer probe set RTS2617 was used to measure mRNA levels. HT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC50 values are also provided in Tables 20, 21, and 22.
Table 20
Dose-dependent antisense inhibition of human HTT in GM04281 cells
Figure imgf000090_0002
459978 29 33 51 69 86 2.5
459992 14 27 51 54 84 3.2
460012 15 24 54 70 81 3.1
460016 3 36 48 71 77 3.3
460019 54 59 74 87 94 0.7
460026 48 47 71 79 88 0.8
460028 39 38 73 77 87 1.4
460031 44 62 72 87 92 0.9
460033 11 38 52 64 87 3.0
460065 43 54 74 89 96 1.1
460068 47 28 63 76 90 2.6
460069 38 50 65 77 91 1.4
460071 53 61 80 89 93 0.6
460073 16 39 42 58 75 4.0
460076 26 47 54 70 86 2.1
460085 48 60 79 89 94 0.8
460140 6 24 44 44 64 6.6
460142 2 38 46 46 68 4.8
460152 35 61 76 92 94 1.2
460157 51 36 53 74 89 2.6
460162 64 41 71 76 85 2.1
460165 41 50 56 76 84 1.5
Table 21
Dose-dependent antisense inhibition of human HTTm' GM02171 cells
Figure imgf000091_0001
460065 11 16 11 31 53 10.3
460068 15 13 39 44 53 8.8
460069 17 28 37 60 79 3.9
460071 16 36 58 70 88 2.6
460073 5 19 24 33 56 8.7
460076 19 29 44 54 83 3.3
460085 10 15 17 28 31 >12.0
460140 8 22 22 28 47 >12.0
460142 11 24 28 36 38 >12.0
460152 14 21 8 25 44 22
460157 22 21 29 44 66 6.7
460162 24 55 52 62 82 2.8
460165 14 34 50 69 81 3.1
Table 22
Dose-dependent antisense inhibition of human H7Tin GM02173B cells
Figure imgf000092_0001
460152 17 32 35 51 66 5.5
460157 9 34 38 52 74 4.5
460162 22 45 57 65 79 2.5
460165 5 45 52 72 84 3.2
Example 7: Antisense inhibition of human HTT in GM04281 cells and GM02171 cells
Additional antisense oligonucleotides were designed based on the gapmers selected from studies described in Example 2. These oligonucleotides were designed by creating gapmers shifted slightly upstream and downstream (i.e. "microwalk") of the original gapmers from Table 4.
The gapmers were tested in the GM04281 and the GM02171 cell lines. Cultured GM04281 or GM02171 cells at a density of 25,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells andHTT mRNA levels were measured by quantitative real-time PCR using primer probe set RTS2617. HT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition ofHTrmRNA, relative to untreated control cells.
The gapmers, from which the newly designed oligonucleotides were derived, were also included in the assay. These parent gapmers, ISIS 435294, ISIS 435295, ISIS 435301, ISIS 435303, ISIS 435304, ISIS 435305, ISIS 435308, ISIS 435330, ISIS 435331, ISIS 435337, ISIS 435339, ISIS 435340, ISIS 435341, ISIS 435344, ISIS 435862, ISIS 435863, ISIS 435864, ISIS 435866, ISIS 435867, ISIS 435868, ISIS 435871, ISIS 435873, ISIS 435875, ISIS 435876, ISIS 435878, ISIS 435880, ISIS 435881, ISIS 435882, ISIS 435884, ISIS 435890, and ISIS 435897 are marked with an asterisk (*) in the table. ISIS 387916 was included in the study as a benchmark
oligonucleotide against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
The chimeric antisense oligonucleotides in Tables 23-48 were designed as 5-9-5 MOE gapmers. The 5-9-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 5 nucleotides each. Each nucleotide in the 5' wing segment and each nucleotide in the 3' wing segment has a 2' -MOE modification. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each gapmer are 5- methylcytosines. The gapmers are organized in Tables 23-48, according to the SNP site they target. "Start site" indicates the 5 '-most nucleotide to which the gapmer is targeted. "Stop site" indicates the 3'- most nucleotide to which the gapmer is targeted. 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele. The number in parentheses indicates the position on the oligonucleotide opposite to the SNP position.
Table 23
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs3856973 (nucleobases 19815 to 19835 of SEQ Π) NO: 1)
Figure imgf000094_0001
Table 24
Comparison of inhibition of human HJJmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2285086 (nucleobases 28901 to 28921 of SEQ ID NO: 1)
Figure imgf000094_0002
Table 25
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs7659144 (nucleobases 37963 to 37983 of SEQ ID NO: 1)
Figure imgf000094_0003
Table 26
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rsl6843804 (nucleobases 44032 to 44052 of SEQ ID NO: 1)
Figure imgf000095_0001
Table 27
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2024115 (nucleobases 44210 to 44230 of SEQ ID NO: 1)
Figure imgf000095_0002
Table 28
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rsl0015979 (nucleobases 49084 to 49104 of SEQ ID NO: 1)
Figure imgf000095_0003
Table 29
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs7691627 (nucleobases 51052 to 51072 of SEQ Π NO: 1)
% %
SEQ
Start Stop Target inhibition inhibition
ISIS No Sequence ID Site Site allele in in
NO
GM04281 GM02171
145466 145485 387916 n/a TCTCTATTGCACATTCCAAG 100 99 6
51052 51070 476467 Major (8) TAAGAAACACAATCAAAGA 45 21 250 51053 51071 476445 Major (9) ATAAGAAACACAATCAAAG 34 1 251
51054 51072 *435880 Major (10) AATAAGAAACACAATCAAA 68 7 24
Table 30
Comparison of inhibition of human HrJmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs6446723 (nucleobases 66455 to 66475 of SEQ Π) NO: 1)
Figure imgf000096_0001
Table 31
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and a chimeric antisense oligonucleotide targeted to SNP rs363064 (nucleobases 81053 to 81071 of SEQ ID NO: 1)
Figure imgf000096_0002
Table 32
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rsll731237 (nucleobases 91455 to 91475 of SEQ H> NO: 1)
Figure imgf000096_0003
Table 33
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs4690073 (nucleobases 99792 to 99812 of SEQ Π) NO: 1)
Figure imgf000096_0004
99792 99810 *435337 Major (8) CCTAAATCAATCTACAAGT 69 7 70
99793 99811 476446 Major (9) CCCTAAATCAATCTACAAG 61 0 257
99794 99812 •435301 Major (10) TCCCTAAATCAATCTACAA 63 1 72
Table 34
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs34315806 (nucleobases 101676 to 101696 of SEQ ED NO: 1)
Figure imgf000097_0001
Table 35
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs363099 (nucleobases 101698 to 101718 of SEQ ID NO: 1)
Figure imgf000097_0002
Table 36
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs363096 (nucleobases 119663 to 119683 of SEQ ID NO: 1)
Figure imgf000097_0003
Table 37
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2298967 (nucleobases 125389 to 125409 of SEQ Π) NO: 1)
Figure imgf000098_0001
Table 38
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and a chimeric antisense oligonucleotide targeted to SNP rs2298969 (nucleobases 125888 to 125906 of SEQ ID NO: 1)
Figure imgf000098_0002
Table 39
Comparison of inhibition of human H7TmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs6844859 (nucleobases 130128 to 130148 of SEQ ID NO: 1)
Figure imgf000098_0003
Table 40
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs363092 (nucleobases 135671 to 135691 of SEQ Π) NO: 1)
Figure imgf000098_0004
Table 41
Comparison of inhibition of human HTTmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs363088 (nucleobases 149972 to 149992 of SEQ ID NO: 1)
Figure imgf000099_0001
Table 42
Comparison of inhibition of human H7 mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs916171 (nucleobases 156457 to 156477 of SEQ ID NO: 1)
Figure imgf000099_0002
Table 43
Comparison of inhibition of human HTTmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362275 (nucleobases 164244 to 164264 of SEQ ED NO: 1)
Figure imgf000099_0003
Table 44
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362273 (nucleobases 167061 to 167081 of SEQ ED NO: 1)
% %
SEQ
Start Stop Target inhibition inhibition
ISIS No Sequence ID Site Site allele in in
NO
GM04281 GM02171
145466 145485 387916 n a TCTCTATTGCACATTCCAAG 100 99 6
167061 167079 463568 Major (8) TGATCTGTAGCAGCAGCTT 96 78 274 167062 167080 463571 Major (9) TTGATCTGTAGCAGCAGCT 95 86 275
167063 167081 463566 Major (10) GTTGATCTGTAGCAGCAGC 94 78 276
Table 45
Comparison of inhibition of human H7TmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362272 (nucleobases 174622 to 174642 of SEQ ID NO: 1)
Figure imgf000100_0001
Table 46
Comparison of inhibition of human H7TmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362271 (nucleobases 175160 to 175180 of SEQ ID NO: 1)
Figure imgf000100_0002
Table 47
Comparison of inhibition of human HTTmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs3775061 (nucleobases 178396 to 178416 of SEQ Π) NO: 1)
Figure imgf000100_0003
Table 48
Comparison of inhibition of human HTT taRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362296 (nucleobases 186649 to 1786669 of SEQ ID NO: 1)
% %
SEQ
Start Stop Target inhibition inhibition
ISIS No Sequence ID Site Site allele in in
NO
GM04281 GM02171 145466 145485 387916 n a TCTCTATTGCACATTCCAAG 100 99 6
186649 186667 476469 Major (8) GGACAGGGTGTGCTCTCCG 80 58 282
186650 186668 476449 Major (9) GGGACAGGGTGTGCTCTCC 80 64 283
186651 186669 *435882 Major (10) GGGGACAGGGTGTGCTCTC 61 61 155
Example 8: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
Gapmers from the studies described in Example 7 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Tables 49, 50, and 51. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HTrmR A levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC50 values are also provided in Tables 49, 50, and 51.
Table 49
Dose-dependent antisense inhibition of human H7T in GM04281 cells
Figure imgf000101_0001
Table 50
Dose-dependent antisense inhibition of human HTT in GM02171 cells
Figure imgf000102_0001
Table 51
Dose-dependent antisense inhibition of human HTTm GM02171 cells
Figure imgf000102_0002
Example 9: Antisense inhibition of human HTT in GM04281 cells by oligonucleotides designed by microwalk
Additional gapmers were designed based on the gapmers selected from studies described in Example 4. These gapmers were designed by creating gapmers shifted slightly upstream and downstream (i.e. "microwalk") of the original gapmers from Tables 8, 9, and 10. Gapmers were also created with 3-9-3 or 5-9-5 motifs, and with constrained 6(S)-CH3-bicyclic nucleic acid (BNA) molecules at various nucleoside positions.
These gapmers were tested in vitro. Cultured GM04281 cells at a density of 25,000 cells per well were transfected using electroporation with 5,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HTT mR A levels were measured by quantitative real-time PCR. HT mR A levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of H7TmRNA, relative to untreated control cells.
The chimeric antisense oligonucleotides in Tables 52-56 were designed as 3-9-3 or 5-9-5 gapmers. The parent gapmers, ISIS 435869, ISIS 435870, ISIS 435874, ISIS 435879, and ISIS 435890, from which the newly designed gapmers were derived are marked with an asterisk (*) in the table. ISIS 387916 was included in the study as a benchmark oligonucleotide against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
