CN103154014B - Modified nucleosides, modified nucleosides-like and oligomeric compounds prepared therefrom - Google Patents
Modified nucleosides, modified nucleosides-like and oligomeric compounds prepared therefrom Download PDFInfo
- Publication number
- CN103154014B CN103154014B CN201180021008.0A CN201180021008A CN103154014B CN 103154014 B CN103154014 B CN 103154014B CN 201180021008 A CN201180021008 A CN 201180021008A CN 103154014 B CN103154014 B CN 103154014B
- Authority
- CN
- China
- Prior art keywords
- replacement
- alkyl
- och
- independently
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 0 CC[C@@]1C*(C)CCC1 Chemical compound CC[C@@]1C*(C)CCC1 0.000 description 11
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/06—Pyrimidine radicals
- C07H19/067—Pyrimidine radicals with ribosyl as the saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/06—Pyrimidine radicals
- C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/16—Purine radicals
- C07H19/167—Purine radicals with ribosyl as the saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
- C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
- C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
- C07H19/16—Purine radicals
- C07H19/20—Purine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
- C12N2320/51—Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Virology (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Saccharide Compounds (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides modified nucleosides, analogs thereof and oligomeric compounds prepared therefrom. More particularly, the present invention provides modified nucleosides and analogs thereof that are useful for incorporation at the terminus of an oligomeric compound. Such oligomeric compounds can also be included in a double stranded composition. In some embodiments, the oligomeric compounds provided herein are expected to hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.
Description
The statement of governmental support
The 5R44GM076793-03 contract that the present invention authorizes according to NIH completes under the support of United States Government.United States Government enjoys some right in the present invention.
Sequence table
Present patent application is submitted to the sequence table of electronic edition.As name, this sequence table is called that the file of 20110426_CHEM0067WOSEQ.txt provides, it is created on April 26th, 2011, and size is 10Kb.Information in this electronic edition sequence table is all incorporated herein by reference.
Invention field
The oligomeric compounds that there is provided herein 5 ' modified nucleoside, its analogue and prepared by them.More particularly, 5 ' modified nucleoside and the analogue thereof of the terminal position (preferably 5 ' position) that can be used for being incorporated into oligomeric compounds is provided.In certain embodiments, expect that oligomeric compounds provided herein has the nuclease stability of enhancing.In certain embodiments, expect that the part being incorporated to one or more oligomeric compounds in these 5 ' modified nucleosides or its analogue and composition and target RNA provided herein is hybridized, thus cause the forfeiture of target RNA normal function.Also expect that these oligomeric compounds can be used as primer in diagnostic use and probe.
Background of invention
Before more than 30 years, people propose target Disease-causing gene sequence (Belikova etc. first, Tet.Lett., 1967,37,3557-3562), and after more than 10 years, in cell cultures, confirm antisense activity (Zamecnik etc., Proc.Natl.Acad.Sci.U.S.A., 1978,75,280-284).Antisense technology is in an advantage in the disease or illness coming from Disease-causing gene for the treatment of, and it is the direct genetic method that one can regulate (increase or reduce) specific Disease-causing gene expression.Another advantage is, uses antisense compounds checking therapeutic target to cause directly and immediately finding drug candidate; Antisense compounds is potential therapeutical agent.
In general, antisense technology principle is behind that antisense compounds and target nucleic acid are hybridized and regulatory gene expression activity or function, such as transcribes or translates.The adjustment of genetic expression can suppress by such as target degraded or occupy-place type and realize.An example of RNA target function is regulated to be the degraded based on RNA enzyme H of hybridizing rear target RNA with DNA sample antisense compounds by degraded.Another example of being expressed by target degraded regulatory gene is RNA interference (RNAi).RNAi generally refers to the gene silencing relating to the antisense mediation introducing dsRNA, thus causes the Endogenous mRNA levels generation sequence-specific be targeted to reduce.Regulate the other example of RNA target function for regulating microRNA function by occupy-place type mechanism.MicroRNA is the non-coding tiny RNA of the expression of the RNA of regulation and control coded protein.The combination of antisense compounds and microRNA prevents microRNA to be attached to its messenger RNA(mRNA) target, and thus disturbs the function of microRNA.Regardless of concrete mechanism, this sequence-specific all makes antisense compounds extremely attractive in the following areas: the instrument determined as target checking and gene function, and as therapeutical agent optionally to regulate the genetic expression related in malignant tumour and Other diseases pathogeny.
Antisense technology is the effective means reducing one or more specific gene Product Expressions, and therefore can prove to apply for multiple treatment, diagnosis and research uniquely.The nucleosides of chemically modified is normally used for being incorporated in antisense compounds, to strengthen one or more characteristics, and such as nuclease resistant, pharmacokinetics or the avidity to target RNA.In 1998, antisense compounds Vitravene
(Fomivirsen (fomivirsen); By Isis Pharmaceuticals Inc., Carlsbad, CA develops) be that the first obtains the antisense drug that U.S. food Drug Administration (FDA) checks and approves listing, and be used at present treat the retinitis that in AIDS patient, cytomegalovirus (CMV) is induced.
New chemically modified has improved usefulness and effect of antisense compounds, thus discloses oral delivery and strengthen the possibility of subcutaneous administration possibility, reduction side effect, and causes patient convenience to improve.The chemically modified strengthening the usefulness of antisense compounds allows to use lower dosage, and this reduces the possibility of toxicity, and reduces the total cost for the treatment of.Strengthen and can cause removing in slower body to the modification of the resistance of degraded, thus allow to reduce administration frequency.In a kind of compound, dissimilar chemically modified capable of being combined, to optimize effect of compound further.
5 '-replace the synthesis of DNA and RNA derivative and to be incorporated in oligomeric compounds existing (Saha etc., J.Org.Chem., 1995,60,788-789 reported in the following documents; Wang etc., Bioorganic & Medicinal Chemistry Letters, 1999,9,885-890; And Mikhailov etc., Nucleosides & Nucleotides, 1991,10 (1-3), 339-343; Leonid etc., 1995,14 (3-5), 901-905; And Eppacher etc., Helvetica ChimicaActa, 2004,87,3004-3020).Also by the base of modifying, the monomer of 5 '-replacement is prepared into phosplate preparation (Wang etc., Nucleosides Nucleotides & Nucleic Acids, 2004,23 (1 & 2), 317-337).
The optional modified nucleoside modified is comprised in multiple position (comprising 5 '-position and the 2 '-position of sugared ring) to a class and the oligomeric compounds being incorporated with these modified nucleosides has wherein carried out reporting (see international application no: PCT/US94/02993, announcing on October 13rd, 1994 with WO 94/22890).
Once report 5 '-CH before
2replace 2 '-O-protect the synthesis of nucleosides and be incorporated into (see Wu etc., Helvetica Chimica Acta, the Bioconjugate such as 2000,83,1127-1143 and Wu Chem.1999,10,921-924) in oligomer.
Prepared the nucleosides dimer that acid amides connects, for being incorporated in oligonucleotide, wherein in dimer (5 ' to 3 '), the 3 ' nucleosides connected comprises 2 '-OCH
3with 5 '-(S)-CH
3(Mesmaeker etc., Synlett, 1997,1287-1290).
Once reported class 2 '-replacement 5 '-CH before
2(or O) modified nucleoside and incorporate them in oligonucleotide and carried out discussing (see international application no: PCT/US92/01020, announcing on February 7th, 1992 with WO 92/13869).
Once reported the synthesis of modification 5 '-methene phosphonate ester monomer with 2 '-replacement before and preparing the purposes in the antiviral dimer of modification (see U.S. Patent Application No.: 10/418,662, announce on April 6th, 2006 with US 2006/0074035).
Prepare the multiple analogue of 5 '-alkynyl phosphonate ribonucleoside, and carried out in the following documents reporting (see Meurillon etc., Tetrahedron, 2009,65,6039-6046 and Nucleic Acids Symposium Series, 2008,52 (1), 565-566; Lera etc., Org.Lett., 2000,2 (24), 3873-3875).
5 '-vinylphosphonate DNA and the preparation of RNA monomer and the purposes in the dimeric compounds synthesized for the preparation of oligonucleotide thereof are described.Also discussed they Biochemical Research (see Whittaker etc., Tet.Lett., 2008,49,6984-6987; Abbas etc., Org.Lett., 2001,3 (21), 3365-3367; Bertram etc., Biochemistry, 2002,41,7725-7731; Zhao etc., Tet.Lett., 1996,37 (35), 6239-6242 and Jung, etc., Bioorg.Med.Chem., 2000,8,2501-2509).
Prepare multiple BNA, and reported in patent documentation and scientific literature, see such as: Singh etc., Chem.Commun., 1998,4,455-456; Koshkin etc., Tetrahedron, 1998,54,3607-3630; Wahlestedt etc., Proc.Natl.Acad.Sci.U.S.A., 2000,97,5633-5638; Kumar etc., Bioorg.Med.Chem.Lett., 1998,8,2219-2222; The PCT international application WO 98-DK39319980914 of Wengel etc.; Singh etc., J.Org.Chem., 1998,63,10035-10039; They are incorporated herein by reference all in full.The United States Patent (USP) of having authorized and the example of patent application announced comprise such as: United States Patent (USP) 7,053,207,6,770,748,6,268,490 and 6,794,499, and the U.S. Patent application 20040219565,20040014959,20030207841,20040192918,20030224377,20040143114 and 20030082807 announced; They are incorporated herein by reference all in full.
Report the synthesis of multiple nucite nucleoside analog in the literature, see such as: Verheggen etc., J.Med.Chem., 1995,38,826-835; Altmann etc., Chimia, 1996,50,168-176; Herdewijn etc., Bioorganic & Medicinal ChemistryLetters, 1996,6 (13), 1457-1460; Verheggen etc., Nucleosides & Nucleotides, 1996,15 (1-3), 325-335; Ostrowski etc., J.Med.Chem., 1998,41,4343-4353; Allart etc., Tetrahedron., 1999,55,6527-6546; Wouters etc., Bioorganic & Medicinal Chemistry Letters, 1999,9,1563-1566; Brown, etc., Drug Development Res., 2000,49,253-259; The PCT application announced: WO 93/25565, WO 02/18406 and WO 05/049582; United States Patent (USP) 5,314,893,5,607,922 and 6,455,507.
Describe the multiple nucite nucleoside analog as monomer, and also to have incorporated them in oligomeric compounds and (see such as: the PCT application WO93/25565 announced, announce on December 23rd, 1993; The Nucleic Acids Res. such as Augustyns, 1993,21 (20), 4670-4676; Verheggen etc., J.Med.Chem., 1993,36,2033-2040; Van Aerschol etc., Angew.Chem.Int.Ed.Engl., 1995,34 (12), 1338-1339; Anderson etc., Tetrahedron Letters, 1996,37 (45), 8147-8150; Herdewijn etc., Liebigs Ann., 1996,1337-1348; De Bouvere etc., LiebigsAnn./Recueil, 1997,1453-1461; 1513-1520; Hendrix etc., Chem.Eur.J., 1997,3 (1), 110-120; Hendrix etc., Chem.Eur.J., 1997,3 (9), 1513-1520; Hossain et al, J.Org.Chem., 1998,63,1574-1582; Allart etc., Chem.Eur.J., 1999,5 (8), 2424-2431; Boudou etc., Nucleic Acids Res., 1999,27 (6), 1450-1456; Kozlov etc., J.Am.Chem.Soc., 1999,121,1108-1109; Kozlov etc., J.Am.Chem.Soc., 1999,121,2653-2656; Kozlov etc., J.Am.Chem.Soc., 1999,121,5856-5859; Pochet etc., Nucleosides & Nucleotides, 1999,18 (4 & 5), 1015-1017; Vastmans etc., Collection Symposium Series, 1999,2,156-160; Froeyen etc., Helvetica Chimica Acta, 2000,83,2153-2182; Kozlov etc., Chem.Eur.J., 2000,6 (1), 151-155; Atkins etc., Parmazie, 2000,55 (8), 615-617; Lescrinier etc., Chemistry & Biology, 2000,7,719-731; Lescrinier etc., Helvetica Chimica Acta, 2000,83,1291-1310; Wang etc., J.Am.Chem., 2000,122,8595-8602; U.S. Patent application US 2004/0033967; The U.S. Patent application US 2008/0038745 announced; The United States Patent (USP) 7,276,592 announced and authorize).DNA analogue has also carried out summarizing in paper (see: Leumann, J.C, Bioorganic & Medicinal Chemistry, 2002,10,841-854), this paper comprises the generality discussion (under " hexitol nucleic acid family " title) of nucite nucleoside analog.
Also the oligomeric compounds with the hexitol nucleic acid (HNA, or the anhydrous hexitol nucleic acid of 1,5-) that phosphodiester connects has been prepared, for the evaluation in raji cell assay Raji.The different motifs evaluated are fully modified, wherein each monomer is the hexitol nucleic acid analog of phosphodiester connection and has breach, wherein oligomeric compounds 3 ' and each monomer in 5 ' external region are the hexitol nucleic acid analog that phosphodiester is connected, and each monomer in interior region is dezyribonucleoside that thiophosphatephosphorothioate connects (see Kang etc., Nucleic AcidsResearch, 2004,32 (14), 4411-4419; Vandermeeren etc., 2000,55,655-663; Flores etc., Parasitol Res., 1999,85,864-866; And Hendrix etc., Chem.Eur.J, 1997,3 (9), 1513-1520).
Prepare the oligomeric compounds of the analogue (band 3 '-OH group) that there is phosphodiester and connect, this analogue is called as ANA or D-altritol (D-altritol) nucleic acid in the art, and structural evaluation and in-vitro evaluation (Allart etc. have been carried out to these oligomeric compounds, Chem.Eur.J., 1999,5 (8), 2424-2431).
Prepare the chemically modified siRNA with the hexitol Nucleotide (being also referred to as HNA nucleic acid in the art) be incorporated to, and carried out testing (see the PCT application WO 06/047842 announced, announcing on May 11st, 2006) to its reticent ability.
Cyclohexene nucleic acids and analogue thereof are reported as monomer and as oligomeric compounds in science and patent documentation, see such as: Robeyns etc., J.Am.Chem.Soc., 2008,130 (6), 1979-1984; Horv á th etc., Tetrahedron Letters, 2007,48,3621-3623; Nauwelaerts etc., J.Am.Chem.Soc., 2007,129 (30), 9340-9348; Gu etc., Nucleosides, Nucleotides & Nucleic Acids, 2005,24 (5-7), 993-998; Nauwelaerts etc., Nucleic Acids Research, 2005,33 (8), 2452-2463; Robeyns etc., Acta Crystallographica, Section F:StructuralBiology and Crystallization Communications, 2005, F61 (6), 585-586; Gu etc., Tetrahedron, 2004,60 (9), 2111-2123; Gu etc., Oligonucleotides, 2003,13 (6), 479-489; Wang etc., J.Org.Chem., 2003,68,4499-4505; Verbeure etc., Nucleic Acids Research, 2001,29 (24), 4941-4947; Wang etc., J.Org.Chem., 2001,66,8478-82; Wang etc., Nucleosides, Nucleotides & NucleicAcids, 2001,20 (4-7), 785-788; Wang etc., J.Am.Chem., 2000,122,8595-8602; The PCT application WO 06/047842 announced; And the PCT application WO 01/049687 announced; They are incorporated herein by reference all in full.
Report the synthesis of multiple tetrahydropyrans nucleoside analog in the literature, see such as: Verheggen etc., J.Med.Chem., 1995,38,826-835; Altmann etc., Chimia, 1996,50,168-176; Herdewijn etc., Bioorganic & Medicinal ChemistryLetters, 1996,6 (13), 1457-1460; Verheggen etc., Nucleosides & Nucleotides, 1996,15 (1-3), 325-335; Ostrowski etc., J.Med.Chem., 1998,41,4343-4353; Allart etc., Tetrahedron., 1999,55,6527-6546; Wouters etc., Bioorganic & Medicinal Chemistry Letters, 1999,9,1563-1566; Brown, etc., Drug Development Res., 2000,49,253-259; The PCT application announced: WO 93/25565, WO 02/18406 and WO 05/049582; United States Patent (USP) 5,314,893,5,607,922 and 6,455,507.
Describe the multiple tetrahydropyrans nucleoside analog as monomer, and also to have incorporated them in oligomeric compounds and (see such as: the PCT application WO 93/25565 announced, announce on December 23rd, 1993; The Nucleic Acids Res. such as Augustyns, 1993,21 (20), 4670-4676; Verheggen etc., J.Med.Chem., 1993,36,2033-2040; Van Aerschol etc., Angew.Chem.Int.Ed.Engl., 1995,34 (12), 1338-1339; Anderson etc., Tetrahedron Letters, 1996,37 (45), 8147-8150; Herdewijn etc., Liebigs Ann., 1996,1337-1348; De Bouvere etc., Liebigs Ann./Recueil, 1997,1453-1461; 1513-1520; Hendrix etc., Chem.Eur.J., 1997,3 (1), 110-120; Hendrix etc., Chem.Eur.J., 1997,3 (9), 1513-1520; Hossain et al, J.Org.Chem., 1998,63,1574-1582; Allart etc., Chem.Eur.J., 1999,5 (8), 2424-2431; Boudou etc., Nucleic Acids Res., 1999,27 (6), 1450-1456; Kozlov etc., J.Am.Chem.Soc., 1999,121,1108-1109; Kozlov etc., J.Am.Chem.Soc., 1999,121,2653-2656; Kozlov etc., J.Am.Chem.Soc., 1999,121,5856-5859; Pochet etc., Nucleosides & Nucleotides, 1999,18 (4 & 5), 1015-1017; Vastmans etc., Collection Symposium Series, 1999,2,156-160; Froeyen etc., Helvetica Chimica Acta, 2000,83,2153-2182; Kozlov etc., Chem.Eur.J., 2000,6 (1), 151-155; Atkins etc., Parmazie, 2000,55 (8), 615-617; Lescrinier etc., Chemistry & Biology, 2000,7,719-731; Lescrinier etc., Helvetica Chimica Acta, 2000,83,1291-1310; Wang etc., J.Am.Chem., 2000,122,8595-8602; U.S. Patent application US 2004/0033967; The U.S. Patent application US 2008/0038745 announced; The United States Patent (USP) 7,276,592 announced and authorize).DNA analogue has also carried out summarizing in paper (see: Leumann, J.C, Bioorganic & Medicinal Chemistry, 2002,10,841-854), this paper comprises the generality discussion (under " hexitol nucleic acid family " title) of tetrahydropyrans nucleoside analog.
Prepare the oligomeric compounds with the 3 '-H tetrahydropyrans nucleoside analog (in the art also referred to as HNA-hexitol nucleic acid or the anhydrous hexitol nucleic acid of 1,5-) that phosphodiester connects, for the evaluation in raji cell assay Raji.The different motifs evaluated are fully modified, wherein each monomer is 3 '-H tetrahydropyrans nucleoside analog of phosphodiester connection and has breach, wherein oligomeric compounds 3 ' and each monomer in 5 ' external region are the 3 '-H tetrahydropyrans nucleoside analog that phosphodiester is connected, and each monomer in interior region is dezyribonucleoside that thiophosphatephosphorothioate connects (see Kang etc., Nucleic Acids Research, 2004,32 (14), 4411-4419; Vandermeeren etc., 2000,55,655-663; Flores etc., Parasitol Res., 1999,85,864-866; And Hendrix etc., Chem.Eur.J, 1997,3 (9), 1513-1520).
Prepare the oligomeric compounds with the 3 '-OH tetrahydropyrans nucleoside analog (being also referred to as ANA or D-altritol nucleic acid in the art) that phosphodiester connects, and structural evaluation and in-vitro evaluation (Allart etc. have been carried out to them, Chem.Eur.J., 1999,5 (8), 2424-2431).
Prepare the chemically modified siRNA with the hexitol Nucleotide (being also referred to as HNA nucleic acid in the art) be incorporated to, and carried out testing (see the PCT application WO 06/047842 announced, announcing on May 11st, 2006) to its reticent ability.
Summary of the invention
The oligomeric compounds that there is provided herein 5 ' modified nucleoside, its analogue and prepared by them.More particularly, 5 ' modified nucleoside provided herein and analogue thereof are connected to the end of oligomeric compounds, preferably at 5 ' end.In certain embodiments, expect that oligomeric compounds provided herein has the nuclease stability of enhancing.In certain embodiments, expect provided hereinly being incorporated with one or more oligomeric compounds in 5 ' modified nucleoside or its analogue and composition can be hybridized with a part of target RNA, thus cause the forfeiture of target RNA normal function.Also expect that these oligomeric compounds can be used as primer in diagnostic use and probe.
In more detail variable is defined separately in this article.It is to be appreciated that all combinations of variable that 5 '-modified nucleoside provided herein, its analogue and oligomeric compounds comprise embodiment disclosed herein and define.
In certain embodiments, the compound with formula Ic is provided:
Wherein:
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O, S, NR
14, C (R
15) (R
16), C (R
15) (R
16) C (R
17) (R
18), C (R
15)=C (R
17), OC (R
15) (R
16) or OC (R
15) (Bx
2);
R
14for H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
R
15, R
16, R
17and R
18be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1for heterocyclic base moiety;
If or there is Bx
2, then Bx
2for heterocyclic base moiety, and Bx
1for H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7one of form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, M
3for O, CH=CH, OCH
2or OC (H) (Bx
2).In certain embodiments, M
3for O.
In certain embodiments, J
4, J
5, J
6and J
7each is H.In certain embodiments, J
4with J
5or J
7one of formed bridge.
In certain embodiments, A has one of following formula:
Wherein:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, Q
1and Q
2each is H.In certain embodiments, Q
1and Q
2be H or halogen independently of one another.In certain embodiments, Q
1and Q
2for H, Q
1and Q
2another be F, CH
3or OCH
3.
In certain embodiments, T
1there is formula:
Wherein:
R
aand R
cbe shielded hydroxyl, shielded mercaptan, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the amino of alkoxyl group, shielded amino or replacement; And
R
bfor O or S.In certain embodiments, R
bfor O, and R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
In certain embodiments, r is 0, M
1for O (CH
2)
2cN, and M
2for N [CH (CH
3)
2]
2.
In certain embodiments, G is halogen, OCH
3, OCH
2f, OCHF
2, OCF
3, OCH
2cH
3, O (CH
2)
2f, OCH
2cHF
2, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-SCH
3, O (CH
2)
2-OCF
3, O (CH
2)
3-N (R
10) (R
11), O (CH
2)
2-ON (R
10) (R
11), O (CH
2)
2-O (CH
2)
2-N (R
10) (R
11), OCH
2c (=O)-N (R
10) (R
11), OCH
2c (=O)-N (R
12)-(CH
2)
2-N (R
10) (R
11) or O (CH
2)
2-N (R
12)-C (=NR
13) [N (R
10) (R
11)] wherein R
10, R
11, R
12and R
13be H or C independently of one another
1-C
6alkyl.In certain embodiments, G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.In certain embodiments, G is F, OCH
3or O (CH
2)
2-OCH
3.In certain embodiments, G is O (CH
2)
2-OCH
3.
In certain embodiments, heterocyclic base moiety is the purine of pyrimidine, the pyrimidine of replacement, purine or replacement.In certain embodiments, heterocyclic base moiety is uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, VITAMIN B4 or guanine.
In certain embodiments, the compound of the configuration with formula Ie is provided:
Wherein Bx is the heterocyclic base moiety of purine being selected from pyrimidine, the pyrimidine of replacement, purine or replacement, and other variable as described above.
In certain embodiments, provide formula Ie compound, wherein A has formula:
Wherein Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, formula Ie compound is provided, wherein Q
1and Q
2be H, F, CH independently of one another
3or OCH
3.In certain embodiments, formula Ie compound is provided, wherein T
1there is formula:
Wherein,
R
bfor O; And
R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
In certain embodiments, the oligomeric compounds with formula IIc is provided:
Wherein:
T
1for the phosphorus part optionally protected;
T
2for the compound of formula IIc being connected to the internucleoside linkage group of oligomeric compounds;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O, S, NR
14, C (R
15) (R
16), C (R
15) (R
16) C (R
17) (R
18), C (R
15)=C (R
17), OC (R
15) (R
16) or OC (R
15) (Bx
2);
R
14for H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
R
15, R
16, R
17and R
18be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1for heterocyclic base moiety;
If or there is Bx
2, then Bx
2for heterocyclic base moiety, and Bx
1for H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7one of form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl;
When j is 1, then Z is not halogen or N (E
2) (E
3); And
Wherein said oligomeric compounds comprises 8 to 40 monomer subunit, and can with the hybridization at least partially of target nucleic acid.
In certain embodiments, M
3for O, CH=CH, OCH
2or OC (H) (Bx
2).In certain embodiments, M
3for O.
In certain embodiments, J
4, J
5, J
6and J
7each is H.In certain embodiments, J
4with J
5or J
7one of formed bridge.
In certain embodiments, A has one of following formula:
Wherein:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, Q
1and Q
2each is H.In certain embodiments, Q
1and Q
2be H or halogen independently of one another.In certain embodiments, Q
1and Q
2for H, Q
1and Q
2another be F, CH
3or OCH
3.
In certain embodiments, T
1there is formula:
Wherein:
R
aand R
cbe shielded hydroxyl, shielded mercaptan, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the amino of alkoxyl group, shielded amino or replacement; And
R
bfor O or S.In certain embodiments, R
bfor O, and R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or CH (CH
3)
2.
In certain embodiments, G is halogen, OCH
3, OCH
2f, OCHF
2, OCF
3, OCH
2cH
3, O (CH
2)
2f, OCH
2cHF
2, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-SCH
3, O (CH
2)
2-OCF
3, O (CH
2)
3-N (R
10) (R
11), O (CH
2)
2-ON (R
10) (R
11), O (CH
2)
2-O (CH
2)
2-N (R
10) (R
11), OCH
2c (=O)-N (R
10) (R
11), OCH
2c (=O)-N (R
12)-(CH
2)
2-N (R
10) (R
11) or O (CH
2)
2-N (R
12)-C (=NR
13) [N (R
10) (R
11)] wherein R
10, R
11, R
12and R
13be H or C independently of one another
1-C
6alkyl.In certain embodiments, G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.In certain embodiments, G is F, OCH
3or O (CH
2)
2-OCH
3.In certain embodiments, G is O (CH
2)
2-OCH
3.
In certain embodiments, heterocyclic base moiety is the purine of pyrimidine, the pyrimidine of replacement, purine or replacement.In certain embodiments, heterocyclic base moiety is uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, VITAMIN B4 or guanine.
In certain embodiments, provide oligomeric compounds, each 5 '-end compound wherein with formula IIc also has the configuration of formula IId:
Wherein Bx is the heterocyclic base moiety of purine being selected from pyrimidine, the pyrimidine of replacement, purine or replacement.
In certain embodiments, A has formula:
Wherein Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, Q
1and Q
2be H, F, CH independently of one another
3or OCH
3.
In certain embodiments, T
1there is formula:
Wherein,
R
bfor O; And
R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
In certain embodiments, provide oligomeric compounds, wherein said 5 '-end compound has formula IIe:
Wherein:
Bx is uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, VITAMIN B4 or guanine;
T
2it is the thiophosphatephosphorothioate internucleoside linkage group compound of formula IIe being connected to oligomeric compounds; And
G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.
In certain embodiments, provide oligomeric compounds, wherein said 5 '-end compound has formula IIe, and wherein G is F, OCH
3or O (CH
2)
2-OCH
3.
In certain embodiments, providing package is containing the oligomeric compounds of the monomer subunit connected, and wherein each internucleoside linkage group is phosphodiester internucleoside linkage group or thiophosphatephosphorothioate internucleoside linkage group independently.In certain embodiments, each internucleoside linkage group is thiophosphatephosphorothioate internucleoside linkage group.
In certain embodiments, provide double-strand composition, it comprises:
First oligomeric compounds and the second oligomeric compounds, wherein said first oligomeric compounds and described second oligomeric compounds complementation, and described second oligomeric compounds and nucleic acid target complementation;
At least one in described first and second oligomeric compounds is oligomeric compounds as provided herein; And
Wherein said composition optionally comprises one or more 5 ' or 3 ' end group.
In certain embodiments, provide the method for inhibition of gene expression, comprise and cell is contacted with oligomeric compounds as provided herein or double-strand composition as provided herein, wherein said oligomeric compounds comprises about 8 to about 40 monomer subunit individually or with the form of double-strand composition, and complementary with target RNA.In certain embodiments, cell is in animal.In certain embodiments, cell is in people.In certain embodiments, target RNA is selected from mRNA, pre-mRNA and micro RNA.In certain embodiments, target RNA is mRNA.In certain embodiments, target RNA is people mRNA.In certain embodiments, target RNA is cleaved, thus suppresses its function.In certain embodiments, the method comprises the level detecting target RNA further.
In certain embodiments, provide the method for vitro inhibition genetic expression, comprise and one or more cell or tissues are contacted with oligomeric compounds as provided herein or double-strand composition as provided herein.
In certain embodiments, there is provided oligomeric compounds and double-strand composition for the method for inhibition of gene expression in body, described method comprise makes one or more cells, tissue or animal and oligomeric compounds as provided herein or as provided herein double-strand composition contact.
In certain embodiments, provide oligomeric compounds as provided herein or double-strand composition for pharmacological agent.
In certain embodiments, provide a kind of for be used alone or with the oligomeric compounds of double-strand composition forms, it comprises the compound with one of following formula in 5 '-position:
Wherein:
T
1for the phosphorus part optionally protected;
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (R
3) (R
4);
Each R
3and R
4be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl;
When j is 1, then Z is not halogen or N (E
2) (E
3); And
Wherein said oligomeric compounds or double-strand composition respectively by the mechanisms play effect based on ssRNAi or dsRNAi RISC, and provide the activity of enhancing relative to not having the 5 ' oligomeric compounds modified.This modification in the end 5 ' position of oligomeric compounds, or for the oligomeric compounds containing non-furans acyl (non-furanosyl) monomer, can be positioned at 5 ' position of equivalence.Show in instances on the monomer that one of vinyl group as implied above is connected to there is non-furans acyl ring.
In certain embodiments, provide a kind of for be used alone or with the oligomeric compounds of double-strand composition forms, it comprises the compound with one of following formula in 5 '-position:
Wherein:
T
1for the phosphorus part optionally protected;
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3); And
Wherein said oligomeric compounds or double-strand composition respectively by the mechanisms play effect based on ssRNAi or dsRNAi RISC, and provide the activity of enhancing relative to not having the 5 ' oligomeric compounds modified.This modification in the end 5 ' position of oligomeric compounds, or for the oligomeric compounds containing non-furans acyl monomer, can be positioned at 5 ' position of equivalence.
In certain embodiments, provide a kind of for be used alone or with the oligomeric compounds of double-strand composition forms, it comprises the compound with following formula in 5 '-position:
Wherein:
T
1for the phosphorus part optionally protected; And
Wherein said oligomeric compounds or double-strand composition respectively by the mechanisms play effect based on ssRNAi or dsRNAi RISC, and provide the activity of enhancing relative to not having the 5 ' oligomeric compounds modified.This modification in the end 5 ' position of oligomeric compounds, or for the oligomeric compounds containing non-furans acyl monomer, can be positioned at 5 ' position of equivalence.
In certain embodiments, 5 ' modified nucleoside and analogue thereof are all included in formula Ic compound:
Wherein:
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O, S, NR
14, C (R
15) (R
16), C (R
15) (R
16) C (R
17) (R
18), C (R
15)=C (R
17), OC (R
15) (R
16) or OC (R
15) (Bx
2);
R
14for H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
R
15, R
16, R
17and R
18be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1and Bx
2one of be heterocyclic base moiety, and Bx
1and Bx
2if another be H, halogen, C when existing
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, M
3for O, CH
2cH
2, CH=CH, OCH
2or OC (H) (Bx
2), wherein Bx
2for heterocyclic base moiety.
In certain embodiments, J
4, J
5, J
6and J
7each is H.
In certain embodiments, A has formula:
Wherein Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, Q
1and Q
2be H or halogen independently of one another.
In certain embodiments, 5 ' modified nucleoside all has formula I:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be the alkyl of alkyl or replacement independently;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, Bx is the purine of pyrimidine, the pyrimidine of replacement, purine or replacement.In certain embodiments, Bx is uridylic, 5-thiazole uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, 5-thiazole cytosine(Cyt), VITAMIN B4, guanine or 2,6-diaminopurine.
In certain embodiments, T
1there is formula:
Wherein:
R
aand R
cbe shielded hydroxyl, shielded mercaptan, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the amino of alkoxyl group, shielded amino or replacement; And
R
bfor O or S.
In certain embodiments, T
1there is formula:
Wherein:
R
aand R
cbe shielded hydroxyl; And
R
bfor O or S.
In certain embodiments, T
1there is formula:
Wherein:
R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2; And
R
bfor O.
In certain embodiments, r is 1, M
1for H, and M
2for OH.In certain embodiments, r is 0, M
1for O (CH
2)
2cN, and M
2for N [CH (CH
3)
2]
2.
In certain embodiments, G is halogen, OCH
3, OCH
2f, OCHF
2, OCF
3, OCH
2cH
3, O (CH
2)
2f, OCH
2cHF
2, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-SCH
3, O (CH
2)
2-OCF
3, O (CH
2)
3-N (R
10) (R
11), O (CH
2)
2-ON (R
10) (R
11), O (CH
2)
2-O (CH
2)
2-N (R
10) (R
11), OCH
2c (=O)-N (R
10) (R
11), OCH
2c (=O)-N (R
12)-(CH
2)
2-N (R
10) (R
11) or O (CH
2)
2-N (R
12)-C (=NR
13) [N (R
10) (R
11)] wherein R
10, R
11, R
12and R
13be H or C independently of one another
1-C
6alkyl.In certain embodiments, G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.In certain embodiments, G is F, OCH
3, O (CH
2)
2-OCH
3, OCH
2c (=O)-N (H) CH
3or OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2.In certain embodiments, G is O (CH
2)
2-OCH
3.In certain embodiments, G is F.
In certain embodiments, A has one of following formula:
In certain embodiments, A has formula:
In certain embodiments, A has one of following formula:
In certain embodiments, Q
1and Q
2each is H.In certain embodiments, Q
1and Q
2for H, and Q
1and Q
2another be halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, Q
1and Q
2for H, and Q
1and Q
2another be F or CH
3.In certain embodiments, Q
1and Q
2be F or CH independently of one another
3.In certain embodiments, Q
3for O.In certain embodiments, Q
3for S.In certain embodiments, Q
3for N (R
5).In certain embodiments, R
5for H.In certain embodiments, R
5for C
1-C
6the C of alkyl or replacement
1-C
6alkyl.In certain embodiments, R
5for CH
3.In certain embodiments, Q
3for C (R
6) (R
7).In certain embodiments, R
6and R
7be H.In certain embodiments, R
6and R
7one of be H, and R
6and R
7another be C
1-C
6the C of alkyl or replacement
1-C
6alkyl.In certain embodiments, R
6and R
7one of be H, and R
6and R
7another be CH
3.In certain embodiments, R
6and R
7be independently of one another
C
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group.
In certain embodiments, A has formula:
In certain embodiments, 5 ' modified nucleoside all has formula Ia:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be the alkyl of alkyl or replacement independently;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, 5 ' modified nucleoside all has formula Ib:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be the alkyl of alkyl or replacement independently;
R is 0 or 1;
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Each R
3and R
4be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, 5 ' modified nucleoside all has formula Ib:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for O (CH
2)
2cN;
M
2for N [(CH (CH
3)
2]
2;
R is 0;
Q
1and Q
2be H;
G is halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, 5 ' modified nucleoside all has formula Ib:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for O (CH
2)
2cN;
M
2for N [(CH (CH
3)
2]
2;
R is 0;
Q
1and Q
2be H;
G is O (CH
2)
2oCH
3.
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIc:
Wherein:
T
1for the phosphorus part optionally protected;
T
2for the compound of formula IIc being connected to the internucleoside linkage group of oligomeric compounds;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O, S, NR
14, C (R
15) (R
16), C (R
15) (R
16) C (R
17) (R
18), C (R
15)=C (R
17), OC (R
15) (R
16) or OC (R
15) (Bx
2);
R
14for H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
R
15, R
16, R
17and R
18be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1and Bx
2one of be heterocyclic base moiety, and Bx
1and Bx
2if another exist for H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, the oligomeric compounds with formula IIc is provided, wherein M
3for O, CH
2cH
2, CH=CH, OCH
2or OC (H) (Bx
2), wherein Bx
2for heterocyclic base moiety.
In certain embodiments, the oligomeric compounds with formula IIc is provided, wherein J
4, J
5, J
6and J
7be H.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIc, and wherein A has formula:
Wherein Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIc, wherein Q
1and Q
2be H or halogen independently of one another.
In certain embodiments, provide oligomeric compounds, it comprises the 5 '-end compound with formula II:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
T
2for formula II compound being connected to the internucleoside linkage group of oligomeric compounds;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II, and wherein Bx is the purine of pyrimidine, the pyrimidine of replacement, purine or replacement.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II, and wherein Bx is uridylic, 5-thiazole uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, 5-thiazole cytosine(Cyt), VITAMIN B4, guanine or 2,6-diaminopurine.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein T
1there is formula:
Wherein:
R
aand R
cbe shielded hydroxyl, shielded mercaptan, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the amino of alkoxyl group, shielded amino or replacement; And
R
bfor O or S.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein T
1there is formula:
Wherein:
R
aand R
cbe shielded hydroxyl; And
R
bfor O or S.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein T
1there is formula:
Wherein:
R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2; And
R
bfor O.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein G is halogen, OCH
3, OCH
2f, OCHF
2, OCF
3, OCH
2cH
3, O (CH
2)
2f, OCH
2cHF
2, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-SCH
3, O (CH
2)
2-OCF
3, O (CH
2)
3-N (R
10) (R
11), O (CH
2)
2-ON (R
10) (R
11), O (CH
2)
2-O (CH
2)
2-N (R
10) (R
11), OCH
2c (=O)-N (R
10) (R
11), OCH
2c (=O)-N (R
12)-(CH
2)
2-N (R
10) (R
11) or O (CH
2)
2-N (R
12)-C (=NR
13) [N (R
10) (R
11)] wherein R
10, R
11, R
12and R
13be H or C independently of one another
1-C
6alkyl.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein G is F, OCH
3, O (CH
2)
2-OCH
3, OCH
2c (=O)-N (H) CH
3or OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein G is O (CH
2)
2-OCH
3.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein G is F.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein A has one of following formula:
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein A has formula:
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein A has one of following formula:
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
1and Q
2be H.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
1and Q
2one of be H, and Q
1and Q
2another be halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
1and Q
2one of be H, and Q
1and Q
2another be F or CH
3.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
1and Q
2be F or CH independently of one another
3.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for O.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for S.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for N (R
5).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for N (R
5), and R
5for H.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for N (R
5), and R
5for C
1-C
6the C of alkyl or replacement
1-C
6alkyl.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for N (R
5), and R
5for CH
3.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for C (R
6) (R
7).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for C (R
6) (R
7), and R
6and R
7be H.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for C (R
6) (R
7), and R
6and R
7one of be H, and R
6and R
7another be C
1-C
6the C of alkyl or replacement
1-C
6alkyl.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for C (R
6) (R
7), and R
6and R
7one of be H, and R
6and R
7another be CH
3.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, wherein Q
3for C (R
6) (R
7), and R
6and R
7be C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II or formula IIc, and wherein A has formula:
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIa:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
T
2for formula II compound being connected to the internucleoside linkage group of oligomeric compounds rest part;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIb:
IIb。
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIb, wherein Q
1and Q
2be H.
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIa or IIb, and wherein G is O (CH
2)
2oCH
3.
In certain embodiments, provide oligomeric compounds, wherein each internucleoside linkage group is phosphodiester internucleoside linkage group or thiophosphatephosphorothioate internucleoside linkage group independently.In certain embodiments, provide oligomeric compounds, wherein each internucleoside linkage group is thiophosphatephosphorothioate internucleoside linkage group substantially.
In certain embodiments, provide double-strand composition, they all comprise:
First oligomeric compounds and the second oligomeric compounds, wherein said first oligomeric compounds and described second oligomeric compounds complementation, and described second oligomeric compounds and nucleic acid target complementation;
At least one of described first and second oligomeric compounds is comprise the oligomeric compounds of 5 ' end compound with formula II, IIa, IIb or IIc; And
Wherein said composition optionally comprises one or more 5 ' or 3 ' end group.
In certain embodiments, provide the method for inhibition of gene expression, the method comprises: make cell and comprise to have formula II, IIa, the oligomeric compounds contact of the 5 ' end compound of IIb or IIc or with comprise at least one there is formula II, IIa, the double-strand composition contact of the 5 ' end compound of IIb or IIc, the first and second oligomeric compounds wherein in this oligomeric compounds and this double-strand composition all comprise about 8 to about 40 monomer subunit, and one of first and second oligomeric compounds in this oligomeric compounds or this double-strand composition are complementary with target RNA.In certain embodiments, cell is in animal.In certain embodiments, cell is in people.In certain embodiments, target RNA is selected from mRNA, pre-mRNA and micro RNA.In certain embodiments, target RNA is mRNA.In certain embodiments, target RNA is people mRNA.In certain embodiments, target RNA is cleaved, thus suppresses its function.In certain embodiments, the method comprises the level detecting target RNA further.
In certain embodiments, provide the method for inhibition of gene expression, the method comprises: make one or more cell or tissues with comprise there is formula II, the oligomeric compounds of 5 ' end compound of IIa, IIb or IIc contact or with comprise at least one there is formula II, the double-strand composition of 5 ' end compound of IIa, IIb or IIc contacts.
In certain embodiments, provide comprise have formula II, IIa, IIb or IIc 5 ' end compound oligomeric compounds or comprise the double-strand composition of 5 ' end compound that at least one has formula II, IIa, IIb or IIc, for the method for inhibition of gene expression in body, the method comprise make one or more cells, tissue or animal with comprise there is formula II, the oligomeric compounds of 5 ' end compound of IIa, IIb or IIc contact or with comprise at least one there is formula II, the double-strand composition of 5 ' end compound of IIa, IIb or IIc contacts.
In certain embodiments, provide comprise have formula II, IIa, IIb or IIc 5 ' end compound oligomeric compounds or comprise the double-strand composition of 5 ' end compound that at least one has formula II, IIa, IIb or IIc, for pharmacological agent.
In certain embodiments, the rest part of oligomeric compounds except 5 ' modified nucleoside or its analogue will have one or more modification thereon.This type of modify comprise sugar-modified or with sugar replacement substitute, base modification, other 3 ' and 5 ' end group (double-strand composition, its comprise at least one itself have two 5 ' end oligomeric compounds as described herein), internucleoside linkage modify and motif.Described by this type of is modified at and has herein, and wherein many be all known to those skilled in the art.This type of modifications all are all suitable for oligomeric compounds disclosed herein and double-strand composition.
In some this type of embodiment, the rest part of oligomeric compounds comprises at least one nucleosides modified.In certain embodiments, oligomeric compounds comprises modified base.In certain embodiments, oligomeric compounds comprises sugar replacement.In some this type of embodiment, sugar replacement is tetrahydropyrans.In certain embodiments, tetrahydropyrans is F-HNA.
In certain embodiments, the rest part of oligomeric compounds comprises at least one and contains the nucleosides modifying sugar.In certain embodiments, this at least one modified nucleoside containing modification sugar is selected from bicyclic nucleoside and 2 '-modified nucleoside.In certain embodiments, this at least one modified nucleoside is bicyclic nucleoside.In certain embodiments, this bicyclic nucleoside is (4 '-CH
2-O-2 ') BNA nucleosides.In certain embodiments, this bicyclic nucleoside is (4 '-(CH
2)
2-O-2 ') BNA nucleosides.In certain embodiments, this bicyclic nucleoside is (4 '-C (CH
3) H-O-2 ') BNA nucleosides.In certain embodiments, this at least one modified nucleoside is 2 '-modified nucleoside.In certain embodiments, this at least one 2 '-modified nucleoside is selected from 2 '-F nucleosides, 2 '-OCH
3nucleosides and 2 '-O (CH
2)
2oCH
3nucleosides.In certain embodiments, this at least one 2 '-modified nucleoside is 2 '-F nucleosides.In certain embodiments, this at least one 2 '-modified nucleoside is 2 '-OCH
3nucleosides.In certain embodiments, this at least one 2 '-modified nucleoside is 2 '-O (CH
2)
2oCH
3nucleosides.
In certain embodiments, the rest part of oligomeric compounds comprises the nucleosides of at least one unmodified.In certain embodiments, the nucleosides of this unmodified is ribonucleoside.In certain embodiments, the nucleosides of this unmodified is dezyribonucleoside.
In certain embodiments, the rest part of oligomeric compounds comprises at least two modified nucleosides.In certain embodiments, these at least two modified nucleosides comprise identical modification.In certain embodiments, these at least two modified nucleosides comprise different modifications.In certain embodiments, at least one of this at least two modified nucleosides comprises sugar replacement.In certain embodiments, at least one of this at least two modified nucleosides comprise 2 '-modify.In certain embodiments, each of this at least two modified nucleosides is independently selected from 2 '-F nucleosides, 2 '-OCH
3nucleosides and 2 '-O (CH
2)
2oCH
3nucleosides.In certain embodiments, each of this at least two modified nucleosides is 2 '-F nucleosides.In certain embodiments, each of this at least two modified nucleosides is 2 '-OCH
3nucleosides.In certain embodiments, each of this at least two modified nucleosides is 2 '-O (CH
2)
2oCH
3modified nucleoside.In certain embodiments, oligomeric compounds substantially each nucleosides be modified nucleoside.In certain embodiments, each nucleosides of oligomeric compounds is modified nucleoside.
In certain embodiments, the rest part of oligomeric compounds comprises:
1-20 first kind region, each first kind region comprises 1-20 adjacent nucleosides independently, and wherein each nucleosides in each first kind region comprises first kind modification;
0-20 Second Type region, each Second Type region comprises 1-20 adjacent nucleosides independently, and wherein each nucleosides in each Second Type region comprises Second Type modification; And 0-20 the 3rd type area, each 3rd type area comprises 1-20 adjacent nucleosides independently, and wherein each nucleosides of each 3rd type area comprises the 3rd type modification; Wherein the first kind is modified, Second Type modifies and the modification of the 3rd type is selected from 2 '-F, 2 ' OCH independently of one another
3, 2 '-O (CH
2)
2oCH
3, BNA, F-HNA, 2 '-H and 2 '-OH; Prerequisite is that the first kind is modified, Second Type is modified and the 3rd type is modified different each other.
In certain embodiments, the rest part of oligomeric compounds comprises 2-20 first kind region, a 3-20 first kind region, a 4-20 first kind region, a 5-20 first kind region or 6-20 first kind region.In certain embodiments, the rest part of oligomeric compounds comprises 1-20 Second Type region, a 2-20 Second Type region, a 3-20 Second Type region, a 4-20 Second Type region or 5-20 Second Type region.In certain embodiments, the rest part of oligomeric compounds comprises 1-20 the 3rd type area, 2-20 the 3rd type area, 3-20 the 3rd type area, 4-20 the 3rd type area or 5-20 the 3rd type area.
In certain embodiments, the rest part of oligomeric compounds comprises the 3rd type area at 3 '-end of oligomeric compounds.In certain embodiments, the rest part of oligomeric compounds comprises the 3rd type area at 3 '-end of oligomeric compounds.In certain embodiments, the 3rd type area comprises 1 to 3 modified nucleoside, and the 3rd type is modified to 2 '-O (CH
2)
2oCH
3.In certain embodiments, third phase region of the same type comprises two modified nucleosides, and the 3rd type is modified to 2 '-O (CH
2)
2oCH
3.
In certain embodiments, each first kind region comprises 1 to 5 modified nucleoside.In certain embodiments, each first kind region comprises 6 to 10 modified nucleosides.In certain embodiments, each first kind region comprises 11 to 15 modified nucleosides.In certain embodiments, each first kind region comprises 16 to 20 modified nucleosides.
In certain embodiments, the first kind is modified to 2 '-F.In certain embodiments, the first kind is modified to 2 '-OMe.In certain embodiments, the first kind is modified to DNA.In certain embodiments, the first kind is modified to 2 '-O (CH
2)
2oCH
3.In certain embodiments, the first kind is modified to 4 '-CH
2-O-2 '.In certain embodiments, the first kind is modified to 4 '-(CH
2)
2-O-2 '.In certain embodiments, the first kind is modified to 4 '-C (CH
3) H-O-2 '.In certain embodiments, each Second Type region comprises 1 to 5 modified nucleoside.In certain embodiments, each Second Type region comprises 6 to 10 modified nucleosides.In certain embodiments, each Second Type region comprises 11 to 15 modified nucleosides.In certain embodiments, each Second Type region comprises 16 to 20 modified nucleosides.In certain embodiments, Second Type is modified to 2 '-F.In certain embodiments, Second Type is modified to 2 '-OMe.In certain embodiments, Second Type is modified to DNA.In certain embodiments, Second Type is modified to 2 '-O (CH
2)
2oCH
3.In certain embodiments, Second Type is modified to 4 '-CH
2-O-2 '.In certain embodiments, Second Type is modified to 4 '-(CH
2)
2-O-2 '.In certain embodiments, Second Type is modified to 4 '-C (CH
3) H-O-2 '.In certain embodiments, oligomeric compounds has alternately motif, and wherein first kind region and Second Type region are alternately.
In certain embodiments, the invention provides the oligomeric compounds that wherein 5 ' end nucleotide is formula II, IIa, IIb, IIc, IId or IIe compound, and the rest part of this oligomeric compounds comprises at least one region of the nucleosides with following nucleosides motif: (A)
n-(B)
n-(A)
n-(B)
n, wherein: A and B is the nucleosides of different modifying; And each n is independently selected from 1,2,3,4 and 5.
In certain embodiments, A and B is selected from dicyclo and 2 '-modified nucleoside independently of one another.In certain embodiments, at least one of A and B is bicyclic nucleoside.In certain embodiments, at least one of A and B is (4 '-CH
2-O-2 ') BNA nucleosides.In certain embodiments, at least one of A and B is (4 '-(CH
2)
2-O-2 ') BNA nucleosides.In certain embodiments, at least one of A and B is (4 '-C (CH
3) H-O-2 ') BNA nucleosides.In certain embodiments, at least one of A and B is 2 '-modified nucleoside.In certain embodiments, 2 '-modified nucleoside is selected from: 2 '-F nucleosides, 2 '-OCH
3nucleosides and 2 '-O (CH
2)
2oCH
3nucleosides.In certain embodiments, A and B is selected from independently of one another: 2 '-F nucleosides, 2 '-OCH
3nucleosides, 2 '-O (CH
2)
2oCH
3nucleosides, (4 '-CH
2-O-2 ') BNA nucleosides, (4 '-(CH
2)
2-O-2 ') BNA nucleosides, (4 '-C (CH
3) H-O-2 ') BNA nucleosides, DNA nucleosides, RNA nucleosides and F-HNA nucleosides.In certain embodiments, A and B is selected from independently of one another: 2 '-F nucleosides, 2 '-OCH
3nucleosides, (4 '-CH
2-O-2 ') BNA nucleosides, (4 '-(CH
2)
2-O-2 ') BNA nucleosides, (4 '-C (CH
3) H-O-2 ') BNA nucleosides and DNA nucleosides.In certain embodiments, one of A and B is 2 '-F nucleosides.In certain embodiments, one of A and B is 2 '-OCH
3nucleosides.In certain embodiments, one of A and B is 2 '-O (CH
2)
2oCH
3nucleosides.In certain embodiments, A is 2 '-F nucleosides, and B is 2 '-OCH
3nucleosides.In certain embodiments, A is 2 '-OCH
3nucleosides, and B is 2 '-F nucleosides.In certain embodiments, one of A and B is selected from (4 '-CH
2-O-2 ') BNA nucleosides, (4 '-(CH
2)
2-O-2 ') BNA nucleosides and (4 '-C (CH
3) H-O-2 ') BNA nucleosides, and the another one of A and B is DNA nucleosides.
In certain embodiments, the invention provides the oligomeric compounds that wherein 5 ' end nucleotide is formula II, IIa, IIb, IIc, IId or IIe compound, and the rest part of this oligomeric compounds comprises at least one region of the nucleosides with following nucleosides motif: (A)
x-(B)
2-(A)
y-(B)
2-(A)
z-(B)
3wherein: A is the nucleosides of the first kind; B is the nucleosides of Second Type; X is 0-10; Y is 1-10; And Z is 1-10.
In certain embodiments, X is selected from 0,1,2 and 3.In certain embodiments, X is selected from 4,5,6 and 7.In certain embodiments, Y is selected from 1,2 and 3.In certain embodiments, Y is selected from 4,5,6 and 7.In certain embodiments, Z is selected from 1,2 and 3.In certain embodiments, Z is selected from 4,5,6 and 7.In certain embodiments, A is 2 '-F nucleosides.In certain embodiments, B is 2 '-OCH
3nucleosides.
In certain embodiments, the invention provides the oligomeric compounds that wherein 5 ' end nucleotide is formula II, IIa, IIb, IIc, IId or IIe compound, and wherein this oligomeric compounds comprises at its 3 '-end the 3 '-region be made up of 1 to 5 nucleosides, wherein: each of the nucleosides in 3 '-region comprises mutually the same modification; And the nucleosides in 3 '-region is different from the modification of last nucleosides in contiguous 3 '-region.
In certain embodiments, the modification in 3 '-region is different from any modification of oligomeric compounds other nucleosides any.In certain embodiments, the nucleosides in 3 '-region is 2 '-O (CH
2)
2oCH
3nucleosides.In certain embodiments, 3 '-region is made up of 2 nucleosides.In certain embodiments, 3 '-region is made up of 3 nucleosides.In certain embodiments, each nucleosides in 3 '-region comprises uridylic base.In certain embodiments, each nucleosides in 3 '-region comprises adenine base.In certain embodiments, each nucleosides in 3 '-region comprises thymine alkali bases.
In certain embodiments, the rest part of oligomeric compounds comprises the nucleosides region evenly modified.In certain embodiments, this nucleosides region evenly modified comprises 2-20 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 3-20 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 4-20 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 5-20 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 6-20 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 5-15 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 6-15 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 5-10 the even modified nucleoside adjoined.In certain embodiments, this nucleosides region evenly modified comprises 6-10 the even modified nucleoside adjoined.
In certain embodiments, the rest part of oligomeric compounds comprises the nucleosides region alternately modified and the nucleosides region evenly modified.In certain embodiments, alternately nucleotide region is 5 ' of complete modified nucleoside region.In certain embodiments, alternately nucleotide region is 3 ' of complete modified nucleoside region.In certain embodiments, graded area and complete modified regions are closely adjacent to each other.In certain embodiments, oligomeric compounds has other nucleosides between graded area and complete modified regions.
In certain embodiments, the rest part of oligomeric compounds comprises the nucleosides region that at least one has following motif I: N
f(PS) N
m(PO), wherein: N
fbe 2 '-F nucleosides, N
mbe 2 '-OCH
3nucleosides, PS is thiophosphatephosphorothioate linking group; And PO is phosphodiester linking group.
In certain embodiments, 5 ' end nucleotide is the compound of formula II, IIa, IIb, IIc, IId or IIe, and the second nucleosides from 5 ' end is N
f.
In certain embodiments, oligomeric compounds comprises at least 2 or 3 or 4 or 6 or 7 or 8 or 9 or 10 independent regions with motif I.
In certain embodiments, the rest part of oligomeric compounds comprises at least one and has the region being selected from following nucleosides motif: AABBAA, ABBABB, AABAAB, ABBABAABB, ABABAA, AABABAB, ABABAA, ABBAABBABABAA, BABBAABBABABAA or ABABBAABBABABAA; Wherein A is first kind nucleosides, and B is Second Type nucleosides.
In certain embodiments, oligomeric compounds of the present invention comprises one or more conjugation group.In certain embodiments, oligomeric compounds of the present invention is made up of oligonucleotide.
In certain embodiments, the invention provides the oligomeric compounds with following formula:
5 '-(Z)-(L-Q
a-L-Q
b)
t-(L-Q
a)
u-(L-Q
c)
v-(G)
a-3 ' wherein: each L is internucleoside linkage group; G is the conjugation group or the linking group that oligomeric compounds are connected to conjugate; A is 0 or 1; Q
a, Q
band Q
ceach independently for having the 2 '-modified nucleoside being selected from 2 ' following-substituted radical: halogen, allyl group, amino, azido-, O-allyl group, O-C
1-C
6alkyl, OCF
3, O-(CH
2)
2-O-CH
3, O (CH
2)
2sCH
3, O-(CH
2)
2-O-N (J
5) (J
6) and O-CH
2-C (=O)-N (J
a) (J
b), wherein each J
aand J
bbe H, amido protecting group or substituted or unsubstituted C independently
1-C
6alkyl; Prerequisite is Q
a, Q
band Q
cdifferent; T is 4 to 8; U is 0 or 1; V is 1 to 3; And Z is formula II, IIa, IIb, IIc, IId or IIe compound.
In certain embodiments, each Q
aand Q
bhalogen and O-C is selected from independently for having
1-C
62 '-modified nucleoside of 2 '-substituted radical of alkyl.In certain embodiments, each Q
aand Q
bindependently for having 2 '-modified nucleoside of the 2 '-substituted radical being selected from F and O-methyl.In certain embodiments, each Q
cfor having O-(CH
2)
2-OCH
32 '-modified nucleoside of 2 '-substituted radical.In certain embodiments, a is 0.In certain embodiments, v is 2.In certain embodiments, u is 0.In certain embodiments, u is 1.
Any above-mentioned embodiment some in, the rest part of oligomeric compounds comprises the nucleosides connected by 8-80; 8-26 the nucleosides connected; 10-24 the nucleosides connected; 16-22 the nucleosides connected; The oligonucleotide of 16-18 the nucleosides connected or 19-22 the nucleosides composition connected.Any above-mentioned embodiment some in, from 5 '-end second nucleosides comprise sugar moieties, this sugar moieties comprises the 2 '-substituting group being selected from OH and halogen.In certain embodiments, second nucleosides from 5 '-end is 2 '-F modified nucleoside.
Any above-mentioned embodiment some in, oligomeric compounds comprise at least one modify linking group.In certain embodiments, each internucleoside linkage group is phosphodiester or thiophosphatephosphorothioate independently.In certain embodiments, 5 '-least significant end internucleoside linkage group is thiophosphatephosphorothioate linking group.In certain embodiments, oligomeric compounds comprises at least one thiophosphatephosphorothioate region, and the latter comprises at least two adjacent thiophosphatephosphorothioate linking groups.In certain embodiments, this at least one thiophosphatephosphorothioate region comprises 3 to 12 adjacent thiophosphatephosphorothioate linking groups.In certain embodiments, this at least one thiophosphatephosphorothioate region comprises 6 to 8 adjacent thiophosphatephosphorothioate linking groups.In certain embodiments, this at least one thiophosphatephosphorothioate region is positioned at 3 '-end of oligomeric compounds.In certain embodiments, this at least one thiophosphatephosphorothioate region is positioned at 3 nucleosides of oligomeric compounds 3 '-end.In certain embodiments, 7-9 internucleoside linkage of oligonucleotide 3 '-end is thiophosphatephosphorothioate bonding, and the internucleoside linkage of 5 '-end is thiophosphatephosphorothioate bonding.
In certain embodiments, the invention provides the oligomeric compounds comprising and connect the oligonucleotide that nucleosides forms by 10 to 30, wherein:
A () 5 ' holds nucleosides to have formula II, IIa, IIb, IIc, IId or IIe:
(b) from 5 '-sugar moieties of second nucleosides that end rises be selected from 2 '-OH sugar of unmodified and the modification containing the modification being selected from 2 '-halogen, 2 ' O-alkyl and 2 '-O-substituted alkyl sugared; And
(c) 5 '-the first internucleoside linkage of end and be thiophosphatephosphorothioate bonding at last seven internucleoside linkage of 3 '-end; And
D () at least one internucleoside linkage is not thiophosphatephosphorothioate bonding.
In certain embodiments, oligomeric compounds is antisense compounds.In certain embodiments, antisense compounds is RNAi compound.In certain embodiments, antisense compounds is single stranded RNA i compound.In certain embodiments, antisense compounds is double-stranded RNA i compound (siRNA), and wherein one or two chains are oligomeric compounds as disclosed herein.In certain embodiments, antisense compounds is microRNA stand-in.In certain embodiments, antisense compounds is RNA enzyme H antisense compounds.In certain embodiments, antisense compounds regulates montage.
In certain embodiments, the core base sequence of oligomeric compounds complementary with a part for target nucleic acid at least partially, wherein this target nucleic acid is selected from: said target mrna, target pre-mRNA, target microRNA and target non-coding RNA.In certain embodiments, the core base sequence of oligomeric compounds comprises the region with target nucleic acid 100% complementation, and the region of wherein this 100% complementation is at least 10 core bases.In certain embodiments, the region of this 100% complementation is at least 15 core bases.In certain embodiments, the region of this 100% complementation is at least 20 core bases.In certain embodiments, this oligonucleotide and target nucleic acid at least 85% complementation.In certain embodiments, this oligonucleotide and target nucleic acid at least 90% complementation.In certain embodiments, this oligonucleotide and target nucleic acid at least 95% complementation.In certain embodiments, this oligonucleotide and target nucleic acid at least 98% complementation.In certain embodiments, this oligonucleotide and target nucleic acid 100% complementation.
In certain embodiments, antisense compounds is microRNA stand-in, and the core base sequence that it has comprises the part identical with the seed region at least 80% of microRNA, and has the overall identity of at least 70% with microRNA.In certain embodiments, the core base sequence of microRNA stand-in has the part identical with the seed region sequence at least 80% of microRNA, and has the overall identity of at least 75% with microRNA.In certain embodiments, the core base sequence of microRNA stand-in has the part identical with the seed region sequence at least 80% of microRNA, and has the overall identity of at least 80% with microRNA.In certain embodiments, the core base sequence of microRNA stand-in has the part identical with the seed region sequence at least 100% of microRNA, and has the overall identity of at least 80% with microRNA.In certain embodiments, the core base sequence of microRNA stand-in has the part identical with the seed region sequence at least 100% of microRNA, and has the overall identity of at least 85% with microRNA.In certain embodiments, the core base sequence of microRNA stand-in has the part identical with microRNA sequence 100%.In certain embodiments, the core base sequence of oligonucleotide comprises the region of mating fragment 100% complementation with the seed of target nucleic acid.In certain embodiments, antisense compounds is microRNA stand-in, and the core base sequence that it has comprises the part identical with the seed region at least 80% of microRNA, and has the overall identity of at least 50% with microRNA.In certain embodiments, antisense compounds is microRNA stand-in, and the core base sequence that it has comprises the part identical with the seed region at least 80% of microRNA, and has the overall identity of at least 55% with microRNA.In certain embodiments, antisense compounds is microRNA stand-in, and the core base sequence that it has comprises the part identical with the seed region at least 80% of microRNA, and has the overall identity of at least 60% with microRNA.In certain embodiments, antisense compounds is microRNA stand-in, and the core base sequence that it has comprises the part identical with the seed region at least 80% of microRNA, and has the overall identity of at least 65% with microRNA.In certain embodiments, oligomeric compounds comprises the core base sequence being selected from the microRNA sequence be present in miRBase.In certain embodiments, oligomeric compounds is made up of the core base sequence being selected from the microRNA sequence be present in miRBase.
In certain embodiments, target nucleic acid is said target mrna.In certain embodiments, target nucleic acid is target pre-mRNA.In certain embodiments, target nucleic acid is non-coding RNA.In certain embodiments, target nucleic acid is microRNA.In certain embodiments, target nucleic acid is pre-mir.In certain embodiments, target nucleic acid is pri-mir.
In certain embodiments, the core base sequence of oligonucleotide comprises the region with target nucleic acid 100% complementation, and the region of wherein this 100% complementation is at least 10 core bases.In certain embodiments, the core base sequence of oligonucleotide comprises the region with target nucleic acid 100% complementation, and the region of wherein this 100% complementation is at least 6 core bases.In certain embodiments, the core base sequence of oligonucleotide comprises the region with target nucleic acid 100% complementation, and the region of wherein this 100% complementation is at least 7 core bases.In certain embodiments, target nucleic acid is Mammals target nucleic acid.In certain embodiments, Mammals target nucleic acid behaviour target nucleic acid.
In certain embodiments, oligomeric compounds at least comprises 1 to 3 end group nucleosides in one end at it.In certain embodiments, oligomeric compounds comprises 1 to 3 end group nucleosides at 3 '-end.In certain embodiments, oligomeric compounds comprises 1 to 3 end group nucleosides at 5 '-end.
In certain embodiments, oligomeric compounds of the present invention is strand.In certain embodiments, oligomeric compounds of the present invention and the second oligomeric compounds match, to form double-strand composition.
In certain embodiments, the invention provides the pharmaceutical composition comprising oligomeric compounds and pharmaceutically acceptable diluent or carrier.In certain embodiments, pharmaceutically acceptable diluent or carrier is pharmaceutical grade Sterile Saline.
In certain embodiments, the invention provides the method comprising and cell is contacted with oligomeric compounds as herein described.In certain embodiments, these class methods comprise detection antisense activity.In certain embodiments, detect antisense activity and comprise the character mutation detected in cell.In certain embodiments, the change that antisense activity comprises the amount detecting cell target nucleic acid is detected.In certain embodiments, the change that antisense activity comprises the amount detecting target protein is detected.In certain embodiments, cell in vitro.In certain embodiments, cell is in animal.In certain embodiments, animal is Mammals.In certain embodiments, Mammals is behaved.
In certain embodiments, the invention provides the method regulating said target mrna in cell, comprise and cell is contacted with oligomeric compounds of the present invention, and thus regulate the mRNA in cell.In certain embodiments, these class methods comprise the character mutation detected in cell.In certain embodiments, method comprises the reduction detecting mRNA level in-site in cell.In certain embodiments, method comprises the change of the amount detecting target protein.In certain embodiments, cell in vitro.In certain embodiments, cell is in animal.In certain embodiments, animal is Mammals.In certain embodiments, Mammals is behaved.
In certain embodiments, the invention provides method pharmaceutical composition of the present invention being administered to animal.In certain embodiments, animal is Mammals.In certain embodiments, Mammals is behaved.In certain embodiments, the method comprises the antisense activity detected in animal.In certain embodiments, the method comprises the change of the amount detecting animal target nucleic acid.In certain embodiments, the method comprises the change of the amount detecting animal target protein.In certain embodiments, the method comprises the character mutation detected in animal.In certain embodiments, character mutation is the amount of active bio marker or the change of quality.
In certain embodiments, the invention provides oligomeric compounds of the present invention for the manufacture of being used for the treatment of with the medicament of the unexpected genetic expression disease that is feature.
In certain embodiments, the invention provides oligomeric compounds of the present invention for the manufacture of the medicament being used for the disease therapy by inhibition of gene expression.
In certain embodiments, the invention provides the method comprising and detect antisense activity, wherein antisense activity is that microRNA stand-in are active.In certain embodiments, the change that microRNA stand-in activity comprises the amount detecting cell target nucleic acid is detected.In certain embodiments, the change that microRNA stand-in activity comprises the amount detecting cell target protein is detected.
In certain embodiments, the method of inhibition of gene expression comprises makes cell contact with oligomeric compounds as provided herein or double-strand composition, a chain of wherein said oligomeric compounds or double-strand composition comprises about 8 to about 40 monomer subunit, and complementary with target RNA.In certain embodiments, cell is in animal.In certain embodiments, cell is in people.In certain embodiments, target RNA is selected from mRNA, pre-mRNA and micro RNA.In certain embodiments, target RNA is mRNA.In certain embodiments, target RNA is people mRNA.In certain embodiments, target RNA is cleaved, thus suppresses its function.In certain embodiments, the method comprises the level detecting target RNA further.
In certain embodiments, provide the method for vitro inhibition genetic expression, comprise and one or more cell or tissues are contacted with oligomeric compounds as provided herein or double-strand composition.
In certain embodiments, oligomeric compounds as provided herein or double-strand composition are used for the method for inhibition of gene expression in body, described method comprises makes one or more cells, tissue or animal contact with oligomeric compounds as provided herein or double-strand composition.
In certain embodiments, oligomeric compounds as provided herein or double-strand composition are used for pharmacological agent.
Detailed Description Of The Invention
Unless provided clear and definite definition, otherwise be known in the art and conventional those in conjunction with the name used of analytical chemistry as herein described, Synthetic Organic Chemistry and pharmaceutical chemistry and its program and technology.Standard technique can be used for chemosynthesis and chemical analysis.Some this type of technology and program are found in such as: " Carbohydrate Modifications in Antisense Research ", Sangvi and Cook edits, American Chemical Society, Washington D.C., 1994; " Remington ' s Pharmaceutical Sciences ", Mack Publishing Co., Easton, Pa., the 18th edition, nineteen ninety; With " Antisense Drug Technology, Principles, Strategies, and Applications ", Stanley T.Crooke edits, CRC Press, BocaRaton, Florida; And Sambrook etc., " Molecular Cloning, A laboratoryManual ", the 2nd edition, Cold Spring Harbor Laboratory Press, 1989 years, they were incorporated to way of reference for any object accordingly.When allowing, all patents referenced in entire chapter is open, patent application, the patent application of announcing and other publication and other data are all overall to be incorporated to way of reference.
Except as otherwise noted, otherwise following term all has following implication:
As used herein, " nucleosides " refers to the compound comprising heterocyclic base moiety and sugar moieties.Nucleosides include but not limited to naturally occurring nucleosides (as being present in DNA and RNA), without base nucleosides, modification nucleosides and there is the nucleosides of mimicry base (mimetic base) and/or glycosyl.Nucleosides can be modified by multiple substituent any one.Nucleosides can comprise phosphonate moiety.
As used herein, " sugar moieties " refers to sugared ring that is natural or that modify or sugar replacement.
As used herein, term " sugar replacement " refers to the structure of the furanose ring that can replace naturally occurring nucleosides.In certain embodiments, sugar replacement is non-furanose (or 4 '-replace furanose) ring or member ring systems or open system.This class formation comprises simple change relative to natural furanose ring, such as six-ring; Or can be more complicated, the same with the non-member ring systems for peptide nucleic acid(PNA).Sugar replacement includes but not limited to morpholine base class, tetrahydrobenzene base class and nucite class.Have at great majority in the nucleosides of sugar replacement group, usually heterocyclic base moiety is remained and allow hybridization.
As used herein, " Nucleotide " refers to the nucleosides comprising phosphoric acid ester linking group further.As used herein, thus " nucleosides of connection " by maybe can't help the connection of phosphoric acid ester bonding, and can comprise " Nucleotide of connection ".
As used herein, " core base " or " heterocyclic base moiety " refer to the heterocyclic base moiety of nucleosides.Core base can be naturally occurring or can be modified.In certain embodiments, can comprise can with hydrogen bonded to any atom in the base of another nucleic acid or one group of atom for core base.
As used herein, " modified nucleoside " refers to and comprise at least one nucleosides modified compared with naturally occurring RNA or DNA nucleosides.This type of modification can be positioned at sugar moieties and/or be positioned in core base.
As used herein, " bicyclic nucleoside " or " BNA " refers to the nucleosides with following sugar moieties, this sugar moieties comprises sugared ring (including but not limited to furanose, such as sugar replacement), and sugared ring comprises two carbon atoms of the sugared ring of connection to form the bridge of second ring.In certain embodiments, 4 ' carbon of 5 yuan of sugared rings is connected to 2 ' carbon by described bridge.
As used herein, " 4 '-2 ' bicyclic nucleoside " refer to the bicyclic nucleoside comprising following furanose ring, this furanose ring comprises the bridge of two carbon atoms connecting furanose ring, and it connects 2 ' carbon atom and the 4 ' carbon atom of sugared ring.
As used herein, " 2 '-modify " or " 2 '-replace " referring to the nucleosides comprising sugar, this sugar comprises again the substituting group of non-H or OH in 2 ' position.2 '-modified nucleoside includes but not limited to: the bicyclic nucleoside that sugared ring 2 ' carbon is connected with another carbon by the bridge wherein connecting two carbon atoms of sugared ring; And there is the substituent nucleosides of non-bridge joint 2 ', these substituting groups are allyl group, amino, azido-, mercaptan, O-allyl group, O-C such as
1-C
10alkyl ,-OCF
3, O-(CH
2)
2-O-CH
3, 2 '-O (CH
2)
2sCH
3, O-(CH
2)
2-O-N (R
m) (R
n) or O-CH
2-C (=O)-N (R
m) (R
n), wherein each R
mand R
nbe H or substituted or unsubstituted C independently
1-C
10alkyl.2 '-modified nucleoside can comprise other further and modify, such as, on other position of sugar and/or in core base.
As used herein, " 2 '-F " refers to the nucleosides comprising sugar, and this sugar comprises fluorin radical again in 2 ' position.
As used herein, " 2 '-OMe " or " 2 '-OCH
3" or " 2 '-O-methyl " all refers to the nucleosides comprising sugar, this sugar comprises-OCH in 2 ' position of sugared ring again
3group.
As used herein, " MOE " or " 2 '-MOE " or " 2 '-OCH
2cH
2oCH
3" or " 2 '-O-methoxy ethyl " all refers to the nucleosides comprising sugar, this sugar comprises-OCH in 2 ' position of sugared ring again
2cH
2oCH
3group.
As used herein, " oligonucleotide " refers to the compound of the nucleosides comprising multiple connection.In certain embodiments, one or more in these multiple nucleosides are modified.In certain embodiments, oligonucleotide comprises one or more ribonucleoside (RNA) and/or dezyribonucleoside (DNA).
As used herein, " oligonucleoside " refers to wherein all internucleoside linkage not containing the oligonucleotide of phosphorus atom.As used herein, oligonucleotide comprises oligonucleoside.
As used herein, " oligonucleotide of modification " refers to the oligonucleotide of the internucleoside linkage comprising at least one nucleosides modified and/or at least one modification.
As used herein, " internucleoside linkage " refers to the covalent linkage between adjacent nucleosides.
As used herein, " naturally occurring internucleoside linkage " refers to 3 ' to 5 ' phosphodiester bond.
As used herein, " between modified nucleoside bonding " refers to any internucleoside linkage of the internucleoside linkage that non-natural exists.
As used herein, " oligomeric compounds " refers to the paradigmatic structure comprising two or more substructures or monomer subunit.In certain embodiments, oligomeric compounds is oligonucleotide.In certain embodiments, oligomeric compounds comprises one or more conjugation group and/or end group.
As used herein, except as otherwise noted or revise, otherwise term " double-strand " refers to the oligomeric compounds that two kinds of hybridizing each other are independent.This type of double chain compound can have the non-hybridization nucleosides (mispairing) of one or more non-hybridization nucleosides (pendency) and/or one or more inside at the one or both ends place of one or two chain, and prerequisite there is enough complementarity to maintain the hybridization under physiology correlated condition.
As used herein, term " from complementary " or " hair clip " refer to the single oligomeric compounds comprising the duplex region formed by oligomeric compounds oneself hybridization.
As used herein, term " strand " refers to not with its complementary sequence hybridization and does not have enough complementarity certainly to form the oligomeric compounds of hairpin structure under physiology correlated condition.Single chain compound can be attached to its complementary sequence thus become double-strand or partially double stranded compound.
As used herein, " end group " refers to that one or more oligonucleotide 3 ' that is connected to is held or one of 5 ' end or both atom.In certain embodiments, end group is conjugation group.In certain embodiments, end group comprises one or more other nucleosides.
As used herein, " conjugate " refers to the atom or one group of atom that are attached to oligonucleotide or oligomeric compounds.In general, conjugation group changes one or more character of its compound be connected to, includes but not limited to pharmacodynamics, pharmacokinetics, combination, absorption, cell distribution, cellular uptake, electric charge and removing.Conjugation group is used in chemical field usually, and directly connects or be connected on parent compound such as oligomeric compounds by optional connection portion or linking group.In certain embodiments, conjugation group includes but not limited to intercalator, reporter molecules, polyamine class, polyamide-based, polyethylene glycols, thioether class, polyethers, cholesterol, sulfydryl cholesterol, cholic acid part, folate, lipid, phosphatide, vitamin H, azophenlyene, phenanthridines, anthraquinone, diamantane, acridine, fluorescein, rhodamine, tonka bean camphor and dyestuff.In certain embodiments, conjugate is end group.In certain embodiments, conjugate is connected to 3 ' or 5 ' end nucleotide or is connected to the inside nucleosides of oligonucleotide.
As used herein, " conjugate linking group " refers to any atom for conjugate being connected to oligonucleotide or oligomeric compounds or one group of atom.All those linking groups or difunctionality connection portion are as known in the art suitable for the present invention.
As used herein, " antisense compounds " refers to oligomeric compounds, and it is at least partially with complementary at least partly with its target nucleic acid of hybridizing.In certain embodiments, antisense compounds regulates expression or the amount of (increase or reduce) target nucleic acid.In certain embodiments, antisense compounds changes the montage of target pre-mRNA, thus causes different splice variants.In certain embodiments, antisense compounds regulates the expression of one or more different target proteins.The antisense mechanism imagined herein includes but not limited to that RNA enzyme H mechanism, RNAi are machine-processed, montage regulates, translation blocks, changes RNA processing, suppresses microRNA function or simulation microRNA function.
As used herein, " expression " refers to that gene is so as to finally producing protedogenous process.Expression includes but not limited to transcribe, montage, post transcriptional modificaiton and translation.
As used herein, " RNAi " refers to the mechanism of some antisense compounds so as to the expression or amount that affect target nucleic acid.RNAi mechanism relates to RISC approach.
As used herein, " RNAi compound " refers to and makes the oligomeric compounds in order to regulate target nucleic acid and/or the protein by target nucleic acid encodes by RNAi mechanisms play at least in part.RNAi compound includes but not limited to double-strand short interfering rna (siRNA), single stranded RNA (ssRNA) and microRNA, comprises microRNA stand-in.
As used herein, " antisense oligonucleotide " refers to the antisense compounds into oligonucleotide.
As used herein, " antisense activity " refers to hybridization owing to antisense compounds and its target nucleic acid and anyly detecting and/or measurable activity of producing.In certain embodiments, this activity can be rising or the reduction of the amount of nucleic acid or protein.In certain embodiments, this activity can be the change of the splice variant ratio of nucleic acid or protein.It can be direct or indirect for detecting and/or measure antisense activity.Such as, in certain embodiments, antisense activity is assessed by the relative quantity of the splice variant of the amount or target protein that detect and/or measure target protein.In certain embodiments, antisense activity is by detecting and/or measure target nucleic acid and/or cracking target nucleic acid and/or assessing for the amount of montage target nucleic acid alternatively.In certain embodiments, antisense activity is assessed by the character mutation in observation cell or animal.
As used herein, binding activities, reaction or effect " detection " or " measurement " represent the test carried out for detecting or measure this activity, reaction or effect.It is zero that this detection and/or measurement can comprise value.Therefore, if the test for detecting or measuring causes finding non-activity (flexibility), but but executed detects or measures active step.Such as, in certain embodiments, the invention provides the method comprising the step detecting antisense activity, detection toxicity and/or measure toxicity markers's thing.It is zero that any this step can comprise value.
As used herein, " target nucleic acid " refers to any nucleic acid molecule that its expression, amount or activity can be regulated by antisense compounds.In certain embodiments, target nucleic acid is DNA or RNA.In certain embodiments, target RNA is mRNA, pre-mRNA, non-coding RNA, pri-microRNA, pre-microRNA, ripe microRNA, promoter regulation RNA or natural antisense transcript.Such as, target nucleic acid can be that it is expressed the cytogene relevant to specified disease or the morbid state mRNA of genetic transcription (or from) or is the nucleic acid molecule from infectious agent.In certain embodiments, target nucleic acid is virus or bacterial nucleic acid.
As used herein, " said target mrna " refers to the RNA molecule of the coded protein selected in advance.
As used herein, " target pre-mRNA " refers to the rna transcription thing being processed into mRNA not yet completely selected in advance.It is apparent that pre-RNA comprises one or more intron.
As used herein, " target microRNA " refers to that the length selected in advance is the non-coding RNA molecule of about 18-30 core base, and it regulates one or more protein expressions, or refers to the precursor of this non-encoding molecules.
As used herein, " target pdRNA " refer to select in advance interact to regulate the RNA molecule of transcribing with one or more promotors.
As used herein, " microRNA " refers to the naturally occurring non-coding tiny RNA in translation skill inhibition of gene expression.In certain embodiments, microRNA is by being attached to target spot in the untranslated region of target nucleic acid 3 ' and inhibition of gene expression.In certain embodiments, microRNA has the core base sequence as shown in miRBase, and described miRBase is the database of a published microRNA sequence, and network address is http://microrna.sanger.ac.uk/sequences/.In certain embodiments, microRNA has the core base sequence as shown in the miRBase 10.1 editions as issued in December, 2007, and this version entirety is incorporated herein by reference.In certain embodiments, microRNA has the core base sequence as shown in the miRBase 12.0 editions as issued in September, 2008, and this version entirety is incorporated herein by reference.
As used herein, " microRNA stand-in " refer to the oligomeric compounds with the sequence identical at least partly with the sequence of microRNA.In certain embodiments, microRNA stand-in comprise the microRNA seed region of microRNA.In certain embodiments, microRNA stand-in regulate the translation of more than a kind of target nucleic acid.
As used herein, " seed region " refers to that being positioned at antisense compounds 5 ' holds or region near it, and this region has the core base sequence that the target nucleic acid identification carried out this antisense compounds exists significance.In certain embodiments, seed region comprises 2-8 core base of antisense compounds.In certain embodiments, seed region comprises 2-7 core base of antisense compounds.In certain embodiments, seed region comprises 1-7 core base of antisense compounds.In certain embodiments, seed region comprises 1-6 core base of antisense compounds.In certain embodiments, seed region comprises 1-8 core base of antisense compounds.