The 3-9-3 gapmers are 15 nucleotides in length, wherein the central gap segment is comprised of nine 2'- deoxynucleosides and is flanked on both 5' and 3' directions by wings comprising 3 sugar modified nucleosides each.
The 5-9-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'- deoxynucleosides and is flanked on both 5' and 3' directions by wings comprising 5 sugar modified nucleosides each.
The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each gapmer are 5-methylcytosines. Bolded and underlined nucleotides in Tables 52-56 indicate the positions of the 6(S)-C¾-BNA molecules (e.g. cEt molecules) in each gapmer. Italicized nucleotides are MOE subunits. "Start site" indicates the 5 '-most nucleotide to which the gapmer is targeted. "Stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted. 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele. The number in parentheses indicates the position on the oligonucleotide opposite to the SNP position.
Table 52
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs4690072 (nucleobases 62147 to 62173 of SEQ ID NO: 1)
Figure imgf000104_0001
Table 53
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2298969 (nucleobases 125884 to 125910 of SEQ ID NO: 1)
Figure imgf000104_0002
Table 54
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs7685686 (nucleobases 146782 to 146808 of SEQ ED NO: 1)
Figure imgf000105_0001
Table 55
Comparison of inhibition of human H7TmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362331 (nucleobases 155475 to 155501 of SEQ ED NO: 1)
Figure imgf000105_0002
Table 56
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362306 (nucleobases 181740 to 181766 of SEQ ED NO: 1)
Figure imgf000105_0003
181746 181760 Major (8) 460206 GCAGCTGCAACCTGG 3-9-3 83 231
181748 181766 Major (14) 460226 GCAAGAGCAGCTGCAACCT 5-9-5 51 234
Example 10: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
Gapmers from studies described in Example 9 were selected and tested at various doses in GM04281, GM02171 and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 312.5 nM, 625 nM, 1,250 nM, 2,500 nM, 5,000 nM and 10,000 nM concentrations of antisense oligonucleotide, as specified in Tables 75, 58, and 59. After a treatment period of approximately 16 hours, RNA was isolated from the cells and H7 mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HTTmRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC50 values are also provided in Tables 57, 58, and 59.
Table 57
Dose-dependent antisense inhibition of human HTT in GM04281 cells
Figure imgf000106_0001
Table 58
Dose-dependent antisense inhibition of human HTT in GM02171 cells
Figure imgf000107_0001
Table 59
Dose-dependent antisense inhibition of human HTT in GM02173B cells
Figure imgf000107_0002
460222 13 19 23 30 35 50 16.1
460231 7 33 25 35 54 77 3.7
460233 11 20 37 52 68 69 2.3
460266 12 6 10 21 25 47 >10.0
Example 11: Dose-dependent antisense inhibition of human HTTm GM04281 and GM02171 cells by oligonucleotides designed by microwalk
Additional gapmers were designed based on the gapmers selected from studies described in
Example 10. These gapmers were designed by creating gapmers shifted slightly upstream and downstream (i.e. "microwalk") of the original gapmers from Tables 57, 58, and 59. Gapmers were also created with 4-9-4 MOE or 5-9-5 MOE motifs, and with constrained 6(S)-CH3-bicyclic nucleic acid (BNA) molecules at various nucleotide positions.
These gapmers were tested in the GM04281 and GM02171 cell lines. Cultured GM04281 or GM02171 cells at a density of 25,000 cells per well were transfected using electroporation with 2,500 nM or 5,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells andH7 mRNA levels were measured by quantitative realtime PCR. HT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition ofH7TmRNA, relative to untreated control cells.
The chimeric antisense oligonucleotides in Tables 60, 61, and 62 were designed as 3-9-3, 4- 9-4, or 5-9-5 MOE gapmers. The parent gapmers, ISIS 435890, ISIS 460210, ISIS 435879, ISIS 460209, ISIS 435870, and ISIS 460207, from which the newly designed gapmers were derived are marked with an asterisk (*) in the table. ISIS 387916 was included in the study as a benchmark oligonucleotide against which the potency of the antisense oligonucleotides targeting nucleotides overlapping each SNP position could be compared.
The 3-9-3 gapmers are 15 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 3 nucleotides each.
The 4-9-4 gapmers are 17 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 4 nucleotides each. The 5-9-5 gapmers are 19 nucleotides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleotides and is flanked on both 5' and 3' directions by wings comprising 5 nucleotides each.
The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each gapmer are 5-methylcytosines. Bolded and underlined nucleotides in Tables 60, 61, and 62 indicate the positions of the 6(S)-CH3-BNA (e.g. cEt molecules)molecules in each gapmer. Italicized nucleotides are MOE subunits.
The gapmers are organized in Tables 60, 61, and 62, according to the SNP site they target. "Start site" indicates the 5'-most nucleotide to which the gapmer is targeted. "Stop site" indicates the 3 '-most nucleotide to which the gapmer is targeted. 'Target allele' indicates whether the gapmer is targeted to the major or the minor allele. The number in parentheses indicates the position on the oligonucleotide opposite to the SNP position.
Table 60
Comparison of inhibition of human HTTmRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs2298969 (nucleobases 125888 to 125907 of SEQ ID NO: 1)
Figure imgf000109_0001
ACTTGGG 5000 51 42
AAGGGATGCTG 2500 5 0
125888 125907 476336 5-9-5 94
ACTTGGGC 5000 43 9
Table 61
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs7685686 (nucleobases 146786 to 146805 of SEQ ID NO: 1)
Figure imgf000110_0001
Table 62
Comparison of inhibition of human HTT mRNA levels by ISIS 387916 and chimeric antisense oligonucleotides targeted to SNP rs362331 (nucleobases 155478 to 155498 of SEQ Π) NO: 1)
% %
SEQ
Start Stop Concentration inhibition inhibition
ISIS No. Sequence Motif ID position position (nM) in in
NO
GM04281 GM02171
TCTCTATTGCAC
145466 145485 387916 5-10-5 5000 57 24 6
ATTCCAAG
GG4G4CAGTAG 2500 19 1
155479 155498 •435870 5-9-5 103
ATGAGGGA 5000 49 34 ACACAGTAGAT 2500 0 0
155481 155495 *460207 3-9-3 217
GAGG 5000 7 8
CACACAGTAGA 2500 35 9
155480 155496 474872 4-9-4 214
TGAGGG 5000 63 37
CACACAGTAGA 2500 43 16
155480 155496 474892 4-9-4 214
TGAGGG 5000 69 31
CACACAGTAGA 2500 16 9
155480 155496 474912 4-9-4 214
TGAGGG 5000 36 6
CACACAGTAGA 2500 22 5
155480 155496 474916 4-9-4 214
TGAGGG 5000 47 7
GCACACAGTAG 2500 19 0
155479 155498 474920 5-9-5 103
ATGAGGGA 5000 43 23
GCACACAGTAG 2500 29 8
155479 155498 474924 5-9-5 103
ATGAGGGA 5000 48 22
CACACAGTAGA 2500 35 7
155480 155496 476334 4-9-4 214
TGAGGG 5000 62 32
GCACACAGTAG 2500 26 9
155479 155498 476338 5-9-5 103
ATGAGGGA 5000 40 4
ACACAGTAGAT 2500 53 9
155479 155495 474873 4-9-4 285
GAGGGA 5000 61 29
ACACAGTAGAT 2500 47 5
155479 155495 474893 4-9-4 285
GAGGGA 5000 59 30
ACACAGTAGAT 2500 30 16
155479 155495 474913 4-9-4 285
GAGGGA 5000 29 17
ACACAGTAGAT 2500 23 12
155479 155495 474917 4-9-4 285
GAGGGA 5000 40 5
CACACAGTAGA 2500 28 0
155478 155497 474921 5-9-5 212
TGAGGGAG 5000 43 23
CACACAGTAGA 2500 30 9
155478 155497 474925 5-9-5 212
TGAGGGAG 5000 61 34
ACACAGTAGAT 2500 35 2
155479 155495 476335 4-9-4 285
GAGGGA 5000 53 31
CACACAGTAGA 2500 15 0
155478 155497 476339 5-9-5 212
TGAGGGAG 5000 34 13
Example 12: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
Gapmers from the studies described in Example 11 were selected and tested at various doses in GM04281, GM02171 and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 625 nM, 1,250 nM, 2,500 nM, 5,000 nM and 10,000 nM concentrations of antisense oligonucleotide, as specified in Tables 63, 64, and 65. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HTTmRNA levels were adjusted according to total RNA content, as measured by RJBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC50 values are also provided in Tables 63, 64, and 65.
Table 63
Dose-dependent antisense inhibition of human HTT in GM04281 cells
Figure imgf000112_0001
Table 64
Dose-dependent antisense inhibition of human HTT in GM02171 cells
Figure imgf000112_0002
474919 44 48 65 71 83 1.1
474922 15 27 49 74 79 2.6
474923 27 53 74 79 84 1.5
476333 42 53 75 76 84 1.0
476334 20 23 58 71 87 2.3
476337 23 34 60 62 75 2.7
Table 65
Dose-dependent antisense inhibition of human HTTm ' GM02173B cells
Figure imgf000113_0001
Example 13: Strategy for selection of antisense oligonucleotides based on potency and selectivity
Gapmers from each of the studies described above were selected for further analysis based on potency and selectivity.
Potency was based on the percent inhibition of HTT rnRNA achieved by the antisense oligonucleotides targeting a SNP compared to the percent inhibition of H7T rnRNA achieved by the benchmark oligonucleotide, ISIS 387916.
Selectivity was based on the ability of the antisense oligonucleotides targeting a SNP to inhibit expression of the major allele and not of the minor allele. The usage of the three cell lines with different genotypes at each SNP position facilitated this process. ISIS 460065 (5 ' - ATAAATTGTCATC ACC AG-3 ' (SEQ ID NO: 199)) is a 4-9-5 MOE gapmer targeted to SNP rs7685686 (major allele A, minor allele G) at position 9 of the
oligonucleotide. The GM04281 cell line is homozygous AA at SNP position rs7685686. The GM02173B cell line is heterozygous AG at SNP position rs7685686. The GM02171 cell line is homozygous GG at SNP position rs7685686. Therefore, selectivity is shown if ISIS 460065 causes potent inhibition ofHTTmRNA in GM04281, less potent inhibition ofHTTmRNA in GM02173, and little to no significant inhibition ofHTTmRNA in GM02171. IC50 values taken from Table 20, 21, and 22, and presented below in Table 66, confirm varying degrees of inhibition in the three cell lines, wherein expression was most reduced in the homozygous AA cell line, moderately reduced in the heterozygous AG cell line, and less reduced in the homozygous GG cell line. IC50 is the concentration of antisense oligonucleotide required for 50 percent inhibitionHTTmRNA. IC50 values are in μΜ.
Table 66
Genotype of the Coriell cell lines for SNP rs7685686 and comparison of inhibition of HTTmRNA by
ISIS 460065 in each cell line
Figure imgf000114_0001
ISIS 459978 (5'-ACAGTGCTACCCAACCT-3' (SEQ ID NO: 174)) is a 2-9-6 MOE gapmer targeted to SNP rs4690072 (major allele T, minor allele G) at position 9 of the