As used herein, " microRNA seed region " refers to the seed region of microRNA or microRNA stand-in.In certain embodiments, microRNA seed region comprises 2-8 core base of microRNA or microRNA stand-in.In certain embodiments, microRNA seed region comprises 2-7 core base of microRNA or microRNA stand-in.In certain embodiments, microRNA seed region comprises 1-7 core base of microRNA or microRNA stand-in.In certain embodiments, microRNA seed region comprises 1-6 core base of microRNA or microRNA stand-in.In certain embodiments, microRNA seed region comprises 1-8 core base of microRNA or microRNA stand-in.
As used herein, " seed coupling fragment " refers to the target nucleic acid part had with the core base of seed region complementation.In certain embodiments, seed coupling fragment has the core base with 2-8 core base complementrity of siRNA, ssRNA, natural microRNA or microRNA stand-in.In certain embodiments, seed coupling fragment has the core base with 2-7 core base complementrity of siRNA, ssRNA, microRNA or microRNA stand-in.In certain embodiments, seed coupling fragment has the core base with 1-6 core base complementrity of siRNA, ssRNA, microRNA or microRNA stand-in.In certain embodiments, seed coupling fragment has the core base with 1-7 core base complementrity of siRNA, ssRNA, microRNA or microRNA stand-in.In certain embodiments, seed coupling fragment has the core base with 1-8 core base complementrity of siRNA, ssRNA, microRNA or microRNA stand-in.
As used herein, " seed coupling target nucleic acid " refers to the target nucleic acid comprising seed coupling fragment.
As used herein, " microRNA family " refers to one group of microRNA having microRNA Seed Sequences.In certain embodiments, microRNA family member regulates one group of common target nucleic acid.In certain embodiments, total microRNA Seed Sequences is present in core base positions identical in each member of microRNA family.In certain embodiments, total microRNA Seed Sequences is not present in core base positions identical in each member of microRNA family.Such as, the microRNA Seed Sequences being present in 1-7 the core base of a microRNA family member is found in 2-8 the core base of another member of microRNA family.
As used herein, " target non-coding RNA " refers to select in advance untranslated to produce protedogenous RNA molecule.Some non-coding RNA participates in the adjustment expressed.
As used herein, " target viral nucleic acid " refers to the nucleic acid (RNA or DNA) relevant to virus selected in advance.Whether this viral nucleic acid comprises the virus genomic nucleic acid of formation, and the transcript of those nucleic acid (comprising reverse transcription thing and the RNA by rna transcription), no matter and produced by host cell machinery.In some cases, the host nucleic acids taken over for use by virus after viral nucleic acid also comprises virus infection.
As used herein, " target " refers to that in antisense compounds and particular target nucleic acid molecule or target nucleic acid molecule, associate in specific nucleotide region.If antisense compounds and target nucleic acid are fully complementary thus allow to hybridize in physiological conditions, then this target nucleic acid of its target.
As used herein, " target protein " refers to that it expresses the protein regulated by antisense compounds.In certain embodiments, target protein is by target nucleic acid encodes.In certain embodiments, the expression of target protein is otherwise by the impact of target nucleic acid.
As used herein, " core base complement " or " complementarity " refers to regard to core base time and can carry out the core base of base pairing with another core base.Such as, in DNA, VITAMIN B4 (A) is complementary with thymus pyrimidine (T).Such as, in RNA, VITAMIN B4 (A) is complementary with uridylic (U).In certain embodiments, complementary core base refers to can carry out the core base of the antisense compounds of base pairing with the core base of its target nucleic acid.Such as, if the core base in a certain position of antisense compounds can become hydrogen bond with the core base in a certain position of target nucleic acid, then think that the position of the hydrogen bond between oligonucleotide and target nucleic acid is complementary at this core base pair place.Comprise some core base of modifying and can keep the ability with corresponding core base pairing, and therefore still can have core base complement.
As used herein, " non-complementary " refers to a pair core base not forming hydrogen bond each other or in other words do not support to hybridize with regard to core base time.
As used herein, refer to the ability of oligomeric compounds by core base complement and another oligomeric compounds or nucleic acid hybridization when " complementary " is with regard to the nucleosides of just connection, oligonucleotide or nucleic acid.In certain embodiments, when the corresponding position of sufficient amount in each molecule is occupied by the core base that can be bonded to each other thus allows the stable association between antisense compounds and target, antisense compounds and target complimentary to one another.Those skilled in the art recognizes, may comprise mispairing, and can not lose the ability of oligomeric compounds maintenance association.Therefore, described herein is the antisense compounds of the Nucleotide (that is, not being the core base with corresponding target nucleotide complementation) of the mispairing that can comprise at most about 20%.Preferably, antisense compounds comprises and is no more than about 15%, more preferably no more than about 10%, be most preferably not exceeding 5% mispairing or without mispairing.Remaining Nucleotide be core base complementrity or in other words can not destroy hybridization (such as, universal base).Those of ordinary skill in the art will appreciate that, compound provided herein and target nucleic acid at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementation.
As used herein, " hybridization " refers to the pairing of complementary oligomeric compounds (such as, antisense compounds and target nucleic acid thereof).Although be not limited to concrete mechanism, modal pairing mechanism relates between complementary nucleotide or nucleotide base (core base) and becomes hydrogen bond, and it can be Watson-Crick, Hoogsteen or anti-Hoogsteen hydrogen bond.Such as, natural nucleobases VITAMIN B4 and natural nucleobases thymidine and uridylic are core base complementrity, and they match by forming hydrogen bond.Natural base guanine is the core base with natural base cytosine(Cyt) and 5-methylcytosine complementation.Hybridization can occur in varied situations.
As used herein, " specific hybrid " refers to that oligomeric compounds is with the ability of hybridizing higher than the avidity of hybridizing with another nucleic acid sequences and a nucleic acid sequences.In certain embodiments, antisense oligonucleotide and a more than target site specificity are hybridized.
As used herein, when " adjustment " refers to compared with the function before regulating or activity, the amount of this function or activity or quality generation disturbance.Such as, regulate and comprise change genetic expression, this change comprises increase (stimulating or induction) or reduces (suppress or reduce).And for example, the adjustment of expression can comprise the splice site selection of disturbance pre-mRNA processing, thus causes compared with intact condition, and the amount of existing specific splice variant changes.For another example, the translation comprising disturbance protein is regulated.
As used herein, " motif " refers to the modification pattern in oligomeric compounds or its region.Motif can be limited by the modification at some nucleosides place of oligomeric compounds and/or some linking group place.
As used herein, " nucleosides motif " refers to that the nucleosides in oligomeric compounds or its region modifies pattern.The bonding of this oligomeric compounds can for modify or unmodified.Except as otherwise noted, otherwise the motif only describing nucleosides be herein intended to represent nucleosides motif.Therefore, in such cases, these bondings are unrestricted.
As used herein, " bonding motif " refers to the pattern that the bonding in oligomeric compounds or its region is modified.The nucleosides of this oligomeric compounds can for modify or unmodified.Except as otherwise noted, otherwise the motif only describing bonding be herein intended to represent bonding motif.Therefore, in such cases, nucleosides is unrestricted.
As used herein, " different modifications " or " different modifying " refer to the modification of relative to each other different naturally occurring molecules, comprise and there is not modification.Therefore, such as, even if DNA nucleosides is not modified, the DNA nucleosides of MOE nucleosides and unmodified is also " different modifying ".Equally, even if DNA and RNA is naturally occurring unmodified nucleosides, both are also " different modifying ".Except as otherwise noted, otherwise nucleosides that is identical but that comprise different IPs base is not different modifying.Such as, the nucleosides comprising 2 '-OMe modification sugar and VITAMIN B4 core base and the nucleosides comprising 2 '-OMe modification sugar and thymus pyrimidine core base are not different modifying.
As used herein, " identical modification " refers to the modification of relative to each other identical naturally occurring molecule, comprises and there is not modification.Therefore, such as, even if DNA nucleosides is not modified, the DNA nucleosides of two unmodifieds also has " identical modification ".
As used herein, " modified types " about a kind of nucleosides or one " class " nucleosides refers to the modification of nucleosides and comprises modification and not modified nucleosides.Except as otherwise noted, otherwise " have the first kind modify nucleosides " can be the nucleosides of unmodified therefore.
As used herein, " independent region " refers to a part for oligomeric compounds, and the nucleosides wherein in this region and internucleoside linkage all comprise identical modification; And the nucleosides of any adjacent part and/or internucleoside linkage comprise at least one different modification.
As used herein, " alternately motif " refers to oligomeric compounds or its part, and it has at least four independent modified nucleoside regions, and pattern is (AB)
na
m, wherein A represents the nucleosides region with the first modified types; B represents the nucleosides region with different modifying type; N is 2-15; And m is 0 or 1.Therefore, in certain embodiments, alternately motif comprises 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or 20 or more graded areas.In certain embodiments, each a-quadrant and each B region comprise 1-4 nucleosides independently.
As used herein, " modifying completely " refers to that wherein each nucleosides is the oligomeric compounds of modified nucleoside or the part on it.The modification of the nucleosides of the oligomeric compounds modified completely can be all identical, or one or more can be different from each other.
As used herein, " evenly modifying " or " modifying equably " refer to the oligomeric compounds or its part that comprise identical modification.The nucleosides in the nucleosides region modified equably all comprises identical modification.
As used herein, term " gapmer " or " breach oligomeric compounds " refer to the oligomeric compounds with two external regions or flank and an interior region or breach.These three regions form adjacent monomer subunit sequence, and the glycosyl of external region is different from the glycosyl of interior region, and the glycosyl of each monomer subunit wherein in specific region is substantially the same.
As used herein, " pharmaceutically acceptable carrier or thinner " refers to any material being applicable to use to animal.In certain embodiments, pharmaceutically acceptable carrier or thinner are Sterile Saline.In certain embodiments, this Sterile Saline is pharmaceutical grade salt solution.
" substituting group " or " substituted radical " is intended to comprise and usually adds on other group or parent compound to strengthen desirable properties or to provide the group of other desired effects as the term is employed herein.Substituted radical can be protected or not protected, and can be added in parent compound an available site or multiple available site.Substituted radical can also be replaced by other substituted radical further, and can directly or by linking group such as alkyl or alkyl be connected on parent compound.
The substituted radical be applicable to herein includes but not limited to: halogen, hydroxyl, alkyl, thiazolinyl, alkynyl, acyl group (-C (O) R
aa), carboxyl (-C (O) O-R
aa), aliphatic group, alicyclic group, alkoxyl group, replacement oxygen base (-O-R
aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (-N (R
bb) (R
cc)), imino-(=NR
bb), amide group (-C (O) N (R
bb) (R
cc) or-N (R
bb) C (O) R
aa), azido-(-N
3), nitro (-NO
2), cyano group (-CN), carbamido group (carbamido) (-OC (O) N (R
bb) (R
cc) or-N (R
bb) C (O) OR
aa), urea groups (-N (R
bb) C (O) N (R
bb) (R
cc)), thioureido (-N (R
bb) C (S) N (R
bb) (R
cc)), guanidine radicals (-N (R
bb) C (=NR
bb) N (R
bb) (R
cc)), amidino groups (amidinyl) (-C (=NR
bb) N (R
bb) (R
cc) or-N (R
bb) C (=NR
bb) (R
aa)), mercaptan (-SR
bb), sulfinyl (-S (O) R
bb), alkylsulfonyl (-S (O)
2r
bb) and sulfoamido (-S (O)
2n (R
bb) (R
cc) or-N (R
bb) S (O)
2r
bb).Wherein each R
aa, R
bband R
ccbe H, the chemical functional group optionally connected or further substituted radical independently, wherein preferred list includes but not limited to H, alkyl, thiazolinyl, alkynyl, aliphatic group, alkoxyl group, acyl group, aryl, aralkyl, heteroaryl, alicyclic group, heterocyclic group and heteroarylalkyl.Substituting group selected in compound described herein exists with recurrence degree (recursive degree).
In this category, " recurrence substituting group " refers to that a substituting group can exist another this substituting group.Due to this type of substituent recursiveness, therefore in theory, a large amount of substituting groups can be there is in any given claim.The those of ordinary skill of pharmaceutical chemistry and organic chemistry filed is reasonably limited understanding this type of substituent sum by the desirable properties of expecting compound.This type of character comprises physical properties such as molecular weight, solubleness or log P in mode for example and not limitation, and application feature is such as the activity of expection target, and practical character is such as easily synthetic.
Recurrence substituting group is contemplated aspects of the present invention.The those of ordinary skill of pharmaceutical chemistry and organic chemistry filed will understand this type of substituent versatility.Be present in the degree in the claims in the present invention at recurrence substituting group under, its sum will be determined as mentioned above.
" stable compound " and " rock steady structure " is intended to represent enough sane can be separated to useful purity from reaction mixture and to be mixed with the compound of effective therapeutical agent as the term is employed herein.Only consider stable compound herein.
" alkyl " refers to the saturated straight chain or branched hydrocarbyl that comprise maximum 24 carbon atoms as the term is employed herein.The example of alkyl includes but not limited to methyl, ethyl, propyl group, butyl, sec.-propyl, n-hexyl, octyl group, decyl, dodecyl etc.Alkyl comprises 1 to about 24 carbon atom usually, more generally comprises 1 to about 12 carbon atom (C
1-C
12alkyl), wherein 1 to about 6 atom is preferred." low alkyl group " comprises 1 to about 6 carbon atom as the term is employed herein.Alkyl as used herein optionally comprises one or more further substituted radical.
" thiazolinyl " refers to and comprises maximum 24 carbon atoms and the straight or branched alkyl with at least one carbon-to-carbon double bond as the term is employed herein.The example of thiazolinyl includes but not limited to vinyl, propenyl, butenyl, 1-methyl-2-butene-1-base, diene such as 1,3-butadiene etc.Thiazolinyl comprises 2 to about 24 carbon atoms usually, more generally comprises 2 to about 12 carbon atoms, and wherein 2 to about 6 carbon atoms are preferred.Thiazolinyl as used herein optionally comprises one or more further substituted radical.
" alkynyl " refers to and comprises maximum 24 carbon atoms and the straight or branched alkyl with at least one carbon-to-carbon triple bond as the term is employed herein.The example of alkynyl includes but not limited to ethynyl, 1-proyl, ethyl acetylene base etc.Alkynyl comprises 2 to about 24 carbon atoms usually, more generally comprises 2 to about 12 carbon atoms, and wherein 2 to about 6 carbon atoms are preferred.Alkynyl as used herein optionally comprises one or more further substituted radical.
" acyl group " refers to the group formed by removing hydroxyl from organic acid as the term is employed herein, and has general formula-C (O)-X, and wherein X is generally aliphatic, alicyclic or aromatics.Example comprises aliphatic carbonyl, aromatics carbonyl, aliphatic sulphonyl groups, aromatics sulfinyl, aliphatic sulfinyl, aromatic phosphate acid ester, aliphatic phosphate etc.Acyl group as used herein optionally comprises further substituted radical.
Term " alicyclic " refers to that wherein ring is the member ring systems of aliphatic series.This member ring systems can comprise one or more ring, and wherein at least one ring is aliphatic.Preferred alicyclic compound comprises in ring the ring with about 5 to about 9 carbon atoms.As used herein, alicyclicly optionally comprise further substituted radical.
As used herein, term " aliphatic series " refers to the straight or branched alkyl comprising maximum 24 carbon atoms, and the saturation ratio wherein between any two carbon atoms is singly-bound, double bond or triple bond.Aliphatic group preferably comprises 1 to about 24 carbon atom, more generally comprises 1 to about 12 carbon atom, and wherein 1 to about 6 group's atom is preferred.The straight or branched of aliphatic group can by one or more heteroatom interruptions comprising nitrogen, oxygen, sulphur and phosphorus.This type of is included but not limited to many alkoxyl groups such as polyalkylene glycols, polyamine class and poly-imines class by the aliphatic group of heteroatom interruptions.As used herein, aliphatic group optionally comprises further substituted radical.
As used herein, term " alkoxyl group " refers to the group formed between alkyl and Sauerstoffatom, and wherein Sauerstoffatom is used for alkoxyl group to be connected to parent molecule.The example of alkoxyl group includes but not limited to methoxyl group, oxyethyl group, propoxy-, isopropoxy, n-butoxy, sec-butoxy, tert.-butoxy, n-pentyloxy, neopentyl oxygen and positive hexyloxy etc.Alkoxyl group as used herein optionally comprises further substituted radical.
" aminoalkyl group " refers to the amino C replaced as the term is employed herein
1-C
12alkyl.The moieties of this group and parent molecule form covalent linkage.Amino can be positioned at any position, and aminoalkyl group can be replaced by further substituted radical at alkyl and/or amino groups.
" aralkyl " and " arylalkyl " refers to and is covalently attached to C as the term is employed herein
1-C
12the aromatic group of alkyl.Moieties and the parent molecule of the aralkyl (or arylalkyl) of gained form covalent linkage.Example includes but not limited to benzyl, styroyl etc.Aralkyl as used herein optionally comprises both the further substituted radicals being connected to alkyl, aryl or forming group.
" aryl " and " aromatics " refers to the carbocyclic ring system group of monocycle or many rings with one or more aromatic ring as the term is employed herein.The example of aryl includes but not limited to phenyl, naphthyl, tetralyl, indanyl, indenyl (idenyl) etc.Preferred aryl ring system has about 5 to about 20 carbon atoms in one or more ring.Aryl as used herein optionally comprises further substituted radical.
" halogen " or " halogen " refers to the atom being selected from fluorine, chlorine, bromine and iodine as the term is employed herein.
" heteroaryl " and " heteroaromatic " refers to the group comprising monocycle or many cyclophanes ring, member ring systems or fused ring system as the term is employed herein, wherein these rings at least one for aromatics and comprise one and or multiple heteroatoms.Heteroaryl is also intended to comprise fused ring system, comprises wherein the one or more of condensed ring and does not contain heteroatomic system.Heteroaryl comprises the annular atoms that is selected from sulphur, nitrogen or oxygen usually.The example of heteroaryl includes but not limited to: pyridyl, pyrazinyl, pyrimidyl, pyrryl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isoxazolyl, thiadiazolyl group, oxadiazolyl, thiophenyl, furyl, quinolyl, isoquinolyl, benzimidazolyl-, benzoxazolyl, quinoxalinyl etc.Heteroaryl can directly or by connection portion such as aliphatic group or heteroatoms be connected on parent molecule.Heteroaryl as used herein optionally comprises further substituted radical.
" heteroarylalkyl " refers to and comprises covalently bound C further as the term is employed herein
1-C
12the heteroaryl as defined before of alkyl.The moieties of gained heteroarylalkyl can form covalent linkage with parent molecule.Example includes but not limited to pyridylmethyl, pyridyl-ethyl group, naphthyridinyl propyl group (napthyridinylpropyl) etc.Heteroarylalkyl as used herein can optionally comprise further substituted radical in the one or both of heteroaryl or moieties.
" heterocyclic group " refers to that comprising at least one with heteroatoms is also undersaturated, fractional saturation or completely saturated monocycle or many rings member ring systems, thus comprises heteroaryl groups as the term is employed herein.Heterocycle is also intended to comprise fused ring system, and wherein the one or more of fused rings comprise at least one heteroatoms, and other ring can comprise one or more heteroatoms or optionally not contain heteroatoms.Heterocyclic group comprises the atom that at least one is selected from sulphur, nitrogen or oxygen usually.The example of heterocyclic group comprises [1,3] dioxolanyl, pyrrolidyl, pyrazolinyl, pyrazolidyl, imidazolinyl, imidazolidyl, piperidyl, pyrazinyl, oxazolidinyl, isoxazole alkyl, morpholinyl, thiazolidyl, isothiazole alkyl, quinoxalinyl, pyridazinyl (pyridazinonyl), tetrahydrofuran base etc.Heterocyclic group as used herein optionally comprises further substituted radical.
Term " alkyl " comprises the group containing C, O and H.It comprises straight chain, side chain and the cyclic group with any saturation ratio.This type of alkyl can comprise one or more heteroatoms being selected from N, O and S, and can be undertaken single or polysubstituted further by one or more substituted radical.
As the term is employed herein " monocycle or polynuclear plane " comprise be selected from monocycle member ring systems or wherein ring be all member ring systems of many rings member ring systems that are that condense or that be connected, and be intended to comprise and be selected from the single of fat base, alicyclic radical, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic radical, heteroaryl, heteroaromatic base and heteroarylalkyl and hybrid ring system individually.This type of monocycle and polynuclear plane can comprise each and have identical saturation ratio or each has the ring of different saturation (comprising completely saturated, fractional saturation or completely unsaturated) independently.Each ring can comprise the annular atoms being selected from C, N, O and S, and to obtain heterocycle and only to contain the ring of C annular atoms, these rings can mix motif to be existed, and such as such as benzoglyoxaline, one of them ring only has carboatomic ring atom, and the ring condensed has two nitrogen-atoms.Monocycle or polynuclear plane can be substituted group further and replace, and such as such as phthalic imidine, it has the two=O group be connected on one of them ring.Monocycle or polynuclear plane can use multiple strategy to be connected on parent molecule, such as directly connected by annular atoms, connect by substituted radical or by difunctionality connection portion.
Term " oxo " refers to group (=O).
All as known in the art those of linking group or difunctionality connection portion can be used for chemical functional group, conjugation group, reporter group and other group being connected on the selectivity site in parent compound such as such as oligomeric compounds.In general, difunctionality connection portion comprises the hydrocarbyl portion with Liang Ge functional group.Select one of them functional group to be attached on parent molecule or the compound paid close attention to, and select another to be attached to substantially on any selected group such as chemical functional group or conjugation group.In some embodiments, the polymkeric substance that base comprises chain structure or repeating unit such as ethylene glycol or Amino Acid Unit is connected.The example being generally used for the functional group of difunctionality connection portion include but not limited to for react electrophile of nucleophilic group and the nucleophile for reacting with electrophilic group.In some embodiments, difunctionality connection portion comprises amino, hydroxyl, carboxylic acid, mercaptan, degree of unsaturation (such as, double bond or triple bond) etc.Some unrestricted examples of difunctionality connection portion comprise 8-amino-3,6-dioxaoctanoic acid (ADO), 4-(N-maleimidomethyl) hexanaphthene-1-carboxylic acid succinimide (SMCC) and 6-aminocaprolc acid (AHEX or AHA).Other linking group includes but not limited to the C replaced
1-C
10alkyl, replacement or unsubstituted C
2-C
10thiazolinyl or replacement or unsubstituted C
2-C
10alkynyl, wherein the non-limiting list of preferred substituents group comprises hydroxyl, amino, alkoxyl group, carboxyl, benzyl, phenyl, nitro, mercaptan, thio alkoxy, halogen, alkyl, aryl, thiazolinyl and alkynyl.
" phosphonate moiety " refers to the terminal phosphate group group comprising phosphoric acid ester and modify phosphoric acid ester as the term is employed herein.Phosphonate moiety can be positioned at arbitrary end, but is preferably placed at 5 '-end nucleotide.In one aspect, terminal phosphate ester unmodified, has formula-O-P (=O) (OH) OH.On the other hand, terminal phosphate ester is modified makes the one or more of O and OH group be replaced by H, O, S, N (R) or alkyl, and wherein R is H, amido protecting group or alkyl that is unsubstituted or that replace.In certain embodiments, 5 ' and/or 3 ' end group can comprise 1 to 3 phosphonate moiety, and they are (two or triguaiacyl phosphate) of unmodified independently of one another or modify.
As used herein, term " phosphorus part " refers to the group with following formula:
Wherein:
R
aand R
cbe OH, SH, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, amino or the amino replaced; And
R
bfor O or S.
The phosphorus part comprised herein can be connected to and can be used for preparing on the monomer of oligomeric compounds, wherein can use O, S, NR
dor CR
er
fconnect this monomer, wherein R
dinclude but not limited to H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6the acyl group of alkynyl or replacement, and R
eand R
finclude but not limited to H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.This type of phosphorus part connected includes but not limited to the phosphorus phosphoramidate of phosphoric acid ester, the phosphoric acid ester of modification, thiophosphatephosphorothioate, the thiophosphatephosphorothioate of modification, phosphonic acid ester, the phosphonic acid ester of modification, phosphoramidate and modification.
" blocking group " refers to that the protective reaction group (including but not limited to hydroxyl, amino and thiol group) that is used for known in the art avoids occurring the unstable chemical part of unexpected reaction in building-up process as the term is employed herein.Blocking group usually in the reaction process of other reactive site optionally and/or orthogonally for the protection of some site, and then can be removed thus in statu quo or the mode that can be used for reaction further discharge unprotected group.Blocking group as known in the art is generally at " Greene ' s Protective Groups inOrganic Synthesis ", and the 4th edition, John Wiley & Sons, New York, described by having in 2007.
Group can be used as precursor and is optionally incorporated in oligomeric compounds as provided herein.Such as, amino can be used as azido-and is placed in compound as provided herein, and described azido-can be chemically converted into amino by the required time point in synthesis.In general, group is protected or is existed for the precursor of inertia as to reaction, and described other region of reacting modification parent molecule, to change into its final group in the suitable time.Further representative blocking group or precursor group are at Agrawal etc., and " Protocols for Oligonucleotide Conjugates ", Humana Press, New Jersey, 1994, discusses in the 26th volume 1-72 page to some extent.
Term " orthogonally protect " refers to the functional group protected by inhomogeneous blocking group, wherein every class blocking group can in any order and be removed under other classes all exist (see Barany etc., J.Am.Chem.Soc., 1977,99,7363-7365; Barany etc., J.Am.Chem.Soc., 1980,102,3084-3095).Orthogonally protect is widely used in such as oligonucleotide synthesis automatically.By functional group's deblocking under one or more other protected functional group existence not being subject to deblocking process influence.The functional group of this deblocking is reacted in a certain manner, and puts sometime remove further orthogonal protecting group under a different set of reaction conditions.This allows to realize selection chemical reaction, thus obtains compound or the oligomeric compounds of expectation.
The example of hydroxy-protective group includes but not limited to ethanoyl, the tertiary butyl, t-butoxymethyl, methoxymethyl, THP trtrahydropyranyl, 1-ethoxyethyl group, 1-(2-chloroethoxy) ethyl, rubigan, 2,4-dinitrophenyl, benzyl, 2,6-dichloro benzyl, diphenyl methyl, to nitrobenzyl, two (2-acetoxyethoxy) methyl (ACE), the trimethyl silicon based ethyl of 2-, trimethyl silicon based, triethyl is silica-based, t-Butyldimethylsilyl, tert-butyl diphenyl is silica-based, triphenyl is silica-based, [(triisopropylsilyl) oxygen base] methyl (TOM), benzoyl formate, chloracetyl, tribromo-acetyl base, trifluoroacetyl group, valeryl, benzoyl, to Phenylbenzoyl, 9-fluorenyl methyl carbonic ether, methylsulfonic acid ester group, toluenesulphonic acids ester group, trityl group (trityl), monomethoxytrityl, dimethoxytrityl (DMT), trimethoxytrityl, 1 (2-fluorophenyl)-4-methoxy piperide-4-base (FPMP), 9-phenyl yanthine-9-base (Pixyl) and 9-(p-methoxyphenyl) xanthine-9-base (MOX).Wherein more conventional hydroxy-protective group includes but not limited to that benzyl, 2,6-dichloro benzyls, t-Butyldimethylsilyl, tert-butyl diphenyl are silica-based, benzoyl, methylsulfonyl, toluenesulphonic acids ester group, dimethoxytrityl (DMT), 9-phenyl yanthine-9-base (Pixyl) and 9-(p-methoxyphenyl) xanthine-9-base (MOX).
Be usually used in protecting the example of the blocking group of phosphoric acid ester and phosphorus hydroxyl to include but not limited to methyl, ethyl, benzyl (Bn), phenyl, sec.-propyl, the tertiary butyl, allyl group, cyclohexyl (cHex), 4-methoxy-benzyl, 4-chlorobenzyl, 4-nitrobenzyl, 4-acyloxybenzyl, 2-aminomethyl phenyl, 2,6-3,5-dimethylphenyl, 2-chloro-phenyl-, diphenyl methyl, 4-methylthio group-1-butyl, 2-(S-acetylthio) ethyl (SATE), 2-cyanoethyl, 2-cyano group-1,1-dimethyl ethyl (CDM), 4-cyano group-crotyl, 2-(trimethyl silicon based) ethyl (TSE), 2-(thiophenyl) ethyl, 2-(triphenyl is silica-based) ethyl, 2-(benzyl alkylsulfonyl) ethyl, 2,2,2-trichloroethyl, 2,2,2-three bromomethyl, 2,3-dibromopropyl, 2,2,2-trifluoroethyl, thiophenyl, the chloro-4-tritylphenyl of 2-, 2-bromophenyl, 2-[N-sec.-propyl-N-(4-anisoyl) is amino] ethyl, 4-(N-TFA base is amino) butyl, 4-oxopentyl, 4-tritylamino phenyl, 4-benzylaminophenyl and morpholino.Wherein more conventional phosphoric acid ester and phosphorus blocking group include but not limited to methyl, ethyl, benzyl (Bn), phenyl, sec.-propyl, the tertiary butyl, 4-methoxy-benzyl, 4-chlorobenzyl, 2-chloro-phenyl-and 2-cyanoethyl.
The example of amido protecting group includes but not limited to carbamate protecting group, the trimethyl silicon based ethoxy carbonyl of such as 2-(Teoc), 1-methyl isophthalic acid-(4-xenyl) ethoxy carbonyl (Bpoc), tert-butoxycarbonyl (BOC), allyloxy carbonyl (Alloc), 9-fluorenylmethoxycarbonyl groups (Fmoc) and benzyloxycarbonyl (Cbz); Amide blocking group, such as formyl radical, ethanoyl, three halogen ethanoyl, benzoyl and nitrophenyl ethanoyl; Sulfanilamide (SN) blocking group, such as 2-nitrobenzenesulfonyl; And imines and cyclin imide blocking group, such as phthalimide-based and dithio succinyl (dithiasuccinoyl).
The example of thiol protective group includes but not limited to trityl group (trityl), benzyl (Bn) etc.
In certain embodiments, the oligomeric compounds as provided herein of the phosphorous internucleoside linkage with one or more optional protection can be prepared.The representative blocking group of phosphorous internucleoside linkage such as phosphodiester and thiophosphatephosphorothioate bonding comprises β-cyanoethyl, the silica-based ethyl of phenylbenzene, δ-cyano group butenyl, cyano group p-Xylol base (CPX), N-methyl-N-TFA base ethyl (META), acetoxyl group Phenoxyethyl (APE) and butylene-4-base.See such as U.S. Patent No. 4,725,677 and Re.34,069(β-cyanoethyl); Beaucage etc., Tetrahedron, 1993,49 (10), 1925-1963; Beaucage etc., Tetrahedron, 1993,49 (46), 10441-10488; Beaucage etc., Tetrahedron, 1992,48 (12), 2223-2311.
In certain embodiments, provide the compound with reactive phosphorus group, it can be used for forming internucleoside linkage, comprises such as phosphodiester and thiophosphatephosphorothioate internucleoside linkage.This type of reactive phosphorus group is well known in the art, and comprises P
iIIor P
vthe phosphorus atom of valence state, includes but not limited to phosphamide, H-phosphonic acid ester, phosphotriester and phosphorous chiral auxiliary(reagent).In certain embodiments, reactive phosphorus group is selected from di-isopropyl cyanoethoxy phosphamide (-O
*-P [N [(CH (CH
3)
2]
2] O (CH
2)
2and H-phosphonic acid ester (-O CN)
*-P (=O) (H) OH), wherein O
*thered is provided by the Markush group of monomer.Preferred solid phase synthesis utilizes phosphamide (P
iIIchemistry) as reactive phosphorous acid ester.Use known method that intermediate phosphite ester compound oxidation is become phosphoric acid ester or thiophosphatephosphorothioate (P subsequently
vchemistry) to obtain phosphodiester or thiophosphatephosphorothioate internucleoside linkage.Disclosed in other reactive phosphorus acid esters and phosphorous acid ester have in Tetrahedron Report Number 309 (Beaucage and Iyer, Tetrahedron, 1992,48,2223-2311).
some monomeric compound
In certain embodiments, the compound with formula Ic is provided:
Wherein:
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O, S, NR
14, C (R
15) (R
16), C (R
15) (R
16) C (R
17) (R
18), C (R
15)=C (R
17), OC (R
15) (R
16) or OC (R
15) (Bx
2);
R
14for H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
R
15, R
16, R
17and R
18be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1and Bx
2one of be heterocyclic base moiety, and Bx
1and Bx
2if another exist for H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, the compound with formula I is provided:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be the alkyl of alkyl or replacement independently;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, the compound with formula Ia configuration is provided:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be the alkyl of alkyl or replacement independently;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, G is not H or OH.
In certain embodiments, the compound with formula Ib is provided:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be the alkyl of alkyl or replacement independently;
R is 0 or 1;
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Each R
3and R
4be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
some oligomeric compounds
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIc:
Wherein:
T
1for the phosphorus part optionally protected;
T
2for the compound of formula IIc being connected to the internucleoside linkage group of oligomeric compounds;
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O, S, NR
14, C (R
15) (R
16), C (R
15) (R
16) C (R
17) (R
18), C (R
15)=C (R
17), OC (R
15) (R
16) or OC (R
15) (Bx
2);
R
14for H, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
R
15, R
16, R
17and R
18be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1and Bx
2one of be heterocyclic base moiety, and Bx
1and Bx
2if another exist for H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=X
2) J
1, OC (=X
2) N (J
1) (J
2) and C (=X
2) N (J
1) (J
2);
X
2for O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula II:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
T
2for formula II compound being connected to the internucleoside linkage group of oligomeric compounds rest part;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIa:
Wherein:
Bx is heterocyclic base moiety;
T
1for the phosphorus part optionally protected;
T
2for formula II compound being connected to the internucleoside linkage group of oligomeric compounds rest part;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X is O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprise one or more optional protection independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) ,=NJ
1, SJ
1, N
3, CN, OC (=L) J
1, OC (=L) N (J
1) (J
2) and C (=L) N (J
1) (J
2);
L is O, S or NJ
3;
Each J
1, J
2and J
3be H or C independently
1-C
6alkyl; And
When j is 1, then Z is not halogen or N (E
2) (E
3).
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIb:
In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIb, wherein Q
1and Q
2be H.In certain embodiments, provide oligomeric compounds, it comprises the compound with formula IIb, and wherein G is O (CH
2)
2oCH
3.
In certain embodiments, the nucleosides of oligomeric compounds contained II, IIa, IIb, IIc, IId or IIe.In some this type of embodiment, formula II, IIa, IIb, IIc, IId or IIe nucleosides are positioned at 5 '-end.In some this type of embodiment, the rest part of oligomeric compounds comprises one or more modification.This type of modification can comprise the internucleoside linkage of the sugar moieties of modification, the core base of modification and/or modification.Some this type of modification that can be incorporated in the oligomeric compounds of contained II, IIa, IIb, IIc, IId or IIe nucleosides is positioned at 5 '-end, as known in the art.
some sugar moieties modified
Oligomeric compounds of the present invention optionally comprises one or more nucleosides, and wherein glycosyl is modified.This type of sugar-modified nucleosides can give the nuclease stability of antisense compounds enhancing, the binding affinity of enhancing or some other useful biological properties.In certain embodiments, nucleosides comprises the ribofuranose loop section of chemically modified.The example of the ribofuranose ring of chemically modified includes but not limited to add substituted radical (comprising 5 ' and/or 2 ' substituted radical); Bridge joint two annular atomses are to form dicyclo nucleic acid (BNA); By S, N (R) or C (R
1) (R
2) (R=H, C
1-C
12alkyl or blocking group) substitute ribosyl epoxy atom; And their combination.The example of the sugar of chemically modified comprise 2 '-F-5 '-methyl substituted nucleosides (relevant other disclosed 5 ', 2 '-bis-substituted nucleosides, PCT international application WO2008/101157 see on August 21st, 2008 announces), ribosyl epoxy atom is substituted also further in 2 '-position replacement (see the U.S. Patent application US2005/0130923 that on June 16th, 2005 announces) or alternatively for the 5 '-replacement of BNA is (see the PCT international application WO 2007/134181 of announcement on November 22nd, 2007 by S, wherein LNA is by such as 5 '-methyl or 5 '-vinyl substituted).
The example with the nucleosides of the sugar moieties of modification includes but not limited to comprise 5 '-vinyl, 5 '-methyl (R or S), 4 '-S, 2 '-F, 2 '-OCH
3with 2 '-O (CH
2)
2oCH
3the nucleosides of substituted radical.The substituting group of 2 ' position also can be selected from allyl group, amino, azido-, sulfo-, O-allyl group, O-C
1-C
10alkyl, OCF
3, O (CH
2)
2sCH
3, O (CH
2)
2-O-N (Rm) (Rn) and O-CH
2-C (=O)-N (Rm) (Rn), wherein each Rm and Rn is H or replacement or unsubstituted C independently
1-C
10alkyl.
In certain embodiments, oligomeric compounds of the present invention comprises one or more bicyclic nucleoside.In some this type of embodiment, this bicyclic nucleoside comprises 4 ' and 2 ' bridge between ribosyl annular atoms.In certain embodiments, oligomeric compounds provided herein comprises one or more bicyclic nucleoside, and its jackshaft forms 4 ' to 2 ' bicyclic nucleoside.The example of this type of 4 ' to 2 ' bicyclic nucleoside includes but not limited to one of following formula: 4 '-(CH
2)-O-2 ' (LNA), 4 '-(CH
2)-S-2 ', 4 '-(CH
2)
2-O-2 ' (ENA), 4 '-CH (CH
3)-O-2 ' and 4 '-CH (CH
2oCH
3)-O-2 ' and analogue thereof (see the United States Patent (USP) 7,399,845 that on July 15th, 2008 authorizes); 4 '-C (CH
3) (CH
3)-O-2 ' and analogue thereof (see the international application WO2009/006478 that on January 8th, 2009 announces); 4 '-CH
2-N (OCH
3)-2 ' and analogue (see the PCT international application WO2008/150729 that, on December 11st, 2008 announces); 4 '-CH
2-O-N (CH
3)-2 ' (see the U.S. Patent application US2004/0171570 that on September 2nd, 2004 announces); 4 '-CH
2-N (R)-O-2 ', wherein R is H, C
1-C
12alkyl or blocking group (see the United States Patent (USP) 7,427,672 that on September 23rd, 2008 authorizes); 4 '-CH
2-C (H) (CH
3)-2 ' (see Chattopadhyaya, etc., J.Org.Chem., 2009,74,118-134); And 4 '-CH
2-C (=CH
2)-2 ' and analogue (see the PCT international application WO 2008/154401 that, on December 8th, 2008 announces).Separately see such as: Singh etc., Chem.Commun., 1998,4,455-456; Koshkin etc., Tetrahedron, 1998,54,3607-3630; Wahlestedt etc., Proc.Natl.Acad.Sci.U.S.A., 2000,97,5633-5638; Kumar etc., Bioorg.Med.Chem.Lett., 1998,8,2219-2222; Singh etc., J.Org.Chem., 1998,63,10035-10039; Srivastava etc., J.Am.Chem.Soc., 129 (26) 8362-8379 (July 4,2007); Elayadi etc., Curr.OpinionInvens.Drugs, 2001,2,558-561; Braasch etc., Chem.Biol., 2001,8,1-7; Orum etc., Curr.Opinion Mol.Ther., 2001,3,239-243; U.S. Patent No. 7,053,207,6,268,490,6,770,748,6,794,499,7,034,133,6,525,191,6,670,461 and 7,399,845; International application WO 2004/106356, WO 1994/14226, WO 2005/021570 and WO 2007/134181; U.S. Patent Publication No.US2004/0171570, US2007/0287831 and US2008/0039618; U.S. Patents Serial numbers 12/129,154,60/989,574,61/026,995,61/026,998,61/056,564,61/086,231,61/097,787 and 61/099,844; And PCT international application No.PCT/US2008/064591, PCT/US2008/066154 and PCT/US2008/068922.Can prepare each (see PCT International Application Serial No. PCT/DK98/00393, announcing on March 25th, 1999 with WO 99/14226) of there are one or more stereochemistry sugar configurations and comprising the aforementioned bicyclic nucleoside of such as α-L-ribofuranose and β-D-RIBOSE.