oligonucleotide. The GM04281 cell line is homozygous TT at SNP position rs4690072. The GM02173B cell line is heterozygous TG at SNP position rs4690072. The GM02171 cell line is homozygous GG at SNP position rs4690072. Therefore, selectivity is shown if ISIS 459978 causes potent inhibition ofHTTmRNA in GM04281, less potent inhibition ofHTTmRNA in GM02173, and little to no significant inhibition ofHTTmRNA in GM02171. IC50 values taken from Table 20, 21, and 22, and presented below in Table 67, confirm varying degrees of inhibition in the three cell lines, wherein expression was most reduced in the homozygous TT cell line, moderately reduced in the heterozygous TG cell line, and less reduced in the homozygous GG cell line. IC50 is the concentration of antisense oligonucleotide required for 50 percent inhibitionHT mRNA. IC50 values are in μΜ. Table 67
Genotype of the Coriell cell lines for SNP rs4690072 and comparison of inhibition of HTTmRNA by
ISIS 459978 in each cell line
Figure imgf000115_0001
ISIS 460028 (5 ' -GAGC AGCTGC AACCTGGC A -3' (SEQ ID NO: 149)) is a 4-11-4 MOE gapmer targeted to SNP rs362306 (major allele G, minor allele A) at position 10 of the
oligonucleotide. The GM04281 cell line is homozygous GG at SNP position rs362306. The GM02173B and GM02171 cell lines are heterozygous GA at SNP position rs362306. Therefore, selectivity is shown if ISIS 460028 causes potent inhibition of HTT RNA in GM04281 and less potent inhibition of HTTmRNA in GM02173 and GM02171. IC50 values taken from Table 20, 21, and 22, and presented below in Table 68, confirm varying degrees of inhibition between the GM04281 cell line and the GM02173B and GM02171 cell lines, wherein expression was most reduced in the homozygous GG cell line and less reduced in the heterozygous AG cell line. IC50 is the concentration of antisense oligonucleotide required for 50 percent inhibition H7TmRNA. IC50 values are in μΜ.
Table 68
Genotype of the Coriell cell lines for SNP rs362306 and comparison of inhibition of HTTmRNA by
ISIS 460028 in each cell line
Figure imgf000115_0002
Example 14: Strategy for selection of antisense oligonucleotides with cEt motifs based on potency and selectivity
Gapmers from each of the studies described above were selected for further analysis based on potency and selectivity. Potency was based on the percent inhibition of H7TmRNA achieved by the antisense oligonucleotides targeting a SNP compared to the percent inhibition of HTT mRNA achieved by the benchmark oligonucleotide, ISIS 387916.
Selectivity was based on the ability of the antisense oligonucleotides targeting a SNP to inhibit expression of the major allele and not of the minor allele. The usage of the three cell lines with different genotypes at each SNP position facilitated this process.
ISIS 460209 (5'- TAAATTGTCATCACC -3' (SEQ ID NO: 203)) is a 3-9-3 gapmer with cEt subunits at positions 2, 3, 13, and 14, targeted to SNP rs7685686 (major allele A, minor allele G) at position 8 of the oligonucleotide. The GM04281 cell line is homozygous AA at SNP position rs7685686. The GM02173B cell line is heterozygous AG at SNP position rs7685686. The
GM02171 cell line is homozygous GG at SNP position rs7685686. Therefore, selectivity is shown if ISIS 460209 causes potent inhibition of HTT mRNA in GM04281, less potent inhibition of HTT mRNA in GM02173, and little to no significant inhibition of HTT mRNA in GM02171. IC50 values taken from Table 57, 58, and 59, and presented below in Table 69, confirm varying degrees of inhibition in the three cell lines, wherein expression was most reduced in the homozygous AA cell line, moderately reduced in the heterozygous AG cell line, and less reduced in the homozygous GG cell line. IC50 is the concentration of antisense oligonucleotide required for 50 percent inhibition HTT mRNA. IC50 values are in μΜ.
Table 69
Genotype of the Coriell cell lines for SNP rs7685686 and comparison of inhibition of HTT mRNA by
ISIS 460209 in each cell line
Figure imgf000116_0001
ISIS 460208 (5'- CAGTGCTACCCAACC -3' (SEQ ID NO: 177)) is a 3-9-3 gapmer with cEt subunits at positions 2, 3, 13, and 14, targeted to SNP rs4690072 (major allele T, minor allele G) at position 8 of the oligonucleotide. The GM04281 cell line is homozygous TT at SNP position rs4690072. The GM02173B cell line is heterozygous TG at SNP position rs4690072. The
GM02171 cell line is homozygous GG at SNP position rs4690072. Therefore, selectivity is shown if ISIS 460208 causes potent inhibition of HTT mRNA in GM04281, less potent inhibition of HTT mRNA in GM02173, and little to no significant inhibition of HTT mRNA in GM02171. IC50 values taken from Table 57, 58, and 59, and presented below in Table 70, confirm varying degrees of inhibition in the three cell lines, wherein expression was most reduced in the homozygous TT cell line, moderately reduced in the heterozygous TG cell line, and less reduced in the homozygous GG cell line. IC50 is the concentration of antisense oligonucleotide required for 50 percent inhibition HTT mRNA. IC50 values are in μΜ.
Table 70
Genotype of the Coriell cell lines for SNP rs4690072 and comparison of inhibition of HTT mRNA by
ISIS 460208 in each cell line
Figure imgf000117_0001
ISIS 460206 (5'- GCAGCTGCAACCTGG -3' (SEQ ID NO: 231)) is a 3-9-3 gapmer with cEt subunits at positions 2, 3, 13, and 14, targeted to SNP rs362306 (major allele G, minor allele A) at position 8 of the oligonucleotide. The GM04281 cell line is homozygous GG at SNP position rs362306. The GM02173B and GM02171 cell lines are heterozygous GA at SNP position rs362306. Therefore, selectivity is shown if ISIS 460206 causes potent inhibition of HTT mRNA in GM04281 and less potent inhibition of HTT mRNA in GM02173 and GM02171. IC50 values taken from Table 57, 58, and 59, and presented below in Table 71, confirm varying degrees of inhibition between the GM04281 cell line and the GM02173B and GM02171 cell lines, wherein expression was most reduced in the homozygous GG cell line and less reduced in the heterozygous AG cell line. IC50 is the concentration of antisense oligonucleotide required for 50 percent inhibition HTT mRNA. IC50 values are in μΜ.
Table 71
Genotype of the Coriell cell lines for SNP rs362306 and comparison of inhibition of HTT mRNA by
ISIS 460206 in each cell line
Figure imgf000117_0002
Example 15: Comparison of SNPs in various cell lines and mouse models associated with Huntington's disease
The genotype at various SNP positions associated with Huntington's disease was compared amongst the three Cornell cell lines, used in the above Examples, as well as with the GM04022 fibroblast, the BACHD mouse model and the YAC18 mouse model.
The donor patient of the GM04022 fibroblast cell line was heterozygous at SNP position rs363125 (NCBI Entrez SNP database), harboring an A allele (adenine) and a C allele (cytosine) at nucleotide 5310 of SEQ ID NO: 2 (van Bilsen, P.H.J, et al., Human Gene Therapy.19: 710-718, 2008). YAC18 mice were developed with a YAC transgene containing human huntingtin gene
(Hodgson, et al. Hum. Mol. Genet. 5: 1875-85, 1996). BACHD mice were developed expressing a full-length mutant huntingtin gene with 97 glutamine repeats under the control of a bacterial artificial chromosome (Gray, M. et al., J. Neurosc. 28: 6182-95, 2008). The comparative genotype at the indicated SNP positions in all four cell lines and mouse models is presented in Table 72.
Table 72
Genotypes of the Coriell cell lines and Huntington mouse models
SNP GM02171 GM02173 GM04281 GM04022 BACHD YAC 18 rs3856973 AA AG GG AG GG AA rs2285086 GG AG AA AG AA GG rs7659144 CG CG CC CG CC GG rs 16843804 TC TC CC CC CC TT
rs2024115 GG AG AA AG AA GG rs3733217 CC CC CC CC CC CC rsl0015979 AA AG GG AA AA AA
rs7691627 AA AG GG AG GG AA rs2798235 GG GG GG AG GG GG rs4690072 GG TG TT TG TT GG rs6446723 CC TC TT TC TT CC rs363081 GG GG GG GG GG GG rs363080 CC CC CC TC CC CC rs363075 GG GG GG GG GG GG rs363064 TC TC CC CC CC TT rs3025849 AA AA AA AA AA AA rs363102 AA AA AA AG AA AA rsl 1731237 CC TC TT CC CC CC rs4690073 AA AG GG AG GG AA rs363144 TT TT TT TT TT TT rs3025838 CC CC CC CC CC CC rs34315806 TC TC CC CC CC TT rs363099 TC TC CC CC CC TT rs363096 CC TC TT CC TT CC rs2298967 TC TC TT TT TT CC rs2298969 GG AG AA AG AA GG rs6844859 CC TC TT TC TT CC rs363092 AA AC CC AC AA AA rs7685686 GG AG AA AG AA GG rs363088 TA TA AA AA AA TT rs362331 CC TC TT TC TT CC rs916171 GG GC CC GC CC GG rs362322 AA AA AA AA AA AA rs362275 TC TC CC CC CC TT rs362273 AG AG AA AA AA GG rs2276881 GG GG GG GG GG GG rs3121419 TC TC CC CC CC TT rs362272 — AG GG GG GG AA rs362271 AG AG GG GG GG AA rs3775061 AG AG AA AA AA GG rs362310 TC CC CC TC CC CC rs362307 CC TC CC CC CC CC rs362306 AG AG GG GG GG AA rs362303 TC CC CC TC CC CC rs362296 AC AC AC CC CC AA
Example 16: Allele-specific inhibition measured in BacHD cortical neurons
Antisense oligonucleotides, ISIS 460209 (5 ' -T AAATTGTC ATC ACC-3 ' (SEQ ID NO: 203)), taigeting SNP rs7685686 of human HTT, and ISIS 387916 (TCTCTATTGCACATTCCAAG (SEQ ID NO: 6)), and with no human or murine SNP target site, were tested for their effect on Htt protein levels in vitro. ISIS 387916 is cross-reactive with murine Htt mRNA (GENBANK
Accession No. NM 010414.1, designated herein as SEQ ID NO: 286) at target start site 5763 with one mismatch. ISIS 460209 is cross-reactive with murine Htt mRNA at target start site 6866 with three mismatches. Primary BacHD cortical neurons, which express human Htt and murine Htt, were isolated in the following way: Embryos were dissected from E15.5-E17.5 pregnant females. Cortices were dissected into ice-cold divalent-free Hank's Balanced Salt Solution (Invitrogen, 14025-134). The cortices were chopped into pieces and digested with 0.05% Trypsin-EDTA (Invitrogen, 25300-120) at 37°C for 8 minutes. The digestion was halted by addition of complete neurobasal media
(Invitrogen, 10888-022). Cells were resuspended in media and treated with DNAse I (Invitrogen, 18047-019). After titration through a lOOul pipette tip, cells are resuspended in neurobasal media with B27 supplement (Invitrogen, 17504-044), and counted. 1.7 x 105 cells/well were plated in 24- well plates precoated with poly-D-lysine (BD Biosciences, 354210). Neurons were fed with 200 μΐ neurobasal media with B27 on the second day in vitro.
ISIS 460209 or ISIS 387916 was added to the supplementary media fed to neurons on division 2 at 0.7 μΜ, 1.4 μΜ or 1.5 μΜ final concentrations. Cells were harvested after 8 days with into 1 mL of media using a cell scraper. Cells were centrifuged at 2,500 rpm for 5 min at 4°C and the pellets were resuspended in a buffer of 50 raM Tris, pH = 8.0, 150 mM NaCl, 1% Igepal, 40 mM β-glycerophosphate, lOmM NaF, 1 x Roche complete protease inhibitor, lmM Sodium
Orthovanadate and 800 μΜ PMSF. The lysates were centrifuged after 15 min incubation and protein concentration was measured with the DC assay (BioRad).
Protein lysates were run on low-bis gels to separate huntingtin alleles (resolving gel - 2001:Acrylamide:BIS (10% acrylamide, 0.5% BIS, 375mMTris pH 8.8; stacking gel - 4%Acrylamide-BIS(29:l), 156 mM Tris pH6.8; Running buffer - 25mM Tris, 190mM Glycine, 0.1% SDS + 10μΜ beta-mercaptoethanol added fresh). After electrophoresis, proteins in the gel were transferred to a nitrocellulose membrane (Hybond-C Extra; GE Healthcare Bio-Sciences) at 90V for 40' to allow samples to penetrate the stacking gel and then at 190V for 2.5h to resolve proteins.
Primary antibodies specific for human Htt and murine calnexin protein were used at 1:10,000 dilutions. HRP-conjugated anti-mouse secondary antibody (1:10,000, Jackson
ImmunoResearch Laboratories) was used for visualizing proteins using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). Protein bands were quantified using ImageJ software and normalized to calnexin levels. Protein bands were quantified using ImageJ software. Table 73 provides an estimate of the percentage inhibition relative to the negative control sample. The comparative percent inhibitions of the human Htt protein and the murine Htt protein are presented.
Table 73
Effect of antisense inhibition on mutant human and wild-type murine Htt protein (percent inhibition normalized to PBS control)
Figure imgf000121_0001
Example 17: Dose-dependent antisense inhibition of human huntingtin mRNA levels in Coriell fibroblast cell lines
Gapmers from the studies described in Examples, 3, 4, 10, and 12 were selected and tested at various doses in GM04281, GM02171 and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 0.4747 nM, 1.5011 nM, 4.7463 nM, 15.0079 nM 45.455 nM, 150.0527 nM, 474.4673 nM, 1,500.27 nM, 4,743.833 nM, and 15,000 nM concentrations of antisense oligonucleotide, as specified in Tables 72, 73, and 74. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HIT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of H7 mRNA, relative to untreated control cells. IC50 values are also provided in Tables 72, 73, and 74.
Table 74
Dose-dependent antisense inhibition of human HTT in GM04281 cells
Figure imgf000121_0002
460209 2 9 21 17 36 46 80 89 94 93 0.09
460210 4 7 5 19 20 35 69 85 98 98 0.21
476333 7 10 8 1 1 42 65 86 93 93 95 0.05
Table 75
Dose-dependent antisense inhibition of human HTT x'n GM02171 cells
ISIS 0.4747 1.5011 4.7463 15.007 47.455 150.05 474.46 1500.2 4743.8 15000. ic50 No nM nM nM 9 nM nM 27 nM 73 nM 7 nM 33 nM O nM (μΜ)
387916 22 8 0 9 0 32 60 90 96 97 0.27
435879 0 1 6 2 0 0 8 9 46 57 7.62
435890 0 0 0 6 0 0 0 31 27 71 4.37
460209 11 5 15 0 0 7 30 69 82 88 0.96
460210 0 0 0 2 17 18 38 70 93 95 0.56
476333 0 0 0 0 13 18 44 69 72 91 0.75
Table 76
Dose-dependent antisense inhibition of human HTT in GM02173B cells
ISIS 0.4747 1.5011 4.7463 15.007 47.455 150.05 474.46 1500.2 4743.8 15000. ICso No nM nM nM 9 nM nM 27 nM 73 nM 7 nM 33 nM O nM (μΜ)
387916 3 17 7 25 27 33 65 88 98 99 0.19
435879 0 6 0 8 3 10 16 24 50 68 3.72
435890 0 13 0 1 2 12 16 23 49 82 4.60
460209 0 7 29 2 9 32 52 71 82 86 0.27
460210 0 13 0 5 16 18 49 74 93 97 0.27
476333 11 13 20 7 23 36 63 75 83 90 0.13
Example 18: Validation of the specificity of ISIS oligonucleotides targeting SNPs of human huntingtin by the Molecular Beacon assay
Some of the gapmers from the study described in Example 17 were tested in GM04022 fibroblasts (from the Coriell Institute for Medical Research).
To verify allele-specific suppression of HJ mR A in GM04022 fibroblasts by ISIS
435879, ISIS 460209, and ISIS 476333, the Molecular Beacon assay, as described in the van Bilsen at el publication (van Bilsen, P.H.J, et al., Human Gene Therapy.19: 710-718, 2008), was conducted using 'molecular beacon' synthetic oligonucleotides linked with a fluorophore and quencher.
GM04022 fibroblasts were transfected by electroporation with ISIS 435879, ISIS 460209, or ISIS 476333 at 0.06 μΜ, 0.19 μΜ, 0.56 μΜ, 1.67 μΜ, 5 μΜ and 15 μΜ concentrations of antisense oligonucleotide, as specified in Tables 75-77. ISIS 387916 was included in the assay as a benchmark oligonucleotide. The qRT-PCR assay for molecular beacon for the A allele was conducted with the annealing temperature at 56.5°C. The qRT-PCR assay for molecular beacon for the C allele was conducted with the annealing temperature at 62.0°C. Primer probe set RTS2617 was used to measure the total HTT mRNA reduction. The results of the assay are presented in Tables 77-79 as percent inhibition over the PBS control. The results demonstrate that the SNP-specific ISIS oligonucleotides specifically target the C allele of rs7685686 compared to the A allele (Table 80).
Table 77
Dose-dependent antisense inhibition of the A allele of rs7685686 in GM04022 fibroblasts
Figure imgf000123_0001
Table 78
Dose-dependent antisense inhibition of the C allele of rs7685686 in GM04022 fibroblasts
Figure imgf000123_0002
Table 79
Dose-dependent antisense inhibition of total HTT mRNA in GM04022 fibroblasts
Figure imgf000123_0003
Table 80
ICso ratio (A/C) in GM04022 fibroblasts
ISIS No Ratio
387916 1.0
435879 4.2
460209 2.8
476333 4.3 Example 19: Allele-specific inhibition measured in cortical neurons from BACHD and YAC18 mice.
In order to identify potential SNPs for screening of human allele-specific ISIS
oligonucleotides, the HTrmRNA of YAC18 and BACHD mice were sequenced by the Goldengate 96SNP assay. It was determined that the BAC and YAC mice carried different alleles at several key SNP positions (Table 72) and could therefore be used as a screening tool for allele-specific knockdown. Each of the SNP positions chosen for targeting in the mouse strains were also compared to human HD chromosomes. For each target, approximately 50% of the human HD population is heterozygous for the target expressed in the BACHD mice, but not the YAC 18 mice.
In order to verify the allele-specificity of the ISIS oligonucleotides (described in Examples 2, 9, 17 and 18), the antisense oligonucleotides, ISIS 460207, targeting SNP rs362331; ISIS 460209, targeting SNP rs7685686; ISIS 435879, targeting SNP rs7685686; ISIS 476333, targeting SNP rs7685686; ISIS 460210, targeting SNP rs2298969; ISIS 435874, targeting SNP rs4690072; ISIS 460208, targeting SNP rs4690072; ISIS 435331, targeting SNP rs2024115; and ISIS 435871, targeting SNP rs363088, were tested for their effect on HTT protein levels in BACHD and YAC 18 cortical neurons. ISIS 387916, which has no human or murine SNP target site, was used as the benchmark. ISIS 387916 is cross-reactive with murine H7TmRNA (GENBANK Accession No. NM_010414.1, designated herein as SEQ ID NO: 286) at target start site 5763 with one mismatch. It was expected that treatment with the allele-specific antisense oligonucleotides would cause significant inhibition of HTT mRNA in the BACHD neurons and not in the YAC18 neurons. It was also expected that treatment with ISIS 387916 would cause inhibition of HTT mRNA in both sets of neurons.
YAC 18 cultures were prepared from El 6.5 pregnant female YAC 18 (line 60, +/+) mice who had been bred with YAC 18 (line 60, +/+) males. All progeny are thus homozygous YAC 18 (line 60), facilitating pooled cortical cultures. BACHD E16.5 embryos were isolated from pregnant BACHD (+/-) mice who had been bred with pregnant BACHD (+/-) male mice, necessitating single pup cultures and genotyping. Single cortices were isolated, using caution to prevent cross- contamination of samples. Each dissociated cortex was used to seed 5 wells of a 6-well plate. After genotyping, only BACHD (+/-) cultures were used for ASO treatment. The antisense
oligonucleotides were added to the supplementary media fed to the neurons on division 2. Cells were harvested after 8 days with into 1 mL of media using a cell scraper. Cells were centrifuged at 2,500 rpm for 5 min at 4°C and the pellets were resuspended in a buffer of 50 mM Tris, pH = 8.0, 150 mM NaCl, 1% Igepal, 40 mM β-glycerophosphate, lOmM NaF, 1 x Roche complete protease inhibitor, lmM Sodium Orthovanadate and 800 μΜ PMSF. The lysates were centrifuged after 15 min incubation and protein concentration was measured with the DC assay (BioRad).
Protein lysates were run on low-bis gels to separate huntingtin alleles (resolving gel - 2001 :Acrylamide:BIS (10% acrylamide, 0.5% BIS, 375mMTris pH 8.8; stacking gel - 4%Acrylamide-BIS(29:l), 156 mM Tris pH6.8; Running buffer - 25mM Tris, 190mM Glycine, 0.1% SDS + lOuM beta-mercaptoethanol added fresh). After electrophoresis, proteins in the gel were transferred to a nitrocellulose membrane (Hybond-C Extra; GE Healthcare Bio-Sciences) at 90V for 40' to allow samples to penetrate the stacking gel and then at 190V for 2.5h to resolve proteins.
Primary antibodies specific for human HTT and murine calnexin protein were used at 1:10,000 dilutions. HRP-conjugated anti-mouse secondary antibody (1 :10,000, Jackson
ImmunoResearch Laboratories) was used for visualizing proteins using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). Protein bands were quantified using ImageJ software and normalized to calnexin levels. Tables 81-91 provide the percentage inhibition relative to the untreated control sample. The percentage inhibition of human HTT protein levels in BACHD and YAC18 neurons are presented.
Table 81
HTT SNPs in BACHD and YAC18 mice and correlation with human HTT SNPs
Figure imgf000125_0001
Table 82
Effect of antisense inhibition by ISIS 387916 in BACHD and YAC18 neurons
Figure imgf000126_0001
Table 83
Effect of antisense inhibition by ISIS 435331, targeting rs2024115 in BACHD and YAC18 neurons
Figure imgf000126_0002
Table 84
Effect of antisense inhibition by ISIS 460210, targeting rs2298969 in BACHD and YAC18 neurons
Figure imgf000126_0003
Table 85
Effect of antisense inhibition by ISIS 460207, targeting rs362331 in BACHD and YAC18 neurons
Figure imgf000126_0004
Table 86
Effect of antisense inhibition by ISIS 435871, targeting rs363088 in BACHD and YAC18 neurons
Figure imgf000126_0005
Table 87
Effect of antisense inhibition by ISIS 435874, targeting rs4690072 in BACHD and YAC18 neurons
Figure imgf000126_0006
Table 88
Effect of antisense inhibition by ISIS 460208, targeting rs4690072 in BACHD and YAC18 neurons
Figure imgf000127_0001
Table 89
Effect of antisense inhibition by ISIS 460209, targeting rs7685686 in BACHD and YAC18 neurons
Figure imgf000127_0002
Table 90
Effect of antisense inhibition by ISIS 435879, targeting rs7685686 in BACHD and YAC18 neurons
Figure imgf000127_0003
Table 91
Effect of antisense inhibition by ISIS 476333, targeting rs7685686 in BACHD and YAC18 neurons
Figure imgf000127_0004