In certain embodiments, the dicyclo sugar moieties of BNA nucleosides includes but not limited to the compound between position at 4 ' and 2 ' of penta furyl glycosyl sugar moieties with at least one bridge, and wherein this type of bridge comprises 1 or 2 to 4 independently independently selected from-[C (R
a) (R
b)]
n-,-C (R
a)=C (R
b)-,-C (R
a)=N-,-C (=NR
a-C)-, (=O)-,-C (=S) ,-O-,-Si (R
a)
2-,-S (=O)
x-and-N (R
a)-linking group;
Wherein:
X is 0,1 or 2;
N is 1,2,3 or 4;
Each R
aand R
bbe H, blocking group, hydroxyl, C independently
1-C
12the C of alkyl, replacement
1-C
12alkyl, C
2-C
12the C of thiazolinyl, replacement
2-C
12thiazolinyl, C
2-C
12the C of alkynyl, replacement
2-C
12alkynyl, C
5-C
20the C of aryl, replacement
5-C
20the heterocyclic radical of aryl, heterocyclic radical, replacement, heteroaryl, the heteroaryl of replacement, C
5-C
7the C of alicyclic radical, replacement
5-C
7alicyclic radical, halogen, OJ
1, NJ
1j
2, SJ
1, N
3, COOJ
1, acyl group (C (=O)-H), replace acyl group, CN, alkylsulfonyl (S (=O)
2-J
1) or sufoxide (sulfoxyl) (S (=O)-J
1); And
Each J
1and J
2be H, C independently
1-C
12the C of alkyl, replacement
1-C
12alkyl, C
2-C
12the C of thiazolinyl, replacement
2-C
12thiazolinyl, C
2-C
12the C of alkynyl, replacement
2-C
12alkynyl, C
5-C
20the C of aryl, replacement
5-C
20aryl, acyl group (C (=O)-H), the acyl group, heterocyclic radical, the heterocyclic radical of replacement, the C that replace
1-C
12the C of aminoalkyl group, replacement
1-C
12aminoalkyl group or blocking group.
In certain embodiments, the bridge of dicyclo sugar moieties is-[C (R
a) (R
b)]
n-,-[C (R
a) (R
b)]
n-O-,-C (R
ar
b)-N (R)-O-or-C (R
ar
b)-O-N (R)-.In certain embodiments, bridge is 4 '-CH
2-2 ', 4 '-(CH
2)
2-2 ', 4 '-(CH
2)
3-2 ', 4 '-CH
2-O-2 ', 4 '-(CH
2)
2-O-2 ', 4 '-CH
2-O-N (R)-2 ' and 4 '-CH
2-N (R)-O-2 '-, wherein each R is H, blocking group or C independently
1-C
12alkyl.
In certain embodiments, bicyclic nucleoside is limited by isometry configuration further.Such as, 4 '-2 is comprised ' nucleosides of methylene radical-oxo bridge or can be β-D configuration for α-L configuration.Before this, existing people is by α-L-methylene radical oxygen (4 '-CH
2-O-2 ') BNA is incorporated into and shows (Frieden etc., Nucleic Acids Research, 2003,21,6365-6372) in the antisense oligonucleotide of antisense activity.
In certain embodiments, bicyclic nucleoside includes but not limited to (A) α-L-methylene radical oxygen (4 '-CH
2-O-2 ') BNA, (B) β-D-methylene radical oxygen (4 '-CH
2-O-2 ') BNA, (C) vinyloxy group (4 '-(CH
2)
2-O-2 ') BNA, (D) aminooxy (4 '-CH
2-O-N (R)-2 ') BNA, (E) oxygen amino (4 '-CH
2-N (R)-O-2 ') BNA, (F) methyl (methylene radical oxygen) (4 '-CH (CH
3)-O-2 ') BNA(is also referred to as restricted ethyl or cEt), (G) methylene radical-sulfo-(4 '-CH
2-S-2 ') BNA, (H) methylene radical-amino (4 '-CH
2-N (R)-2 ') BNA, (I) methyl carbocyclic ring (4 '-CH
2-CH (CH
3)-2 ') BNA and (J) propylene carbocyclic ring (4 '-(CH
2)
3-2 ') BNA, as described below.
Wherein Bx is base portion, and R is H, blocking group or C independently
1-C
12alkyl.
In certain embodiments, bicyclic nucleoside has formula I:
Wherein:
Bx is heterocyclic base moiety;
-Q
a-Q
b-Q
c-be-CH
2-N (R
c)-CH
2-,-C (=O)-N (R
c)-CH
2-,-CH
2-O-N (R
c)-,-CH
2-N (R
c)-O-or-N (R
c)-O-CH
2;
R
cfor C
1-C
12alkyl or amido protecting group; And
T
aand T
bbe H, hydroxy-protective group, conjugation group, reactive phosphorus group, phosphorus part or covalently bound with mounting medium independently of one another.
In certain embodiments, bicyclic nucleoside has formula II:
Wherein:
Bx is heterocyclic base moiety;
T
aand T
bbe H, hydroxy-protective group, conjugation group, reactive phosphorus group, phosphorus part or covalently bound with mounting medium independently of one another;
Z
afor C
1-C
6alkyl, C
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
1-C
6the C of alkyl, replacement
2-C
6the C of thiazolinyl, replacement
2-C
6the mercaptan of the acyl group of alkynyl, acyl group, replacement, the acid amides of replacement, mercaptan or replacement.
In certain embodiments, each of substituted radical is by independently selected from following substituting group single group or polysubstituted independently: halogen, oxo, hydroxyl, OJ
c, NJ
cj
d, SJ
c, N
3, OC (=X) J
cand NJ
ec (=X) NJ
cj
d, wherein each J
c, J
dand J
ebe H, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl, and X is O or NJ
c.
In certain embodiments, bicyclic nucleoside has formula III:
Wherein:
Bx is heterocyclic base moiety;
T
aand T
bbe H, hydroxy-protective group, conjugation group, reactive phosphorus group, phosphorus part or covalently bound with mounting medium independently of one another;
Z
bfor C
1-C
6alkyl, C
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
1-C
6the C of alkyl, replacement
2-C
6the C of thiazolinyl, replacement
2-C
6the acyl group (C (=O)-) of alkynyl or replacement.
In certain embodiments, bicyclic nucleoside has formula IV:
Wherein:
Bx is heterocyclic base moiety;
T
aand T
bbe H, hydroxy-protective group, conjugation group, reactive phosphorus group, phosphorus part or covalently bound with mounting medium independently of one another;
R
dfor C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each q
a, q
b, q
cand q
dbe H, halogen, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the acyl group of alkoxyl group, acyl group, replacement, C
1-C
6the C of aminoalkyl group or replacement
1-C
6aminoalkyl group;
In certain embodiments, bicyclic nucleoside has formula V:
Wherein:
Bx is heterocyclic base moiety;
T
aand T
bbe H, hydroxy-protective group, conjugation group, reactive phosphorus group, phosphorus part or covalently bound with mounting medium independently of one another;
Q
a, q
b, q
eand q
fbe hydrogen, halogen, C independently of one another
1-C
12the C of alkyl, replacement
1-C
12alkyl, C
2-C
12the C of thiazolinyl, replacement
2-C
12thiazolinyl, C
2-C
12the C of alkynyl, replacement
2-C
12alkynyl, C
1-C
12the C of alkoxyl group, replacement
1-C
12alkoxyl group, OJ
j, SJ
j, SOJ
j, SO
2j
j, NJ
jj
k, N
3, CN, C (=O) OJ
j, C (=O) NJ
jj
k, C (=O) J
j, O-C (=O) NJ
jj
k, N (H) C (=NH) NJ
jj
k, N (H) C (=O) NJ
jj
kor N (H) C (=S) NJ
jj
k;
Or q
eand q
fbe=C (q together
g) (q
h);
Q
gand q
hbe H, halogen, C independently of one another
1-C
12the C of alkyl or replacement
1-C
12alkyl.
Describe methylene radical oxygen (4 '-CH
2-O-2 ') BNA monomer VITAMIN B4, cytosine(Cyt), guanine, 5-methyl-cytosine, the synthesis and preparative of thymine and uracil and oligomerization thereof and nucleic acid recognizing character is (see such as Koshkin etc., Tetrahedron, 1998,54,3607-3630).Described by BNA and preparation thereof also have in WO 98/39352 and WO 99/14226.
Obtain methylene radical oxygen (4 '-CH
2-O-2 ') BNA, methylene radical oxygen (4 '-CH
2-O-2 ') BNA and 2 '-sulfo--BNA analogue (see, such as Kumar etc., Bioorg.Med.Chem.Lett., 1998,8,2219-2222).Comprise oligodeoxynucleotide duplex and have also been obtained description (see such as Wengel etc., WO 99/14226) as the preparation of the lock nucleoside analog of the substrate of nucleic acid polymerase.In addition, the synthesis of 2 '-amino-BNA is described in the art, and it is the high affine oligonucleotide analogs (see such as Singh etc., J.Org.Chem., 1998,63,10035-10039) of a kind of novel conformational restriction.In addition, prepared 2 '-amino-and 2 '-methylamino-BNA, and also reported before the thermostability of their duplex and complementary RNA and DNA chain.
In certain embodiments, bicyclic nucleoside has formula VI:
Wherein:
Bx is heterocyclic base moiety;
T
aand T
bbe H, hydroxy-protective group, conjugation group, reactive phosphorus group, phosphorus part or covalently bound with mounting medium independently of one another;
Each q
i, q
j, q
kand q
lbe H, halogen, C independently
1-C
12the C of alkyl, replacement
1-C
12alkyl, C
2-C
12the C of thiazolinyl, replacement
2-C
12thiazolinyl, C
2-C
12the C of alkynyl, replacement
2-C
12alkynyl, C
1-C
12the C of alkoxyl group, replacement
1-C
12alkoxyl group, OJ
j, SJ
j, SOJ
j, SO
2j
j, NJ
jj
k, N
3, CN, C (=O) OJ
j, C (=O) NJ
jj
k, C (=O) J
j, O-C (=O) NJ
jj
k, N (H) C (=NH) NJ
jj
k, N (H) C (=O) NJ
jj
kor N (H) C (=S) NJ
jj
k; And
Q
iand q
jor q
land q
kbe=C (q together
g) (q
h), wherein q
gand q
hbe H, halogen, C independently of one another
1-C
12the C of alkyl or replacement
1-C
12alkyl.
One has 4 '-(CH
2)
3the carbocyclic ring bicyclic nucleoside of-2 ' bridge and thiazolinyl analogue bridge 4 '-CH=CH-CH
2-2 ' obtained description (see, such as Freier etc., Nucleic AcidsResearch, 1997,25 (22), 4429-4443 and Albaek etc., J.Org.Chem., 2006,71,7731-7740).The synthesis and preparative of carbocyclic ring bicyclic nucleoside and oligomerization thereof and Biochemical Research have also been obtained description (see, such as Srivastava etc., J.Am.Chem.Soc.2007,129 (26), 8362-8379).
In certain embodiments, oligomeric compounds comprises the tetrahydropyrans nucleosides of one or more modification, and it is have hexa-atomic tetrahydropyrans to replace the nucleosides of the natural penta furyl glycosyl residue existed in nucleosides.The tetrahydropyrans nucleosides modified includes but not limited to be called that hexitol nucleic acid (HNA), anitol nucleic acid (ANA), N.F,USP MANNITOL nucleic acid (MNA) are (see Leumann in the art, CJ., Bioorg. & Med.Chem. (2002) 10:841-854), fluoro HNA (F-HNA) those or there are those compounds of formula VII:
Wherein independently for each of at least one tetrahydropyrans nucleoside analog described in formula X:
Bx is heterocyclic base moiety;
T
3and T
4independently of one another for tetrahydropyrans nucleoside analog being connected to the internucleoside linkage group of antisense compounds, or T
3and T
4one of the internucleoside linkage group for tetrahydropyrans nucleoside analog being connected to antisense compounds, and T
3and T
4another be the conjugation group or 5 ' or 3 '-end group of H, hydroxy-protective group, connection;
Q
1, q
2, q
3, q
4, q
5, q
6and q
7be H, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl; And
R
1and R
2one of be hydrogen, another be selected from halogen, replacement or unsubstituted alkoxyl group, NJ
1j
2, SJ
1, N
3, OC (=X) J
1, OC (=X) NJ
1j
2, NJ
3c (=X) NJ
1j
2and CN, wherein X is O, S or NJ
1, and each J
1, J
2and J
3be H or C independently
1-C
6alkyl.
In certain embodiments, the modification THP nucleosides of formula X is provided, wherein q
1, q
2, q
3, q
4, q
5, q
6and q
7be H.In certain embodiments, q
1, q
2, q
3, q
4, q
5, q
6and q
7at least one be not H.In certain embodiments, q
1, q
2, q
3, q
4, q
5, q
6and q
7at least one be methyl.In certain embodiments, the THP nucleosides of formula X is provided, wherein R
1and R
2one of be F.In certain embodiments, R
1for fluorine and R
2for H, R
1for methoxyl group and R
2for H, and R
1for methoxy ethoxy and R
2for H.
In certain embodiments, oligomeric compounds comprises the cyclohexenyl nucleosides of one or more modification, and it is have six-ring hexenyl to replace the nucleosides of the natural penta furyl glycosyl residue existed in nucleosides.The cyclohexenyl nucleosides modified include but not limited to describe in the art those (see the PCT application WO2010/036696 that the 10 days April in 2010 such as owned together announces; Robeyns etc., J.Am.Chem.Soc., 2008,130 (6), 1979-1984; Horv á th etc., Tetrahedron Letters, 2007,48,3621-3623; Nauwelaerts etc., J.Am.Chem.Soc., 2007,129 (30), 9340-9348; Gu etc., Nucleosides, Nucleotides & Nucleic Acids, 2005,24 (5-7), 993-998; Nauwelaerts etc., Nucleic Acids Research, 2005,33 (8), 2452-2463; Robeyns etc., ActaCrystallographica, Section F:Structural Biology and CrystallizationCommunications, 2005, F61 (6), 585-586; Gu etc., Tetrahedron, 2004,60 (9), 2111-2123; Gu etc., Oligonucleotides, 2003,13 (6), 479-489; Wang etc., J.Org.Chem., 2003,68,4499-4505; Verbeure etc., Nucleic AcidsResearch, 2001,29 (24), 4941-4947; Wang etc., J.Org.Chem., 2001,66,8478-82; Wang etc., Nucleosides, Nucleotides & Nucleic Acids, 2001,20 (4-7), 785-788; Wang etc., J.Am.Chem., 2000,122,8595-8602; The PCT application WO 06/047842 announced; And the PCT application WO01/049687 announced; They each be incorporated in full herein with way of reference).Some cyclohexenyl nucleosides modified has formula VIII.
Wherein independently for each of at least one cyclohexenyl nucleoside analog described in formula VIII:
Bx is heterocyclic base moiety;
T
3and T
4independently of one another for cyclohexenyl nucleoside analog being connected to the internucleoside linkage group of antisense compounds, or T
3and T
4one of the internucleoside linkage group for tetrahydropyrans nucleoside analog being connected to antisense compounds, and T
3and T
4another be the conjugation group or 5 ' or 3 '-end group of H, hydroxy-protective group, connection; And
Q
1, q
2, q
3, q
4, q
5, q
6, q
7, q
8and q
9be H, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or other sugar substituent group.
Other dicyclos many and three cyclohexanol surrogate member ring systems are also known in the art, can be used for modified nucleoside being incorporated in antisense compounds (see, such as summary property paper: Leumann, J.C, Bioorganic & Medicinal Chemistry, 2002,10,841-854).Also for there is provided herein the combination that these are modified, be not limited to such as 2 '-F-5 '-methyl substituted nucleosides (relevant other disclosed 5 ', 2 '-disubstituted nucleosides, PCT international application WO 2008/101157 see announcement on August 21st, 2008) and substitute ribosyl epoxy atom also further in 2 '-position replacement (see the U.S. Patent application US2005-0130923 that on June 16th, 2005 announces) or alternatively for 5 '-replacement of dicyclo nucleic acid is (see the PCT international application WO 2007/134181 of announcement on November 22nd, 2007 with S, wherein 4 '-CH
2-O-2 ' bicyclic nucleoside is replaced by 5 '-methyl or 5 '-vinyl further in 5 ' position).Multiple replacement in addition can be there is with enhanced activity in this type of member ring systems.
Prepare the method for modifying sugar to know to those skilled in the art.
Have in the Nucleotide modifying sugar moieties, keeping core base portion (natural, that modify or their combination) to hybridize with suitable nucleic acid target.
In certain embodiments, antisense compounds comprises one or more Nucleotide with modification sugar moieties.In certain embodiments, the sugar moieties of modification is 2 '-MOE.In certain embodiments, 2 '-MOE modified nucleotide arranges with gapmer motif.In certain embodiments, the sugar moieties of modification is cEt (4 '-CH (CH
3)-O-2 ' BNA).In certain embodiments, the nucleosides that cEt modifies arranges in the flank of whole gapmer motif.
some modifies core base
In certain embodiments, nucleosides of the present invention comprises the core base of one or more unmodified.In certain embodiments, nucleosides of the present invention comprises the core base of one or more modification.
As used herein, term " the core base of unmodified " and " naturally occurring core base " comprise purine base adenine (A) and guanine (G) and pyrimidine base thymine (T), cytosine(Cyt) (C) and uridylic (U).Modify that core base comprises other synthesis with natural core base such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, xanthoglobulin, 2-aminoadenine, the 6-methyl of VITAMIN B4 and guanine and other alkyl derivative, the 2-propyl group of VITAMIN B4 and guanine and other alkyl derivative, 2-thiouracil, 2-thio-thymine and 2-thiocytosine, 5-halogen uridylic and cytosine(Cyt), 5-proyl (-C ≡ C-CH
3) other alkynyl derivatives of uridylic and cytosine(Cyt) and pyrimidine bases, 6-azo uridylic, cytosine(Cyt) and thymus pyrimidine, 5-uridylic (pseudouracil), 4-thiouracil, 8-halogen, 8-is amino, 8-mercaptan, 8-alkylthio, the VITAMIN B4 that 8-hydroxyl and other 8-replace and guanine, 5-halogen is 5-bromine especially, the uridylic that 5-trifluoromethyl and other 5-replace and cytosine(Cyt), 7-methyl guanine and 7-methyladenine, 2-F-VITAMIN B4, 2-amino-adenine, guanozola and 8-azaadenine, 7-denitrification guanine and 7-denitrification VITAMIN B4, 3-denitrification guanine and 3-denitrification VITAMIN B4, universal base, hydrophobic bases, promiscuous base (promiscuous base), ring expansion base (size-expandedbase), and fluoridize base as herein defined.Further modification core base comprises tricyclic pyrimidine such as phenoxazine cytidine(C ([5, 4-b] [1, 4] benzoxazine-2 (3H)-one), thiodiphenylamine cytidine(C (1H-Kui Linpyrimido quinoline [5, 4-b] [1, 4] benzothiazine-2 (3H)-one), G folder (G-clamp) such as replaces phenoxazine cytidine(C (such as 9-(2-amino ethoxy)-H-Kui Linpyrimido quinoline [5, 4-b] [1, 4] benzoxazine-2 (3H)-one), carbazole cytidine(C (2H-Kui Linpyrimido quinoline [4, 5-b] indol-2-one), pyrido indoles cytidine(C (H-pyrido [3 ', 2 ': 4, 5] pyrrolo-[2, 3-d] pyrimid-2-one).The nucleosides modified can also comprise that wherein purine or pyrimidine bases are substituted by other heterocycle those, such as 7-denitrification VITAMIN B4,7-denitrification guanosine, PA and 2-pyridone." heterocyclic base moiety " comprises the core base of core base and modification as the term is employed herein.The core base of further core base and modification is included in U.S. Patent No. 3,687, disclosed in 808 those; At " The Concise Encyclopedia Of Polymer Science AndEngineering ", Kroschwitz, J.I. edit, John Wiley & Sons, nineteen ninety, disclosed in 858-859 page those; By Englisch etc., " Angewandte Chemie ", international version, 1991, the 30th volume the 613rd page those disclosed and by Sanghvi, Y.S., 15th chapter, " Antisense Research and Applications ", Crooke, S.T. and Lebleu, B. edit, CRC Press, 1993,273-288 page those disclosed.
The heterocyclic base moiety of each nucleosides can by one or more substituted radical modify with strengthen one or more character such as target chain avidity or affect some other character in an advantageous manner.Modify core base include but not limited to universal base as herein defined, hydrophobic bases, promiscuous base, ring expansion base and fluoridize base.Some of wherein these core bases especially can be used for the binding affinity strengthening oligomeric compounds as provided herein.The purine that these comprise pyrimidine that 5-replaces, 6-aza-pyrimidine and N-2, N-6 and O-6 replace, comprises 2-aminopropyl VITAMIN B4,5-propynyluracil and 5-propynylcytosine.Show, 5-methylcytosine replaces increases 0.6-1.2 DEG C of (" Antisense Researchand Applications ", Sanghvi, Y.S., Crooke by the stability of nucleic acid duplex, S.T. and Lebleu, B. chief editor, CRCPress, Boca Raton, 1993,276-278 page).
Some above-mentioned modification core base and other representative United States Patent (USP) modifying the preparation of core base is instructed to include but not limited to U.S.3, 687, 808, 4, 845, 205, 5, 130, 302, 5, 134, 066, 5, 175, 273, 5, 367, 066, 5, 432, 272, 5, 457, 187, 5, 459, 255, 5, 484, 908, 5, 502, 177, 5, 525, 711, 5, 552, 540, 5, 587, 469, 5, 594, 121, 5, 596, 091, 5, 614, 617, 5, 645, 985, 5, 681, 941, 5, 750, 692, 5, 763, 588, 5, 830, 653 and 6, 005, 096, wherein some and the application own together, and each in them is incorporated herein by reference in full.
some internucleoside linkage
In certain embodiments, the invention provides the oligomeric compounds of the nucleosides comprising connection.In this type of embodiment, any internucleoside linkage can be used to be linked together by nucleosides.The main internucleoside linkage group of two classes is defined by presence or absence phosphorus atom.Representational phosphorous internucleoside linkage includes but not limited to phosphodiester (P=O), phosphotriester, methylphosphonate, phosphoramidate and thiophosphatephosphorothioate (P=S).Representational not phosphorous internucleoside linkage group includes but not limited to methylene radical methyl-imino (-CH
2-N (CH
3)-O-CH
2-), sulfo-diester (-O-C (O)-S-), thionocarbamate (-O-C (O) (NH)-S-), siloxanes (-O-Si (H)
2-O-) and N, N '-dimethylhydrazine (-CH
2-N (CH
3)-N (CH
3)-).The oligonucleotide with not phosphorous internucleoside linkage group can be called as oligonucleoside.The nuclease resistant changing (usually strengthening) oligomeric compounds is can be used for the modification bonding of natural phosphodiester Bonded Phase ratio.In certain embodiments, can be used as the internucleoside linkage that racemic mixture or independent chiral preparation have chiral atom.Representational chiral linkage includes but not limited to alkyl phosphonates and thiophosphatephosphorothioate.The method preparing phosphorous and not phosphorous internucleoside linkage is known to those skilled in the art.
Oligonucleotide as herein described comprises one or more asymmetric center, and thus produce enantiomorph, diastereomer and other stereoisomeric configurations, with regard to absolute stereochemical, these configurations can be defined as (R) or (S), α or β, such as sugared anomer, or be defined as (D) or (L), such as amino acid etc.In antisense compounds provided herein, comprise these type of possible isomerss all and their racemic form and optionally pure form.
As used herein, term " neutral internucleoside linkage " is intended to comprise non-ionic internucleoside linkage.Neutral internucleoside linkage includes but not limited to phosphotriester, methylphosphonate, MMI (3 '-CH
2-N (CH
3)-O-5 '), acid amides-3 (3 '-CH
2-C (=O)-N (H)-5 '), acid amides-4 (3 '-CH
2-N (H)-C (=O)-5 '), methylene acetal (formacetal) (3 '-O-CH
2-O-5 ') and thio-methylene acetal (thioformacetal) (3 '-S-CH
2-O-5 ').Further neutral internucleoside linkage comprises nonionic linkages, comprises siloxanes (dialkylsiloxane), carboxylicesters, methane amide, sulfide, sulphonate and acid amides (see such as: " Carbohydrate Modifications inAntisense Research "; Y.S.Sanghvi and P.D.Cook edits, ACS SymposiumSeries 580; 3rd and 4 chapters, 40-65 page).Further neutral internucleoside linkage comprises containing mixing N, O, S and CH
2the nonionic linkages of integral part.
some length
In certain embodiments, the invention provides the oligomeric compounds of the oligonucleotide comprising any different lengths scope.In certain embodiments, the invention provides the oligomeric compounds or oligonucleotide that are made up of X to Y the nucleosides connected, wherein X represents nucleosides number minimum within the scope of this, and Y represents nucleosides number maximum within the scope of this.In some this type of embodiment, X and Y is selected from 8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49 and 50 independently of one another; Prerequisite is X≤Y.Such as, in certain embodiments, the invention provides oligomeric compounds, it comprises by 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30 or 29 to 30 connect nucleosides composition oligonucleotide.Limit in the embodiment of nucleosides number of oligomeric compounds or oligonucleotide wherein, no matter be for a certain scope or for concrete numerical value, oligomeric compounds or oligonucleotide all can comprise other other substituting group further.Such as, the oligonucleotide comprising 8-30 nucleosides does not comprise the oligonucleotide with 31 nucleosides, but except as otherwise noted, otherwise this oligonucleotide can comprise such as one or more conjugate, end group or other substituting group further.In certain embodiments, end group includes but not limited to end group nucleosides.In this type of embodiment, the end nucleotide of end group nucleosides and oligonucleotide is differently modified, thus is distinguished by the nucleosides of this type of end group nucleosides and oligonucleotide and come.
some motif
In certain embodiments, the invention provides and comprise one or more oligomeric compounds with the region of specific nucleosides motif.In certain embodiments, the compound of 5 '-end nucleotide composition formula II, IIa, IIb, IIc, IId or IIe of modified oligonucleotide of the present invention.
breach motif
In certain embodiments, oligomeric compounds of the present invention comprises gapmer region.In some this type of embodiment, the glycosyl of external region is mutually the same (being called symmetrical gapmer herein).In certain embodiments, the glycosyl for 5 '-external region different from the glycosyl for 3 '-external region (being called asymmetric gapmer herein).In certain embodiments, external region less (each is 1,2,3,4 or about 5 monomer subunit independently), and these monomer subunit comprise the glycosyl that non-natural exists, and stub area comprises β-D-2 '-dezyribonucleoside.In certain embodiments, external region comprises the monomer subunit that 1 to about 5 has the glycosyl that non-natural exists independently of one another, and interior region comprises the nucleosides of 6 to 18 unmodifieds.Interior region or breach comprise β-D-2 '-dezyribonucleoside usually, but can comprise the glycosyl of non-natural existence.Heterocyclic base and internucleoside linkage can change independently in each position of breach oligomeric compounds.Motif optionally comprises further and uses other group one or more, include but not limited to add cap group, conjugation group and other 5 ' or 3 '-end group.
In certain embodiments, breach oligomeric compounds comprises the interior region of β-D-2 '-dezyribonucleoside, and one of external region comprises the nucleosides of modification.In certain embodiments, breach oligomeric compounds comprises the interior region of β-D-2 '-dezyribonucleoside, and two external regions all comprise the nucleosides of modification.In certain embodiments, there is provided herein breach oligomeric compounds, wherein all monomer subunit all comprise the glycosyl that non-natural exists.
In certain embodiments, provide such breach oligomeric compounds, it comprises one or two modified nucleoside of 5 '-end, two or three modified nucleosides of 3 '-end, and the interior region of 10 to 16 β-D-2 '-dezyribonucleosides.In certain embodiments, provide such breach oligomeric compounds, it comprises a modified nucleoside of 5 '-end, two modified nucleosides of 3 '-end, and the interior region of 10 to 16 β-D-2 '-dezyribonucleosides.In certain embodiments, provide such breach oligomeric compounds, it comprises a modified nucleoside of 5 '-end, two modified nucleosides of 3 '-end, and the interior region of 10 to 14 β-D-2 '-dezyribonucleosides.
In certain embodiments, the breach oligomeric compounds that length is about 10 to about 21 monomer subunit is provided.In certain embodiments, the breach oligomeric compounds that length is about 12 to about 16 monomer subunit is provided.In certain embodiments, the breach oligomeric compounds that length is about 12 to about 14 monomer subunit is provided.
some graded area
In certain embodiments, oligonucleotide of the present invention comprises one or more alternately modified regions.In certain embodiments, oligonucleotide comprises one or more alternately nucleosides modified regions.In certain embodiments, oligonucleotide comprises one or more alternately bonding modified regions.In certain embodiments, oligonucleotide comprises one or more alternately nucleosides and bonding modified regions.
In certain embodiments, oligonucleotide of the present invention comprises one or more alternately 2 '-F modified nucleoside and 2 '-OMe modified nucleoside region.In some this type of embodiment, alternately 2 ' F modification and 2 ' OMe modified nucleoside region also comprise alternately bonding for these type of.In some this type of embodiment, the 3 ' bonding held of 2 '-F modified nucleoside is thiophosphatephosphorothioate bonding.In some this type of embodiment, the 3 ' bonding held of 2 ' OMe nucleosides is phosphodiester bond.In certain embodiments, this type of graded area is: (2 '-F)-(PS)-(2 '-OMe)-(PO).
In certain embodiments, oligomeric compounds comprises 2,3,4,5,6,7,8,9,10 or 11 these type of graded areas.This type of region can be adjacent, or can be interrupted by the nucleosides of different modifying or bonding.
In certain embodiments, the one or more graded areas replaced in motif comprise the single nucleosides of a more than type.Such as, oligomeric compounds of the present invention can comprise one or more regions of any following nucleosides motif:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA; Or
ABABBAABBABABAA;
Wherein A is first kind nucleosides, and B is Second Type nucleosides.In certain embodiments, A and B is all selected from 2 '-F, 2 '-OMe, BNA, DNA and MOE.
In certain embodiments, A is DNA.In certain embodiments, B is 4 '-CH
2o-2 '-BNA.In certain embodiments, A is DNA and B is 4 '-CH
2o-2 '-BNA.In certain embodiments, A is 4 '-CH
2o-2 '-BNA.In certain embodiments, B is DNA.In certain embodiments, A is 4 '-CH
2o-2 '-BNA and B is DNA.In certain embodiments, A is 2 '-F.In certain embodiments, B is 2 '-OMe.In certain embodiments, A is 2 '-F and B is 2 '-OMe.In certain embodiments, A is 2 '-OMe.In certain embodiments, B is 2 '-F.In certain embodiments, A is 2 '-OMe and B is 2 '-F.In certain embodiments, A is DNA and B is 2 '-OMe.In certain embodiments, A is 2 '-OMe and B is DNA.
In certain embodiments, the 5 ' end nucleotide of the oligomeric compounds with so alternately motif also contained II, IIa, IIb, IIc, IId or IIe.
2-2-3 motif
In certain embodiments, oligonucleotide of the present invention comprises the region with 2-2-3 motif.This type of region comprises following motif:
5 '-(formula II, IIa, IIb, IIc, IId or IIe)-(E)
w-(A)
2-(B)
x-(A)
2-(C)
y-(A)
3-(D)
z
Wherein: A is the modified nucleoside of the first kind;
B, C, D and E are the nucleosides of different modifying compared with A, but B, C, D and E can have the modification be same to each other or different to each other;
W and z is 0 to 15;
X and y is 1 to 15.
In certain embodiments, A is 2 '-OMe modified nucleoside.In certain embodiments, B, C, D and E are 2 '-F modified nucleoside.In certain embodiments, A is 2 '-OMe modified nucleoside, and B, C, D and E are 2 '-F modified nucleoside.
In certain embodiments, the bonding of 2-2-3 motif is the bonding of modification.In certain embodiments, these bondings are thiophosphatephosphorothioate bonding.In certain embodiments, the bonding of 3 '-end of each modification of the first kind is phosphodiester.
In certain embodiments, Z is 0.In this type of embodiment, the region of three nucleosides of the first kind is positioned at 3 '-end of oligonucleotide.In certain embodiments, such region is positioned at 3 '-end of oligomeric compounds, and is connected to the 3 ' end in the region of three nucleosides of the first kind without additional group.In certain embodiments, comprising wherein Z is that the oligomeric compounds of the oligonucleotide of 0 can comprise the end group being connected to 3 '-end nucleotide.This type of end group can comprise other nucleosides.This type of other nucleosides is generally the nucleosides of non-hybridization.
In certain embodiments, Z is 1-3.In certain embodiments, Z is 2.In certain embodiments, the nucleosides of Z is 2 '-MOE nucleosides.In certain embodiments, Z represents non-hybridization nucleosides.For avoiding confusion, it should be noted, this type of non-hybridization nucleosides also can be described to the 3 '-end group of Z=0.
the combination of motif
It is to be appreciated that some above-mentioned motif and modification can be combined.Because motif can only comprise several nucleosides, therefore specific oligonucleotide can comprise two or more motifs.By way of non-limiting example, in certain embodiments, oligomeric compounds can have the nucleosides motif as described in following table.In the following table, term "None" represents that specific feature is not present in oligonucleotide.Such as, the "None" in the row being labeled as " 5 ' motif/modification " shows that 5 ' end of oligonucleotide comprises first nucleosides of central motif.
There is any one oligomeric compounds of multiple nucleosides motif as herein described and can have any bonding motif.Such as, include but not limited to that those the oligomeric compounds described in table can have the unrestricted bonding motif being selected from following table:
5 ' end bonding | Central zone | 3 '-region |
PS | Alternative P O/PS | 6PS |
PS | Alternative P O/PS | 7PS |
PS | Alternative P O/PS | 8PS |
Can obviously find out from non-limiting table above, need not be identical with the zone length that bonding motif limits by nucleosides motif.Such as, in upper table nucleosides motif, 3 ' region is 2 nucleosides, and 3 '-region of upper table bonding motif is 6-8 nucleosides.In merging, table will obtain the oligonucleotide (some bonding therefore, in nucleosides motif central zone is also thiophosphatephosphorothioate) with 23 '-terminal M OE nucleosides and 6 to 83 '-terminal thiophosphate ester bond.In order to further elaboration, and limit never in any form, combination nucleosides motif and sequence motifs are to show 5 limiting examples in the following table.The first row of table lists according to first nucleosides of position from N1(5 '-end) to the 20th of N20(5 '-end) nucleosides and bonding.In certain embodiments, 20 nucleosides (form is only exemplary) are longer than by oligonucleotide of the present invention.Some position in form lists nucleosides or bonding, and "None" shows oligonucleotide in this position without nucleosides.
In superincumbent limiting examples:
The oligomeric compounds be made up of 20 nucleosides connected is shown in A list, and wherein this oligomeric compounds comprises: the modification 5 '-end nucleotide of formula II, IIa, IIb, IIc, IId or IIe; Alternately nucleosides region; Alternately bond area; 23 '-terminal M OE nucleosides, its each comprise uridylic base; And six thiophosphatephosphorothioate bonding regions of 3 '-end.
The oligomeric compounds be made up of 18 nucleosides connected is shown in B list, and wherein this oligomeric compounds comprises: the modification 5 '-end nucleotide of formula II, IIa, IIb, IIc, IId or IIe; 2-2-3 motif, wherein the modified nucleoside of 2-2-3 motif is 2 ' O-Me, and remaining nucleosides is 2 '-F; Two 3 '-terminal M OE nucleosides, its each comprise uridylic base; And six thiophosphatephosphorothioate bonding regions of 3 '-end.
The oligomeric compounds be made up of 20 nucleosides connected is shown in C list, and wherein this oligomeric compounds comprises: the modification 5 '-end nucleotide of formula II, IIa, IIb, IIc, IId or IIe; 2 '-F nucleosides region of even modification; 23 '-terminal M OE nucleosides, its each comprise uridylic base; And wherein each internucleoside linkage is thiophosphatephosphorothioate bonding.
The oligomeric compounds be made up of 20 nucleosides connected is shown in D list, and wherein this oligomeric compounds comprises: the modification 5 '-end nucleotide of formula II, IIa, IIb, IIc, IId or IIe; Alternately 2 '-OMe/2 '-F nucleosides region; Even 2 ' F nucleosides region; Alternately thiophosphatephosphorothioate/phosphodiester bond region; Two 3 '-terminal M OE nucleosides, its each comprise adenine base; And six thiophosphatephosphorothioate bonding regions of 3 '-end.
The oligomeric compounds be made up of 17 nucleosides connected is shown in E list, and wherein this oligomeric compounds comprises: the modification 5 '-end nucleotide of formula II, IIa, IIb, IIc, IId or IIe; 2-2-3 motif, wherein the modified nucleoside of 2-2-3 motif is 2 ' F, and remaining nucleosides is 2 '-OMe; Three 3 '-terminal M OE nucleosides.
Thering is provided above-mentioned example just can how to be used in a joint manner by described motif to set forth, not being intended to limit the invention to particular combination or the specific modification for setting forth this combination.In addition, specific examples herein, include but not limited in table those, be intended to contain more general embodiment.Such as, the A row in upper table exemplarily illustrate 2 '-OMe alternately and 2 '-F nucleosides region.Therefore, this same disclosing also schematically illustrates difference 2 '-modified regions alternately.It also schematically illustrates 2 '-O-alkyl alternately and 2 '-halogen nucleosides region.It also schematically illustrates different modifying nucleosides region alternately.All examples in entire description all consider this general explaination.
Should also be noted that the length of oligomeric compounds, all those as above shown in representation case, easily can control by extending or shorten one or more described region when not destroying motif.
In certain embodiments, the invention provides oligomeric compounds, wherein 5 '-end nucleotide (1) compound that is formula II, IIa, IIb, IIc, IId or IIe, and 2 nucleosides comprise 2 '-modify.In some this type of embodiment, 2 nucleosides 2 '-modify the alkyl being selected from halogen, alkyl and replacement.In certain embodiments, 2 '-modification of 2 nucleosides is selected from 2 '-F and 2 '-alkyl.In certain embodiments, 2 nucleosides 2 '-be modified to 2 '-F.In certain embodiments, 2 nucleosides 2 '-be substituted by the OH(of unmodified as in naturally occurring RNA).
In certain embodiments, 3 nucleosides are modified nucleoside.In certain embodiments, 3 nucleosides are bicyclic nucleoside.In certain embodiments, 3 nucleosides comprise sugar replacement.In some this type of embodiment, sugar replacement is tetrahydropyrans.In certain embodiments, the sugar of 3 nucleosides is F-HNA.
In certain embodiments, antisense oligonucleotide compound comprises the oligonucleotide connecting nucleosides containing 10 to 30, and wherein oligonucleotide comprises: 1 modified nucleoside of formula II, IIa, IIb, IIc, IId or IIe; Comprise 2 nucleosides of sugar moieties, this sugar moieties is differently modified compared with the sugar moieties of 1 modified nucleoside; And 1 to 43 '-end group nucleosides, it is each comprises 2 '-modify; And wherein at least 73 '-end internucleoside linkage be thiophosphatephosphorothioate bonding.
some conjugation group
In certain embodiments, oligomeric compounds is modified by connecting one or more conjugation group.In general, conjugation group changes one or more character of the oligomeric compounds connected, and includes but not limited to pharmacodynamics, pharmacokinetics, stability, combination, absorption, cell distribution, cellular uptake, electric charge and removing.Conjugation group is used in chemical field usually, and directly connects or be connected on parent compound such as oligomeric compounds by optional conjugate connection portion or conjugate linking group, such as oligonucleotide.Conjugation group includes but not limited to intercalator, reporter molecules, polyamine class, polyamide-based, polyethylene glycols, thioether class, polyethers, cholesterol, sulfydryl cholesterol, cholic acid part, folate, lipid, phosphatide, vitamin H, azophenlyene, phenanthridines, anthraquinone, diamantane, acridine, fluorescein, rhodamine, tonka bean camphor and dyestuff.Described some conjugation group, such as: cholesterol moiety (Letsinger etc., Proc.Natl.Acad.Sci.USA before, 1989,86,6553-6556), cholic acid (Manoharan etc., Bioorg.Med.Chem.Let., 1994,4,1053-1060), thioether such as hexyl-S-three beneze methane thiol (Manoharan etc., Ann.N.Y.Acad.Sci., 1992,660,306-309, Manoharan etc., Bioorg.Med.Chem.Let., 1993,3,2765-2770), sulfydryl cholesterol (Oberhauser etc., Nucl.Acids Res., 1992,20,533-538), aliphatic chain such as dodecanediol or undecyl residues (Saison-Behmoaras etc., EMBO J., 1991,10,1111-1118, Kabanov etc., FEBS Lett., 1990,259,327-330, Svinarchuk etc., Biochimie, 1993,75,49-54), phosphatide such as double hexadecyl-rac-glycerine or 1,2-bis--O-hexadecyl-rac-glycerine-3-H-phosphine triethylenetetraminehexaacetic acid ammonium (Manoharan etc., TetrahedronLett., 1995,36,3651-3654, Shea etc., Nucl.Acids Res., 1990, 18, 3777-3783), polyamine or polyglycol chain (Manoharan etc., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantane acetic acid (Manoharan etc., Tetrahedron Lett., 1995, 36, 3651-3654), palmityl part (Mishra etc., Biochim.Biophys.Acta, 1995, 1264, 229-237) or octadecylamine or hexylamino-carbonyl-oxygen cholesterol moiety (Crooke etc., J.Pharmacol.Exp.Ther., 1996, 277, 923-937).
In certain embodiments, conjugation group comprises active medicine, such as acetylsalicylic acid, warfarin (warfarin), protect Qin Song (phenylbutazone), Ibuprofen BP/EP, sutoprofen, fenbufen (fen-bufen), Ketoprofen, (S)-(+)-Y-8004, carprofen, red sarkosine (dansylsarcosine), 2, 3, 5-Triiodobenzoic acid, Flufenamic Acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturate(s), cynnematin, sulfonamides, antidiabetic drug, antimicrobial drug or microbiotic.Oligonucleotide-drug conjugate and be prepared in U.S. Patent application 09/334, described by having in 130.
The representative United States Patent (USP) of the preparation of instruction oligonucleotide conjugate thing includes but not limited to: 4,828,979, 4,948,882, 5,218,105, 5,525,465, 5,541,313, 5,545,730, 5,552,538, 5,578,717, 5,580,731, 5,580,731, 5,591,584, 5,109,124, 5,118,802, 5,138,045, 5,414,077, 5,486,603, 5,512,439, 5,578,718, 5,608,046, 4,587,044, 4,605,735, 4,667,025, 4,762,779, 4,789,737, 4,824,941, 4,835,263, 4,876,335, 4,904,582, 4,958,013, 5,082,830, 5,112,963, 5,214,136, 5,082,830, 5,112,963, 5,214,136, 5,245,022, 5,254,469, 5,258,506, 5,262,536, 5,272,250, 5,292,873, 5,317,098, 5,371,241, 5,391,723, 5,416,203, 5,451,463, 5,510,475, 5,512,667, 5,514,785, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,595,726, 5,597,696, 5,599,923, 5,599,928 and 5,688,941.
In certain embodiments, conjugation group is connected directly to the oligonucleotide in oligomeric compounds.In certain embodiments, conjugation group is connected to oligonucleotide by conjugate linking group.In some this type of embodiment, conjugate linking group, include but not limited to difunctionality connection portion all as known in the art those, be suitable for compound provided herein.Conjugate linking group can be used for conjugation group, and such as chemically stable group, functional group, reporter group and other group are connected to the selectivity site in parent compound such as such as oligomeric compounds.In general, difunctionality connection portion comprises the hydrocarbyl portion with Liang Ge functional group.Select one of them functional group to be attached on parent molecule or the compound paid close attention to, and select another to be attached to substantially on any selected group such as chemical functional group or conjugation group.In some embodiments, conjugate connects the oligomer that base comprises chain structure or repeating unit such as ethylene glycol or Amino Acid Unit.The example being generally used for the functional group of difunctionality connection portion include but not limited to for react electrophile of nucleophilic group and the nucleophile for reacting with electrophilic group.In some embodiments, difunctionality connection portion comprises amino, hydroxyl, carboxylic acid, mercaptan, degree of unsaturation (as double bond or triple bond) etc.
Some unrestricted examples of conjugate connection portion comprise tetramethyleneimine, amino-3, the 6-dioxaoctanoic acid (ADO) of 8-, 4-(N-maleimidomethyl) hexanaphthene-1-carboxylic acid succinimide (SMCC) and 6-aminocaprolc acid (AHEX or AHA).Other linking group includes but not limited to the C replaced
1-C
10alkyl, replacement or unsubstituted C
2-C
10thiazolinyl or replacement or unsubstituted C
2-C
10alkynyl, wherein the non-limiting list of preferred substituted radical comprises hydroxyl, amino, alkoxyl group, carboxyl, benzyl, phenyl, nitro, mercaptan, thio alkoxy, halogen, alkyl, aryl, thiazolinyl and alkynyl.
Conjugation group can be connected to the one or both ends (end conjugation group) of oligonucleotide and/or any interior location.
In certain embodiments, conjugated radicle cumularsharolith is in 3 '-end of the oligonucleotide of oligomeric compounds.In certain embodiments, conjugation group is near 3 '-end.In certain embodiments, conjugate is connected 3 ' end of oligomeric compounds, but before one or more end group nucleosides.In certain embodiments, conjugation group is placed in end group.
In certain embodiments, the invention provides oligomeric compounds.In certain embodiments, oligomeric compounds comprises oligonucleotide.In certain embodiments, oligomeric compounds comprises oligonucleotide and one or more conjugation and/or end group.This type of conjugation and/or end group can be added to the oligonucleotide with above-mentioned any chemical motif.Therefore, such as, the oligomeric compounds comprising the oligonucleotide with alternately nucleosides region can comprise end group.
antisense compounds
In certain embodiments, oligomeric compounds of the present invention is antisense compounds.In this type of embodiment, oligomeric compounds and complementary target.In certain embodiments, target nucleic acid is RNA.In certain embodiments, target nucleic acid is non-coding RNA.In certain embodiments, target nucleic acid encodes protein.In certain embodiments, target nucleic acid is selected from mRNA, pre-mRNA, microRNA, non-coding RNA comprise non-coding tiny RNA, and the RNA of promoter regulation.In certain embodiments, oligomeric compounds and more than a kind of target nucleic acid complementary at least partly.Such as, oligomeric compounds of the present invention can be microRNA stand-in, and it is attached to multiple target usually.
Antisense mechanism comprises any mechanism relating to oligomeric compounds and target nucleic acid and hybridize, and wherein hybridization produces biological effect.In certain embodiments, this hybridization cause target nucleic acid degrade or occupy-place, simultaneously suppress or irritation cell mechanism, these mechanism relate to such as target nucleic acid translation, transcribe or montage.
The antisense mechanism relating to target RNA degraded of one type is the antisense that RNA enzyme H mediates.RNA enzyme H is a kind of cellular endonuclease, its cleaving rna: the RNA chain of DNA duplex.It is well known in the art that the single-stranded antisense compound of " DNA sample " guides RNA enzyme H active in mammalian cell.Therefore the activation of RNA enzyme H causes the cracking of RNA target, thus greatly strengthens the efficiency of the oligonucleotide mediated gene expression inhibition of DNA sample.
Antisense mechanism also includes but not limited to RNAi mechanism, and it utilizes RISC approach.This type of RNAi mechanism includes but not limited to siRNA, ssRNA and microRNA mechanism.This mechanism comprises formation microRNA stand-in and/or anti-microRNA.
Antisense mechanism also includes but not limited to the mechanism hybridizing or simulate the non-coding RNA outside microRNA or mRNA.This type of non-coding RNA includes but not limited to the RNA of promoter regulation and affects the short and long RNA transcribing or translate of one or more nucleic acid.
In certain embodiments, antisense compounds is specific hybrid when there is enough complementary degree, with avoid antisense compounds under the condition needing specific binding non-specific binding to non-target nucleic acid sequences, namely, measure in vivo or therapeutic agent treats situation in physiological conditions, and under carrying out the condition that measures in situation about measuring in vitro.
In certain embodiments, oligomeric compounds of the present invention is RNAi compound.In certain embodiments, oligomeric compounds of the present invention is ssRNA compound.In certain embodiments, oligomeric compounds of the present invention and the second oligomeric compounds match, to form siRNA.In some this type of embodiment, the second oligomeric compounds is also oligomeric compounds of the present invention.In certain embodiments, the second oligomeric compounds be any modification or the nucleic acid of unmodified.In certain embodiments, oligomeric compounds of the present invention is the antisense strand in siRNA compound.In certain embodiments, oligomeric compounds of the present invention is the sense strand in siRNA compound.
single-stranded antisense compound
In certain embodiments, oligomeric compounds of the present invention is particularly suited for being used as single-stranded antisense compound.In some this type of embodiment, this type of oligomeric compounds is single stranded RNA i compound.In certain embodiments, this type of oligomeric compounds is ssRNA compound or microRNA stand-in.Some 5 '-end nucleotide as herein described is applicable to this type of strand oligomeric compounds.In certain embodiments, this type of 5 '-end nucleotide stablizes 5 '-phosphorus part.In certain embodiments, 5 '-end nucleotide of the present invention has resistance to nuclease.In certain embodiments, motif of the present invention is particularly useful for strand oligomeric compounds.
The use of single stranded RNA i compound limits to some extent.In some cases, single stranded RNA i compound fast degradation and/or effectively can not be loaded into RISC.Some compound of the present invention have be better than before the character of described ssRNAi compound.In certain embodiments, oligomeric compounds of the present invention is excellent external ssRNAi compound.In some this type of embodiment, make 5 '-end phosphorus partially stabilized.In some this type of embodiment, 5 '-nucleosides has resistance to nuclease cleavage.In certain embodiments, 5 '-end is effectively loaded into RISC.In certain embodiments, motif makes oligomeric compounds stablize.In certain embodiments, 3 '-terminal stabilization of oligomeric compounds is made.
Be designed in cell and/or for the single stranded RNA i compound in body and there is many-sided challenge.Such as, this compound must chemically stable, nuclease degradation had to resistance, cell can be entered, RISC(can be loaded into such as, in conjunction with Ago1 or Ago2), can to hybridize with target nucleic acid and to cell or animal nontoxicity.In some cases, the modification or the motif that improve a kind of such feature can make the deterioration of another kind of feature, thus make the compound with this modification or motif be not suitable for use in RNAi compound.Such as, some is modified, if be especially placed in oligomeric compounds 5 '-end or its near time, compound can be made more stable and more have resistance to nuclease degradation, but also by blocking and the interaction of RISC component such as Ago1 or Ago2 and suppress or prevent from being loaded into RISC.Although have the stability of improvement, this compound is not suitable for RNAi yet.Therefore, facing challenges to determine: meet each parameter to be at least enough to provide the functionalized modification of single stranded RNA i compound and the position of combination and modification.In certain embodiments, oligomeric compounds of the present invention combines multiple modification to provide the compound of the single stranded RNA i with single stranded RNA i compound activity.
In some cases, the strand oligomeric compounds comprising 5 '-phosphorus part expects.Such as, in certain embodiments, this 5 '-phosphorus part is required or for RNAi compound, especially single stranded RNA i compound.In such cases, also expect to make phosphorus partially stabilized, avoid its generation can make degraded or the dephosphorylation of its inactivation.In addition, expect that whole 5 '-nucleosides is stablized avoids it to degrade, and degraded also can make its inactivation.Therefore, in certain embodiments, the both stable oligonucleotide of 5 '-phosphorus part and 5 '-nucleosides is wherein made to be expect.In certain embodiments, the invention provides and can be placed in oligomeric compounds 5 '-end thus produce the modified nucleoside stablizing phosphorus and stable nucleosides.In some this type of embodiment, the nucleosides of phosphorus part relative to unmodified in biosystem has resistance to removal, and/or the cracking of 5 '-nucleosides to nuclease has resistance.In certain embodiments, this type of nucleosides is being modified with next position, two positions or all three positions: 2 '-position, 5 '-position and phosphorus part.This type of modified nucleoside can be incorporated into 5 '-end of oligomeric compounds.
Although some oligomeric compounds of the present invention has the specific end use as single chain compound, this compounds also can match to form double-strand oligomeric compounds with Article 2 chain.In this type of embodiment, the Article 2 chain of duplex can be or also can not be oligomeric compounds of the present invention.
In certain embodiments, oligomeric compounds of the present invention combines and/or activates one or more nucleases.In certain embodiments, this combination and/or activation finally cause antisense activity.In certain embodiments, oligomeric compounds of the present invention and target nucleic acid and interact with nuclease, thus cause nuclease activation and target nucleic acid cracking.In certain embodiments, oligomeric compounds of the present invention and target nucleic acid and interact with nuclease, thus cause nuclease activation and target nucleic acid inactivation.In certain embodiments, oligomeric compounds of the present invention and target nucleic acid form duplex, and this duplex activation nuclease, thus cause one or both cracking and/or the inactivation of oligomeric compounds and target nucleic acid.In certain embodiments, oligomeric compounds of the present invention combines and/or activation nuclease, and the nuclease after combining and/or activating makes target nucleic acid cracking or inactivation.Nuclease includes but not limited to rnase (nuclease of Specific lytic ribonucleotide), double-strandednucleic acid enzyme (nuclease of Specific lytic duplex one or two chain) and double stranded RNA enzyme.Such as, nuclease includes but not limited to RNA enzyme H, argonaute albumen (including but not limited to Ago2) and dicer.
In certain embodiments, oligomeric compounds of the present invention and argonaute albumen (Ago) interact.In certain embodiments, first this type of oligomeric compounds enters RISC approach, and mode interacts with another member (such as, dicer) of this approach.In certain embodiments, first oligomeric compounds enters RISC approach by interacting with Ago.In certain embodiments, this interaction finally causes antisense activity.In certain embodiments, the invention provides to comprise and make Ago contact with oligomeric compounds and make the method that Ago activates.In certain embodiments, this type of oligomeric compounds comprises 5 '-bound phosphate groups of modification.In certain embodiments, the invention provides and regulate the expression of cell target nucleic acid or the method for amount, comprise and cell is contacted with the oligomeric compounds that can activate Ago, finally cause the cracking of target nucleic acid.In certain embodiments, cell is in animal.In certain embodiments, cell in vitro.In certain embodiments, the method is performed when there is manganese.In certain embodiments, manganese is endogenic.In certain embodiments, the method is performed when there is not manganese.In certain embodiments, Ago is endogenous cellular.In some this type of embodiment, cell is in animal.In certain embodiments, Ago is people Ago.In certain embodiments, Ago is Ago2.In certain embodiments, Ago is people Ago2.
In certain embodiments, oligomeric compounds of the present invention and enzyme dicer interact.In some this type of embodiment, oligomeric compounds is attached to dicer and/or by dicer cracking.In some this type of embodiment, thisly finally cause antisense activity with the interaction of dicer.In certain embodiments, dicer is people dicer.In certain embodiments, interactional oligomeric compounds is double-strand oligomeric compounds with dicer.In certain embodiments, interactional oligomeric compounds is strand oligomeric compounds with dicer.
Wherein in double-strand oligomeric compounds and the interactional embodiment of dicer, this double-strand oligomeric compounds forms dicer duplex.In certain embodiments, any oligomeric compounds as herein described can be suitable as or two chains of dicer duplex.In certain embodiments, every bar chain of dicer duplex is all oligomeric compounds of the present invention.In certain embodiments, a chain of dicer duplex is oligomeric compounds of the present invention, and another chain be any modification or the oligomeric compounds of unmodified.In certain embodiments, the nucleosides of contained II, IIa, IIb, IIc, IId or IIe held by one of dicer duplex or two chains 5 '.In certain embodiments, a chain of dicer duplex is antisense oligonucleotide compound, and another chain is its message complementary sense sequence.
In certain embodiments, dicer duplex at one end or two ends comprise 3 '-pendency (3 '-overhang).In certain embodiments, this type of pendency is other nucleosides.In certain embodiments, dicer duplex does not comprise 3 ' pendency on antisense oligonucleotide there being MODN.In certain embodiments, dicer duplex MODN does not comprise 3 ' pendency having at antisense oligonucleotide.In certain embodiments, 3 ' pendency of dicer duplex comprises 1-4 nucleosides.In certain embodiments, this type of pendency comprises two nucleosides.In certain embodiments, the nucleosides in 3 '-pendency comprises purine nucleobase.In certain embodiments, the nucleosides in 3 ' pendency comprises VITAMIN B4 core base.In certain embodiments, the nucleosides in 3 ' pendency comprises pyrimidine.In certain embodiments, the dicer dimer that the dicer duplex comprising 3 '-purine pendency comprises 3 ' pyrimidine pendency as antisense compounds ratio has more activity.In certain embodiments, the dimeric oligomeric compounds of dicer comprises one or more 3 ' deoxynucleoside.In some this type of embodiment, 3 ' deoxynucleoside is dT nucleosides.
In certain embodiments, the every bar chain 5 ' end of dicer duplex comprises phosphonate moiety.In certain embodiments, the antisense strand of dicer duplex comprises phosphonate moiety, and the sense strand of dicer duplex does not comprise phosphonate moiety.In certain embodiments, the sense strand of dicer duplex comprises phosphonate moiety, and the antisense strand of dicer duplex does not comprise phosphonate moiety.In certain embodiments, dicer duplex does not comprise phosphonate moiety at 3 ' end.In certain embodiments, dicer duplex is by dicer cracking.In this type of embodiment, dicer duplex does not comprise 2 '-OMe and modifies on the nucleosides of cracking site.In certain embodiments, this type of cracking site nucleosides is RNA.
In certain embodiments, the interaction of oligomeric compounds and dicer finally causes antisense activity.In certain embodiments, one or two chains of dicer cracking double-strand oligomeric compounds, and the product of gained enters RISC approach, finally causes antisense activity.In certain embodiments, arbitrary chain of dicer not cracking double-strand oligomeric compounds, but still be conducive to entering RISC approach and finally causing antisense activity.In certain embodiments, dicer cracking strand oligomeric compounds, and the product of gained enters RISC approach, finally causes antisense activity.In certain embodiments, dicer not cracking strand oligomeric compounds, but still be conducive to entering RISC approach and finally causing antisense activity.
In certain embodiments, the invention provides the method for activation dicer, comprise and dicer is contacted with oligomeric compounds.In some this type of embodiment, dicer is in cell.In some this type of embodiment, cell is in animal.
Dicer
In certain embodiments, oligomeric compounds of the present invention and enzyme dicer interact.In some this type of embodiment, oligomeric compounds is attached to dicer and/or by dicer cracking.In some this type of embodiment, thisly finally cause antisense activity with the interaction of dicer.In certain embodiments, dicer is people dicer.In certain embodiments, interactional oligomeric compounds is double-strand oligomeric compounds with dicer.In certain embodiments, interactional oligomeric compounds is strand oligomeric compounds with dicer.
Wherein in double-strand oligomeric compounds and the interactional embodiment of dicer, this double-strand oligomeric compounds forms dicer duplex.In certain embodiments, any oligomeric compounds as herein described can be suitable as or two chains of dicer duplex.In certain embodiments, every bar chain of dicer duplex is all oligomeric compounds of the present invention.In certain embodiments, a chain of dicer duplex is oligomeric compounds of the present invention, and another chain be any modification or the oligomeric compounds of unmodified.In certain embodiments, one of dicer duplex or two chains are at the nucleosides of 5 ' contained II, IIa, IIb, IIc, IId or IIe.In certain embodiments, a chain of dicer duplex is antisense oligonucleotide compound, and another chain is its message complementary sense sequence.
In certain embodiments, the invention provides the interactional strand oligomeric compounds with dicer.In certain embodiments, the nucleosides of this type of strand dicer compound contained II, IIa, IIb, IIc, IId or IIe.In certain embodiments, strand dicer compound 3 '-hold not phosphorus-containing moieties.In certain embodiments, this type of strand dicer compound can comprise 3 '-pendency.In certain embodiments, this type of 3 '-dangle as other nucleosides.In certain embodiments, this type of 3 '-pendency comprises 1-4 other nucleosides, and it is not differently modified with complementary target and/or with the adjacent 3 ' nucleosides of oligomeric compounds.In certain embodiments, strand oligomeric compounds comprises the antisense oligonucleotide with two 3 '-end pendency nucleosides, and the nucleosides that wherein dangles is the adenosine of VITAMIN B4 or modification.In certain embodiments, the nucleosides of interactional strand oligomeric compounds contained II, IIa, IIb, IIc, IId or IIe with dicer.
In certain embodiments, the interaction of oligomeric compounds and dicer finally causes antisense activity.In certain embodiments, one or two chains of dicer cracking double-strand oligomeric compounds, and the product of gained enters RISC approach, finally causes antisense activity.In certain embodiments, arbitrary chain of dicer not cracking double-strand oligomeric compounds, but still be conducive to entering RISC approach and finally causing antisense activity.In certain embodiments, dicer cracking strand oligomeric compounds, and the product of gained enters RISC approach, finally causes antisense activity.In certain embodiments, dicer not cracking strand oligomeric compounds, but still be conducive to entering RISC approach and finally causing antisense activity.
In certain embodiments, the invention provides the method for activation dicer, comprise and dicer is contacted with oligomeric compounds.In some this type of embodiment, dicer is in cell.In some this type of embodiment, cell is in animal.
Ago
In certain embodiments, oligomeric compounds of the present invention and Ago interact.In certain embodiments, first this type of oligomeric compounds enters RISC approach, and mode interacts with another member (such as, dicer) of this approach.In certain embodiments, first oligomeric compounds enters RISC approach by interacting with Ago.In certain embodiments, this interaction finally causes antisense activity.In certain embodiments, the invention provides to comprise and make Ago contact with oligomeric compounds and make the method that Ago activates.In some this type of embodiment, Ago is in cell.In some this type of embodiment, cell is in animal.
oligomeric compounds identity
In certain embodiments, a part for oligomeric compounds is identical with the core base sequence 100% of microRNA, but whole oligomeric compounds is not identical with microRNA.In some this type of embodiment, the length with the oligomeric compounds of 100% same section is greater than the length of microRNA.Such as, for the microRNA stand-in that the nucleosides connected by 24 forms, core base wherein at the 1 to 23 is all identical with the corresponding position of the microRNA of 23 core bases longs, it has 23 nucleoside moieties identical with microRNA core base sequence 100%, and has the overall identity with the core base sequence about 96% of microRNA.
In certain embodiments, the core base sequence of oligomeric compounds and the core base sequence of a microRNA part identical.Such as, for the strand microRNA stand-in that the nucleosides connected by 22 forms, wherein the core base of the 1 to 22 is all identical with the corresponding position of the microRNA of 23 core bases longs, and it is identical with 22 core base portions of microRNA core base sequence.Such strand microRNA stand-in and the core base sequence of whole microRNA have the overall identity of about 96%, and have the identity with 22 of microRNA core base portions 100%.
the synthesis of monomer and oligomeric compounds
Nucleosides provided herein is prepared by any applicable organic synthesis technology, such as in the following embodiments shown in.This type of technology many are known in the art.But, many known technology are documented in the following documents: " Compendium of OrganicSynthetic Methods ", John Wiley & Sons, New York: the 1 volume, Ian T.Harrison and Shuyen Harrison, 1971; 2nd volume, Ian T.Harrison and ShuyenHarrison, 1974 years; 3rd volume, Louis S.Hegedus and Leroy Wade, 1977; 4th volume, Leroy G.Wade Jr., 1980; 5th volume, Leroy G.Wade Jr., 1984; With the 6th volume, Michael B.Smith; And March, J., " AdvancedOrganic Chemistry ", the 3rd edition, John Wiley & Sons, New York, 1985 years; " Comprehensive Organic Synthesis.Selectivity, Strategy & Efficiency inModern Organic Chemistry ", the 9th volume, Barry M.Trost editor-in-chief, PergamonPress, New York, 1993; " Advanced Organic Chemistry, Part B:Reactions and Synthesis ", the 4th edition, Carey and Sundberg, KluwerAcademic/Plenum Publishers, New York, calendar year 2001; " Advanced OrganicChemistry, Reactions, Mechanisms, and Structure ", the 2nd edition, March, McGraw Hill, 1977 years; Greene, T.W. and Wutz, P.G.M., " Protecting Groupsin Organic Synthesis ", the 4th edition, John Wiley & Sons, New York, 1991 years; And Larock, R.C., " Comprehensive Organic Transformations ", the 2nd edition, John Wiley & Sons, New York, 1999 years.
Compound as herein described comprises one or more asymmetric center, and therefore produce enantiomorph, diastereomer and other stereoisomeric forms in any ratio, its can be defined as according to absolute stereochemical (R)-or (S)-, α or β, or be defined as (D)-or (L)-, such as amino acid.Comprise this type of possible isomer all herein, and their racemize and optical purity form.Optical isomer by its corresponding optical activity precursor by said procedure or pass through resolving racemic mixtures and prepare.Fractionation can be carried out by chromatography or by periodic crystallisation or by some combinations of these technology well known by persons skilled in the art when there is resolving agent.About the further details split is found in Jacques etc., " Enantiomers, Racemates, andResolutions ", John Wiley & Sons, 1981 years.When compound as herein described comprises olefinic double bond, other degree of unsaturation or other geometry asymmetric center, and except as otherwise noted, otherwise it is intended to represent that this compound comprises E and Z geometrical isomer or suitable, trans-isomer(ide).Equally, be also intended to comprise all tautomeric forms.The configuration of any carbon-to-carbon double bond occurred herein is only selected for facility, is not intended to limit particular configuration, unless be illustrated like this.
In certain embodiments, the preparation of oligomeric compounds as disclosed herein is according to carrying out for the program of DNA in Publication about Document: " Protocols for Oligonucleotides andAnalogs ", Agrawal edits, Humana Press, 1993; And/or RNA:Scaringe, " Methods ", calendar year 2001, the 23rd volume 206-217 page; Gait etc., " Applications ofChemically synthesized RNA in RNA:Protein Interactions ", Smith edits, 1998,1-36 page; Gallo etc., " Tetrahedron ", calendar year 2001, the 57th volume, 5707-5713 page.The other method of solid phase synthesis is found in Caruthers U.S. Patent No. 4,415,732,4,458,066,4,500,707,4,668,777,4,973,679 and 5,132,418; And Koster U.S. Patent No. 4,725,677 and Re.34,069.
The synthesis of oligomeric compounds
Oligomeric compounds uses the solid support method preparation relative with liquid phase process usually.The commercial equipment of solid support method that utilizes being usually used in preparing oligomeric compounds is sold by Duo Jia supplier, comprises such as Applied Biosystems (Foster City, CA).In addition or alternatively, any other device for this synthesis known in the art can be adopted.Suitable solid phase technique, comprises automatic Synthesis, and at " Oligonucleotides and Analogues, a Practical Approach ", F.Eckstein edits, and Oxford University Press, NewYork, described by having in 1991.
In RNA interference and micro RNA increase, continuous effort has been made relative to DNA and the RNA of related analogs and the synthesis of related analogs.The main RNA synthesis strategy of current commercial employing comprises 5 '-O-DMT-2 '-O-t-Butyldimethylsilyl (TBDMS), 5 '-O-DMT-2 '-O-[1 (2-difluorophenyl)-4-methoxy piperide-4-base] (FPMP), 2 '-O-[(triisopropylsilyl) oxygen base] methyl (2 '-O-CH
2-O-Si (iPr)
3and 5 '-O-silicon ether-2 '-ACE (two (2-acetoxyethoxy) methyl (ACE) of two (trimethylsiloxy group) cyclo-dodecyl oxygen silicon ether (DOD)-2 '-O-of 5 '-O-(TOM).The current list of some dominant companies of RNA product is provided to comprise Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri Biotechnologies Inc. and Integrated DNATechnologies, Inc at present.This company of Princeton Separations synthesizes activator at a kind of RNA of sale, and it declares can shorten coupling time when especially adopting TOM and TBDMS chemistry.Essential groups for business RNA synthesis is TBDMS:5 '-O-DMT-2 '-O-t-Butyldimethylsilyl; TOM:2 '-O-[(triisopropylsilyl) oxygen base] methyl; Two (2-acetoxyethoxy) methyl of two (trimethylsiloxy group) cyclo-dodecyl oxygen silicon ether-2 '-O-of DOD/ACE:(5 '-O-; And FPMP:5 '-O-DMT-2 '-O-[1 (2-difluorophenyl)-4-ethoxypiperidin-4-base].In certain embodiments, each of aforementioned RNA synthesis strategy all can use in this article.In certain embodiments, aforementioned RNA synthesis strategy can carry out together by hybrid mode, such as, use 2 '-O-blocking group in 5 '-blocking group in a kind of strategy and another kind of strategy.
the composition of compounding pharmaceutical composition and method
Oligomeric compounds can with pharmaceutically acceptable activity and/or inert substance compounding, for the preparation of pharmaceutical composition or preparation.Composition and the method for compounding pharmaceutical composition depend on multiple standards, include but not limited to route of administration, disease degree or dosage to be administered.
Comprise the oligomeric compounds of antisense compounds by this type of oligomeric compounds and suitable pharmaceutically acceptable diluent or carrier being carried out combining and be used for pharmaceutical composition.Pharmaceutically acceptable thinner comprises phosphate buffered saline buffer (PBS).PBS is the thinner of the composition being applicable to potential delivery.Therefore, in certain embodiments, for method as herein described is the pharmaceutical composition comprising antisense compounds and pharmaceutically acceptable thinner.In certain embodiments, pharmaceutically acceptable thinner is PBS.
The pharmaceutical composition comprising oligomeric compounds contains the salt of any pharmacy acceptable salt, ester or this type of ester.In certain embodiments, the pharmaceutical composition comprising oligomeric compounds comprises one or more oligonucleotide, and it (directly or indirectly) can provide bioactive metabolite or its resistates after being administered to animal (comprising people).Therefore, such as, the disclosure also relates to the pharmacy acceptable salt of antisense compounds, prodrug, the pharmacy acceptable salt of this type of prodrug and other bioequivalence agent.Suitable pharmacy acceptable salt includes but not limited to sodium salt and sylvite.
Prodrug can comprise the one or both ends of the oligomeric compounds other nucleosides being incorporated into endogenous nucleic acid enzymatic lysis in meeting body, to form active oligomeric compound.
Carrier based on lipid has been used to the exonuclease treatment in multiple method.In one approach, nucleic acid is introduced in the premolding liposome or liposome complex be made up of cation lipid and neutral lipid mixture.In another approach, when there is not neutral lipid, form the mixture of DNA and list or polycation lipid.
In some method, prepare the preparation of polyamino compound or the lipid part comprised with nucleic acid compound.Described by this type of preparation has in the following documents: the open WO/2008/042973 of PCT; And Akinc etc., " Nature Biotechnology ", the 26th volume 561-569 page (on May 1st, 2008), they are incorporated herein by reference all in full.
some method/purposes
In certain embodiments, the invention provides the reduction amount of target nucleic acid or the Compounds and methods for of activity.In certain embodiments, the invention provides antisense compounds and method.In certain embodiments, the invention provides the antisense compounds activated based on RNA enzyme H and method.In certain embodiments, the invention provides RNAi Compounds and methods for.
In some cases, it is desirable to use at least in part by antisense compounds that RISC plays a role.In some this type of situation, no matter the RNA of unmodified, be strand or double-strand, be all not suitable for.Single stranded RNA is relatively unstable, and double-stranded RNA not easily enters cell.Challenge the modification and motif that are also must determine to provide required character (stability such as improved), and do not disturb the RNA antisense activity that (and even may improve) is played by RNAi.
In certain embodiments, the invention provides the oligonucleotide having and cause the motif (nucleosides motif and/or bonding motif) improving characteristic.Some this type of motif produces has the stability of improvement and/or cellular uptake characteristic and the single stranded oligonucleotide that simultaneously maintains antisense activity.Such as, near 3 '-end, there is stability and the activity that the oligonucleotide replacing nucleosides motif and 7 thiophosphatephosphorothioate bondings has improvement.The analogue compounds comprising thiophosphatephosphorothioate bonding at each bonding place have the stability improved further, but the activity do not had as RNAi compound, the chances are because the interaction of other phosphorothioate bond credit union interference oligonucleotide and RISC pathway component (such as with Ago).In certain embodiments, the oligonucleotide with motif herein produces the single stranded RNA i compound with desirable properties.In certain embodiments, this class oligonucleotide can match with Article 2 chain, to form double-stranded RNA i compound.In this type of embodiment, the Article 2 chain of this type of double-stranded RNA i compound can comprise motif of the present invention, can comprise another and modify motif or can unmodified.
Show, in some cases, the single stranded RNA comprising 5 '-bound phosphate groups has RNAi activity, but if lack this 5 '-bound phosphate groups, has lower RNAi active.The present inventor has recognized that, in some cases, 5 '-bound phosphate groups potentially unstable of unmodified (chemically or unstable in zymetology).Therefore, in some cases, wish that modified oligonucleotide is to stablize 5 '-phosphoric acid ester.In certain embodiments, this realizes by modifying bound phosphate groups.In certain embodiments, this passes through sugar of modification 5 '-end nucleotide and realizes.In certain embodiments, this is realized by modification bound phosphate groups and sugar.In certain embodiments, sugar in 5 '-position, 2 '-position or these two positions, 5 '-position and 2 '-position are modified.As motif above, need in the embodiment of RNAi activity wherein, phosphoric acid ester stabilization must not modify the interactional ability disturbing oligonucleotide and RISC pathway component (such as, with Ago).
In certain embodiments, the invention provides the oligonucleotide comprising phosphoric acid ester stabilization as herein described modification and motif.In certain embodiments, this class oligonucleotide can be used as the single stranded RNA i compound with required character.In certain embodiments, this class oligonucleotide can match with Article 2 chain, to form double-stranded RNA i compound.In this type of embodiment, Article 2 chain can comprise motif of the present invention, can comprise another and modify motif or can be the RNA of unmodified.
This type of target comprising the antisense compounds of motif of the present invention and/or the modification of 5 '-phosphoric acid ester stabilization can be any naturally occurring nucleic acid.In certain embodiments, target is selected from: pre-mRNA, mRNA, non-coding RNA, non-coding tiny RNA, pd-RNA and microRNA.Target nucleic acid is in the embodiment of pre-RNA or mRNA wherein, and target can identical with the target of naturally occurring micro-RNA (that is, oligonucleotide can be microRNA stand-in).In this type of embodiment, more than a kind of said target mrna can be had.
In certain embodiments, the invention provides the Compounds and methods for realizing antisense activity in cell.In certain embodiments, cell is in animal.In certain embodiments, animal is behaved.In certain embodiments, to the invention provides compound administration of the present invention to animal to regulate the amount of one or more target nucleic acids or method that is active or function.
In certain embodiments, oligonucleotide comprises one or more motif of the present invention, but does not comprise the modification of phosphoric acid ester stabilization.In certain embodiments, this class oligonucleotide can be used for external application.In certain embodiments, this class oligonucleotide can be used for wherein not needing to apply in the body of RISC activity.Such as, in certain embodiments, this class oligonucleotide changes the montage of pre-mRNA.
non-limiting open and be incorporated to way of reference
Be described according to some embodiment although some compound as herein described, composition and method are special, following examples only are not intended to be limited for setting forth compound as herein described.The each reference enumerated in the application, GenBank accession number etc. are incorporated herein by reference all in full.
Each sequence identifier be " RNA " or " DNA " by this submits to although enclose sequence table as required, and in fact, those sequences can combine with any chemically modified and modify.The name that it will be appreciated by those of ordinary skill in the art that such as " RNA " or " DNA " for describing modified oligonucleotide is arbitrary in some cases.Such as, the oligonucleotide comprising the nucleosides containing 2 '-OH sugar moieties and thymine alkali bases can be described to have modifies sugar (2 ' OH, natural 2 '-H for DNA) DNA, or be described as the RNA with modified base (thymus pyrimidine (methylate uridylic), the natural uridylic for RNA).
Embodiment (generally)
Record on 300MHz and 75MHz Bruker spectrograph respectively
1h and
13c NMR spectrum.
Embodiment 1
The synthesis of nucleoside phosphoramidites
The preparation of nucleoside phosphoramidites is carried out according to the program herein and described in this area, such as, but not limited to United States Patent (USP) 6, and 426,220 and the PCT WO 02/36743 that announced.
Embodiment 2
The synthesis of oligomeric compounds
Oligomeric compounds used according to the invention is convenient and obtain routinely by the solid phase synthesis technique known.Equipment for this synthesis is sold by Duo Jia supplier, comprises such as Applied Biosystems (Foster City, CA).In addition or alternatively, other device any for this synthesis known in the art can be adopted.It is well known that use similar technology to prepare oligonucleotide, such as alkyl derivative and there are those of thiophosphatephosphorothioate bonding.
Oligomeric compounds: phosphodiester (P=O) oligomeric compounds (including but not limited to oligonucleotide) that is unsubstituted and that replace can use standard phosphoramidite chemistry be oxidized by iodine and above synthesize at automatization DNA synthesizer (Applied Biosystems 394 type).
In certain embodiments, thiophosphatephosphorothioate internucleoside linkage (P=S) synthesizes in the mode being similar to phosphodiester internucleoside linkage, unlike: by using 3 of 10%w/v, H-1, the acetonitrile solution of 2-benzo two mercaptan-3-ketone-1,1-dioxide is oxidized phosphorous acid ester bonding and realizes thiation.The time of thiation reactions steps is increased to 180 seconds, and continues by normally adding cap step.Process in strong aqua at 55 DEG C (12-16h) from the cracking of CPG post and solution be honored as a queen, by with the ethanol more than 3 times of volumes from the NH of 1M
4precipitation is carried out to reclaim oligomeric compounds in OAc solution.Phosphinate (phosphinate) internucleoside linkage can as United States Patent (USP) 5, and 508, prepare described in 270.
Alkyl phosphate internucleoside linkage can as United States Patent (USP) 4, and 469, prepare described in 863.
3 '-deoxidation-3 '-methene phosphonate ester internucleoside linkage can as United States Patent (USP) 5,610,289 or 5, and 625, prepare described in 050.
Between phosphoramidite nucleoside, bonding can as United States Patent (USP) 5, and 256,775 or United States Patent (USP) 5,366, prepare described in 878.
Alkylphosphonothioate internucleoside linkage can be announced with WO 94/17093 and WO94/02499 respectively as the PCT application PCT/US94/00902 that announced and PCT/US93/06976() described in and prepare.
3 '-deoxidation-3 '-amino phosphoramidate internucleoside linkage can as United States Patent (USP) 5, and 476, prepare described in 925.
Phosphotriester internucleoside linkage can as United States Patent (USP) 5, and 023, prepare described in 243.
Borane phosphonate (borano phosphate) internucleoside linkage can as United States Patent (USP) 5,130,302 and 5, and 177, prepare described in 198.
There is one or more not phosphorous internucleoside linkage, include but not limited to the oligonucleoside (also differentiating the oligonucleoside for MMI connects) that methylene radical methyl-imino connects, the oligonucleoside (also differentiating the oligonucleoside for MDH connects) that methylene radical dimethylhydrazine connects, the oligomeric compounds of the oligonucleoside (also differentiating the oligonucleoside for acid amides-3 connects) that methylene radical carbonylamino connects and the oligonucleoside (also differentiating the oligonucleoside for acid amides-4 connects) that methene amido carbonyl connects, and the mixed backbone oligomeric compounds with such as alternately MMI and P=O or P=S bonding can as United States Patent (USP) 5, 378, 825, 5, 386, 023, 5, 489, 677, 5, 602, 240 and 5, 610, prepare described in 289.
Methylene acetal and thio-methylene acetal internucleoside linkage can as United States Patent (USP)s 5,264,562 and 5, and 264, prepare described in 564.
Oxyethane internucleoside linkage can as United States Patent (USP) 5, and 223, prepare described in 618.
Embodiment 3
The abstraction and purification of oligomeric compounds
Cracking from controlled pore glass solid carrier or other mounting medium also, in the strong aqua of 55 DEG C after deblocking 12-16 hour, will include but not limited to the NH of oligomeric compounds from 1M of oligonucleotide and oligonucleoside by the ethanol of >3 times of volume
4be precipitated out in OAc and reclaim.By the oligomeric compounds of synthesis by electrospray mass spectrometry (molecular weight determination) and analyzed by capillary gel electrophoresis.The thiophosphatephosphorothioate obtained in synthesis and the relative quantity of phosphodiester bond are determined relative to the ratio of-16amu product (+/-32+/-48) by correct molecular weight.For some research, by HPLC purifying oligomeric compounds, as Chiang etc., J.Biol.Chem.1991, described in 266,18162-18171.Usually those that obtain by non-HPLC purified material are similar to by the result that HPLC purified material obtains.
Embodiment 4
Use 96 well plate format synthesis oligomeric compounds
Include but not limited to that the oligomeric compounds of oligonucleotide synthesizes on the automatic DNA synthesizer DNA simultaneously can assembling 96 sequences with 96 well format by solid phase P (III) phosphoramidite chemistry.Phosphodiester internucleoside linkage is by obtaining with iodine Water oxidize.Thiophosphatephosphorothioate internucleoside linkage by utilizing 3, H-1, the sulfuration of the anhydrous acetonitrile of 2 benzo two sulphur-3-ketone-1,1-dioxide (Beaucage reagent) and generating.β-cyanoethyl the diisopropylphosphoramidite of standard base protection can purchased from many commercial supplier (such as PE-Applied Biosystems, Foster City, CA or Pharmacia, Piscataway, NJ).Non-standard nucleosides according to standard or patented method synthesis, and can functionalised the β-cyanoethyl diisopropylphosphoramidite into base protection.
Dense NH can be used under high temperature (55-60 DEG C)
4oH process 12-16 hour, goes oligomeric compounds to protection from cracking carrier, and the then vacuum-drying product that discharges.Then, the product of drying is resuspended in sterilized water, to provide motherboard, then uses autospencer to dilute all analyses and test panel sample by it.
Embodiment 5
96 well plate format are used to analyze oligomeric compounds
In each hole, the concentration of oligomeric compounds is assessed by diluted sample and ultra-violet absorption spectrum.The total length integrity of each product by capillary electrophoresis (CE) with 96 well format (Beckman P/ACE
tMmDQ) or for the sample of single preparation at business CE equipment (as Beckman P/ACE
tM5000, ABI 270) upper evaluation.Base and main chain composition confirm by utilizing electrospray mass spectrometry to carry out mass analysis to oligomeric compounds.All mensuration test panels all use list and hyperchannel autospencer are diluted by motherboard and obtain.If the oligomeric compounds of at least 85% is at least 85% total length on flat board, then this flat board is judged as accepting.
Embodiment 6
Use oligomeric compounds ex vivo treatment of cells
Various kinds of cell type any one in test the impact of oligomeric compounds on target nucleic acid expression, prerequisite is that this target nucleic acid exists with measurable level.This usually can use such as PCR or Northern engram analysis and measure.The clone deriving from Various Tissues and species can derive from American Type Culture Collection (ATCC, Manassas, VA).