Claims

CLAIMS What is claimed is:
1. A compound comprising a modified antisense oligonucleotide consisting of 12 to 30 linked nucleosides targeted to a single nucleotide polymorphism site, wherein the modified oligonucleotide comprises a wing-gap- wing motif with a 5' wing region positioned at the 5' end of a deoxynucleoside gap, and a 3' wing region positioned at the 3' end of the deoxynucleoside gap, wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, or positions 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
2. The compound of claim 1, wherein the single nucleotide polymorphism site is on a mutant allele that is associated with a disease.
3. The compound of claim 1 , wherein the single nucleotide polymorphism site contains a differentiating polymorphism.
4. The compound of claim 1, wherein the modified antisense oligonucleotide consists of 12 to 20 linked nucleosides.
5. The compound of claim 1, wherein the modified antisense oligonucleotide consists of 15 to 20 linked nucleosides.
6. The compound of claim 1, wherein the modified antisense oligonucleotide consists of 15 to 19 linked nucleosides.
7. The compound of any one of claim 1, 4, 5, and 6, wherein position 8, 9, or 10 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, or positions 4, 5, or 6 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
8. The compound of claim 7, wherein the gap region is 7-11 nucleosides in length, the 5' wing region is 1-6 nucleobases in length and the 3' wing region is 1-6 nucleobases in length.
9. The compound of claim 8, wherein the wing-gap- wing motif is any one of the group consisting of 5-10-5, 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-3, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11- 5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, and 6-9-2.
10. The compound of claim 9, wherein the wing-gap- wing motif is any one of the group consisting of 2-9-6, 4-9-5, and 4-11-4.
11. The compound of claim 1 , wherein at least one internucleoside linkage is a modified internucleoside linkage.
12. The compound of claim 2, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
13. The compound of claim 1, wherein at least one nucleoside comprises a modified nucleobase.
14. The compound of claim 5, wherein the modified nucleobase is a 5 '-methylcytosine.
15. The compound of claim 1 , wherein at least one nucleoside of at least one of the wing regions comprises a modified sugar or sugar surrogate.
16. The compound of claim 1 , wherein each of the nucleosides of each wing region comprises a modified sugar or sugar surrogate.
17. The compound of claim 16, wherein the sugar or sugar surrogate is a 2'-0-methoxyethyl modified sugar.
18. The comound of claim 1, wherein at least one of the wing regions comprises a 4' to 2' bicyclic nucleoside and at least one of the remaining wing nucleosides is a non-bicyclic 2'-modified nucleoside.
19. The compound of claim 16, wherein the non-bicyclic 2'-modified nucleoside is a 2'-0- methoxyethyl nucleoside.
20. The compound of claim 1, wherein the 4' to 2' bicyclic nucleoside is 4'-CH(CH3)-0-2' bicyclic nucleoside.
21. The compound of claim 1 , wherein the modified antisense oligonucleotide consists of 17 linked nucleosides and wherein position 9 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
22. The compound of claim 21 , wherein the wing-gap-wing motif is 2-9-6.
23. A compound comprising a modified oligonucleotide consisting of 18 linked nucleosides and 90% complementary to a differentiating polymorphism site, wherein the modified oligonucleotide comprises a wing-gap-wing motif, wherein position 9 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; wherein each nucleoside of each wing segment comprises a 2'-0- methoxyethyl sugar; and wherein the wing-gap- wing motif is 4-9-5.
24. A compound comprising a modified oligonucleotide consisting of 19 linked nucleosides and 90% complementary to a differentiating polymorphism site, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 10 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism; wherein each nucleoside of each wing segment comprises a 2'-0- methoxyethyl sugar; and wherein the wing-gap- wing motif is 4-11-4.
25. A compound comprising:
a modified oligonucleotide consisting of 15 to 19 linked nucleosides and complementary to a differentiating polymorphism site, wherein the modified oligonucleotide comprises a wing- gap-wing motif, wherein position 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism;
and at least one high-affinity sugar modification.
26. The compound of claim 1, wherein the modified oligonucleotide is 100% complementary to the single nucleotide polymorphism site.
27. The compound of claim 1, wherein at least one of the wing regions comprises a high- affinity sugar modification.
28. The comound of claim 27, wherein the high-affinity sugar modification is a bicyclic sugar.
29. The compound of claim 28, wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
30. The compound of claim 25, wherein at least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified
oligonucleotide, comprises the at least one high-affinity sugar modification.
31. The compound of claim 25, wherein at least one of positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises the at least one high-affinity sugar modification.
32. The compound of claim 31, wherein each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprise the at least one high-affinity sugar modification.
33. The compound of claim 32, wherein the high-affinity sugar modification is a bicyclic sugar.
34. The compound of claim 33, wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
35. The compound of claim 25, wherein the wing-gap-wing motif is any of the group consisting of 3-9-3, 4-9-4, and 5-9-5.
36. A compound comprising:
a modified oligonucleotide consisting of 15, 17, or 19 linked nucleosides and fully complementary to a differentiating polymorphism site, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 6, 8, 10, or 14 of the modified
oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism;
and at least one high-affinity sugar modification.
37. The compound of claim 36, wherein at least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified
oligonucleotide, comprises the at least one high-affinity sugar modification.
38. The compound of claim 37, wherein the high-affinity sugar modification is a bicyclic sugar.
39. The compound of claim 38, wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
40. The compound of claim 36, wherein the wing-gap-wing motif is any of the group consisting of 3-9-3, 4-9-4, and 5-95.
41. A compound comprising :
a modified oligonucleotide consisting of 15 linked nucleosides and 90% complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif, wherein position 8 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism;
and at least one high-affinity sugar modification.
42. The compound of claim 41, wherein the modified oligonucleotide is 100%
complementary to the differentiating polymorphism.
43. The compound of claim 4 , wherein each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprise the at least one high-affinity sugar modification.
44. The compound of claim 43, wherein the high-affinity sugar modification is a bicyclic sugar.
45. The compound of claim 44, wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
46. The compound of claim 41 , wherein the wing-gap-wing motif is 3-9-3.
47. A method of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide complementary to a differentiating polymorphism site, wherein the modified oligonucleotide comprises a wing-gap- wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
48. The method of claim 47, wherein the modified oligonucleotide is 90% complementary to the single differentiating polymorphism.
49. The method of claims 47, wherein the modified oligonucleotide is 95% complementary to the single nucleotide polymorphism site.
50. The method of claim 47, wherein the modified oligonucleotide is 100% complementary to the single nucleotide polymorphism site.
51. The method of claim 47, wherein the single nucleotide polymorphism site is from 12 to 30 nucleobases in length.
52. The method of claim 47, wherein the single nucleotide polymorphism site is from 15 to 25 nucleobases in length.
53. The method of claim 47, wherein the single nucleotide polymorphism site is from 17 to 22 nucleobases in length.
54. The method of claim 47, wherein the single nucleotide polymorphism site is 17 nucleobases in length.
55. The method of claim 47, wherein the single nucleotide polymorphism site is 18 nucleobases in length.
56. The method of claim 47, wherein the single nucleotide polymorphism site is 19 nucleobases in length.
57. The method of claim 47, wherein the single nucleotide polymorphism site is 20 nucleobases in length.
58. The method of claim 47, wherein the allelic variant is associated with disease.
59. The method of claim 58, wherein the disease is Huntington's Disease.
60. The method of claim 47, wherein the modified oligonucleotide is a single-stranded oligonucleotide.
61. The method of claim 60, wherein at least one internucleoside linkage is a modified internucleoside linkage.
62. The method of claim 61 , wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
63. The method of claim 60, wherein at least one nucleoside comprises a modified nucleobase.
64. The method of claim 63, wherein the at least one modified nucleobase is a 5'- methylcytosine.
65. The method of claim 60, wherein at least one nucleoside comprises a modified sugar.
66. The method of claim 65, wherein the modified sugar is a high-affinity sugar modification.
67. The method of claim 66, wherein the high-affinity sugar is a bicyclic sugar.
68. The method of claim 67, wherein each bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
69. The method of claim 60, wherein at least one of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, counting from the 5' terminus of the modified oligonucleotide, comprises a nucleoside having a bicyclic sugar wherein the bicyclic sugar comprises a 4'- CH(CH3)-0-2' bridge.
70. The method of claim 69, wherein each of nucleoside positions 2, 3, 13, and 14 of the modified oligonucleotide, counting from the 5' terminus of the modified oligonucleotide, comprises a bicyclic sugar wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
71. The method of claim 65, wherein the at least one modified sugar comprises a 2'-0- methoxyethyl.
72. The method of claim 71, wherein each nucleoside positioned in a wing segment of the modified oligonucleotide comprises a 2'-0-methoxyethyl modification.
73. The method of claim 47, wherein the wing-gap- wing motif is any of the group consisting of 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9- 5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, and 6-9-2.
74. The method of claim 47, wherein the modified oligonucleotide is not a ribozyme, a double stranded siR A, or an shRNA.
75. The method of claim 47, wherein the single nucleotide polymorphism site is on a mutant allele that is associated with disease.
76. The method of claim 47, wherein the single nucleotide polymorphism site contains a differentiating polymorphism.
The method of claim 47, wherein the modified antisense oligonucleotide consists of 12 to
78. The method of claim 47, wherein the modified antisense oligonucleotide consists of 15 to 19 linked nucleosides.
79. The method of claim 47, wherein the gap region is 7 to 11 nucleosides in length, the 5' wing region is 1 to 6 nucleobases in length and 3' wing region is 1 to 6 nucleobases in length.
80. The method of claim 47, wherein at least one nucleoside of at least one of the wing regions comprises a modified sugar or sugar surrogate.
81. The method of claim 47, wherein each of the nucleosides of each wing region comprises a modified sugar or sugar surrogate.
82. The method of claim 81, wherein the sugar or sugar surrogate is a 2'-0-methoxyethyl modified sugar.
83 The method of claim 47, wherein at least one of the wing regions comprises a 4' to 2' bicyclic nucleoside and at least one of the remaining wing nucleosides is a non-bicyclic 2'- modified nucleoside.
84. The method of claim 81, wherein the non-bicyclic 2'-modified nucleoside is a 2'-0- methoxyethyl nucleoside.
85. The method of claim 47, wherein the 4' to 2' bicyclic nucleoside is a 4'-CH(CH3)-0-2' bicyclic nucleoside.
86. A method of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism.
87. A method of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and complementary to a differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap-wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide aligns with the differentiating polymorphism; and wherein the allelic variant is a mutant allele.
88. The method of claim 81, wherein the mutant allele is associated with any disease from the group consisting of Alzheimer's disease, Creutzfeldt- Jakob disease, fatal familial insomnia, Alexander disease, Parkinson's disease, amyotrophic lateral sclerosis, dentato-rubral and pallido- luysian atrophy DRPA, spino-cerebellar ataxia, Torsion dystonia, cardiomyopathy, chronic obstructive pulmonary disease (COPD), liver disease, hepatocellular carcinoma, systemic lupus erythematosus, hypercholesterolemia, breast cancer, asthma, Type 1 diabetes, Rheumatoid arthritis, Graves disease, SLE, spinal and bulbar muscular atrophy, Kennedy's disease, progressive childhood posterior subcapsular cataracts, cholesterol gallstone disease,
arthrosclerosis, cardiovascular disease, primary hypercalciuria, alpha-thallasemia, obsessive compulsive disorder, Anxiety, comorbid depression, congenital visual defects, hypertension, metabolic syndrome, prostate cancer, congential myasthenic syndrome, peripheral arterial disease, atrial fibrillation, sporadic pheochromocytoma, congenital malformations, Machado- Joseph disease, Huntington's disease, and Autosomal Dominant Retinitis Pigmentosa disease.
89. A method of treating Huntington's Disease, comprising selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and complementary to differentiating polymorphism, wherein the modified oligonucleotide comprises a wing-gap- wing motif and wherein position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with differentiating polymorphism; and wherein the allelic variant is associated with Huntington's Disease.
90. The method of any one of claims 47, 86, 87, and 89, wherein position 8, 9, or 10 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, or positions 4, 5, or 6 of the modified oligonucleotide, as counted from the 5' terminus of the gap, aligns with the single nucleotide polymorphism.
91. A compound comprising:
a modified oligonucleotide consisting of 15 to 19 linked nucleosides and complementary to a differentiating polymorphism site, wherein the nucleoside at position 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, aligns with the differentiating polymorphism;
and wherein the nucleoside at at least one of positions 2, 3, 6, 9, 10, 11, 13, or 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises a high-affinity sugar modification.
92. The compound of claim 91 , wherein the nucleoside that aligns with the differentiating polymorphism comprises a high-affinity sugar modification.
93. The compound of claim 91 or 92, wherein the nucleoside immediately adjacent to and at the 5 '-side of the nucleoside that aligns with the differentiating polymorphism comprises a high- affinity sugar modification.
94. The compound of any one of claims 91-93, wherein the nucleoside immediately adjacent to and at the 3 '-side of the nucleoside that aligns with the differentiating polymorphism comprises a high-affinity sugar modification.
95. The compound of claim 91, wherein the modified oligonucleotide is 100%
complementary to the single nucleotide polymorphism site.
96. The comound of claim 91 , wherein the high-affimty sugar modification is a bicyclic sugar.
97. The compound of claim 96, wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
98. The compound of claim 91, wherein the nucleoside at at least one of positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises a high-affinity sugar modification.
99. The compound of claim 98, wherein each of nucleosides at positions 2, 3, 13, and 14 of the modified oligonucleotide, as counted from the 5' terminus of the modified oligonucleotide, comprises a high-affinity sugar modification.
100. The compound of claim 99, wherein the high-affinity sugar modification is a bicyclic sugar.
101. The compound of claim 100, wherein the bicyclic sugar comprises a 4'-CH(CH3)-0-2' bridge.
102. A method of selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism in a cell, tissue, or animal, comprising administering to the cell, tissue, or animal a compound according to any of claims 91-101.
PCT/US2011/024103 2010-02-08 2011-02-08 Selective reduction of allelic variants WO2011097643A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
CA2789005A CA2789005A1 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
JP2012552932A JP6006120B2 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
EP17206749.8A EP3321361B1 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
EP11740542.3A EP2534248B1 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
EP19164928.4A EP3561060A1 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
US13/577,616 US8957040B2 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
AU2011213562A AU2011213562B2 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
DK11740542.3T DK2534248T3 (en) 2010-02-08 2011-02-08 SELECTIVE REDUCTION OF ALLELVARIANS
IL221272A IL221272A (en) 2010-02-08 2012-08-02 Selective reduction of allelic variants
US14/581,235 US20150329859A1 (en) 2010-02-08 2014-12-23 Selective reduction of allelic variants
AU2016234914A AU2016234914B2 (en) 2010-02-08 2016-09-28 Selective reduction of allelic variants
IL254191A IL254191B (en) 2010-02-08 2017-08-28 Selective reduction of allelic variants
US15/961,567 US20190002877A1 (en) 2010-02-08 2018-04-24 Selective reduction of allelic variants
AU2018260866A AU2018260866A1 (en) 2010-02-08 2018-11-07 Selective reduction of allelic variants
US17/577,832 US12110491B2 (en) 2010-02-08 2022-01-18 Selective reduction of allelic variants

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US30246910P 2010-02-08 2010-02-08
US61/302,469 2010-02-08
US37163510P 2010-08-06 2010-08-06
US61/371,635 2010-08-06

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/577,616 A-371-Of-International US8957040B2 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants
US14/581,235 Continuation US20150329859A1 (en) 2010-02-08 2014-12-23 Selective reduction of allelic variants

Publications (1)

Publication Number Publication Date
WO2011097643A1 true WO2011097643A1 (en) 2011-08-11

Family

ID=44355846

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/024103 WO2011097643A1 (en) 2010-02-08 2011-02-08 Selective reduction of allelic variants

Country Status (9)

Country Link
US (4) US8957040B2 (en)
EP (3) EP3561060A1 (en)
JP (4) JP6006120B2 (en)
AU (3) AU2011213562B2 (en)
CA (1) CA2789005A1 (en)
DK (1) DK2534248T3 (en)
ES (1) ES2733708T3 (en)
IL (2) IL221272A (en)
WO (1) WO2011097643A1 (en)