There is provided following cell type for exemplary purpose, but can use other cell type routinely, prerequisite is that target is expressed in selected cell type.This can easily be measured by method conventional in this area, such as Northern engram analysis, ribonuclease protection assay or RT-PCR.
B.END cell: mouse brain endothelial cell line b.END derives from Werner doctor Risau of Max Plank Institute (Bad Nauheim, Germany).B.END cell is usually with 10% foetal calf serum (Invitrogen Life Technologies, Carlsbad, CA) cultivate in the DMEM high glucose medium (Invitrogen Life Technologies, Carlsbad, CA) supplemented.Usually by carrying out tryptic digestion and dilution when reaching about 90% degree of converging to passage.Cell is inoculated on 96 orifice plates (Falcon-Primaria#353872, BD Biosciences, Bedford, MA), for including but not limited to the purposes of oligomeric compounds transfection experiment with the density of about 3000 cells/well.
Relate to the experiment with oligomeric compounds process cell:
When cell reach approximately degree of converging time, use transfection method oligomeric compounds as described herein to process it.
LIPOFECTIN
TM
When cell reaches 65-75% degree of converging, with one or more oligomeric compounds, it is processed.By oligomeric compounds and LIPOFECTIN
tM(Invitrogen Life Technologies, Carlsbad, CA) is at Opti-MEM
tM-1 subtracts mixing in blood serum medium (Invitrogen LifeTechnologies, Carlsbad, CA), to reach the LIPOFECTIN of required oligomeric compounds concentration and every 100nM oligomeric compounds 2.5 or 3 μ g/mL
tMconcentration.This transfection mixture is at room temperature hatched about 0.5 hour.For the cell grown in 96 orifice plates, by hole 100 μ L OPTI-MEM
tMthen-1 washing once, and uses 130 μ L transfection mixture process.The substratum of proper volume and oligomeric compounds is used to process the cell grown in 24 orifice plates or other standard tissue culture plate similarly.Process cell, obtains data in duplicate or in triplicate., after about 4-7 hour the substratum fresh culture containing transfection mixture is replaced 37 DEG C of process.16-24 hour harvested cell after with oligomeric compounds process.
Other suitable transfection reagent known in the art includes but not limited to CYTOFECTIN
tM, LIPOFECTAMINE
tM, OLIGOFECTAMINE
tMand FUGENE
tM.Other suitable transfection method known in the art includes but not limited to electroporation.
Embodiment 7
The Real-time PCR Analysis of said target mrna level
The quantitative of said target mrna level uses ABI PRISM by real-time quantitative PCR
tM7600,7700 or 7900 sequence detection systems (PE-Applied Biosystems, Foster City, CA) illustrate according to manufacturers and complete.It is a kind of stopped pipe, non-gel-type fluorescence detecting system, can carry out real-time high-throughput quantification to polymerase chain reaction (PCR) product.Relative with the Standard PC R wherein just carrying out amplified production quantitative after completing PCR, the product in real-time quantitative PCR carries out when they are accumulated quantitatively.This realizes by being included in the oligonucleotide probe of specificity annealing between forward and inverse PCR primer in PCR reaction, and comprises two kinds of fluorescence dyes.Reporting dyes (as FAM or JOE, is derived from PE-Applied Biosystems, Foster City, CA; Operon Technologies Inc., Alameda, CA or IntegratedDNA Technologies Inc., Coralville, IA) be connected to 5 ' end of probe, and by quencher dyes (as TAMRA, derive from PE-Applied Biosystems, Foster City, CA; Operon Technologies Inc., Alameda, CA or Integrated DNA TechnologiesInc., Coralville, IA) be connected to 3 ' end of probe.When probe and dyestuff intact time, reporting dyes launch by the 3 ' quencher dyes cancellation be close to.In amplification procedure, probe and target sequence are annealed, and formed can by the substrate of 5 '-exonuclease activity cracking of Taq polysaccharase.In the extension stage of pcr amplification circulation, Taq polysaccharase discharges reporting dyes to the cracking of probe from the rest part (and therefore from quencher moieties) of probe, and produces sequence specific fluorescent signal.By each circulation, additional reporter dye molecules from its corresponding probe cleavage, and passes through ABIPRISM
tMthe built-in laser optical element of sequence detection system is with fixing interval monitoring fluorescence intensity.In each mensuration, a series of parallel reactor comprising the serial dilution mRNA deriving from untreated control sample generates typical curve, and it carries out the suppression per-cent after antisense oligonucleotides acid treatment for quantitative to test sample.
Before quantitative PCR analysis, evaluate the ability that the target gene aligning measurement has specific primer-probe group and GAPDH amplified reaction " multiplex ".In multiplex, amplified target gene and internal standard gene GAPDH while of in single sample.In the analysis, serial dilution is carried out to the mRNA be separated from untreated cell.In existence only to GAPDH, only to target gene (" substance ") or when having specific primer-probe group to both (multiplexes), increase each diluted sample.After pcr amplification, generated the typical curve of GAPDH as extent of dilution function and said target mrna signal by substance and multiplex sample.If the slope of the GAPDH generated by multiplex sample and target signal and relation conefficient all drop in 10% of the analog value that it is generated by substance sample, then will have that specific primer-probe group is considered as to this target can multiplex.Other PCR method is also known in the art.
RT and PCR reagent derive from Invitrogen Life Technologies (Carlsbad, CA).RT(is real-time) PCR carries out in the following manner: by 20 μ L PCR mixtures, (2.5 × PCR damping fluid is not (containing MgCl
2), 6.6mM MgCl
2, each 375 μMs of dATP, dCTP, dCTP and dGTP, forward primer and each 375nM of reverse primer, probe 125nM, 4 units of RNAase inhibitor, 1.25 unit PLATINUM
taq, 5 unit MuLV reversed transcriptive enzymes and 2.5 × ROX dyestuff) be added to 96 orifice plates containing 30 μ L total rna solutions (20-200ng).Within 30 minutes, RT reaction is carried out by hatching at 48 DEG C.10 minutes are hatched to activate PLATINUM at 95 DEG C
after Taq, carrying out 40 circulations of two-step pcr scheme: 95 DEG C 15 seconds (sex change), is then 60 DEG C 1.5 minutes (annealing/extend).
By real-time by RT() amount of gene target that obtains of PCR is normalized, mode uses GAPDH(mono-kind to express constant gene) expression level, or by using RIBOGREEN
tMit is quantitative that (Molecular Probes, Inc.Eugene, OR) carries out total serum IgE.GAPDH expresses by real-time RT-PCR quantitative, mode for running with target simultaneously, multiplex runs or isolated operation.Use RiboGreen
tMit is quantitative that RNA quantitative reagent (MolecularProbes, Inc.Eugene, OR) carries out total serum IgE.Pass through RIBOGREEN
tMcarry out the quantitative method of RNA to instruct to some extent in Jones, L.J. etc. (" Analytical Biochemistry ", the 265th volume 368-374 page in 1998).
In this measures, by 170 μ L RIBOGREEN
tMworking reagent is (by the RIBOGREEN of dilution proportion in 10mM Tris-HCl, 1mM EDTA of 1:350
tMreagent, pH 7.5) be pipetted into containing the purified cell RNA of 30 μ L 96 orifice plates.Read in the CytoFluor 4000 (PE Applied Biosystems) dull and stereotyped, wherein excitation wavelength is 485nm and emission wavelength is 530nm.
Embodiment 8
To the analysis that oligonucleotide suppresses target to be expressed
The antisense adjustment of target expression can be measured by various ways known in the art.Such as, said target mrna level is undertaken quantitatively by such as Northern engram analysis, competition polymerase chain reaction (PCR) or PCR in real time.Real-time quantitative PCR is required at present.RNA analysis can be carried out to total cell RNA or poly (A)+mRNA.A kind of method that the disclosure carries out RNA analysis uses as the total cell RNA of this paper described in other embodiment.The method that RNA is separated is known in the art.Northern engram analysis is also conventional in this area.Real-time quantitative (PCR) can derive from PE-Applied Biosystems, the commercially available ABI PRISM of Foster City, CA by using
tM7600,7700 or 7900 sequence detection systems and according to manufacturers illustrate use and complete expediently.
The protein level of target can be quantitative by various ways well known in the art, such as immunoprecipitation, western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS).Antibody for target can be identified and can available from multiple source, the MSRS catalogue (Aerie Corporation, Birmingham, MI) of such as antibody, or prepare by conventional monoclonal well known in the art or polyclonal antibody production method.Prepare the method for polyclonal antiserum at such as Ausubel, F.M. etc., " Current Protocols inMolecular Biology ", 2nd volume, 11.12.1-11.12.9 page, John Wiley & Sons, Inc., instruct to some extent in 1997.Monoclonal antibody be prepared in such as Ausubel, F.M. etc., " Current Protocols in Molecular Biology ", the 2nd volume, 11.4.1-11.11.5 page, John Wiley & Sons, Inc., instructs in 1997 years to some extent.
Immuno-precipitation is the standard method of this area, and is found in such as Ausubel, F.M. etc., " Current Protocols in Molecular Biology ", the 2nd volume, 10.16.1-10.16.11 page, John Wiley & Sons, Inc., 1998.Western blot (immunoblotting) analysis is the standard method of this area, and be found in such as Ausubel, F.M. etc., " Current Protocols in Molecular Biology ", 2nd volume, 10.8.1-10.8.21 page, John Wiley & Sons, Inc., 1997.Enzyme-linked immunosorbent assay (ELISA) is the standard method of this area, and be found in such as Ausubel, F.M. etc., " Current Protocolsin Molecular Biology ", 2nd volume, 11.2.1-11.2.22 page, John Wiley & Sons, Inc., 1991.
Embodiment 9
For the phenotype test of target inhibitor purposes and the design of In vivo study
Phenotype test
After identifying target inhibitor by method disclosed herein, studied further by oligomeric compounds in one or more phenotype tests, often kind of mensuration has the endpoint measured of the measurable curative effect to particular disease states or illness.
Phenotype test, test kit and reagent used are known to those skilled in the art, and in this article for studying target healthy with the role in disease and/or associate.Can comprise purchased from the representative phenotype test of many arbitrary families of commercial supplier: for measuring those (Molecular Probes, Eugene, OR of cytoactive, cytotoxicity, propagation or cell survival; PerkinElmer, Boston, MA); Based on protein measuring, comprise enzymatic determination (Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; OncogeneResearch Products, San Diego, CA); Cell regulate and control, signal transduction, inflammation, oxidising process and apoptosis (Assay Designs Inc., Ann Arbor, MI); Triglyceride level accumulation (Sigma-Aldrich, St.Louis, MO); Angiogenesis test, tubule form test, cytokine and hormone determination and metabolic determination (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ).
In a limiting examples, the cell measured through determining to be suitable for particular phenotype (that is, is the MCF-7 cell that breast cancer research is selected; Adipocyte for obesity research is selected) process with the target inhibitor identified by vitro study and the control compound of optimum concn determined by aforesaid method.At the end of the process phase, to mensuration, there is specific methods analyst process and untreated cell by one or more, to determine phenotypic results and terminal.
Phenotype terminal comprises the change of the cellular form along with time or therapeutic dose, and the change of cellular component such as protein, lipid, nucleic acid, hormone, carbohydrate or metal level.The measurement of cell state is also paid close attention to terminal, and these states comprise pH, the stage of cell cycle, cell to the picked-up of biological indicator or secretion.
Also effect of target inhibitor or the instruction of effect are used as to the measurement of the expression of one or more genes of cell after process.Hallmark gene or those are doubtfully being processed with the gene of particular disease states, illness or phenotypic correlation and all measured in untreated cell.
In vivo study
The individual subjects of In vivo study as herein described is warm-blooded vertebrate, and it comprises people.
Embodiment 10
RNA is separated
Poly (A)+mRNA is separated
Poly (A)+mRNA is separated according to the method for (Clin.Chem., 1996,42,1758-1764) such as Miura.Other method be separated for poly (A)+mRNA is conventional in the art.In brief, for the cell of growth on 96 orifice plates, from cell, remove growth medium, wash each hole with the cold PBS of 200 μ L.60 μ L lysis buffers (10mM Tris-HCl, pH 7.6,1mM EDTA, 0.5M NaCl, 0.5% NP-40,20mM vanadyl-ribonucleoside complex) are joined each hole, stirs flat board gently, and then at room temperature hatch five minutes.55 μ L lysates are transferred to 96 orifice plates (AGCT Inc., Irvine CA) that Oligo d (T) wraps quilt.Flat board is at room temperature hatched 60 minutes, washs 3 times with 200 μ L lavation buffer solutions (10mM Tris-HCl pH 7.6,1mM EDTA, 0.3M NaCl).After last washing, flat board is imprinted on paper handkerchief, to remove unnecessary lavation buffer solution, and then air-dry 5 minutes.The 60 μ L elution buffers (5mM Tris-HClpH 7.6) being preheating to 70 DEG C are added in each hole, flat board are hatched 5 minutes on the hot plate of 90 DEG C, and then eluate is transferred to 96 new orifice plates.
All solution of proper volume can be used to process the cell grown on 100mm or other on-gauge plate similarly.
Total serum IgE is separated
Use the RNEASY 96 purchased from Qiagen Inc. (Valencia, CA)
tMthe program that test kit is recommended according to manufacturers with damping fluid is separated total serum IgE.In brief, for the cell of growth on 96 orifice plates, growth medium is removed from cell, and washs each hole with the cold PBS of 200 μ L.150 μ L damping fluid RLT are added to each hole, and stirring 20 seconds that flat board is exerted oneself.Then the ethanol of 150 μ L 70% is added each hole, and carry out contents were mixed by blowing and beating 3 times up and down with transfer pipet.Then sample is transferred to and be connected to QIAVAC
tMthe RNEASY 96 of manifold
tMorifice plate, and this manifold is furnished with waste collection dish and is connected to vacuum source.Apply vacuum 1 minute.Add 500 μ L damping fluid RW1 to RNEASY 96
tMeach hole of plate, and hatch 15 minutes, and and then apply vacuum 1 minute.Add other 500 μ L damping fluid RW1 to RNEASY 96
tMeach hole of plate, and apply vacuum 2 minutes.Then 1mL damping fluid RPE is added to RNEASY 96
tMeach hole of plate, and apply vacuum 90 seconds.Then repeat damping fluid RPE washing, and apply vacuum again 3 minutes.Then by flat board from QIAVAC
tMmanifold is removed, and blots on paper handkerchief.Then flat board is connected to QIAVAC again
tMmanifold, it is furnished with the collection tube support containing 1.2mL collection tube.Then in each hole, carrying out eluted rna without the water of RNA enzyme by pipetting 140 μ L, being hatched 1 minute, and then applying vacuum 3 minutes.
Can use QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA) automatically perform repeatedly move liquid and elution step.Substantially, on culture plate after lysing cell, flat board is transferred to automatic platform, perform wherein and move liquid, DNA enzymatic process and elution step.
Embodiment 11
Target specific primer and probe
Can use the sequence information announced, be hybridize probe and design of primers with target sequence.
Such as, for people PTEN, use the sequence information (GENBANK announced
tMaccession number U92436.1, SEQ ID NO:1) devise following primer-probe group.
Forward primer: AATGGCTAAGTGAAGATGACAATCAT (SEQ ID NO:2)
Reverse primer: TGCACATATCATTACACCAGTTCGT (SEQ ID NO:3)
And PCR probe:
FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA (SEQ ID NO:4), wherein FAM is fluorescence dye, and TAMRA is quencher dyes.
Embodiment 12
The western blot analysis of target protein level
Standard method is used to perform western blot analysis (immunoblotting assay).16-20h harvested cell after oligonucleotide process, washs once with PBS, is suspended in Laemml damping fluid (100 μ l/ hole), boils 5 minutes, and be loaded to 16%SDS-PAGE gel.Run gel electrophoresis 1.5 hours at 150V, and transfer to film for western blot.Use the suitable primary antibodie for target, and resist for the radio-labeled or fluorescently-labeled two of primary antibodie material.Use PHOSPHORIMAGER
tM(Molecular Dynamics, Sunnyvale CA) shows zone.
Embodiment 13
The preparation of compound 5
According to United States Patent (USP) 5,969, the program announced in 116 prepares compound 1.
Embodiment 14
The preparation of compound 9
A) preparation of compound 7
By commercially available 1,2; 5,6-bis--O-isopropylidene different the furanose of-α-D-and compound 6 (135g, 519.0mmol) with 2-(brooethyl) naphthalene (126g, 570.0mmol) be dissolved in the DMF (500mL) in three-necked flask (500mL), and reactant is cooled in ice bath.Sodium hydride (60%w/w, 29g, 727.0mmol) is carefully added in (by 6g for a part adds once for every 10 minutes) reaction, and added rear continuation and stir 60 minutes again.Now, TLC analyzes and shows to no longer include sugar (compound 6).Reactant is carefully poured on trash ice (about 500g), then the slurries of gained is firmly stirred, until all ice all melts.By the pale solid of collecting by filtration gained, and be suspended in water.Use mechanical stirrer to be exerted oneself by suspension stirring 30 minutes, afterwards, by solid collected by filtration, and be hung in hexane.Suspension to be exerted oneself stirring 30 minutes, afterwards, by solid collected by filtration, and air-dry 4-6 hour, then at P
2o
5on by high vacuum dry 16 hours, obtain the compound 7 (206.0g, 99%) as pale solid.
1H NMR(300MHz,CDCl
3)δ:7.85(m,4H),7.48(m,3H),5.74(s,1H),4.92(d,1H,J=11.7),4.75(d,1H,J=11.6),4.58(m,1H),4.36(m,1H),4.15(m,1H),4.03-3.86(m,3H),1.61(s,3H),1.36(s,9H)。
B) preparation of compound 8
Compound 7 (200.0g, 0.5mol) point small portion is joined the solution of acetic acid (2.2L) and water (740mL).Reactant is at room temperature stirred 16h, and TLC analysis (30%EtOAc/ hexane) shows that compound 7 is totally consumed afterwards.Then by reactant concentrating under reduced pressure, until remove most of acetic acid.Remaining solution is poured in the EtOAc (1L) of stirring and the mixture of water (1L).Then in said mixture, solid KOH is added, until waterbearing stratum is strong basicity (pH>12).Organic layer is separated, with saturated sodium bicarbonate solution and salt water washing, then dry (Na
2sO
4), filter and concentrating under reduced pressure, obtain yellow foam compound 8, it directly used and is not further purified.
C) preparation of compound 9
By NaIO
4(107.0g) water (3L) solution joined compound 8 diox (1.5L) solution through stirring (mechanical stirrer) in 40 minutes.After 60 minutes, reaction mixture is poured into EtOAc (1.5L), and be separated organic layer, with water (1L) and salt solution (1L) washing, then dry (Na
2sO
4) and concentrated, obtain yellow oily compound 9, it is directly used and is not further purified.
Embodiment 15
The preparation of compound 14
Compound 9 is prepared according to the program described in embodiment 14.
Embodiment 16
The preparation of compound 17
A) preparation of compound 15
According to United States Patent (USP) 5,969, the program announced in 116 prepares compound 1.Benzoyl chloride (5.6mL, 48.5mmol) is joined pyridine (100mL) solution of nucleoside compound 1 (25g, 40.5mmol).At room temperature stir after 3 hours, in reaction, add other Benzoyl chloride (2.5mL).Again after 60 minutes, reaction shrend is gone out, and then distributes between ethyl acetate and water.Organic layer is used further water, salt water washing, dry (sodium sulfate) is also concentrated, obtains the nucleosides of rough benzoyl protection, it is directly used and be not further purified.
Trifluoroacetic acid (5mL) is joined the dichloromethane solution from rough nucleosides obtained above and triethyl silicane (12mL).After 2 hours, in reaction, add other trifluoroacetic acid (5mL) and triethyl silicane (5mL), and continue stirring again 4 hours, therebetween, reactant becomes light yellow from initial bright orange.On a rotary evaporator except desolventizing, and resistates is dissolved in ethyl acetate, and carefully washs organic layer with water, sodium bicarbonate, salt solution, dry (sodium sulfate) is also concentrated.The white solid of gained is hanged in hexane, and is collected by filtration, then wash further with other hexane, obtain nucleoside compound 15(14.9g, 87%, through 2 steps).
B) preparation of compound 16
By dicyclohexylcarbodiimide (1.5g, 7.2mmol) join compound 15 (2.0g, 4.8mmol) with pyridinium trifluoroacetate (0.92g, dimethyl sulfoxide (DMSO) (48mL) solution 4.8mmol), and reaction mixture is at room temperature stirred 6 hours.In independent flask, the solution (the THF solution of 10mL 1M) of potassium tert.-butoxide is joined THF (20mL) solution of tetraethyl methylenediphosphonate (2.4mL, 9.6mmol).At room temperature stir after 10 minutes, this flask is cooled in ice bath, and by intubate, DMSO solution is added.At room temperature stir after 2 hours, by reactant diluted ethyl acetate, and with water, salt water washing organic layer, dry (sodium sulfate) also concentrates.Vinyl nucleoside compound 16 (1.25g, 47%) is obtained by column chromatography (silica gel, the dichloromethane of the acetone with 20 to 40%) purifying.
C) preparation of compound 16a
By methyl alcohol (2mL) solution at room temperature aging 6 hours of vinyl nucleoside compound 16 (110mg, 0.2mmol) and 7N ammoniacal liquor, and on a rotary evaporator except desolventizing.By chromatogram (silica gel, the dichloromethane of the acetone with 70 to 90%) Purification, obtain compound 16a (84mg, 95%).
D) preparation of compound 17
By (2-cyanoethoxy)-tetraisopropylphosph-ro phosphoryl diamine (0.084mL, 0.28mmol) join compound 16a (84mg, 0.19mmol), dimethyl formamide (1mL) solution of tetrazolium (12mg, 0.15mmol) and N-Methylimidazole (1).At room temperature stir after 3 hours, by reactant diluted ethyl acetate, and wash organic layer with salt solution (2x), dry (sodium sulfate) is also concentrated.Sub-acid amides (amidite) compound 17 (113mg, 90%) is obtained by column chromatography (silica gel, the dichloromethane of the methyl alcohol with 2 to 4%) purifying.
Embodiment 17
The preparation of compound 19 and 19a
Compound 15 is prepared according to the program described in embodiment 16.By chromatography separating compound 18 and 18a.By the structure of spectroscopic analysis deterministic compound 19 and 19a.
Embodiment 18
The preparation of compound 20
Compound 8 is prepared according to the program described in embodiment 14.
Embodiment 19
The preparation of compound 24
Compound 20 is prepared according to the program described in embodiment 18.
Embodiment 20
The preparation of compound 27
Compound 15 is prepared according to the program described in embodiment 16.
Embodiment 21
The preparation of compound 30
Compound 20 is prepared according to the program described in embodiment 18.
Embodiment 22
The preparation of compound 32
Compound 28 is prepared according to the program described in embodiment 21.
Embodiment 23
The preparation of compound 36,37 and 38
Compound 23a is prepared according to the program described in 19 embodiments.
Embodiment 24
The preparation of compound 42,43 and 44
Compound 26 is prepared according to the program described in embodiment 20.
Embodiment 25
Prepare alternative method of compound 14 and 47
Compound 15 is prepared according to the program described in embodiment 16.
Embodiment 26
The preparation of compound 50
Compound 15 is prepared according to the program described in embodiment 16.The spectroscopic analysis of compound 50 is consistent with structure.
Embodiment 27
The preparation of compound 62
A) preparation (alkylation of diacetoneglucose) of compound 52
The commercially available acquisition of starting compound 51, also can according to Moffatt etc., J.Org.Chem., and 1979,44, the program preparation in 1301.
NaH(60% is dispersed in mineral oil, 49.2g, 1.6 equivalents) join the 2L round-bottomed flask crossed with nitrogen purging, wash NaH to remove mineral oil with hexane (2x 1.0L).After decant hexane, add DMF (700mL), and mixture is cooled in ice bath.Then diacetoneglucose compound 51 (200g, 0.77mol) is added within the time of 30 minutes.Remove ice bath, and mixture is at room temperature stirred 1 hour.Then make reactant second time cooling in ice bath, within the time of 30 minutes, dropwise add DMF (100mL) solution of 1-brooethyl naphthalene (187g, 1.1 equivalents).After completing interpolation, ice bath is stirred and spends the night, melt the ice simultaneously, thus allow reaction to proceed to room temperature.After 16h, through the TLC (R that determines that reaction completes
f=0.45,20%EtOAc/ hexane, and develop the color with charing after aubepine spraying agent treated).Then mixture is poured over put into ice bath cold water (1.5L) on.By waterbearing stratum EtOAc (250mL × 2) extraction, then use saturated NaHCO
3(1L), salt solution (1L) washs successively, and reduction vaporization organic layer, obtain dark brown oil.This oily matter is dissolved in minimum DCM, and allows it pass through to fill in the silica gel filter of 100% hexane (3.0L) wash-out, to remove the upper strata impurity of trace, then collect principal spot with 20%EtOAc/ hexane.Concentrated solvent obtains brown oil alkylate (269g, 87%), it is directly used and is not further purified.
The selective splitting of isopropylidene (isopropylidine)
Rough oily matter (69g, 0.67mol) obtained above is dissolved in acetic acid (2.2L) and water (900mL).Reaction is allowed at room temperature to carry out 16h.By TLC(20%EtOAc/ hexane) follow the tracks of reaction.After having reacted, reduction vaporization falls most of acetic acid, and then remaining solution is divided small portion pour into through stir EtOAc (1L)/NaHCO
3(1L, saturated aqueous solution) mixture, then adds NaHCO
3, until stop evolving gas.By organic layers with water (1L × 2), salt solution (1L) washing, through Na
2sO
4drying, filters, and then decompression removes, and obtains crude yellow oil thing.Then oily matter is dissolved in minimum DCM, and allows it pass through to fill in the silica gel filter of 20%EtOAc/ hexane (3.0L) wash-out, to remove upper strata spot impurity, and then use 80%EtOAc/ Hex, obtain main compound.Evaporating solvent obtains pale yellowish oil crude product (201g, 82%).TLC(R
f=0.22,20%EtOAc/ hexane).
The selective silicon alkanisation of primary hydroxyl
Crude compound (105g, 0.293mol) is dissolved in dry DMF (1L), then adds imidazoles (39.9g, 0.58mol).While stirring under a nitrogen, make the yellow solution of gained in ice bath, be cooled to 0 DEG C.The TERT-BUTYL DIMETHYL CHLORO SILANE (TBDMSCl, 48.5ml, 0.322mol) being dissolved in minimum quantity DMF is dropwise added within the time of 40 minutes.Allow the ice bath being initially 0 DEG C during interpolation reach room temperature, and continued again to stir 16h.Measured by TLC and now reacted (R
f=0.56,20%EtOAc/ hexane).Then reaction cancellation is allowed by adding MeOH (50mL).Then add water (1L) and EtOAc (500mL), and use saturated NaHCO
3(1L) organic layer is washed with salt solution (1L), then dry (Na
2sO
4), filter, and removal of solvent under reduced pressure, obtain yellow oily compounds 52 (139.0g).
1h NMR (300MHz, CDCl
3+ 2%D
2o): δ 7.7 and 7.4 (m, 7H, Nap), 5.86 (d, 1H, J=3.6Hz), 4.7 (m, 2H), 4.54 (d, 1H, J=5.7Hz), 4.08 (s, 2H), 3.9-4.0 (m, 1H), 3.7-3.8 (m, 2H), 1.39 (s, 1H, CH
3), 1.24 (s, 1H, CH
3), 0.82 (s, 9H, tBu), 0.02 (s, 6H, SiMe
2).
13C NMR(75MHz,CDCl
3+2%D
2O):δ135.1,133.3,133.1,128.3,128.0,127.7,126.6,126.2,126.0,125.7,111.7,105.2,82.6,81.9,79.6,72.6,68.6,64.5,26.7,26.3,25.9,18.3,-5.4。LCMS(method CN
1), retention time=1.8min, m/z=497.1 (M+Na), purity >98%.
B) preparation of compound 53
By oxalyl chloride (12.2mL, 145mmol) and CH
2cl
2(280mL) the 2L round-bottomed flask that two feed hoppers are housed is joined.A feed hopper is equipped with the CH of DMSO (20.5mL, 289mmol)
2cl
2(30mL) solution, another funnel is then equipped with and is dissolved in CH
2cl
2(380mL) compound 52 (45.75g, 96.4mmol).Then round-bottomed flask is cooled to-78 DEG C under a nitrogen, and dropwise added DMSO solution in 15 minutes.After stirring 50 minutes again, the solution of compound 52 was dropwise added in 15 minutes.After stirring 30 minutes again, by Et
3n (60mL, 434mmol) added in 10 minutes, and made reaction at room temperature carry out 30 minutes.Then NH is used
4cl(is saturated, 150mL) will cancellation be reacted, and use 10% citric acid (1L), sodium bicarbonate (saturated, 1L) and salt solution (1L) to wash organic layer successively.Then by organic layer at Na
2sO
4upper drying, concentrated, filtered by silica gel (20%EtOAc/ hexane), obtain rough ketone (42.4g, 93%), be directly used in next step, and be not further purified.TLC(R
f=0.55,20%EtOAc/ hexane).LCMS(method CN
1), retention time=2.1min, m/z=473.1 (M+H), 495.1 (M+Na), 967.3 (2M+Na).
THF (240mL) solution of this rough ketone (39g, 82.5mmol) is joined the 1L round-bottomed flask being furnished with feed hopper, and this feed hopper is equipped with THF (125mL) solution of the vinyl magnesium bromide of 1.0M.Flask is cooled in ice bath, and then Grignard reagent was dropwise added in 10 minutes.Then make reaction at room temperature carry out 1.5h, then use NH
4cl(is saturated, 150mL) cancellation.By Et
2o (400mL) adds, and washs organic layer with salt solution (1L).Organic layer is made (to use Et if desired by silica gel filter plug
2o wash-out), and then concentrate, obtain the compound 53 of quantitative yield, its purity is about 90%, and is directly used in next step.TLC(R
f=0.55,20%EtOAc/ hexane).
1h NMR (300MHz, CDCl
3): δ 7.79-7.90 and 7.47-7.56 (m, 7H, Nap), 6.11 (dd, 1H, J=16.2,9.6Hz ,=CH-), 6.08 (d, 1H, J=3.9Hz, H-1), 5.49 (dd, 1H, J=17.4,1.5Hz ,=CH
2); 5.22 (dd, 1H, J=12.3,1.5Hz ,=CH
2), 4.91 and 4.72 (ABq, 2H, CH
2), 4.71 (d, 1H, J=4.2Hz, H-2), 4.38 (d, 1H, J=3.0Hz, H-4), 4.24 (d, 1H, J=2.7Hz, H-3), 3.92 (s, 1H, OH), 3.63 (d, 1H, J=9.6Hz, 6a), 3.47 (d, 1H, J=9.6Hz, 6b), 1.53 (s, 3H, CH
3), 1.38 (s, 3H, CH
3), 0.86 (s, 9H, C (CH
3)
3) ,-0.0 (s, 3H, SiMe) ,-0.08 (s, 3H, SiMe).
1h NMR and Tetrahedron Lett., 1993, in 1653, the OBn derivative of report strictly mates.
LCMS(method DR1), m/z=501.1 (M+H), 523.2 (M+Na).
C) preparation (hydrolysis of TBS and isopropylidene) of compound 54
To purer compound 53 (41.3g, 82.5mmol) and Amberlite(IR-120H
+strong-acid ion exchange resin, 80g) in add Isosorbide-5-Nitrae-diox (275mL) and H
2o (230mL).By this mixture at 90 DEG C of heating 36h, and then by the filter of diatomite heat, then be evaporated to drying.Then by the crude solid of gained at P
2o
5on in 50 DEG C of dry 12h.
The acetylize of hydrolyzed material
By crude white solid pyridine (290mL) process obtained above, then by Ac
2o(78mL, 10 equivalents) dropwise add, more then add DMAP (120mg).Reaction at room temperature proceed 16h, and then evaporating solvent and with toluene (3x100mL) coevaporation.By primary product by silica gel chromatography (25%EtOAc/ hexane is to 35%EtOAc/ hexane) purifying, obtain the rough tetraacetate compound 54 (31.4g, 74%) of transparent whites spumescence.TLC(R
f=0.27,40%EtOAc/ hexane).
1h NMR (300MHz, CDCl
3): δ 7.83-7.79,7.68,7.5-7.4,7.35 and 7.32 (m, 7H, Nap), 5.95-5.87 (m, 3H, CH=CH and H1), 5.63 (dd, 1H, J=8.7,3.3Hz ,=CH), 5.46 (d, 1H, J=9.9Hz, H4), 5.25 (dd, 1H, J=9.3,8.4Hz, H2), 4.76 (s, 2H, CH
2nap), 4.14 and 3.71 (d, J=12.4Hz, H6), 3.79 (dd, 1H, J=9.8,9.8Hz, H3), 2.10 (s, 6H, Ac x 2), 1.95 (s, 3H, Ac), 1.90 (s, 3H, Ac).
13C NMR(75MHz,CDCl
3+2%D
2O):δ170.7,169.5,169.1,169.0,135.2,133.2,133.0,129.8,128.3,127.9,127.7,126.3(2C),126.1,125.5,122.03,88.9,78.5,78.1,74.6,72.6,69.5,65.2,20.9(3C),20.8。
LCMS(method CN1), retention time=1.47min, m/z=537.1 (M+Na), purity=99%.
Note: compound 54 by Tetrahedron Lett., 1993,1653 and Tetrahedron, 2004, in 6813, the program of report is revised a little and is prepared from by compound 51.
D) preparation (Vorbr ü ggen coupling and deacetylated) of compound 55
By N, two (trimethylsilyl) ethanamide (BSA, 54.7mL, 224mmol) of O-adds the uridylic (10.2g through stirring, 90.7mmol) with the suspension of compound 54 (31.1g, 60.4mmol) in anhydrous acetonitrile (300mL).At room temperature stir after 30 minutes, observe clear solution, and under a nitrogen reactant is cooled to 0 DEG C.Trimethyl silicon based methyl fuoride sulphonate (TMSOTf, 21.9mL, 121mmol) is added, and after reactant is at room temperature stirred 15 minutes, is transferred in the preheating oil bath of 80 DEG C.After stirring 4h at 80 DEG C, by reactant cool to room temperature, and add MeOH (20mL), EtOAc (250mL) and H
2o (400mL).Then organic phase is used saturated NaHCO successively
3, salt water washing, dry (Na
2sO
4) and concentrated obtain rough triacetate.TLC(R
f=0.60,80%EtOAc/ hexane).LCMS(method DRHI), m/z=567.1 (M+H).
By rough nucleosides 7N MeOH/NH
3(300mL) 50 DEG C of process of spending the night, and then drying is evaporated to.By primary product through silica gel chromatography (2%MeOH/CH
2cl
2to 6%MeOH/CH
2cl
2) purifying, obtain three alkylol cpds 55 (17.75g, 67%) as white solid.TLC(R
f=0.25,8%MeOH/CH
2Cl
2)。
1h NMR (300MHz, DMSO-d
6/ 2%D
2o): δ 7.9-7.8 (m, 5H, Nap and H6), 7.62,7.59, and 7.53-7.46 (m, 3H, Nap), 6.07 (dd, 1H, J=11.9,17.3Hz, C=CH), 5.68 (d, 1H, J=3.0Hz, H5), 5.66 (s, 1H, H1 '), 5.45-5.39 (m, 2H, C=CH
2), 4.99 (s, 2H, CH
2oNap), 3.93 (d, 1H, J=9.6Hz, H4 '), 3.67 (dd, 1H, J=8.9,8.9Hz, H2 '), 3.43 (dd, 1H, J=9.6,12.0Hz, H3 '), 3.16 and 3.42 (d, 2H, J=8.9Hz, 6 '-CH
2).
13C NMR(75MHz,DMSO-d
6/2%D
2O):δ162.8(C4),150.6(C2),141.4(C6),136.8(quat),132.6(quat),132.5(=CH-),132.0(quat),127.3,127.2,127.1,125.8,125.7,125.3,
*117.9(=CH
2),101.6(C5),82.3(C3’),81.3(C5’),77.8(C1’),73.5(CH
2ONap),71.1(C2’),68.4(C4’),64.8(6’-CH
2)。Note:
*between 127.3 and 125.3, there is an additional carbon, it is overlapping with in other carbon.
LCMS(method G1), retention time=2.09min, m/z=463.1 (M+Na), purity >99%.
E) preparation (forming benzylidene (benzylidine)) of compound 56
To the three alkylol cpd 55 (16.1g through stirring, mixture 36.5mmol) in dry DMF (180mL) camphorates sulfonic acid (CSA, 850mg), then adds benzaldehyde dimethyl acetal (BDMA, 22mL, 146mmol).This mixture is stirred at 50 DEG C, and after two hours, adds other CSA (600mg) and BDMA (6mL).After 2h, by reaction mixture cool to room temperature, and at EtOAc (300mL) and NaHCO
3(saturated)/H
2distribute between O (500mL, 3:2).Then by organic layer washed with brine twice, and by other EtOAc part, stripped in waterbearing stratum.By the organic layer of merging at Na
2sO
4upper drying, and evaporation obtains rough benzal compound.By crude on silica gel chromatogram (2%MeOH/CH
2cl
2to 5%MeOH/CH
2cl
2) purifying, obtain the benzal compound 56 (18.6g, 96%) as white solid.As passed through
1h NMR measures final compound and contains some DMF, can not interfere with subsequent step.TLC(R
f=0.45,8%MeOH/CH
2Cl
2)。
1h NMR (300MHz, DMSO-d
6/ 2%D
2o): δ 7.9-7.8 (m, 5H, Nap and H6), 7.71-7.78 and 7.51-7.41 (m, 8H, Nap, Ph), 6.32 (dd, 3H, J=11.1,18.2Hz, C=CH), 5.84 (d, 1H, J=9.3Hz, H1 '), 5.77 (s, 1H, benzylidene CH), 5.72 (d, 1H, J=7.8Hz, H5), 5.61-5.56 (m, 2H, C=CH
2), 4.96 (s, 2H, CH
2oNap), 4.06 (d, 1H, J=10.5Hz, H4 '), and 4.0-3.7 (m, 4H, H2 ', H3 ', and 6 '-CH
2).
13cNMR (75MHz, DMSO-d
6/ 2% D
2o): δ 162.8 (C4), 150.4 (C2), 140.8 (C6), 136.9 (quat), 136.0 (quat), 134.5 (=CH-), 132.2 (quat), 131.9 (quat), 128.5,127.7,127.1,127.0,125.7,125.5,125.3,125.2,125.1
*, 118.0 (=CH
2), 101.8 (benzylidene CH), 101.2 (C5), 80.8 (CH), 78.6 (C1 '), 77.9 (CH), 75.5 (6 '-CH
2), 72.9 (CH
2oNap), 71.5 (CH), 70.6 (quat).Note:
*between 128.5 and 125.1, there is an additional carbon, it is overlapping with in other carbon.
LCMS(method G1), retention time=3.70min, m/z=529.1 (M+H), 551.1 (M+Na), purity >99%.
F) preparation (dihydroxylation, periodate cracking and be reduced into alcohol) of compound 57
N-methyl morpholine oxide (48g, 409mmol) and 2.5%OsO is added to the solution of compound 56 (45g, 85mmol) in 95% acetone (moisture, 350mL) through stirring
4at Virahol (70mg OsO
4) in solution, and make reactant at room temperature stir 4 days.Now, by reactant by diatomite and filtered through silica gel, with the thorough wash-out of acetone.By Purified on column chromatography (methyl alcohol/DCM of 2.5% to the 5%) purifying of gained, obtain glycol (19.74g), it is used immediately THF (175mL), H
2o (175mL) and NaIO
4(15g, 70mmol) processes.After 1h, add water and EtOAc, organic layer is used saturated NaHCO
3with salt water washing, then dry (Na
2sO
4), filter, and removal of solvent under reduced pressure obtains crude aldehyde.This compound is used immediately the NaBH of 4 equivalents
4methanol solution at 0 DEG C of process 1h, and then add water and EtOAc, and with 10% citric acid (moisture) and salt water washing organic layer, then drying (Na
2sO
4), filter, removal of solvent under reduced pressure obtains crude alcohol.By reactant by silica gel chromatography, obtain the overall yield of compound 57(40% with methyl alcohol/DCM wash-out).
1h NMR with LCMS is consistent with structure.
G) preparation (formation anhydride) of compound 58
DIAD (1.6mL, 8.4mmol) is dropwise added to the compound 57 (1.28g, 2.4mmol) through stirring and 0 DEG C of mixture of triphenyl phosphine (2.2g, 8.4mmol) in anhydrous THF (20mL).At room temperature stir after 18 hours, add water and DCM, and with salt water washing organic layer, then drying (Na
2sO
4), filter, and removal of solvent under reduced pressure, obtain rough bicyclic product.By this product by silica gel chromatography (2% methyl alcohol/DCM to 10% methyl alcohol/DCM), obtain pure compound 58 (1.11g, 90%).
1h NMR with LCMS is consistent with structure.
H) preparation of compound 59
Compound 58 (1.1g, 2.15mmol) is dissolved in DMF (15mL), and is dispersed in mineral oil with NaH(60%, 6.4mmol) process 15 minutes.Now, NH is added
4cl and EtOAc, and by organic layers with water and salt water washing, then dry (NaCl
2sO
4), filter, and removal of solvent under reduced pressure obtains crude compound.By this compound by silica gel chromatography (3% methyl alcohol/DCM) purifying, obtain pure compound 59 (866mg, 79%).
1h NMR with LCMS is consistent with structure.
I) preparation (removing Nap) of compound 60
Compound 59 (800mg, 1.6mmol) is dissolved in DCM (15mL), and processes with water (1.5mL) and DDQ (529mg, 2.3mmol).Stir after 16 hours, add water and DCM, and use saturated NaHCO
3with salt water washing organic layer, then dry (Na
2sO
4), filter, removal of solvent under reduced pressure, obtains crude alcohol.Organism DCM is stripped for several times.By crude compound and methyl alcohol/DCM (10mL) and silica gel (1g) coevaporation.After drying, this is directly applied to silicagel column, and by silica gel chromatography (2% to 6% methyl alcohol/DCM) purifying, obtain compound 60 (409mg, 70%).
1h NMR with LCMS is consistent with structure.
J) preparation (Barton-Macombie deoxidation) of compound 61
0 DEG C to through stir compound 60 (388mg, 1.04mmol) and DMAP (343mg, 2.8mmol) at CH
3mixture in CN (14mL) adds chlorinated thio phenyl formate (196 μ L, 1.45mmol).Stir after 4 hours, reaction mixture is evaporated to drying.By toluene (13mL), Bu
4snH (1.65mL, 6.24mmol) and AIBN (15mg) is at 90 DEG C of heating 4h.Then reactant is evaporated to drying, by silica gel chromatography (1.5% to 3% methyl alcohol/DCM) purifying, obtains compound 61 (254mg, 68%).
1h NMR with LCMS is consistent with structure.
K) preparation (removing benzylidene and DMT protection) of compound 62
By the mixture of the compound 61 (230mg, 0.64mmol) through stirring at a pressure of 40 psi through 10%Pd/C (20mg) hydrogenation 10 hours.By reactant filter, evaporation, and with toluene coevaporation.Drying under reduced pressure, after 16 hours, adds pyridine (3mL) and DMTCl (187mg, 0.55mmol).Allow reactant at room temperature stir 4 hours, and add water and EtOAc, then use saturated NaHCO
3with salt water washing organic layer, then dry (Na
2sO
4), filter, removal of solvent under reduced pressure.By the foam of gained by silica gel chromatography (10% to 40% acetone/CH
2cl
2) purifying, obtain compound 62 (171mg, 47%).
1h NMR with LCMS is consistent with structure.
Embodiment 28
The preparation of compound 65
Compound 62 is prepared according to the program described in embodiment 27.
Embodiment 29
The preparation of compound 69
Preparation and the program similar (see international application no: PCT/US2009/033373, on August 13rd, 2009 announces with WO 2009/100320) announced of compound 66.
Embodiment 30
The preparation of compound 73
Preparation and the program similar (see Wang etc., J.Am.Chem.Soc., 2000,122 8595-8602) announced of compound 70.
Embodiment 31
The preparation of compound 77
Preparation and the program similar (see international application no: PCT/US2009/058011, on April 1st, 2011 announces with WO 2010/036696) announced of compound 74.
Embodiment 32
The preparation of compound 81
Preparation and the program similar (see international application no: PCT/US2008/073379, on February 19th, 2009 announces with WO 2009/023855) announced of compound 78.
Embodiment 33
The preparation of compound 85
Preparation and the program similar (U.S. Patent Application No. see having announced: US 2004/0033967) announced of compound 82.
Embodiment 34
The preparation of compound 89
Preparation and the program similar (see international application no: PCT/US2010/022759, on August 12nd, 2010 announces with WO 2010/090969) announced of compound 86.
Embodiment 35
The preparation of compound 93
Preparation and the program similar (see international application no: PCT/US2010/022759, on August 12nd, 2010 announces with WO 2010/090969) announced of compound 90.
Embodiment 35a
Prepare alternative method of compound 50
Compound 1 according to United States Patent (USP) 5,969, in 116 announce program and prepare.The spectroscopic analysis of compound 50 is consistent with structure.
Embodiment 36
Polyacetylene compound
According to synthesis program well known in the art (some in them are being set forth to some extent), using previous embodiment (embodiment 13, compound 5 herein; Embodiment 15 and 25, compound 14; Embodiment 16, compound 17; Embodiment 17, compound 19 and 19a; Embodiment 19, compound 24; Embodiment 20, compound 27; Embodiment 21, compound 30; Embodiment 22, compound 32; Embodiment 23, compound 36-38; Embodiment 24, compound 42-44; Embodiment 25, compound 47; Embodiment 26 and 35a, compound 50; Embodiment 28, compound 65; Embodiment 29, compound 69; Embodiment 30, compound 73; Embodiment 31, compound 77; Embodiment 32, compound 81; Embodiment 33, compound 85; Embodiment 34, compound 89 and embodiment 35, compound 93) described in one or more of phosphoramidite compound, preparation has the oligomeric compounds of 5 ' modified nucleoside of at least one formula II, IIa, IIb, IIc, IId or IIe.
The automated oligonucleotide synthetic technology of use standard, is incorporated into (E)-vinyl-dimethyl base phosphonic acid ester phosphoramidite compound 17 in oligomeric compounds.
SEQ ID NO. forms (5 ' to 3 ')
/ISIS NO.
05/505739 Pv-T
esU
fsG
mU
fsC
mU
fsC
mU
fsG
mG
fsU
mC
fsC
mU
fsU
msA
fsC
msU
fsU
msA
esA
e
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.
Embodiment 37
The general method (preparation 505739) that 5 '-end comprises the oligomeric compounds of modified nucleoside as provided herein is prepared in by solid phase technique
Except as otherwise noted, otherwise for oligomeric compounds synthesis all reagent and the equal available from commercial sources of solution.Standard phosphoramidite and solid carrier be used for being incorporated to A, U, G,
mec and C residue.By the anhydrous acetonitrile (CH of the 2 '-F of 0.1M and 2 '-O-Me phosphoramidite
3cN) solution be dissolved in 30% methylene dichloride (CH
2cl
2) anhydrous CH
3together with 2 '-the O-MOE-5 '-deoxidation-5 of CN solution '-methylene diethyl phosphonic acid ester and 2 '-O-MOE-deoxidation-5 '-vinyl-dimethyl base phosphonic acid ester 3 '-phosphoramidite for the synthesis of.By oligomeric compounds at VIMAD UnyLinker
tMsolid carrier synthesizes, and appropriate solid carrier is filled in synthesis post.To the dichloro acetic acid (6%) of toluene be dissolved in as detritylation reagent.4,5-dicyano imidazoles under N-Methylimidazole is existed or the CH of 1H-TETRAZOLE
3cN solution is used as the activator in coupling step.The synthesis of oligomeric compounds exists
synthesizer (GE Healthcare Bioscience) or ABI394 synthesizer (Applied Biosystems) carry out with the following program of the scale of 2-200 μm of ol.
Unylinker will be pre-installed
tMsolid carrier after closedown post bottom outlet, load synthesis post, and add CH
3cN is to form slurries.The carrier-bound Unylinker swelling by this
tMbe used in the detritylation agent treated containing 6% dichloro acetic acid in toluene, to obtain free hydroxyl.In coupling step, for linked reaction provides the phosphoramidite solution 10 minutes of 4 to 14 equivalents.Other steps all are all undertaken by standard scheme.Thiophosphatephosphorothioate bonding is by using the DDTT (3-((dimethylamino-methylene radical) is amino)-3H-1,2,4-dithiazole-3-thioketones) of 0.05M at 1:1 pyridine/CH
3solution in CN contacts 3 minutes to carry out sulfuration and introduces.Use tertbutyl peroxide/CH
3the solution reaction of CN/ water (10:87:3) 12 minutes, is oxidized to phosphodiester internucleoside linkage by tris phosphite internucleoside linkage.
After sequence needed for assembling, by the solid carrier CH in conjunction with oligomeric compounds
2cl
2washing, and dry under a high vacuum.After 4 hours, the solid carrier of drying is suspended in the CH of Iodotrimethylsilane (TMSI) and pyridine
2cl
2in solution, to remove 5 '-phosphonic acid ester blocking group (ethyl ether or methyl ether).By 0.75mL TMSI and 0.53mL pyridine are dissolved in 28.2mL CH
2cl
2and protection solution (every μm of ol solid carrier uses 0.5mL) is removed in preparation.After at room temperature 30 minutes, use 1M 2 mercapto ethanol at 1:1 TEA/CH reaction
3solution cancellation (every μm of ol solid carrier uses 0.5mL) in CN.Supernatant decanted liquid, and with other 2 mercapto ethanol solution washing solid carrier.After at room temperature 45 minutes, repeat the washing step adopting other 2 mercapto ethanol solution.Supernatant decanted liquid, and the oligomeric compounds that solid carrier combines is suspended to ammoniacal liquor (28-30 % by weight) solution in 1M 2 mercapto ethanol (every μm of ol solid carrier uses 0.75mL), and 55 DEG C heating 2 hours, with by oligomeric compounds from solid carrier cracking.
The solution of cracking is allowed to be cooled to envrionment temperature (20 DEG C) 24 hours.Then unconjugated oligomeric compounds is filtered, rinsing carrier, with water: ethanol (1:1) uses water filtration again.Merging filtrate, and be concentrated into drying.By the resistates of gained, at reverse-phase chromatographic column, (Waters X-Bridge C-185 μm, the tributyl ammonium acetate of 19 × 250mm, A=5mM is at 5% moisture CH
3solution in CN, B=CH
3cN, the B of 0 to 90% continues 80 minutes, flow velocity 7mL min
-1, λ=260nm) on by HPLC purifying.By the fraction collector containing total length oligomeric compounds to together (by LC/MS analysis and evaluation >95%), and at strong anion exchange chromatographic post (GE HealthcareBioscience, Source 30Q, 30 μm, the ammonium acetate of 2.54 × 8cm, A=100mM is at 30% moisture CH
3solution in CN, the solution A of the NaBr of B=1.5M, the B of 0-40% continues 60min, flow velocity 14mL min
-1) on by HPLC, tributyl ammonium gegenion is exchanged into sodium.Resistates is passed through HPLC desalination on reverse-phase chromatographic column, and the yield obtaining being separated based on solid carrier loading capacity is the oligomeric compounds of 15-20%.Unconjugated oligomeric compounds is analyzed by paired-ion chromatography-MS in Agilent 1100 MSD system and characterizes.
SEQ ID NO. forms (5 ' to 3 ')
/ISIS NO.
05/505739 Pv-T
esU
fsG
mU
fsC
mU
fsC
mU
fsG
mG
fsU
mC
fsC
mU
fsU
msA
fsC
msU
fsU
msA
esA
e
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.
Embodiment 38
Comprise the preparation of the modification oligomeric compounds of modification 5 '-nucleosides (5 '-deoxidation-5 '-methylene diethyl phosphonic acid ester and 5 '-deoxidation-5 '-vinyl-dimethyl base phosphonic acid ester)
Oligomeric compounds is prepared according to the program described in embodiment 37 with the scale of 2 or 200 μm of ol.Will
synthesizer (GE Healthcare Bioscience) and ABI394 synthesizer (Applied Biosystems) are all for specific operation.By unconjugated oligomeric compounds from cracking solid carrier, and analyzed by paired-ion chromatography-MS.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Py " of 5 '-end represents 5 '-methylene diethyl phosphonate groups (PO (OCH
2cH
3)
2(CH
2cH
2-)." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.
Embodiment 39
The general method of preparation C16-and cholesterol-conjugate oligomeric compound 95 and 96
Compound 94 and conjugate oligomeric compound 95 and 96 are according to the program (see Swayze etc., WO 2006/031461) announced and the preparation of the program described in embodiment 37.
Embodiment 40
Preparation C16-and cholesterol-conjugate oligomeric compound
The program preparation according to embodiment 38 and 39 of C16 as follows and cholesterol conjugate oligomeric compound.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.Connect the C16 alkyl chain of base conjugation by tetramethyleneimine and cholesterol as follows.
By conjugate oligomeric compound from cracking solid carrier, then analyzed by paired-ion chromatography-MS.
Calculate actual measurement
/ ISIS NO. quality (Da) quality (Da)
06/526608 7879.2 7877.6
06/527155 8067.5 8066.5
Embodiment 41
The general method of preparation C10-conjugate oligomeric compound 99
Unylinker
tM97 commercially available acquisitions.The preparation of conjugate oligomeric compound 99 and the program (see Swayze etc., WO 2006/031461) announced and the program described in embodiment 38 and 39 similar.
Embodiment 42
Preparation C10-conjugate oligomeric compound
C10-conjugate oligomeric compound as follows obtains according to the program preparation described in embodiment 41, wherein C10 conjugate is connected to 3 ' end or any interior location of oligomeric compounds.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.The nucleosides with subscript " C10 " is as follows.
Embodiment 43
The modification ssRNA-in vitro study of target PTEN
Prepare a series of modification single stranded RNA (ssRNA), and test the ability that they reduce PTENmRNA expression level in HeLa cell and liver cell.Use transfection method as described herein such as LIPOFECTAMINE
tM2000 (Lipo) or electroporation (Electro), by HeLa cell and liver cell modification strand oligomeric compounds process as follows.The equation of linear regression generated by normalization method mRNA level in-site being drawn relative to the logarithm of concentration used is used to calculate IC
50.The modification ssRNA with asterisk (*) is tested in independent mensuration, and their IC
50as follows.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Px " of 5 '-end represents 5 '-(E)-(F-vinyl) phosphonate groups (PO (OH)
2(CF=CH-)." Pz " of 5 '-end represents 5 '-(Z)-(F-vinyl) phosphonate groups (PO (OH)
2(CF=CH-)." Pyy " of 5 '-end represents 5 '-(F-methylene radical) phosphonate groups (PO (OH)
2(CHFCH
2-)." P " of 5 '-end represents 5 '-bound phosphate groups." Py " of 5 '-end represents 5 '-methylene phosphonic acid ester group (PO (OH)
2(CH
2cH
2-)." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).
mec represents 5-methylcytosine nucleosides.Its nucleosides that followed by subscript " d " is β-D-2 '-dezyribonucleoside.It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.The nucleosides with subscript " R " is as follows.
Subscript R.
Embodiment 44
The modification ssRNA in vitro study comprising modification at 3 ' end of target PTEN
Prepare a series of modification single stranded RNA (ssRNA) comprising modification at 3 ' end, and test them and reduce the PTEN mRNA ability in HeLa cells level.Use LIPOFECTAMINE as described herein
tM2000 as transfection reagent by the modification strand oligomeric compounds process as follows of HeLa cell.The equation of linear regression generated by normalization method mRNA level in-site being drawn relative to the logarithm of concentration used is used to calculate IC
50, and they are as follows.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).Its nucleosides that followed by subscript " d " is β-D-2 '-dezyribonucleoside.It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.
Embodiment 45
The modification ssRNA-in vitro study comprising at least one FHNA of target PTEN
Prepare a series of modification single stranded RNA (ssRNA) comprising at least one FHNA, and test them and reduce the PTEN mRNA ability in HeLa cells level.Use LIPOFECTAMINE as described herein
tM2000 as transfection reagent by the modification strand oligomeric compounds process as follows of HeLa cell.The equation of linear regression generated by normalization method mRNA level in-site being drawn relative to the logarithm of concentration used is used to calculate IC
50, and they are as follows.Test in independent mensuration with asterisk (
*) modification ssRNA, and their IC
50as follows.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).It followed by subscript f, the nucleosides of m, e or h is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.The nucleosides with subscript " h " is FHNA, and as follows.
Subscript h or FHNA.
Embodiment 46
The modification ssRNA-in vitro study of target FVII, eIF4E and target X
Prepare the single stranded RNA (ssRNA) of a series of modification, and test them and reduce FVII, eIF4E and the target X mRNA ability in liver cell or HeLa cells level.Use LIPOFECTAMINE as described herein
tM2000 as transfection reagent by liver cell or the modification strand oligomeric compounds process as follows of HeLa cell.The equation of linear regression generated by normalization method mRNA level in-site being drawn relative to the logarithm of concentration used is used to calculate IC
50.Reduce situation for often kind of target independently and perform mensuration, and modify the IC of ssRNA
50as follows.Sequence X 1, X2 and X3 target target X.
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." N " is U, T, C,
mec, G or A nucleosides." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).
mec represents 5-methylcytosine nucleosides.Its nucleosides that followed by subscript " d " is β-D-2 '-dezyribonucleoside.Its nucleosides that followed by subscript " r " is ribonucleoside.It followed by subscript f, the nucleosides of m, e or k is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.The nucleosides with subscript " k " is (S)-cEt, and as follows.
Subscript k or (S)-cEt.
Embodiment 47
Modify the estimation of stability-In vivo study of ssRNA
The stability of modifying ssRNA can use program as described herein to carry out interior evaluating.
Gather in the crops on ice from the BALB/C mice with modification ssRNA process and gather hepatic tissue.
By the chopping of 100-200mg sample and homogenize in 400 μ L homogenizing buffer (20mM Tris, pH 8,20mM EDTA, 0.1M NaCl, 0.5%NP-40).For containing mark (SEQ ID NO:24 in 10 μ g, Isis NO:355868,27-mer, the phosphorothioate oligonucleotide that 2 '-O-methoxy ethyl is modified) contrast liver homogenate (400 μ g/mL) 500 μ L aliquots containigs in often kind of ssRNA, scope of drawing is at the typical curve of 1 μ g-75 μ g.Then phenol/chloroform and solid phase extraction techniques as described below extraction tissue homogenate is used, wherein by 300 μ LNH
4oH and 800 μ L phenol/chloroform/primary isoamyl alcohol are used for phenol/chloroform extraction.
Phenol/chloroform extraction
Evaluate the stability of ssRNA at 0,5,10,20,30,40 and 60 minutes points, below: SEQ ID NO:25, Isis NO:408877, it is evaluated at the time point of 0,15,30,60,120 and 240 minute; And SEQ ID NO:25, Isis NO:409044, it is evaluated at the time point of 0,0.5,1,2,4,8 and 18 hour.Before extraction, be mark (SEQ ID NO:24, Isis NO:355868,27-mer, the phosphorothioate oligonucleotide that 2 '-O-methoxy ethyl is modified) in 2.5 μMs to be added in each sample by ultimate density.By sample 70 μ L NH
4oH and 240 μ L phenol/chloroform/primary isoamyl alcohol (25:24:1) extraction.After 14000rpm is centrifugal 2 minutes, supernatant liquor is removed.The 500 other μ L eddies of waters of remaining extract are revolved, removing waterbearing stratum, and merge with supernatant liquor after 14000rpm is centrifugal 2 minutes.
Solid-Phase Extraction
The triethyl Spirit of Mindererus of 1M (500 μ L) is joined supernatant liquor.After 9000rpm is centrifugal 20 minutes, the waterbearing stratum of mixture is loaded to the Biotage nursed one's health in advance
tMphenyl solid-phase extraction plate (SPE plate).With water by SPE plate washing several.Then by the eluant solution of the TEA of sample 1.5mL1% in 90%MeOH, and by albumen precipitation plate (Phenomenex
tM) filter.Elutriant is evaporated to drying, and with 50% quenching buffers (8M urea, 50mM EDTA) and water be diluted to 200 μ L, then sample introductions.
LC-MS
By serial for Agilent 1100 LC/MSD Cascade System to mass spectrograph.Allow mass spectrograph with electron spray(ES) negative electricity from mode operation.Spraying gun nitrogen is arranged on 325psi, and drying nitrogen is arranged on 12L/min.Drying temperature is 325 DEG C.Sample (25 μ L/ hole) is introduced by automatic sampler, and uses the flow velocity of 300 μ L/min to perform reverse-phase chromatography analysis at 55 DEG C by XBridge OST C18 2.5 μm of 2.1mm × 50mm HPLC chromatographic columns.Ion pair buffer is made up of following: A:5mM tributyl ammonium acetate (TBAA) solution in 20% acetonitrile, and the solution of B:5mM TBAA in 90% acetonitrile, and sample-loading buffer is the solution of 25mMTBAA in 25% acetonitrile.Continue 9min with 30% to 70%B, the gradient then continuing 11min with 80%B is separated.
Use MSD ChemStation software, carry out oligonucleotide and interior target quantitative analysis by the extraction chromatography of ions figure of the highest ion of abundance.
Embodiment 48
The modification ssRNA-multiple doses In vivo study of target PTEN
To BALB/C mice (the Jackson Laboratory in 6 week age, Bar Harbor, ME) the as follows modification strand oligomeric compounds deriving from the target PTEN of embodiment 43 of subcutaneous injection or saline control, twice on the one, continue two days, dosage is that 25mg/kg(amounts to 100mg); Or one day twice, continue five days, dosage is that 30mg/kg(amounts to 300mg).Also the 5-10-5 breach oligomer (116847) in flank with 2 '-O-MOE modified nucleoside is included, for comparing.Use latter 48 hours the last time, by sacrifice.By liver organization homogenize, and use Real-Time PCR quantitation mRNA level in-site as described herein, compare for untreated control level (%UTC).Result is listed with the average % of the PTEN mrna expression that each treatment group contrasts relative to pump pickle.The analyzing adjuncts carried out in this type of In vivo study comprise that the blood plasma of the animal of modifying ssRNA process of using by oneself is chemical, liver and kidney weight and liver, kidney and spleen tissue.Also measure following liver transaminases level in serum relative to the mouse of pump pickle: alanine aminotransferase (ALT) and aspartate aminotransferase (AST), result is as follows.
Relative to the contrast by brine treatment, for the animal of modifying the process of strand oligomeric compounds, ALT and AST level and kidney and liver weight are in NL.Histopathology report also shows in the animal with oligomeric compounds process abnormal without liver, kidney and spleen.
Embodiment 49
The stability of the modification ssRNA of target PTEN: multiple doses In vivo study
Use the body internal stability of the modification ssRNA in the embodiment 48 of program appraisal as described in example 47 above.To the modification ssRNA of BALB/C mice (Jackson Laboratory, BarHarbor, the ME) subcutaneous injection in 6 week age target PTEN as follows, one day twice, continue two days, dosage is that 25mg/kg(amounts to 100mg); Or one day twice, continue five days, dosage is that 30mg/kg(amounts to 300mg).Also the 5-10-5 breach oligomer (116847) in flank with 2 '-O-MOE modified nucleoside is included, for comparing.Use latter 48 hours the last time, by sacrifice.
Use Chemstation software, carried out the quantitative analysis of oligonucleotide standard substance by the extraction chromatography of ions figure of the most high charge state (-4) of abundance.The liver concentration (μ g/g) that the total length comprising 5 '-terminal phosphonate ester group group modifies ssRNA is measured by LC/MS, and result is hereafter providing.
Embodiment 50
Dose response research in the modification ssRNA-body of target PTEN
To BALB/C mice (the Jackson Laboratory in 6 week age, Bar Harbor, ME) the modification strand oligomeric compounds (522247) of subcutaneous injection target PTEN, twice on the one, continue one day, two days, four days or six days, dosage is 25mg/kg.Also the 5-10-5 breach oligomer (116847) in flank with 2 '-O-MOE modified nucleoside is included, for comparing.Use latter 48 hours the last time, by sacrifice.By liver organization homogenize, and use Real-Time PCR quantitation mRNA level in-site, and normalized to RIBOGREEN as described herein
tM, compare for untreated control level (%UTC).Result is listed with the average % of the PTEN mrna expression that each treatment group contrasts relative to pump pickle.
Relative to the contrast by brine treatment, in the animal with the strand oligomeric compounds process of modifying, ALT level, liver, kidney, spleen and body weight are in NL.
Embodiment 51
Dose response and stability study in the modification ssRNA body of target FVII
To BALB/C mice (the Jackson Laboratory in 6 week age, Bar Harbor, ME) the modification strand oligomeric compounds of subcutaneous injection target FVII, twice on the one, continue one day, two days or four days, dosage is 25mg/kg (529100) or 5mg/kg (457869).Use latter 48 hours the last time, by sacrifice.By liver organization homogenize, and use Real-Time PCR quantitation mRNA level in-site, and normalized to cyclophilin as described herein, compare for untreated control level (%UTC).Result is listed with the average % of the PTEN mrna expression that each treatment group contrasts relative to pump pickle.
Program appraisal as described in example 47 above is also used to modify the body internal stability of ssRNA.Use Chemstation software, carried out the quantitative analysis of oligonucleotide standard substance by the extraction chromatography of ions figure of the most high charge state (-4) of abundance.The liver concentration (μ g/g) that the total length comprising 5 '-terminal phosphonate ester group group modifies ssRNA is measured by LC/MS, and result is hereafter providing.
SEQ ID NO. forms (5 ' to 3 ')
/ISIS NO.
18/529100 Pv-T
esU
fsA
mA
fsG
mA
fsC
mU
fsU
mG
fsA
mG
fsA
mU
fsG
msA
fsU
msC
fsC
msA
esA
e
26/457869 G
esT
esA
es meC
esG
es meC
dsT
dsT
dsG
dsG
dsT
ds meC
ds meC
ds meC
dsT
dsA
es meC
esA
esT
esG
e
Subscript " s " between two nucleosides represents thiophosphatephosphorothioate internucleoside linkage (from 5 ' to 3 ').There is not subscript " s " between two nucleosides and represent phosphodiester internucleoside linkage." Pv " of 5 '-end represents 5 '-(E)-vinyl phosphonate ester group (PO (OH)
2(CH=CH-).
mec represents 5-methylcytosine nucleosides.Its nucleosides that followed by subscript " d " is β-D-2 '-dezyribonucleoside.It followed by subscript f, the nucleosides of m or e is sugar-modified nucleosides.Subscript " f " represents 2 '-fluoro modified nucleoside, and subscript " m " represents 2 '-O-methyl modified nucleoside, and subscript " e " represents 2 '-O-methoxy ethyl (MOE) modified nucleoside.
Embodiment 52
Multiple doses and stability study in the modification ssRNA-body of target target X
To BALB/C mice (the Jackson Laboratory in 6 week age, Bar Harbor, ME) subcutaneous injection derives from modification strand oligomerization compound or the saline control of the target target X of embodiment 46, twice on the one, continue six days, dosage is that 25mg/kg(amounts to 300mg); Or one day twice, continue two days, dosage is that 25mg/kg(amounts to 100mg).Use latter 48 hours the last time, by sacrifice.By liver organization homogenize, and use Real-Time PCR quantitation mRNA level in-site, and normalized to cyclophilin as described herein, compare for untreated control level (%UTC).Result is listed with the average % of the target X mrna expression that each treatment group contrasts relative to pump pickle.
Program appraisal as described in example 47 above is also used to modify the body internal stability of ssRNA.Use Chemstation software, carried out the quantitative analysis of oligonucleotide standard substance by the extraction chromatography of ions figure of the most high charge state (-4) of abundance.The liver concentration (μ g/g) that the total length comprising 5 '-terminal phosphonate fat group modifies ssRNA is measured by LC/MS, and result provides below.
Claims (55)
1. one kind has the compound of formula Ic:
Wherein:
T
1there is following formula:
Wherein:
R
aand R
cbe shielded hydroxyl, shielded mercaptan, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the amino of alkoxyl group, shielded amino or replacement; And
R
bfor O or S;
Wherein hydroxy-protective group is independently selected from methyl, ethyl, benzyl (Bn), phenyl, sec.-propyl, the tertiary butyl, allyl group, cyclohexyl (cHex), 4-methoxy-benzyl, 4-chlorobenzyl, 4-nitrobenzyl, 4-acyloxybenzyl, 2-aminomethyl phenyl, 2,6-3,5-dimethylphenyl, 2-chloro-phenyl-, diphenyl methyl, 4-methylthio group-1-butyl, 2-(S-acetylthio) ethyl (SATE), 2-cyanoethyl, 2-cyano group-1,1-dimethyl ethyl (CDM), 4-cyano group-crotyl, 2-(trimethyl silicon based) ethyl (TSE), 2-(thiophenyl) ethyl, 2-(triphenyl is silica-based) ethyl, 2-(benzyl alkylsulfonyl) ethyl, 2,2,2-trichloroethyl, 2,2,2-three bromomethyl, 2,3-dibromopropyl, 2,2,2-trifluoroethyl, thiophenyl, the chloro-4-tritylphenyl of 2-, 2-bromophenyl, 2-[N-sec.-propyl-N-(4-anisoyl) is amino] ethyl, 4-(N-TFA base is amino) butyl, 4-oxopentyl, 4-tritylamino phenyl, 4-benzylaminophenyl and morpholino,
Wherein thiol protective group is independently selected from trityl group (trityl), benzyl (Bn);
Wherein amido protecting group is independently selected from the trimethyl silicon based ethoxy carbonyl of 2-(Teoc), 1-methyl isophthalic acid-(4-xenyl) ethoxy carbonyl (Bpoc), tert-butoxycarbonyl (BOC), allyloxy carbonyl (Alloc), 9-fluorenylmethoxycarbonyl groups (Fmoc) and benzyloxycarbonyl (Cbz), formyl radical, ethanoyl, three halogen ethanoyl, benzoyl and nitrophenyl ethanoyl, 2-nitrobenzenesulfonyl, phthalimide-based and dithio succinyl,
M
1for H, OH or OR
1;
M
2for OH, OR
1or N (R
1) (R
2);
Each R
1and R
2be C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
R is 0 or 1;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O or OC (R
15) (R
16);
R
15and R
16be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1for heterocyclic base moiety;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7one of form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprises one or more independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) and CN;
Each J
1and J
2be H or C independently
1-C
6alkyl; And
When j is 1, Z is not halogen or N (E
2) (E
3).
2. compound, wherein M as claimed in claim 1
3for O.
3. the compound as described in any one of claim 1 to 2, wherein J
4, J
5, J
6and J
7be H.
4. the compound as described in any one of claim 1 to 2, wherein J
4with J
5or J
7one of formed bridge.
5. the compound as described in any one of Claims 1-4, wherein A has one of following formula:
Wherein:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.
6. compound, wherein Q as claimed in claim 5
1and Q
2be H.
7. compound, wherein Q as claimed in claim 5
1and Q
2be H or halogen independently of one another.
8. compound, wherein Q as claimed in claim 5
1and Q
2one of be H, and Q
1and Q
2another be F, CH
3or OCH
3.
9. compound, wherein R as claimed in claim 1
bfor O, and R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
10. the compound as described in any one of claim 1 to 9, wherein r is 0, M
1for O (CH
2)
2cN, and M
2for N [CH (CH
3)
2]
2.
11. compounds as described in any one of claim 1 to 10, wherein G is halogen, OCH
3, OCH
2f, OCHF
2, OCF
3, OCH
2cH
3, O (CH
2)
2f, OCH
2cHF
2, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-SCH
3, O (CH
2)
2-OCF
3, O (CH
2)
3-N (R
10) (R
11), O (CH
2)
2-ON (R
10) (R
11), O (CH
2)
2-O (CH
2)
2-N (R
10) (R
11), OCH
2c (=O)-N (R
10) (R
11), OCH
2c (=O)-N (R
12)-(CH
2)
2-N (R
10) (R
11) or O (CH
2)
2-N (R
12)-C (=NR
13) [N (R
10) (R
11)], wherein R
10, R
11, R
12and R
13be H or C independently of one another
1-C
6alkyl.
12. compounds as described in any one of claim 1 to 10, wherein G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.
13. compounds as described in any one of claim 1 to 10, wherein G is F, OCH
3or O (CH
2)
2-OCH
3.
14. compounds as described in any one of claim 1 to 10, wherein G is O (CH
2)
2-OCH
3.
15. compounds as described in any one of claim 1 to 14, wherein said heterocyclic base moiety is the purine of pyrimidine, the pyrimidine of replacement, purine or replacement.
16. compounds as described in any one of claim 1 to 15, wherein said heterocyclic base moiety is uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, VITAMIN B4 or guanine.
17. compounds as claimed in claim 1, it has formula Ie:
Wherein Bx is the heterocyclic base moiety of purine being selected from pyrimidine, the pyrimidine of replacement, purine or replacement.
18. compounds as claimed in claim 17, wherein A has following formula:
Wherein Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.
19. compound, wherein Q as claimed in claim 18
1and Q
2be H, F, CH independently of one another
3or OCH
3.
20. compounds as described in any one of claim 17 to 19, wherein T
1there is following formula:
Wherein,
R
bfor O; And
R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
21. 1 kinds of oligomeric compounds comprising the 5'-end compound with formula IIc:
Wherein:
T
1there is following formula:
Wherein:
R
aand R
cbe shielded hydroxyl, shielded mercaptan, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6the amino of alkoxyl group, shielded amino or replacement; And
R
bfor O or S;
Wherein hydroxy-protective group is independently selected from methyl, ethyl, benzyl (Bn), phenyl, sec.-propyl, the tertiary butyl, allyl group, cyclohexyl (cHex), 4-methoxy-benzyl, 4-chlorobenzyl, 4-nitrobenzyl, 4-acyloxybenzyl, 2-aminomethyl phenyl, 2,6-3,5-dimethylphenyl, 2-chloro-phenyl-, diphenyl methyl, 4-methylthio group-1-butyl, 2-(S-acetylthio) ethyl (SATE), 2-cyanoethyl, 2-cyano group-1,1-dimethyl ethyl (CDM), 4-cyano group-crotyl, 2-(trimethyl silicon based) ethyl (TSE), 2-(thiophenyl) ethyl, 2-(triphenyl is silica-based) ethyl, 2-(benzyl alkylsulfonyl) ethyl, 2,2,2-trichloroethyl, 2,2,2-three bromomethyl, 2,3-dibromopropyl, 2,2,2-trifluoroethyl, thiophenyl, the chloro-4-tritylphenyl of 2-, 2-bromophenyl, 2-[N-sec.-propyl-N-(4-anisoyl) is amino] ethyl, 4-(N-TFA base is amino) butyl, 4-oxopentyl, 4-tritylamino phenyl, 4-benzylaminophenyl and morpholino,
Wherein thiol protective group is independently selected from trityl group (trityl), benzyl (Bn);
Wherein amido protecting group is independently selected from the trimethyl silicon based ethoxy carbonyl of 2-(Teoc), 1-methyl isophthalic acid-(4-xenyl) ethoxy carbonyl (Bpoc), tert-butoxycarbonyl (BOC), allyloxy carbonyl (Alloc), 9-fluorenylmethoxycarbonyl groups (Fmoc) and benzyloxycarbonyl (Cbz), formyl radical, ethanoyl, three halogen ethanoyl, benzoyl and nitrophenyl ethanoyl, 2-nitrobenzenesulfonyl, phthalimide-based and dithio succinyl,
T
2for the described compound of formula IIc being connected to the internucleoside linkage group of described oligomeric compounds;
A has one of following formula:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (R
3) (R
4);
Q
3for O, S, N (R
5) or C (R
6) (R
7);
Each R
3, R
4, R
5, R
6and R
7be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl or C
1-C
6alkoxyl group;
M
3for O or OC (R
15) (R
16);
R
15and R
16be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Bx
1for heterocyclic base moiety;
J
4, J
5, J
6and J
7be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Or J
4with J
5or J
7one of form bridge, wherein said bridge comprises and is selected from O, S, NR
19, C (R
20) (R
21), C (R
20)=C (R
21), C [=C (R
20) (R
21)] with 1 to 3 double-basis group be connected of C (=O), and J
5, J
6and J
7other two be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
Each R
19, R
20and R
21be H, C independently
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group, replacement
1-C
6alkoxyl group, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl or replacement
2-C
6alkynyl;
G is H, OH, halogen or O-[C (R
8) (R
9)]
n-[(C=O)
m-X
1]
j-Z;
Each R
8and R
9be H, halogen, C independently
1-C
6the C of alkyl or replacement
1-C
6alkyl;
X
1for O, S or N (E
1);
Z is H, halogen, C
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
2-C
6the C of thiazolinyl, replacement
2-C
6thiazolinyl, C
2-C
6the C of alkynyl, replacement
2-C
6alkynyl or N (E
2) (E
3);
E
1, E
2and E
3be H, C independently of one another
1-C
6the C of alkyl or replacement
1-C
6alkyl;
N is 1 to about 6;
M is 0 or 1;
J is 0 or 1;
The group of each replacement comprises one or more independently selected from following substituted radical: halogen, OJ
1, N (J
1) (J
2) and CN;
Each J
1and J
2be H or C independently
1-C
6alkyl;
When j is 1, Z is not halogen or N (E
2) (E
3); And
Wherein said oligomeric compounds comprises 8 to 40 monomer subunit, and can with the hybridization at least partially of target nucleic acid.
22. oligomeric compounds, wherein M as claimed in claim 21
3for O.
23. oligomeric compounds as described in any one of claim 21 to 22, wherein J
4, J
5, J
6and J
7be H.
24. oligomeric compounds as described in any one of claim 21 to 22, wherein J
4with J
5or J
7one of formed bridge.
25. oligomeric compounds as described in any one of claim 21 to 24, wherein A has one of following formula:
Wherein:
Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.
26. oligomeric compounds, wherein Q as claimed in claim 25
1and Q
2be H.
27. oligomeric compounds, wherein Q as claimed in claim 25
1and Q
2be H or halogen independently of one another.
28. oligomeric compounds, wherein Q as claimed in claim 25
1and Q
2one of be H, and Q
1and Q
2another be F, CH
3or OCH
3.
29. oligomeric compounds, wherein R as claimed in claim 21
bfor O, and R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
30. oligomeric compounds as described in any one of claim 21 to 29, wherein G is halogen, OCH
3, OCH
2f, OCHF
2, OCF
3, OCH
2cH
3, O (CH
2)
2f, OCH
2cHF
2, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-SCH
3, O (CH
2)
2-OCF
3, O (CH
2)
3-N (R
10) (R
11), O (CH
2)
2-ON (R
10) (R
11), O (CH
2)
2-O (CH
2)
2-N (R
10) (R
11), OCH
2c (=O)-N (R
10) (R
11), OCH
2c (=O)-N (R
12)-(CH
2)
2-N (R
10) (R
11) or O (CH
2)
2-N (R
12)-C (=NR
13) [N (R
10) (R
11)], wherein R
10, R
11, R
12and R
13be H or C independently of one another
1-C
6alkyl.
31. oligomeric compounds as described in any one of claim 21 to 29, wherein G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.
32. oligomeric compounds as described in any one of claim 21 to 29, wherein G is F, OCH
3or O (CH
2)
2-OCH
3.
33. oligomeric compounds as described in any one of claim 21 to 29, wherein G is O (CH
2)
2-OCH
3.
34. oligomeric compounds as described in any one of claim 21 to 33, wherein said heterocyclic base moiety is the purine of pyrimidine, the pyrimidine of replacement, purine or replacement.
35. oligomeric compounds as described in any one of claim 21 to 34, wherein said heterocyclic base moiety is uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, VITAMIN B4 or guanine.
36. oligomeric compounds as claimed in claim 21, wherein said 5'-end compound has formula IId:
Wherein Bx is the heterocyclic base moiety of purine being selected from pyrimidine, the pyrimidine of replacement, purine or replacement.
37. oligomeric compounds as claimed in claim 36, wherein A has following formula:
Wherein Q
1and Q
2be H, halogen, C independently of one another
1-C
6the C of alkyl, replacement
1-C
6alkyl, C
1-C
6the C of alkoxyl group or replacement
1-C
6alkoxyl group.
38. oligomeric compounds, wherein Q as claimed in claim 36
1and Q
2be H, F, CH independently of one another
3or OCH
3.
39. oligomeric compounds as described in any one of claim 36 to 38, wherein T
1there is following formula:
Wherein,
R
bfor O; And
R
aand R
cbe OCH independently of one another
3, OCH
2cH
3or OCH (CH
3)
2.
40. oligomeric compounds as claimed in claim 21, wherein said 5'-end compound has formula IIe:
Wherein:
Bx is uridylic, thymus pyrimidine, cytosine(Cyt), 5-methylcytosine, VITAMIN B4 or guanine;
T
2it is the thiophosphatephosphorothioate internucleoside linkage group compound of formula IIe being connected to described oligomeric compounds; And
G is halogen, OCH
3, OCF
3, OCH
2cH
3, OCH
2cF
3, OCH
2-CH=CH
2, O (CH
2)
2-OCH
3, O (CH
2)
2-O (CH
2)
2-N (CH
3)
2, OCH
2c (=O)-N (H) CH
3, OCH
2c (=O)-N (H)-(CH
2)
2-N (CH
3)
2or OCH
2-N (H)-C (=NH) NH
2.
41. oligomeric compounds as described in any one of claim 21 to 40, wherein each internucleoside linkage group is phosphodiester internucleoside linkage group or thiophosphatephosphorothioate internucleoside linkage group independently.
42. oligomeric compounds as described in any one of claim 21 to 40, wherein each internucleoside linkage group is thiophosphatephosphorothioate internucleoside linkage group substantially.