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012109395A1 (en) * 2011-02-08 2012-08-16 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013138353A3 (en) * 2012-03-12 2013-11-14 Santaris Pharma A/S Compositions and methods for modulation of atxn3 expression
WO2014059356A2 (en) 2012-10-12 2014-04-17 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP2742056A1 (en) * 2011-08-11 2014-06-18 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
WO2014121287A2 (en) 2013-02-04 2014-08-07 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
US10479995B2 (en) 2015-07-22 2019-11-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
EP3452596A4 (en) * 2016-05-04 2020-03-18 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2021084495A1 (en) 2019-11-01 2021-05-06 Novartis Ag The use of a splicing modulator for a treatment slowing progression of huntington's disease
US11293025B2 (en) 2015-09-25 2022-04-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating Ataxin 3 expression
US11382918B2 (en) 2017-06-28 2022-07-12 Ptc Therapeutics, Inc. Methods for treating Huntington's Disease
US11395822B2 (en) 2017-06-28 2022-07-26 Ptc Therapeutics, Inc. Methods for treating Huntington's disease
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
US11407753B2 (en) 2017-06-05 2022-08-09 Ptc Therapeutics, Inc. Compounds for treating Huntington's disease
US11434488B2 (en) 2018-05-09 2022-09-06 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
WO2022189363A1 (en) * 2021-03-08 2022-09-15 Les Laboratoires Servier Antisense oligonucleotides for inhibiting alpha-synuclein expression
WO2022208170A1 (en) 2021-03-29 2022-10-06 Novartis Ag The use of the splicing modulator brataplam for slowing progression of huntington's disease
US11583548B2 (en) 2016-11-10 2023-02-21 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
US11638706B2 (en) 2015-12-10 2023-05-02 Ptc Therapeutics, Inc. Methods for treating Huntington's disease
US11780839B2 (en) 2018-03-27 2023-10-10 Ptc Therapeutics, Inc. Compounds for treating Huntington's disease
US11820985B2 (en) 2019-03-26 2023-11-21 University Of Massachusetts Modified oligonucleotides with increased stability
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs
EP4010476A4 (en) * 2019-08-09 2023-12-27 University Of Massachusetts Chemically modified oligonucleotides targeting snps
US11858941B2 (en) 2018-06-27 2024-01-02 Ptc Therapeutics, Inc. Heterocyclic and heteroaryl compounds for treating Huntington's disease
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
US12049627B2 (en) 2017-06-23 2024-07-30 University Of Massachusetts Two-tailed self-delivering siRNA
US12077755B2 (en) 2015-08-14 2024-09-03 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011097643A1 (en) 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
WO2013148260A1 (en) 2012-03-30 2013-10-03 Washington University Methods for modulating tau expression for reducing seizure and modifying a neurodegenerative syndrome
WO2014078749A1 (en) * 2012-11-15 2014-05-22 The Regents Of The University Of California Splice modulating oligonucleotides that inhibit cancer
EP2971142B1 (en) * 2013-03-14 2020-06-24 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating tau expression
TWI657819B (en) 2013-07-19 2019-05-01 美商Ionis製藥公司 Compositions for modulating tau expression
GB201410693D0 (en) 2014-06-16 2014-07-30 Univ Southampton Splicing modulation
CA2963288A1 (en) 2014-10-03 2016-04-07 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
US10196639B2 (en) 2015-10-09 2019-02-05 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US10370667B2 (en) 2015-11-18 2019-08-06 Rosalind Franklin University Of Medicine And Science Antisense compounds targeting leucine-rich repeat kinase 2 (LRRK2) for the treatment of parkinsons disease
EP3377629B1 (en) 2015-11-18 2023-07-05 Rosalind Franklin University of Medicine and Science Antisense compounds targeting leucine-rich repeat kinase 2 (lrrk2) for the treatment of parkinsons disease
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
EP3390636B1 (en) 2015-12-14 2021-05-19 Cold Spring Harbor Laboratory Antisense oligomers for treatment of dravet syndrome
JOP20190065A1 (en) 2016-09-29 2019-03-28 Ionis Pharmaceuticals Inc Compounds and methods for reducing tau expression
WO2019040923A1 (en) 2017-08-25 2019-02-28 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
MX2020011695A (en) 2018-05-04 2021-02-26 Stoke Therapeutics Inc Methods and compositions for treatment of cholesteryl ester storage disease.
WO2021178374A2 (en) * 2020-03-05 2021-09-10 Synerk Inc. Compounds and methods for reducing apoe expression
EP4150092A1 (en) 2020-05-11 2023-03-22 Stoke Therapeutics, Inc. Opa1 antisense oligomers for treatment of conditions and diseases
WO2024173719A1 (en) * 2023-02-15 2024-08-22 Ascidian Therapeutics, Inc. Htt trans-splicing molecules

Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2699508A (en) 1951-12-21 1955-01-11 Selectronics Inc Method of mounting and construction of mounting for low frequency piezoelectric crystals
US2699808A (en) 1944-10-06 1955-01-18 Mark W Lowe Apparatus for peeling tomatoes
WO1994014226A1 (en) 1992-12-14 1994-06-23 Honeywell Inc. Motor system with individually controlled redundant windings
US5656408A (en) 1996-04-29 1997-08-12 Xerox Corporation Coated carrier particles
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
WO2005021570A1 (en) 2003-08-28 2005-03-10 Gene Design, Inc. Novel artificial nucleic acids of n-o bond crosslinkage type
US20060063730A1 (en) * 2004-09-17 2006-03-23 Monia Brett P Enhanced antisense oligonucleotides
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008143774A2 (en) 2007-05-01 2008-11-27 University Of Massachusetts Methods and compositions for locating snp heterozygosity for allele specific diagnosis and therapy
WO2008147930A2 (en) 2007-05-23 2008-12-04 Medtronic, Inc. Methods and kits for linking polymorphic sequences to expanded repeat mutations
WO2009135322A1 (en) 2008-05-09 2009-11-12 The Universtity Of British Columbia Methods and compositions for the treatment of huntington's disease
US20090318536A1 (en) * 2006-11-27 2009-12-24 Iss Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
US8623108B2 (en) 2009-01-14 2014-01-07 Boehler Edelstahl Gmbh & Co Kg Wear-resistant material
US9778708B1 (en) 2016-07-18 2017-10-03 Lenovo Enterprise Solutions (Singapore) Pte. Ltd. Dual sided latching retainer for computer modules
US9984408B1 (en) 2012-05-30 2018-05-29 Amazon Technologies, Inc. Method, medium, and system for live video cooperative shopping

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6331617B1 (en) 1996-03-21 2001-12-18 University Of Iowa Research Foundation Positively charged oligonucleotides as regulators of gene expression
US5898031A (en) 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
WO2000052210A2 (en) 1999-03-01 2000-09-08 Variagenics, Inc. Methods for targeting rna molecules
US6753422B2 (en) 1999-03-01 2004-06-22 O'brien Thomas G. Odc allelic analysis method for assessing carcinogenic susceptibility
ATE356824T1 (en) 1999-05-04 2007-04-15 Santaris Pharma As L-RIBO-LNA ANALOGUE
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US20020187931A1 (en) 2000-04-13 2002-12-12 Michael Hayden Modulating cell survival by modulating huntingtin function
CA2452458A1 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
AU2002326589B2 (en) 2001-08-07 2008-06-05 University Of Delaware Compositions and methods for the prevention and treatment of Huntington's disease
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
DK2284266T3 (en) 2002-11-14 2014-01-13 Thermo Fisher Scient Biosciences Inc SIRNA MOLECULE MOD TP53
EP2821085B1 (en) * 2003-09-12 2020-04-29 University of Massachusetts Rna interference for the treatment of gain-of-function disorders
WO2005027962A1 (en) 2003-09-18 2005-03-31 Isis Pharmaceuticals, Inc. 4’-thionucleosides and oligomeric compounds
US20050176045A1 (en) 2004-02-06 2005-08-11 Dharmacon, Inc. SNP discriminatory siRNA
JP2008501693A (en) * 2004-06-03 2008-01-24 アイシス ファーマシューティカルズ、インク． Double-stranded composition with individually regulated strands for use in gene regulation
WO2007002904A2 (en) 2005-06-28 2007-01-04 Medtronic, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
PL3210633T3 (en) 2006-01-26 2019-12-31 Ionis Pharmaceuticals, Inc. Compositions and their uses directed to huntingtin
JP2009536222A (en) 2006-05-05 2009-10-08 アイシス ファーマシューティカルズ， インコーポレーテッド Compounds and methods for modulating the expression of PCSK9
CA2662704A1 (en) * 2006-07-07 2008-01-10 University Of Massachusetts Rna silencing compositions and methods for the treatment of huntington's disease
DK2092065T4 (en) 2006-10-18 2019-10-21 Ionis Pharmaceuticals Inc The antisense compounds
US8084437B2 (en) * 2006-11-27 2011-12-27 Isis Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
CA2688321A1 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
EP2173760B2 (en) 2007-06-08 2015-11-04 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
DE602007005629D1 (en) 2007-06-18 2010-05-12 Commissariat Energie Atomique Reversible siRNA silencing of a mutated and endogenous HD wild-type gene and its use in the treatment of Huntington's disease
ES2376507T5 (en) 2007-07-05 2015-08-31 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
EP2447274B1 (en) 2008-10-24 2017-10-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds and methods
JP6018506B2 (en) 2010-02-08 2016-11-02 アイオーニス ファーマシューティカルズ， インコーポレーテッドＩｏｎｉｓ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ，Ｉｎｃ． Selective reduction of allelic variants
WO2011097643A1 (en) 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
CN103154014B (en) 2010-04-28 2015-03-25 Isis制药公司 Modified nucleosides, modified nucleosides-like and oligomeric compounds prepared therefrom
EP3067421B1 (en) 2011-02-08 2018-10-10 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP2742056B2 (en) 2011-08-11 2020-06-10 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP2839006B1 (en) 2012-04-20 2018-01-03 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP2841579B1 (en) 2012-04-25 2018-10-10 Regulus Therapeutics Inc. Microrna compounds and methods for modulating mir-21 activity
EP2906699A4 (en) 2012-10-11 2016-06-08 Ionis Pharmaceuticals Inc Oligomeric compounds comprising bicyclic nucleosides and uses thereof
CA2887884A1 (en) 2012-10-12 2014-04-17 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
WO2014121287A2 (en) 2013-02-04 2014-08-07 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US11332733B2 (en) 2018-02-12 2022-05-17 lonis Pharmaceuticals, Inc. Modified compounds and uses thereof

Patent Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2699808A (en) 1944-10-06 1955-01-18 Mark W Lowe Apparatus for peeling tomatoes
US2699508A (en) 1951-12-21 1955-01-11 Selectronics Inc Method of mounting and construction of mounting for low frequency piezoelectric crystals
WO1994014226A1 (en) 1992-12-14 1994-06-23 Honeywell Inc. Motor system with individually controlled redundant windings
US5656408A (en) 1996-04-29 1997-08-12 Xerox Corporation Coated carrier particles
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US20080039618A1 (en) 2002-11-05 2008-02-14 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
WO2005021570A1 (en) 2003-08-28 2005-03-10 Gene Design, Inc. Novel artificial nucleic acids of n-o bond crosslinkage type
US20060063730A1 (en) * 2004-09-17 2006-03-23 Monia Brett P Enhanced antisense oligonucleotides
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US20070287831A1 (en) 2006-05-11 2007-12-13 Isis Pharmaceuticals, Inc 5'-modified bicyclic nucleic acid analogs
US20090318536A1 (en) * 2006-11-27 2009-12-24 Iss Pharmaceuticals, Inc. Methods for treating hypercholesterolemia
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008143774A2 (en) 2007-05-01 2008-11-27 University Of Massachusetts Methods and compositions for locating snp heterozygosity for allele specific diagnosis and therapy
WO2008147930A2 (en) 2007-05-23 2008-12-04 Medtronic, Inc. Methods and kits for linking polymorphic sequences to expanded repeat mutations
WO2009135322A1 (en) 2008-05-09 2009-11-12 The Universtity Of British Columbia Methods and compositions for the treatment of huntington's disease
US8623108B2 (en) 2009-01-14 2014-01-07 Boehler Edelstahl Gmbh & Co Kg Wear-resistant material
US9984408B1 (en) 2012-05-30 2018-05-29 Amazon Technologies, Inc. Method, medium, and system for live video cooperative shopping
US9778708B1 (en) 2016-07-18 2017-10-03 Lenovo Enterprise Solutions (Singapore) Pte. Ltd. Dual sided latching retainer for computer modules

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"Huntington's Disease Collaborative Research Group", CELL, vol. 72, no. 6, 1993, pages 971 - 83
ADV EXP MED BIOL., vol. 613, 2008, pages 203
ADV. APPL. MATH., vol. 2, 1981, pages 482 489
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 410
BRAIN RES., vol. 877, 2000, pages 379
CELL, vol. 130, 2007, pages 427
DRAGATSIS ET AL., NAT. GENET, vol. 26, 2000, pages 300 - 306
FREIER ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 4429 - 4443
GENE, vol. 234, 1999, pages 177
GENE, vol. 371, 2006, pages 68
GENOME RES., vol. 10, 2000, pages 895
J. CLIN. INVEST., vol. 111, 2003, pages 145
J. NEUROSCI., vol. 26, 2006, pages 111623
LOMBARDI ET AL., J EXP NEUROL, vol. 217, 2009, pages 312 - 319
NASIR ET AL., CELL, vol. 81, no. 5, 1995, pages 811 - 23
NAT. MED., vol. 3, 1997, pages 1009
NEUROMOL MED., vol. 4, 2007, pages 73
NEW ENGL J MED., vol. 346, 2002, pages 45
PROTEIN SCI., vol. 12, 2003, pages 953
SCIENCE, vol. 281, 1998, pages 1851
See also references of EP2534248A4
TRENDS BIOTECHNOL., vol. 18, 2000, pages 77
TRENDS MOL. MED., vol. 7, 2001, pages 479
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 656

Cited By (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
WO2012109395A1 (en) * 2011-02-08 2012-08-16 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP3067421A1 (en) * 2011-02-08 2016-09-14 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP3467109A1 (en) * 2011-02-08 2019-04-10 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US10017764B2 (en) 2011-02-08 2018-07-10 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
EP2742056A1 (en) * 2011-08-11 2014-06-18 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US11732261B2 (en) 2011-08-11 2023-08-22 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP2742056B1 (en) 2011-08-11 2017-01-11 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP3205725A1 (en) * 2011-08-11 2017-08-16 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP2742056A4 (en) * 2011-08-11 2015-03-25 Isis Pharmaceuticals Inc Selective antisense compounds and uses thereof
EP3556859A1 (en) * 2011-08-11 2019-10-23 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
WO2013138353A3 (en) * 2012-03-12 2013-11-14 Santaris Pharma A/S Compositions and methods for modulation of atxn3 expression
EP2839006A4 (en) * 2012-04-20 2015-12-16 Isis Pharmaceuticals Inc Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US9914922B2 (en) 2012-04-20 2018-03-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
EP3336189A1 (en) * 2012-04-20 2018-06-20 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US11566245B2 (en) 2012-04-20 2023-01-31 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
WO2014059356A2 (en) 2012-10-12 2014-04-17 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP4086347A3 (en) * 2012-10-12 2023-01-11 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP3459549A1 (en) * 2012-10-12 2019-03-27 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US11236335B2 (en) 2012-10-12 2022-02-01 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP2906256A4 (en) * 2012-10-12 2016-08-10 Ionis Pharmaceuticals Inc Selective antisense compounds and uses thereof
WO2014059356A3 (en) * 2012-10-12 2015-07-16 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
WO2014121287A2 (en) 2013-02-04 2014-08-07 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
WO2014121287A3 (en) * 2013-02-04 2014-10-23 Isis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US10260069B2 (en) 2013-02-04 2019-04-16 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
EP3778618A1 (en) * 2013-02-04 2021-02-17 Ionis Pharmaceuticals, Inc. Selective antisense compounds and uses thereof
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10479995B2 (en) 2015-07-22 2019-11-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US12077755B2 (en) 2015-08-14 2024-09-03 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
US11293025B2 (en) 2015-09-25 2022-04-05 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating Ataxin 3 expression
US11638706B2 (en) 2015-12-10 2023-05-02 Ptc Therapeutics, Inc. Methods for treating Huntington's disease
US11896669B2 (en) 2016-01-31 2024-02-13 University Of Massachusetts Branched oligonucleotides
EP3452596A4 (en) * 2016-05-04 2020-03-18 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US10724035B2 (en) 2016-05-04 2020-07-28 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11583548B2 (en) 2016-11-10 2023-02-21 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
US11407753B2 (en) 2017-06-05 2022-08-09 Ptc Therapeutics, Inc. Compounds for treating Huntington's disease
US12049627B2 (en) 2017-06-23 2024-07-30 University Of Massachusetts Two-tailed self-delivering siRNA
US11395822B2 (en) 2017-06-28 2022-07-26 Ptc Therapeutics, Inc. Methods for treating Huntington's disease
US11382918B2 (en) 2017-06-28 2022-07-12 Ptc Therapeutics, Inc. Methods for treating Huntington's Disease
US12103926B2 (en) 2018-03-27 2024-10-01 Ptc Therapeutics, Inc. Compounds for treating huntington's disease
US11780839B2 (en) 2018-03-27 2023-10-10 Ptc Therapeutics, Inc. Compounds for treating Huntington's disease
US11434488B2 (en) 2018-05-09 2022-09-06 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
US11858941B2 (en) 2018-06-27 2024-01-02 Ptc Therapeutics, Inc. Heterocyclic and heteroaryl compounds for treating Huntington's disease
US11827882B2 (en) 2018-08-10 2023-11-28 University Of Massachusetts Modified oligonucleotides targeting SNPs
US11820985B2 (en) 2019-03-26 2023-11-21 University Of Massachusetts Modified oligonucleotides with increased stability
EP4010476A4 (en) * 2019-08-09 2023-12-27 University Of Massachusetts Chemically modified oligonucleotides targeting snps
WO2021084495A1 (en) 2019-11-01 2021-05-06 Novartis Ag The use of a splicing modulator for a treatment slowing progression of huntington's disease
WO2022189363A1 (en) * 2021-03-08 2022-09-15 Les Laboratoires Servier Antisense oligonucleotides for inhibiting alpha-synuclein expression
WO2022208170A1 (en) 2021-03-29 2022-10-06 Novartis Ag The use of the splicing modulator brataplam for slowing progression of huntington's disease

Also Published As

Publication number Publication date
EP3321361B1 (en) 2019-03-27
AU2011213562A1 (en) 2012-08-23
EP2534248A1 (en) 2012-12-19
US20150329859A1 (en) 2015-11-19
JP2020089382A (en) 2020-06-11
JP6006120B2 (en) 2016-10-12
US20130046007A1 (en) 2013-02-21
AU2011213562B2 (en) 2016-07-07
AU2016234914B2 (en) 2018-08-09
JP2016171800A (en) 2016-09-29
US20220403386A1 (en) 2022-12-22
IL254191B (en) 2021-07-29
JP2018117630A (en) 2018-08-02
EP2534248B1 (en) 2018-08-29
EP2534248A4 (en) 2014-09-17
US20190002877A1 (en) 2019-01-03
AU2018260866A1 (en) 2018-11-22
IL221272A (en) 2017-09-28
IL254191A0 (en) 2017-10-31
JP6316334B2 (en) 2018-04-25
AU2016234914A1 (en) 2016-10-20
IL221272A0 (en) 2012-10-31
ES2733708T3 (en) 2019-12-02
US8957040B2 (en) 2015-02-17
EP3561060A1 (en) 2019-10-30
JP6652984B2 (en) 2020-02-26
CA2789005A1 (en) 2011-08-11
JP2013518604A (en) 2013-05-23
US12110491B2 (en) 2024-10-08
DK2534248T3 (en) 2018-11-19
EP3321361A1 (en) 2018-05-16

Similar Documents

Publication Publication Date Title
US12110491B2 (en) Selective reduction of allelic variants
US20240309452A1 (en) Selective Reduction of Allelic Variants
AU2015231130C1 (en) Compositions for modulating Ataxin 2 expression
US20200239882A1 (en) Compositions for modulating c9orf72 expression
EP2906696A1 (en) Methods for modulating c9orf72 expression
WO2016167780A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
WO2016112132A1 (en) Compositions for modulating expression of c9orf72 antisense transcript
WO2011038288A1 (en) Modulation of ttc39 expression to increase hdl
EP3265564A1 (en) Methods for modulating mecp2 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11740542

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011213562

Country of ref document: AU

Ref document number: 2011740542

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 221272

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2789005

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012552932

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2011213562

Country of ref document: AU

Date of ref document: 20110208

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13577616

Country of ref document: US