43. 1 kinds of double-strand compositions, described double-strand composition comprises:
First oligomeric compounds and the second oligomeric compounds, wherein said first oligomeric compounds and described second oligomeric compounds complementation, and described second oligomeric compounds and nucleic acid target complementation;
At least one in described first and second oligomeric compounds is the oligomeric compounds according to any one of claim 21 to 42; And
Wherein said composition optionally comprises one or more 5' or 3' end group.
44. oligomeric compounds as described in any one of claim 21 to 42 or double-strand composition as claimed in claim 43 a kind of for the purposes in the medicine of inhibition of gene expression in preparation, wherein said oligomeric compounds comprises about 8 to about 40 monomer subunit and complementary with target RNA.
45. purposes as claimed in claim 44, wherein said cell is in animal.
46. purposes as claimed in claim 44, wherein said cell is in people.
47. purposes as claimed in claim 44, wherein said target RNA is selected from mRNA, pre-mRNA and micro RNA.
48. purposes as claimed in claim 44, wherein said target RNA is mRNA.
49. purposes as claimed in claim 44, wherein said target RNA is people mRNA.
50. purposes as claimed in claim 44, wherein said target RNA is cleaved, thus suppresses its function.
51. purposes as claimed in claim 44, described inhibition of gene expression comprises the level detecting target RNA further.
The external non-diseases diagnosis of 52. 1 kinds of inhibition of gene expression and the method for non-diseases treatment, described method comprises makes one or more cell or tissues contact with the oligomeric compounds as described in any one of claim 21 to 42 or double-strand composition as claimed in claim 43.
53. 1 kinds of oligomeric compounds as described in any one of claim 21 to 42 or double-strand composition as claimed in claim 43, for pharmacological agent.
54. oligomeric compounds as described in any one of claim 21 to 42 or double-strand composition as claimed in claim 43 a kind of for the purposes in the medicine of inhibition of gene expression in preparation.
55. purposes as claimed in claim 54, wherein said medicine is in one approach for inhibition of gene expression, and described method comprises makes one or more cell or tissue contact with the oligomeric compounds as described in any one of claim 21 to 42 or double-strand composition as claimed in claim 43.
Applications Claiming Priority (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US32899010P | 2010-04-28 | 2010-04-28 | |
US61/328,990 | 2010-04-28 | ||
US39310010P | 2010-10-14 | 2010-10-14 | |
US61/393,100 | 2010-10-14 | ||
US40968410P | 2010-11-03 | 2010-11-03 | |
US61/409,684 | 2010-11-03 | ||
PCT/US2011/033968 WO2011139702A2 (en) | 2010-04-28 | 2011-04-26 | Modified nucleosides and oligomeric compounds prepared therefrom |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103154014A CN103154014A (en) | 2013-06-12 |
CN103154014B true CN103154014B (en) | 2015-03-25 |
Family
ID=44904335
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201180021008.0A Active CN103154014B (en) | 2010-04-28 | 2011-04-26 | Modified nucleosides, modified nucleosides-like and oligomeric compounds prepared therefrom |
Country Status (6)
Country | Link |
---|---|
US (4) | US8993738B2 (en) |
EP (2) | EP3173419A1 (en) |
JP (2) | JP6005628B2 (en) |
KR (1) | KR101869570B1 (en) |
CN (1) | CN103154014B (en) |
WO (1) | WO2011139702A2 (en) |
Families Citing this family (89)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2358398A2 (en) | 2008-10-24 | 2011-08-24 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and methods |
SG171914A1 (en) | 2008-12-02 | 2011-07-28 | Chiralgen Ltd | Method for the synthesis of phosphorus atom modified nucleic acids |
AU2010270714B2 (en) | 2009-07-06 | 2015-08-13 | Wave Life Sciences Ltd. | Novel nucleic acid prodrugs and methods use thereof |
JP6005628B2 (en) * | 2010-04-28 | 2016-10-12 | アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. | Modified nucleosides, analogs thereof, and oligomeric compounds prepared therefrom |
US9127033B2 (en) * | 2010-04-28 | 2015-09-08 | Isis Pharmaceuticals, Inc. | 5′ modified nucleosides and oligomeric compounds prepared therefrom |
US10428019B2 (en) | 2010-09-24 | 2019-10-01 | Wave Life Sciences Ltd. | Chiral auxiliaries |
DK2734208T3 (en) | 2011-07-19 | 2017-06-19 | Wave Life Sciences Ltd | PROCEDURES FOR SYNTHESIS OF FUNCTIONALIZED NUCLEIC ACIDS |
US20140303235A1 (en) | 2011-08-11 | 2014-10-09 | Isis Pharmaceuticals, Inc. | Linkage modified gapped oligomeric compounds and uses thereof |
DK2751270T3 (en) | 2011-08-29 | 2018-10-29 | Ionis Pharmaceuticals Inc | OLIGOMER-CONJUGATE COMPLEXES AND THEIR USE |
EP2751269B1 (en) * | 2011-08-29 | 2016-03-23 | Ionis Pharmaceuticals, Inc. | Methods and compounds useful in conditions related to repeat expansion |
AU2012358238B2 (en) | 2011-12-22 | 2017-12-07 | C. Frank Bennett | Methods for modulating Metastasis-Associated-in-Lung-Adenocarcinoma-Transcript-1(MALAT-1) expression |
WO2013120003A1 (en) | 2012-02-08 | 2013-08-15 | Isis Pharmaceuticals, Inc. | Modulation of rna by repeat targeting |
US9340784B2 (en) | 2012-03-19 | 2016-05-17 | Ionis Pharmaceuticals, Inc. | Methods and compositions for modulating alpha-1-antitrypsin expression |
JP6492003B2 (en) | 2012-03-30 | 2019-03-27 | ワシントン・ユニバーシティWashington University | Methods of modulating tau expression to reduce stroke and to modify neurodegenerative syndrome |
WO2013177248A2 (en) | 2012-05-22 | 2013-11-28 | Isis Pharmaceuticals, Inc. | Modulation of enhancer rna mediated gene expression |
ES2809199T3 (en) | 2012-06-25 | 2021-03-03 | Ionis Pharmaceuticals Inc | Modulation of UBE3A-ATS expression |
SG11201500232UA (en) | 2012-07-13 | 2015-04-29 | Wave Life Sciences Pte Ltd | Chiral control |
JP6246121B2 (en) | 2012-07-13 | 2017-12-13 | 株式会社新日本科学 | Chiral nucleic acid adjuvant |
US9598458B2 (en) | 2012-07-13 | 2017-03-21 | Wave Life Sciences Japan, Inc. | Asymmetric auxiliary group |
EP4052709A1 (en) | 2012-10-11 | 2022-09-07 | Ionis Pharmaceuticals, Inc. | Methods of treating kennedy's disease |
AR092982A1 (en) | 2012-10-11 | 2015-05-13 | Isis Pharmaceuticals Inc | MODULATION OF THE EXPRESSION OF ANDROGEN RECEIVERS |
EP4086347A3 (en) | 2012-10-12 | 2023-01-11 | Ionis Pharmaceuticals, Inc. | Selective antisense compounds and uses thereof |
EP2951191B1 (en) | 2013-01-31 | 2018-10-17 | Ionis Pharmaceuticals, Inc. | Method of preparing oligomeric compounds using modified coupling protocols |
CA3170716A1 (en) | 2013-02-14 | 2014-08-21 | Ionis Pharmaceuticals, Inc. | Modulation of apolipoprotein c-iii (apociii) expression in lipoprotein lipase deficient (lpld) populations |
CA2900238A1 (en) * | 2013-02-22 | 2014-08-28 | Sirna Therapeutics, Inc. | Short interfering nucleic acid (sina) molecules containing a 2' internucleoside linkage |
CA2906119A1 (en) | 2013-03-14 | 2014-09-25 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulating tau expression |
PT2992098T (en) | 2013-05-01 | 2019-07-05 | Ionis Pharmaceuticals Inc | Compositions and methods for modulating hbv and ttr expression |
US20160122761A1 (en) | 2013-06-21 | 2016-05-05 | Isis Pharmaceuticals, Inc. | Compositions and methods for modulation of target nucleic acids |
ES2787600T3 (en) | 2013-07-02 | 2020-10-16 | Ionis Pharmaceuticals Inc | Growth hormone receptor modulators |
TWI772856B (en) | 2013-07-19 | 2022-08-01 | 美商百健Ma公司 | Compositions for modulating tau expression |
WO2015017675A2 (en) | 2013-07-31 | 2015-02-05 | Isis Pharmaceuticals, Inc. | Methods and compounds useful in conditions related to repeat expansion |
EP3043827B1 (en) | 2013-09-13 | 2019-07-03 | Ionis Pharmaceuticals, Inc. | Modulators of complement factor b |
PT3087183T (en) | 2013-12-24 | 2020-10-08 | Ionis Pharmaceuticals Inc | Modulation of angiopoietin-like 3 expression |
JPWO2015108048A1 (en) | 2014-01-15 | 2017-03-23 | 株式会社新日本科学 | Chiral nucleic acid adjuvant and antitumor agent having antitumor activity |
EP3095460A4 (en) | 2014-01-15 | 2017-08-23 | Shin Nippon Biomedical Laboratories, Ltd. | Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent |
JPWO2015108047A1 (en) | 2014-01-15 | 2017-03-23 | 株式会社新日本科学 | Chiral nucleic acid adjuvant having immunity induction activity and immunity induction activator |
US10160969B2 (en) | 2014-01-16 | 2018-12-25 | Wave Life Sciences Ltd. | Chiral design |
EP3647318B1 (en) | 2014-04-28 | 2021-06-30 | Ionis Pharmaceuticals, Inc. | Linkage modified oligomeric compounds |
SI3137605T1 (en) | 2014-05-01 | 2021-02-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating angiopoietin-like 3 expression |
PE20170010A1 (en) | 2014-05-01 | 2017-03-04 | Ionis Pharmaceuticals Inc | COMPOSITIONS AND METHODS TO MODULATE THE EXPRESSION OF THE COMPLEMENT FACTOR B |
CA2942570A1 (en) | 2014-05-01 | 2015-11-05 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating growth hormone receptor expression |
EP3137606A4 (en) * | 2014-05-01 | 2018-04-25 | Larry J. Smith | METHODS AND MODIFICATIONS THAT PRODUCE ssRNAi COMPOUNDS WITH ENHANCED ACTIVITY, POTENCY AND DURATION OF EFFECT |
KR102494171B1 (en) | 2014-08-20 | 2023-02-02 | 알닐람 파마슈티칼스 인코포레이티드 | Modified double-stranded rna agents |
WO2016077704A1 (en) | 2014-11-14 | 2016-05-19 | The Regents Of The University Of California | Modulation of agpat5 expression |
WO2016086104A1 (en) | 2014-11-25 | 2016-06-02 | Ionis Pharmaceuticals, Inc. | Modulation of ube3a-ats expression |
BR112017017178A2 (en) | 2015-02-26 | 2018-04-03 | Ionis Pharmaceuticals Inc | p23h rhodopsin allele-specific modulators |
ES2901455T3 (en) | 2015-04-03 | 2022-03-22 | Univ Massachusetts | Oligonucleotide compounds for the treatment of preeclampsia and other angiogenic disorders |
AU2016349625B2 (en) | 2015-11-06 | 2022-07-07 | Ionis Pharmaceuticals, Inc. | Modulating apolipoprotein (a) expression |
EP3408391A4 (en) | 2016-01-31 | 2019-08-28 | University of Massachusetts | Branched oligonucleotides |
EA201892285A1 (en) | 2016-06-06 | 2019-07-31 | Эрроухэд Фармасьютикалз, Инк. | NUCLEOTIDES MODIFIED BY CYCLOPHOSPHONATE IN REGULATION 5 ' |
WO2018031933A2 (en) | 2016-08-12 | 2018-02-15 | University Of Massachusetts | Conjugated oligonucleotides |
JP6978099B2 (en) * | 2016-09-02 | 2021-12-08 | ディセルナ ファーマシューティカルズ インコーポレイテッド | 4'-Phosphate analogs and oligonucleotides containing them |
JOP20190065A1 (en) | 2016-09-29 | 2019-03-28 | Ionis Pharmaceuticals Inc | Compounds and methods for reducing tau expression |
KR20190065341A (en) | 2016-10-06 | 2019-06-11 | 아이오니스 파마수티컬즈, 인코포레이티드 | Method of joining oligomeric compounds |
AU2017368050A1 (en) | 2016-11-29 | 2019-06-20 | Puretech Lyt, Inc. | Exosomes for delivery of therapeutic agents |
CN110573619A (en) * | 2017-04-05 | 2019-12-13 | 赛伦斯治疗有限责任公司 | Products and compositions |
CN111655268B (en) | 2017-10-04 | 2024-03-26 | 艾维迪提生物科学公司 | Nucleic acid-polypeptide compositions and uses thereof |
CN110944675B (en) | 2017-12-01 | 2024-06-04 | 苏州瑞博生物技术股份有限公司 | Nucleic acid, composition containing nucleic acid, conjugate, preparation method and application |
EP3719126A4 (en) | 2017-12-01 | 2021-10-20 | Suzhou Ribo Life Science Co., Ltd. | Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof |
EP3719128A4 (en) | 2017-12-01 | 2021-10-27 | Suzhou Ribo Life Science Co., Ltd. | Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method therefor and use thereof |
JP7365052B2 (en) | 2017-12-01 | 2023-10-19 | スーチョウ リボ ライフ サイエンス カンパニー、リミテッド | Nucleic acids, compositions and complexes containing the nucleic acids, and preparation methods and uses |
CN116375774A (en) | 2017-12-29 | 2023-07-04 | 苏州瑞博生物技术股份有限公司 | Conjugate, preparation method and application thereof |
EP3735252A4 (en) * | 2018-01-04 | 2021-10-06 | Avidity Biosciences, Inc. | Heteroduplex nucleic acid molecules and uses thereof |
EP3762395A1 (en) * | 2018-03-07 | 2021-01-13 | Sanofi | Nucleotide precursors, nucleotide analogs and oligomeric compounds containing the same |
EP3775207A1 (en) | 2018-04-05 | 2021-02-17 | Silence Therapeutics GmbH | Sirnas with vinylphosphonate at the 5' end of the antisense strand |
MX2020011570A (en) | 2018-05-07 | 2020-11-24 | Alnylam Pharmaceuticals Inc | Extrahepatic delivery. |
MX2021001590A (en) | 2018-08-10 | 2021-07-02 | Univ Massachusetts | Modified oligonucleotides targeting snps. |
EP3842534A4 (en) | 2018-08-21 | 2022-07-06 | Suzhou Ribo Life Science Co., Ltd. | Nucleic acid, pharmaceutical composition and conjugate containing nucleic acid, and use thereof |
WO2020063198A1 (en) | 2018-09-30 | 2020-04-02 | 苏州瑞博生物技术有限公司 | Sirna conjugate, preparation method therefor and use thereof |
US11166976B2 (en) | 2018-11-08 | 2021-11-09 | Aligos Therapeutics, Inc. | S-antigen transport inhibiting oligonucleotide polymers and methods |
CA3131700A1 (en) | 2019-02-27 | 2020-09-03 | Ionis Pharmaceuticals, Inc. | Modulators of malat1 expression |
MX2021011916A (en) | 2019-03-29 | 2021-10-26 | Ionis Pharmaceuticals Inc | Compounds and methods for modulating ube3a-ats. |
JP2022535588A (en) | 2019-06-06 | 2022-08-09 | アビディティー バイオサイエンシーズ,インク. | NUCLEIC ACID POLYPEPTIDE COMPOSITIONS AND USES THEREOF |
CN114375297A (en) | 2019-06-06 | 2022-04-19 | 艾维迪提生物科学公司 | UNA imides and uses thereof |
CN110204583B (en) * | 2019-07-01 | 2021-03-23 | 中国人民解放军军事科学院军事医学研究院 | Modified nucleoside, nucleotide and modified nucleic acid polymer as well as preparation method and application thereof |
BR112022002307A2 (en) | 2019-08-09 | 2022-06-28 | Univ Massachusetts | CHEMICALLY MODIFIED OLIGONUCLEOTIDES TARGETING SNPS |
JP2022544587A (en) | 2019-08-15 | 2022-10-19 | アイオーニス ファーマシューティカルズ, インコーポレーテッド | Bond-modified oligomeric compounds and uses thereof |
US20220364096A1 (en) | 2020-03-06 | 2022-11-17 | Aligos Therapeutics, Inc. | Modified Short Interfering Nucleic Acid (siNA) Molecules and Uses Thereof |
EP4121063A4 (en) | 2020-03-19 | 2024-07-03 | Avidity Biosciences Inc | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
US20220380770A1 (en) | 2020-04-10 | 2022-12-01 | Aligos Therapeutics, Inc. | SHORT INTERFERING NUCLEIC ACID (siNA) MOLECULES AND USES THEREOF FOR CORONAVIRUS DISEASES |
JP2024523509A (en) | 2021-06-23 | 2024-06-28 | ユニバーシティー オブ マサチューセッツ | Optimized anti-FLT1 oligonucleotide compounds for the treatment of pre-eclampsia and other angiogenic disorders - Patent Application 20070233633 |
WO2023039076A1 (en) | 2021-09-08 | 2023-03-16 | Aligos Therapeutics, Inc. | Modified short interfering nucleic acid (sina) molecules and uses thereof |
CN118201942A (en) | 2021-09-08 | 2024-06-14 | 阿利戈斯治疗公司 | Modified short interfering nucleic acid (siNA) molecules and uses thereof |
WO2023043953A1 (en) | 2021-09-16 | 2023-03-23 | Avidity Biosciences, Inc. | Compositions and methods of treating facioscapulohumeral muscular dystrophy |
US20230346819A1 (en) * | 2022-02-22 | 2023-11-02 | Sanegene Bio Usa Inc. | 5'-modified carbocyclic ribonucleotide derivatives and methods of use |
TW202400787A (en) | 2022-03-16 | 2024-01-01 | 美商安彼瑞可股份有限公司 | Galnac compositions for improving sirna bioavailability |
WO2023246935A1 (en) * | 2022-06-23 | 2023-12-28 | 安沛治疗有限公司 | Target-specific nucleic acid molecule having quinoline modification |
WO2024062413A1 (en) * | 2022-09-21 | 2024-03-28 | Janssen Biotech, Inc. | Novel stabilized nucleoside phosphates and analogues thereof |
CN118063533A (en) * | 2023-09-18 | 2024-05-24 | 广州必贝特医药股份有限公司 | Modified nucleotide compound, oligonucleotide and application thereof |
Family Cites Families (232)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US2699808A (en) | 1944-10-06 | 1955-01-18 | Mark W Lowe | Apparatus for peeling tomatoes |
US2699508A (en) | 1951-12-21 | 1955-01-11 | Selectronics Inc | Method of mounting and construction of mounting for low frequency piezoelectric crystals |
US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
US4500707A (en) | 1980-02-29 | 1985-02-19 | University Patents, Inc. | Nucleosides useful in the preparation of polynucleotides |
US5132418A (en) | 1980-02-29 | 1992-07-21 | University Patents, Inc. | Process for preparing polynucleotides |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4668777A (en) | 1981-03-27 | 1987-05-26 | University Patents, Inc. | Phosphoramidite nucleoside compounds |
US4973679A (en) | 1981-03-27 | 1990-11-27 | University Patents, Inc. | Process for oligonucleo tide synthesis using phosphormidite intermediates |
US4415732A (en) | 1981-03-27 | 1983-11-15 | University Patents, Inc. | Phosphoramidite compounds and processes |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
JPS5927900A (en) | 1982-08-09 | 1984-02-14 | Wakunaga Seiyaku Kk | Oligonucleotide derivative and its preparation |
FR2540122B1 (en) | 1983-01-27 | 1985-11-29 | Centre Nat Rech Scient | NOVEL COMPOUNDS COMPRISING A SEQUENCE OF OLIGONUCLEOTIDE LINKED TO AN INTERCALATION AGENT, THEIR SYNTHESIS PROCESS AND THEIR APPLICATION |
US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
USRE34069E (en) | 1983-08-18 | 1992-09-15 | Biosyntech Gmbh | Process for the preparation of oligonucleotides |
DE3329892A1 (en) | 1983-08-18 | 1985-03-07 | Köster, Hubert, Prof. Dr., 2000 Hamburg | METHOD FOR PRODUCING OLIGONUCLEOTIDES |
US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
FR2567892B1 (en) | 1984-07-19 | 1989-02-17 | Centre Nat Rech Scient | NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS |
US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
US5430136A (en) | 1984-10-16 | 1995-07-04 | Chiron Corporation | Oligonucleotides having selectably cleavable and/or abasic sites |
US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
FR2575751B1 (en) | 1985-01-08 | 1987-04-03 | Pasteur Institut | NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS |
US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
JPS638396A (en) | 1986-06-30 | 1988-01-14 | Wakunaga Pharmaceut Co Ltd | Poly-labeled oligonucleotide derivative |
DE3788914T2 (en) | 1986-09-08 | 1994-08-25 | Ajinomoto Kk | Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers. |
US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
AU598946B2 (en) | 1987-06-24 | 1990-07-05 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
US4924624A (en) | 1987-10-22 | 1990-05-15 | Temple University-Of The Commonwealth System Of Higher Education | 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof |
US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
DE3738460A1 (en) | 1987-11-12 | 1989-05-24 | Max Planck Gesellschaft | MODIFIED OLIGONUCLEOTIDS |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
WO1989005358A1 (en) | 1987-11-30 | 1989-06-15 | University Of Iowa Research Foundation | Dna and rna molecules stabilized by modifications of the 3'-terminal phosphodiester linkage and their use as nucleic acid probes and as therapeutic agents to block the expression of specifically targeted genes |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
EP0406309A4 (en) | 1988-03-25 | 1992-08-19 | The University Of Virginia Alumni Patents Foundation | Oligonucleotide n-alkylphosphoramidates |
US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
US5194599A (en) | 1988-09-23 | 1993-03-16 | Gilead Sciences, Inc. | Hydrogen phosphonodithioate compositions |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
US5457183A (en) | 1989-03-06 | 1995-10-10 | Board Of Regents, The University Of Texas System | Hydroxylated texaphyrins |
US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
US5721218A (en) | 1989-10-23 | 1998-02-24 | Gilead Sciences, Inc. | Oligonucleotides with inverted polarity |
US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
DE69034150T2 (en) | 1989-10-24 | 2005-08-25 | Isis Pharmaceuticals, Inc., Carlsbad | 2'-modified oligonucleotides |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
US5587470A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | 3-deazapurines |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
AU7579991A (en) | 1990-02-20 | 1991-09-18 | Gilead Sciences, Inc. | Pseudonucleosides and pseudonucleotides and their polymers |
US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
GB9009980D0 (en) | 1990-05-03 | 1990-06-27 | Amersham Int Plc | Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
EP0455905B1 (en) | 1990-05-11 | 1998-06-17 | Microprobe Corporation | Dipsticks for nucleic acid hybridization assays and methods for covalently immobilizing oligonucleotides |
US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
BR9106702A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals Inc | ANALOG OF OLIGONUCLEOTIDEOS AND PROCESSES TO MODULATE THE PRODUCTION OF A PROTEIN BY AN ORGANISM AND TO TREAT AN ORGANISM |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
DE69115702T2 (en) | 1990-08-03 | 1996-06-13 | Sterling Winthrop Inc | CONNECTIONS AND METHOD FOR SUPPRESSING GENE EXPRESSION |
US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
JPH06505704A (en) | 1990-09-20 | 1994-06-30 | ギリアド サイエンシズ,インコーポレイテッド | Modified internucleoside linkages |
US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
KR930702373A (en) | 1990-11-08 | 1993-09-08 | 안토니 제이. 페이네 | Addition of Multiple Reporter Groups to Synthetic Oligonucleotides |
US5672697A (en) | 1991-02-08 | 1997-09-30 | Gilead Sciences, Inc. | Nucleoside 5'-methylene phosphonates |
US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
ES2103918T3 (en) | 1991-10-17 | 1997-10-01 | Ciba Geigy Ag | BICYCLE NUCLEOSIDES, OLIGONUCLEOTIDES, PROCEDURE FOR THEIR OBTAINING AND INTERMEDIATE PRODUCTS. |
US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
TW393513B (en) | 1991-11-26 | 2000-06-11 | Isis Pharmaceuticals Inc | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
AU3222793A (en) | 1991-11-26 | 1993-06-28 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
FR2687679B1 (en) | 1992-02-05 | 1994-10-28 | Centre Nat Rech Scient | OLIGOTHIONUCLEOTIDES. |
US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
NL9300058A (en) | 1992-06-18 | 1994-01-17 | Stichting Rega V Z W | 1,5-ANHYDROHEXITOL NUCLEOSIDE ANALOGA AND PHARMACEUTICAL USE THEREOF. |
EP0577558A2 (en) | 1992-07-01 | 1994-01-05 | Ciba-Geigy Ag | Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
AU678769B2 (en) | 1992-07-27 | 1997-06-12 | Hybridon, Inc. | Oligonucleotide alkylphosphonothioates |
EP0673559A1 (en) | 1992-12-14 | 1995-09-27 | Honeywell Inc. | Motor system with individually controlled redundant windings |
US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
US5314893A (en) | 1993-01-25 | 1994-05-24 | Bristol-Myers Squibb Co. | Antiviral tetrahydropyrans |
ES2086997T3 (en) | 1993-01-25 | 1996-07-01 | Hybridon Inc | OLIGONUCLEOTIDE-ALKYLPHOSPHONATES AND -ALKYLPHOSPHONOTIOATES. |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
GB9304620D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Compounds |
GB9304618D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Chemical compounds |
CA2159631A1 (en) | 1993-03-30 | 1994-10-13 | Sanofi | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
CA2159632A1 (en) | 1993-03-31 | 1994-10-13 | Ashis Kumar Saha | Novel 5'-substituted nucleosides and oligomers produced therefrom |
WO1994022891A1 (en) | 1993-03-31 | 1994-10-13 | Sterling Winthrop Inc. | Oligonucleotides with amide linkages replacing phosphodiester linkages |
ATE177430T1 (en) | 1993-05-12 | 1999-03-15 | Novartis Erfind Verwalt Gmbh | NUCLEOSIDES AND OLIGONUCLEOTIDES WITH 2'-ETHER GROUPS |
GB9311682D0 (en) | 1993-06-05 | 1993-07-21 | Ciba Geigy Ag | Chemical compounds |
US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
CA2178729A1 (en) | 1993-12-09 | 1995-06-15 | Eric B. Kmiec | Compounds and methods for site-directed mutations in eukaryotic cells |
US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
US5864031A (en) | 1994-07-29 | 1999-01-26 | Amgen Inc. | Process for preparing 5-dithio-modified oligonucleotides |
US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5681940A (en) | 1994-11-02 | 1997-10-28 | Icn Pharmaceuticals | Sugar modified nucleosides and oligonucleotides |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
GB9606158D0 (en) * | 1996-03-23 | 1996-05-29 | Ciba Geigy Ag | Chemical compounds |
US5656408A (en) | 1996-04-29 | 1997-08-12 | Xerox Corporation | Coated carrier particles |
WO1998000434A1 (en) | 1996-06-28 | 1998-01-08 | Novartis Ag | Modified oligonucleotides |
CN1113888C (en) | 1996-10-09 | 2003-07-09 | 法玛塞特有限公司 | Tetraphosphonate bicyclic trisanhydrides |
US6770748B2 (en) | 1997-03-07 | 2004-08-03 | Takeshi Imanishi | Bicyclonucleoside and oligonucleotide analogue |
JP3756313B2 (en) | 1997-03-07 | 2006-03-15 | 武 今西 | Novel bicyclonucleosides and oligonucleotide analogues |
NZ501415A (en) | 1997-06-10 | 2001-10-26 | Glaxo Group Ltd | Benzimidazole derivatives (optionally with saccharide substituents) useful for the treatment or prophylaxis of viral infections (particularly herpes, cytomegalovirus and Hepatitis B) or for the treatment or prophylaxis of restenosis |
US6794499B2 (en) | 1997-09-12 | 2004-09-21 | Exiqon A/S | Oligonucleotide analogues |
JP4236812B2 (en) | 1997-09-12 | 2009-03-11 | エクシコン エ/エス | Oligonucleotide analogues |
YU73600A (en) | 1998-05-26 | 2003-08-29 | Icn Pharmaceuticals Inc. | Novel nucleosides having bicyclic sugar moiety |
US6043352A (en) | 1998-08-07 | 2000-03-28 | Isis Pharmaceuticals, Inc. | 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides |
CZ296576B6 (en) | 1999-02-12 | 2006-04-12 | Sankyo Company Limited | Nucleoside analogue, oligonucleotide analogue, pharmaceutical composition, probe and a primer containing thereof |
US7084125B2 (en) | 1999-03-18 | 2006-08-01 | Exiqon A/S | Xylo-LNA analogues |
AU776362B2 (en) | 1999-05-04 | 2004-09-09 | Roche Innovation Center Copenhagen A/S | L-ribo-LNA analogues |
US6525191B1 (en) | 1999-05-11 | 2003-02-25 | Kanda S. Ramasamy | Conformationally constrained L-nucleosides |
JP4151751B2 (en) | 1999-07-22 | 2008-09-17 | 第一三共株式会社 | New bicyclonucleoside analogues |
US6147200A (en) | 1999-08-19 | 2000-11-14 | Isis Pharmaceuticals, Inc. | 2'-O-acetamido modified monomers and oligomers |
JP2003519231A (en) | 1999-12-30 | 2003-06-17 | カー・ユ・ルーベン・リサーチ・アンド・ディベロップメント | Cyclohexene nucleic acid |
AU2001282522A1 (en) | 2000-08-29 | 2002-03-13 | Takeshi Imanishi | Novel nucleoside analogs and oligonucleotide derivatives containing these analogs |
GB2366290A (en) | 2000-08-30 | 2002-03-06 | Leuven K U Res & Dev | Hexitol Nucleosides |
US6426220B1 (en) | 2000-10-30 | 2002-07-30 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
CA2459347C (en) | 2001-09-04 | 2012-10-09 | Exiqon A/S | Locked nucleic acid (lna) compositions and uses thereof |
EP1485396A2 (en) * | 2002-02-28 | 2004-12-15 | Biota, Inc. | Nucleoside 5'-monophosphate mimics and their prodrugs |
US20060074035A1 (en) | 2002-04-17 | 2006-04-06 | Zhi Hong | Dinucleotide inhibitors of de novo RNA polymerases for treatment or prevention of viral infections |
US7569575B2 (en) | 2002-05-08 | 2009-08-04 | Santaris Pharma A/S | Synthesis of locked nucleic acid derivatives |
EP2314690A1 (en) | 2002-07-10 | 2011-04-27 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | RNA-interference by single-stranded RNA molecules |
EP1527176B2 (en) | 2002-08-05 | 2017-03-22 | Silence Therapeutics GmbH | Further novel forms of interfering rna molecules |
US20040219565A1 (en) | 2002-10-21 | 2004-11-04 | Sakari Kauppinen | Oligonucleotides useful for detecting and analyzing nucleic acids of interest |
AU2003291755A1 (en) | 2002-11-05 | 2004-06-07 | Isis Pharmaceuticals, Inc. | Oligomers comprising modified bases for binding cytosine and uracil or thymine and their use |
EP1562971B1 (en) | 2002-11-05 | 2014-02-12 | Isis Pharmaceuticals, Inc. | Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
CA2463719A1 (en) | 2003-04-05 | 2004-10-05 | F. Hoffmann-La Roche Ag | Nucleotide analogs with six membered rings |
JP2006528723A (en) | 2003-05-12 | 2006-12-21 | ユニオン・カーバイド・ケミカルズ・アンド・プラスティックス・テクノロジー・コーポレイション | Method for controlling polymer fine particles in gas phase polymerization |
WO2005020885A2 (en) | 2003-05-21 | 2005-03-10 | Isis Pharmaceuticals, Inc. | Compositions and methods for the treatment of severe acute respiratory syndrome (sars) |
WO2004106356A1 (en) | 2003-05-27 | 2004-12-09 | Syddansk Universitet | Functionalized nucleotide derivatives |
JP2005060664A (en) | 2003-07-31 | 2005-03-10 | Asahi Glass Co Ltd | Fluorine containing compound, fluorine containing polymer and production process for the same, and resist composition containing the same |
EP1648914A4 (en) | 2003-07-31 | 2009-12-16 | Regulus Therapeutics Inc | Oligomeric compounds and compositions for use in modulation of small non-coding rnas |
ES2382807T3 (en) | 2003-08-28 | 2012-06-13 | Takeshi Imanishi | New artificial nucleic acids of the N-O link type with cross-linking |
WO2005026356A1 (en) | 2003-09-12 | 2005-03-24 | Commonwealth Scientific And Industrial Research Organisation | Modified gene-silencing nucleic acid molecules and uses thereof |
AU2004274021B2 (en) | 2003-09-18 | 2009-08-13 | Isis Pharmaceuticals, Inc. | 4'-thionucleosides and oligomeric compounds |
WO2005049582A1 (en) | 2003-11-14 | 2005-06-02 | Auspex Pharmaceuticals, Inc. | Method of preparation of novel nucleoside analogs and uses |
US20090203132A1 (en) | 2004-09-09 | 2009-08-13 | Swayze Eric E | Pyrrolidinyl groups for attaching conjugates to oligomeric compounds |
WO2006038865A1 (en) | 2004-10-01 | 2006-04-13 | Betagenon Ab | Nucleotide derivatives for the treatment of type 2 diabetes and other disorders |
US20080261905A1 (en) | 2004-11-08 | 2008-10-23 | K.U. Leuven Research And Development | Modified Nucleosides for Rna Interference |
WO2007020018A1 (en) | 2005-08-12 | 2007-02-22 | Universite Libre De Bruxelles | Use of purinergic and pyrimidinergic receptor agonists for dendritic cells based immunotherapies |
CA2640171C (en) | 2006-01-27 | 2014-10-28 | Isis Pharmaceuticals, Inc. | 6-modified bicyclic nucleic acid analogs |
US8935416B2 (en) | 2006-04-21 | 2015-01-13 | Fortinet, Inc. | Method, apparatus, signals and medium for enforcing compliance with a policy on a client computer |
DK2066684T3 (en) | 2006-05-11 | 2012-10-22 | Isis Pharmaceuticals Inc | 5'-Modified Bicyclic Nucleic Acid Analogs |
MX2009003548A (en) | 2006-10-03 | 2009-04-15 | Alnylam Pharmaceuticals Inc | Lipid containing formulations. |
EP2125852B1 (en) | 2007-02-15 | 2016-04-06 | Ionis Pharmaceuticals, Inc. | 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom |
EP2170917B1 (en) | 2007-05-30 | 2012-06-27 | Isis Pharmaceuticals, Inc. | N-substituted-aminomethylene bridged bicyclic nucleic acid analogs |
EP2173760B2 (en) | 2007-06-08 | 2015-11-04 | Isis Pharmaceuticals, Inc. | Carbocyclic bicyclic nucleic acid analogs |
CA2692579C (en) | 2007-07-05 | 2016-05-03 | Isis Pharmaceuticals, Inc. | 6-disubstituted bicyclic nucleic acid analogs |
JP5572090B2 (en) | 2007-08-15 | 2014-08-13 | アイシス ファーマシューティカルズ, インコーポレーテッド | Tetrahydropyran nucleic acid analog |
US8530640B2 (en) | 2008-02-07 | 2013-09-10 | Isis Pharmaceuticals, Inc. | Bicyclic cyclohexitol nucleic acid analogs |
US20090274686A1 (en) * | 2008-05-02 | 2009-11-05 | Yat Sun Or | Nucleoside phosphonate derivatives |
DK2361256T3 (en) | 2008-09-24 | 2013-07-01 | Isis Pharmaceuticals Inc | Cyclohexenyl-nucleic acid analogues |
EP2358398A2 (en) | 2008-10-24 | 2011-08-24 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and methods |
CN102264374B (en) | 2008-10-24 | 2015-01-07 | Isis制药公司 | 5' and 2' bis-substituted nucleosides and oligomeric compounds prepared therefrom |
AT507215B1 (en) | 2009-01-14 | 2010-03-15 | Boehler Edelstahl Gmbh & Co Kg | WEAR-RESISTANT MATERIAL |
WO2010090969A1 (en) | 2009-02-06 | 2010-08-12 | Isis Pharmaceuticals, Inc. | Tetrahydropyran nucleic acid analogs |
US9102938B2 (en) | 2010-04-01 | 2015-08-11 | Alnylam Pharmaceuticals, Inc. | 2′ and 5′ modified monomers and oligonucleotides |
US9127033B2 (en) | 2010-04-28 | 2015-09-08 | Isis Pharmaceuticals, Inc. | 5′ modified nucleosides and oligomeric compounds prepared therefrom |
JP6005628B2 (en) | 2010-04-28 | 2016-10-12 | アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. | Modified nucleosides, analogs thereof, and oligomeric compounds prepared therefrom |
US9311307B2 (en) | 2011-06-03 | 2016-04-12 | Apple Inc. | Context sensitive entry points |
US9400902B2 (en) | 2012-05-22 | 2016-07-26 | Trimble Navigation Limited | Multi-modal entity tracking and display |
US9984408B1 (en) | 2012-05-30 | 2018-05-29 | Amazon Technologies, Inc. | Method, medium, and system for live video cooperative shopping |
US9778708B1 (en) | 2016-07-18 | 2017-10-03 | Lenovo Enterprise Solutions (Singapore) Pte. Ltd. | Dual sided latching retainer for computer modules |
-
2011
- 2011-04-26 JP JP2013508162A patent/JP6005628B2/en active Active
- 2011-04-26 KR KR1020127030987A patent/KR101869570B1/en active IP Right Grant
- 2011-04-26 CN CN201180021008.0A patent/CN103154014B/en active Active
- 2011-04-26 EP EP16187500.0A patent/EP3173419A1/en not_active Withdrawn
- 2011-04-26 EP EP11721850.3A patent/EP2601204B1/en active Active
- 2011-04-26 US US13/642,827 patent/US8993738B2/en active Active
- 2011-04-26 WO PCT/US2011/033968 patent/WO2011139702A2/en active Application Filing
-
2015
- 2015-02-20 US US14/627,960 patent/US9321799B2/en active Active
-
2016
- 2016-03-17 US US15/073,386 patent/US10087210B2/en active Active
- 2016-04-11 JP JP2016078844A patent/JP2016166222A/en not_active Withdrawn
-
2018
- 2018-08-30 US US16/117,435 patent/US11084844B2/en active Active
Non-Patent Citations (3)
Title |
---|
《commercially avaiable 5"-DMT Phosphoramidites as Reagents for the Synthesis of Vinylphosphonate-linked Oligonucleic Acids》;Sahar Abbas;《Organic Letters》;20011001;第3卷(第21期);3365-3367 * |
《Stereoselecitve synthesis of highly functionalised Pstereogenic nucleosides via palladium-catalysed P-C cross-coupling reactions》;Whittaker B;《Tetrahedron Letters》;20081201;第49卷(第49期);6984-6987 * |
《synthesis and preliminary biochemical studies with 5 PRG?-Deoxy-5PRG?-methy》;zhangyun zhao;《Tetrahedron Letters》;19960826;第37卷(第35期);6239-6242 * |
Also Published As
Publication number | Publication date |
---|---|
US10087210B2 (en) | 2018-10-02 |
JP2016166222A (en) | 2016-09-15 |
JP6005628B2 (en) | 2016-10-12 |
EP2601204B1 (en) | 2016-09-07 |
EP2601204A2 (en) | 2013-06-12 |
US9321799B2 (en) | 2016-04-26 |
US8993738B2 (en) | 2015-03-31 |
EP3173419A1 (en) | 2017-05-31 |
US20130084576A1 (en) | 2013-04-04 |
WO2011139702A3 (en) | 2013-05-02 |
JP2013532122A (en) | 2013-08-15 |
US20180371005A1 (en) | 2018-12-27 |
WO2011139702A2 (en) | 2011-11-10 |
KR20130105294A (en) | 2013-09-25 |
KR101869570B1 (en) | 2018-06-20 |
US20160186185A1 (en) | 2016-06-30 |
CN103154014A (en) | 2013-06-12 |
US20150159163A1 (en) | 2015-06-11 |
US11084844B2 (en) | 2021-08-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103154014B (en) | Modified nucleosides, modified nucleosides-like and oligomeric compounds prepared therefrom | |
US11268094B2 (en) | 5′ modified nucleosides and oligomeric compounds prepared therefrom | |
US9738895B2 (en) | Oligomeric compounds and methods | |
CN101490074B (en) | 5'-modified bicyclic nucleic acid analogs | |
EP1677822B1 (en) | 4'-thionucleosides and oligomeric compounds | |
JP5763539B2 (en) | 5 'and 2' bis-substituted nucleosides and oligomeric compounds produced therefrom | |
EP2606057B1 (en) | Modified 5' diphosphate nucleosides and oligomeric compounds prepared therefrom | |
KR20130042043A (en) | 6-modified bicyclic nucleic acid analogs | |
AU2003228477B2 (en) | Oligomeric compounds having modified phosphate groups |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |